WO2013091472A1

WO2013091472A1 - Method and device for performing polymerase chain reaction under constant heat reservoir

Info

Publication number: WO2013091472A1
Application number: PCT/CN2012/085595
Authority: WO
Inventors: 葛胜祥; 周文彬; 张师音; 陈清瑞; 夏宁邵
Original assignee: 厦门万泰沧海生物技术有限公司; 厦门大学
Priority date: 2011-12-23
Filing date: 2012-11-30
Publication date: 2013-06-27
Also published as: CN103173434A

Abstract

Provided is a method and device for performing a polymerase chain reaction under a constant heat reservoir, wherein the method is a method based on the Rayleigh-Benard principle, whereby heat is provided to or removed from specific regions of reaction tubes to establish a bottom-up temperature gradient for the reagents in the reaction tubes, and convection occurs spontaneously due to the uneven heating of the reaction reagents; thus corresponding PCR amplification occurs when fluids flow through the different temperature regions. Also provided are a reaction to realize the method and a device for real-time fluorescent detection.

Description

Method and device for performing polymerase chain reaction under constant temperature heat source

The invention relates to a polymerase chain reaction method and device. More specifically, the present invention relates to the principle of establishing a bottom-up temperature gradient of a liquid based on thermal convection, a method of spontaneously performing convection when the liquid is heated, and corresponding PCR amplification when flowing through different temperature zones, and a corresponding apparatus. Background technique:

Polymerase chain reaction technology (hereinafter referred to as PCR technology) is a technique for rapidly amplifying DNA in vitro. Each cycle includes three processes of denaturation, annealing and extension. The number of nucleic acid molecules of interest is doubled every cycle. After 30-40 cycles, the number of nucleic acid molecules of interest is amplified to nearly ¹⁰⁹ times. PCR is a method for obtaining a large number of DNA fragments in vitro, which facilitates further analysis and testing of nucleic acid molecules. At present, PCR technology has been widely used in basic research and applied research. As a "cell-free gene amplification system", PCR can be used to clone genes in basic research, and on this basis, direct sequence analysis of genomic DNA, detection of mutation sites, analysis of chromosome recombination, etc. In applied research, it can be used for the diagnosis of infectious diseases, the detection of genetic diseases and prenatal diagnosis, forensic research, etc. PCR technology is described in U.S. Patent Nos. 4,683,202; 4,683,159; 4,800,159; 4,965,188.

The amplification of DNA is carried out by the involvement of related factors in the body. The DNA molecules of the double helix are melted into two single strands. The DNA primers are synthesized by the action of the primer enzymes, and the primers are complementary to the single-stranded DNA bases to form primers. Single-stranded DNA complexes; under the action of DNA polymerase, along the 5, -3, direction, base pairing principle, at the beginning of primer 3, the complementary deoxynucleotide triphosphate is connected one by one, and finally Form a new double-stranded DNA molecule.

In vitro PCR amplification of DNA molecules mimics three steps in vivo: First, heating a double-stranded DNA sample at a high temperature of about 95 ° C, the hydrogen bonds between the double strands are broken, and the DNA is thermally decomposed into two complementary High temperature melting The reaction then rapidly drops to a temperature in the range of about 50-65 ° C. At this temperature, the single-stranded DNA is combined with the primers according to the principle of complementary base pairing. This process is called low temperature annealing; after the annealing reaction, the temperature The extension reaction is rapidly increased to about 72 ° C, and the single nucleotide is bound from the 3' end of the primer under the conditions of DNA polymerase and appropriate magnesium ion concentration to form a new DNA. After one such process, the original DNA double-stranded molecule formed two DNA molecules, which doubled. By repeating the three processes of high temperature melting - low temperature annealing - medium temperature extension, a larger number of duplicate duplexes can be obtained, and these newly formed double chains can be used as templates for the next cycle.

At present, the reaction device of the mainstream PCR amplification technology generally uses a PCR reaction tube made of a temperature-controlled metal block to heat the plastic. After the metal block is heated and cooled, the equilibrium temperature is reached, and heat is transferred to the PCR reaction solution through the reaction tube. The drawbacks of this type of device are: The reaction volume is large, that is, the system usually has a large volume and heat capacity. It takes 2-3 hours for conventional PCR to complete 30 cycles, most of which is consumed in the heating and cooling process, that is, metal. The block reaches an equilibrium temperature and heat is transferred to the PCR reaction solution through the reaction tube, so that it is difficult to achieve high efficiency and high throughput by PCR. In order to speed up the temperature rise and fall, the difficulty in manufacturing the PCR instrument is also increased, and the cost of the instrument is greatly increased.

On this basis, in the 1990s, researchers began to apply microfluidic chip technology to PCR amplification. Microfluidic chip technology is a new micro-analysis system that has been rapidly developed in the past decade. It uses micro-machining technology to etch micron-sized reaction tubes and analytical components on centimeter-sized glass, plastic and silicone rubber materials. Various analysis processes can be performed in a micron-sized structure, which on the one hand can reduce the consumption of precious biological samples and reagents to a micro-liter to nano-upgrade, and on the other hand, increase the analysis speed by a factor of ten, a hundred times, and achieve high Flux detection. The miniaturization of the PCR device not only reduces the consumption of PCR samples, but also the lower heat capacity significantly increases the heat transfer efficiency of the system, and the PCR reaction speed is greatly accelerated. At present, PCR microfluidic chip systems mainly have two forms: micro-chamber static PCR chip and continuous flow PCR chip. The former is the miniaturization of conventional PCR, in which the reaction mixture is fixed in the reaction cell, and the thermal cycle is amplified depending on the temperature cycle change of the temperature control device. Due to the miniaturization of the conventional PCR, the volume and heat capacity are reduced, so the reaction time is greatly Reduced, energy consumption is also greatly reduced; while the latter is micro-added The worker forms a meandering flow path, and under the action of a certain driving force, the PCR reaction liquid continuously flows through three different temperature zones to complete the process of denaturation, annealing and extension, and the advantage is that the reaction temperature does not need to repeatedly rise and fall repeatedly. Although these two PCR microfluidic chip systems are capable of rapidly and efficiently amplifying DNA fragments of interest, they have successfully integrated processes such as capillary electrophoresis separation, real-time fluorescence detection, and array chip hybridization. However, the former is actually only the miniaturization of traditional PCR. It still does not break through the mode of heating and cooling modules to repeatedly raise and lower the temperature. It does not completely solve the problem of the long time of lifting and lowering temperature; while the latter solves the time-consuming problem of repeated lifting and lowering, it takes The new problem is that the system usually contains complex liquid drive systems, which increases the complexity and cost of instrumentation and reaction vessel fabrication. On the other hand, the operation is more complicated and limits its wide application.

At the beginning of the 21st century, a new type of PCR amplification method was developed, which uses the principle of natural convection, ie, the Reynolds-Bernard convection principle. The technology is to place the PCR reaction solution in a closed cylindrical reaction chamber, and the upper and lower surfaces of the reaction chamber are respectively controlled by constant temperature, usually the upper end temperature is 60 ° C, the lower end temperature is 97 ° C, and the liquid is driven by the temperature difference between the upper and lower surfaces. PCR amplification is achieved through different temperature zones. This method does not require changing the temperature of the device, nor does it require an external drive to effect the flow of the sample. Only one reaction chamber is required, and the temperature of the upper and lower ends is controlled to be constant temperature, and PCR amplification can be realized. However, the method still has defects: First, the reagent needs to fill the entire reaction chamber, and needs to be sealed, and there is a potential leakage problem. Secondly, the reagent is directly injected into the reaction chamber, causing the heater to directly contact the reagent, and there is a potential pollution problem.

Therefore, there is an urgent need in the prior art for a new polymerase chain reaction amplification method and corresponding apparatus to solve the problems of contamination and unstable reaction. Summary of the invention

One aspect of the present invention provides a method for amplifying a nucleic acid by polymerase chain reaction, which comprises: (1) providing a reaction vessel having an opening at one end, into which a nucleic acid amplification reaction product is added; (2) inside the open container or Externally providing one or more thermostats capable of controlling temperature, the thermostat being configured to provide a temperature above denaturation, and to supply or remove heat to control annealing and extension temperatures, and by contact in a different reaction vessel Part, establishment The upper and lower temperature gradients of the pipe wall and the inner space of the pipe to produce stable convection of the liquid in the pipe;

(3) Amplification of nucleic acids by polymerase chain reaction using liquid convection in a tube. In one embodiment, the method further comprises detecting the amplified product, such as performing real-time monitoring. Preferably, the polymerase chain reaction product contains a fluorescent dye or probe to enable real-time monitoring.

The present invention provides, in another aspect, a nucleic acid amplification reaction apparatus comprising: (a) an amplification reaction vessel containing a nucleic acid amplification reagent; (b) one or more thermostats capable of controlling temperature; (c) Amplifying the thermal insulation between the reaction vessels; wherein the upper and lower portions of the amplification reaction vessel are contacted by different constant temperature heat sources to establish a temperature gradient distribution between the tube wall and the vertical space within the tube. Optionally, the apparatus of the present invention further comprises: (d) a real time detection device, such as a fluorescence detection device.

The invention solves the defects of various methods in the prior art, and has a fast reaction speed; the instrument and the reaction container are simple in manufacturing process and low in cost; the operation is convenient, no sealing is required, no direct contact with the heater, no potential leakage With pollution problems.

In the method and apparatus of the present invention, according to the principle of thermal convection, the PCR reagent in the tube establishes a stable bottom-up temperature gradient, and then spontaneously drives the reagent to generate convective motion, and the reagent passes through different temperature regions during the flow. Thereby achieving the purpose of PCR amplification. In a preferred embodiment, the special device of the present invention can collect the fluorescence signals during amplification and after amplification while amplifying, and can replace the agarose gel electrophoresis identification step for real-time monitoring purposes.

First of all, the present invention will eventually provide a method and apparatus that is simpler in design of the mechanism and cheaper in hardware devices, without the need for repeated temperature rise and fall, without the need for complicated mechanisms and electronic control of conventional PCR instruments, such as precision temperature. Controlled circuit boards, devices that change temperature by consuming electrical energy, and the like.

Therefore, based on the present invention, we can provide a method and apparatus for integrating nucleic acid amplification and detection more easily than existing amplification techniques, and the method is simple in structure, easy to miniaturize and integrated into more functional composites. Miniaturized devices, such as full system analysis on a chip.

Secondly, since the apparatus of the present invention is used for nucleic acid amplification without repeatedly raising and lowering the temperature, the present invention is not only time-saving but also greatly reduced in energy consumption compared to conventional PCR. Third, not only the amplification of DNA but also the reverse transcription of ribonucleic acid (RNA) can be performed. When the upper and lower temperature control sets the same temperature, the reagent in the tube reaches the set average temperature due to heat transfer. At this time, reverse transcriptase reverse transcribes the sample; after the transcription is finished, the upper and lower temperature control is reset to form the temperature inside the test tube. Gradient, thermal convection can occur, and a PCR amplification step is performed. Therefore, only one temperature change is required to allow RNA to undergo reverse transcription and amplification in one tube. The important aspect of this method is the detection of pathogens that use RNA as a genetic material, which has not been described in previous thermal convection nucleic acid amplification techniques.

In summary, the present invention provides a nucleic acid amplification and detection technique that is more time-saving and more efficient than the prior art, and overcomes the disadvantages of high time consumption and high energy consumption caused by repeated temperature changes in the prior art. The problems that can be solved by the present invention and the advantages of the present invention will be explained in detail below and in the accompanying drawings. detailed description

The present invention provides a method for amplifying a nucleic acid by polymerase chain reaction, which comprises:

(1) providing a reaction vessel having an open end, wherein a nucleic acid amplification reaction is added thereto, optionally, the polymerase chain reaction product comprises a fluorescent dye or a probe;

(2) providing one or more temperature-controlled thermostats inside or outside the open vessel, the thermostat being configured to provide a temperature above denaturation, and to supply or remove heat to control annealing and extension temperatures And establishing an upper and lower temperature gradient distribution of the tube wall and the inner space of the tube by contacting at different portions of the reaction vessel to produce stable convection of the liquid in the tube;

(3) polymerase chain reaction using liquid convection in the tube;

(4) Optionally detecting a thermally convective polymerase chain reaction product, such as real-time monitoring.

In the polymerase chain reaction tube contains: sample nucleic acid to be tested, DNA polymerase, adenine triphosphate deoxynucleotide, cytosine deoxynucleotide triphosphate, adenosine triphosphate deoxynucleotide, thymidine triphosphate deoxynucleotide Glycoside, reaction buffer, divalent magnesium ion, non-primary PCR additives (eg NP-40, tween-20, DMSO, etc.) and at least two oligonucleotide primers that are specifically complementary to the nucleic acid sequence to be tested, And optionally with double-stranded DNA knots A fluorescent dye or a specific fluorescent probe or the like. Thereafter, a low-density non-volatile material (such as paraffin oil or various low-melting waxes) or a highly transparent plastic cover is used to cover the surface of the reagent to prevent evaporation and to penetrate the light source.

In the amplification reaction, a stable spatial temperature distribution is established and maintained in the reagent and the sample to be tested, which is achieved by: making different heat sources in close contact with the reaction tube for heat exchange, supplying heat to a specific region or Removing heat, a region of low temperature that is lower than a high temperature in a vertical height; a specific spatial temperature distribution in the reaction tube containing different specific spatial regions, each of which has a different PCR reaction step, The specific spatial region has a certain temperature range, and the temperature conditions are suitable for: 1. Denaturation reaction, in which double-stranded DNA is untwisted into single-stranded DNA; 2. Annealing reaction, primers are paired with complementary regions of single-stranded DNA to form primers - Single-stranded DNA complexes; 3. Extension reaction, polymerase incorporation of deoxyribonucleotide triphosphates one by one from the primer-single-stranded DNA pairing region, ultimately forming a double-stranded product. Since a stable temperature gradient distribution in the reaction tube leads to continuous thermal convection, the reagents are repeatedly circulated for denaturing annealing and extension steps, and the amplification reaction can be completed within 30 minutes.

Preferably, a fluorescence monitoring step synchronized with the reaction is also included in the method of the invention. Real-time monitoring of polymerase amplification reactions is well known to those skilled in the art. Theoretically, each cycle of PCR amplification can double the number of copies of newly generated double-stranded DNA, and a large number of double-stranded DNA can be produced after 20-30 cycles. However, the PCR amplification reaction is affected by conditions such as the consumption of primers, deoxynucleotide triphosphate (dNTP), and enzyme activity. Subtle changes in conditions will affect the amplification yield, and the reaction will enter the plateau stage to a certain extent. It is difficult to obtain a reliable result by estimating the initial amount of the template in the PCR reaction system from the amount of the amplified product by the endpoint method. Therefore, the best approach is to quantify the real-time PCR, estimating the initial amount of the template from the slope of the rise of the amplification curve and the number of critical cycles. In the early 1990s, nuclease PCR technology (TaqMan technology) was first introduced to quantify specific PCR amplification products in real time. Then, the amount of double-stranded DNA was detected in real time using ethidium bromide dye. At the same time, researchers have developed fluorescent probes or TaqMan probes to improve real-time quantitative methods for detecting specific amplification products. At the end of the last century, there was a real-time, homogeneous, specific sequence of PCR products on the chip. Detection.

Real-time quantitative PCR was developed on the basis of common PCR. The fluorescent dye for amplifying DNA is used to linearly correlate the amount of amplified DNA with the detected fluorescence intensity, and the DNA amplification curve is roughly obtained. There are currently three methods for real-time PCR based on DNA and fluorescent dyes: TaqMan probe, SYBR Green I /EtBr dye to detect double-stranded DNA production and molecular beacons.

The TaqMan probe is a pair of probes that are completely complementary to the middle of the amplification template, 5, connected to the fluorogenic group (fluorescent dye), and 3, with a fluorescent quencher (quencher) Connected. Due to the fluorescence energy transfer, the fluorescence of the fluorescent dye is quenched by the influence of the quencher. During the PCR process, due to the 5,-3, exonuclease action of DNA polymerase, the fluorescent dye at the end of the probe 5 is cleaved and falls off into the solution, and the distance between the fluorescent dye and the quencher increases, getting rid of Fluorescence is produced by the action of a quencher. As the PCR amplification reaction proceeds, more and more of the 5, end fluorescent dyes are excised and the fluorescence is enhanced. This method is applicable to: 1. It has high adaptability and reliability, and the experimental results are stable and reproducible, and the specificity is higher; 1. It is suitable for the detection of the system specific to the amplified sequence; 3. The target gene content in the sample is too low. Quantitative PCR detection; 4, the specific sequence of the target gene is short, no matter how to optimize the primer design conditions can not be solved; 5, there are sequences homologous to the target gene, prone to non-specific amplification in PCR, the specific requirements High quantitative; 6, widely used in the diagnosis and pathogen quantification of human infectious diseases, detection of animal pathogen genes, inspection and quarantine of livestock and poultry products, identification of biological products.

SYBR Green I /EtBr dye can be used to detect the amount of double-stranded DNA produced.

EtBr is a commonly used fluorescent dye in real-time quantitative PCR. It contains a tricyclic planar group that can be inserted between DNA-stacked bases. The binding to DNA has almost no base sequence specificity. When the dye molecule is inserted, its planar group is perpendicular to the axis of the helix and interacts with the upper and lower bases by van der Waals forces. The fixed position of this group and its close proximity to the base cause the dye bound to the DNA to fluoresce, and its fluorescence yield is increased compared to the dye in the free solution. SYBR Green I dye binds to DNA and enhances fluorescence by a thousand times. It is more than 50 times higher than EtBr. It is the most sensitive double-stranded DNA fluorescent dye. It has good light stability and is not easy to photobleach (ie, the fluorophore is exposed to light in the excited state). Irreversible damage), The excitation wavelength is 494 nm and the emission wavelength is around 530 nm. Since the PCR reaction continuously produces new double-stranded DNA, the amplification of SYBR Green I fluorescence can be used to quantitatively detect the amount of double-stranded DNA produced in real time. This method is suitable for: 1. High sensitivity: SYBR can enhance the fluorescence effect by more than 1000 times; 2. Good versatility, no need to design probes, simple method, time saving and low price; 3. General method, in China It is widely used in foreign scientific research; 4. High-throughput large-scale quantitative PCR detection; 5. Quantitative PCR detection with low specificity requirement.

A molecular beacon is essentially a circular probe that is complementary to the first and last sequences and that labels the fluorophore and the quencher, respectively. During the PCR amplification process, the fluorescent signal in the PCR reaction system is detected during the annealing phase of each cycle. During the annealing phase, the PCR amplification product binds to the molecular beacon to produce fluorescence, while the unbound molecular beacon remains in the closed loop state without fluorescence. As the number of PCR cycles increases, the fluorescence signal increases continuously, and the intensity of the fluorescent signal is proportional to the concentration of the PCR amplification product.

The excitation and acquisition device of the fluorescent signal is an organic whole composed of an optical switch array, a self-focusing lens, a pigtail collimator and a variable gain low-light O/E device, and is managed by an electronic control device with a 16-bit single chip as the core. It can complete the rapid equalization scan detection of multiple specimens in millisecond time, avoiding the time lag or vignetting error caused by mechanical scanning mode or CCD scanning mode. High-throughput real-time fluorescence excitation and quantitative detection of standard samples.

In the present invention, the effects of PCR amplification and real-time monitoring can be achieved by a specially designed polymerase chain reaction amplification method and apparatus.

During the polymerase chain reaction, when a stable temperature gradient is established in the reaction tube, the reagent undergoes a regenerative annealing and extension step due to the continuous and spontaneous cyclic flow of the thermal convection physics. The fluorescent dye in the reagent contains a tricyclic planar group that can be intercalated between the DNA stacking bases. When the dye molecule is inserted, its planar group is perpendicular to the axis of the helix and interacts with the upper and lower bases by van der Waals force. The behavior is almost non-base sequence specific and will continue to be embedded in the newly generated double-stranded DNA molecule as the amplification progresses. The fixed position of the intercalating group and its close proximity to the base cause the dye bound to the DNA to fluoresce, and the fluorescence yield is increased compared with the dye in the free solution, so the amplification state can be reacted by collecting the fluorescent signal. .

In addition to the fluorescent insertion dye, the present invention can also achieve the purpose of fluorescence detection by using a fluorescent probe. The fluorescent probe is an oligonucleotide completely complementary to the sequence to be detected, and the fluorescent group and the quenching group are labeled end to end, respectively, and the fluorescent signal is blocked by the quenching group, so that no fluorescence is detected. signal. During the thermal convection cycle, the reagent will undergo a denaturing annealing and extension step spontaneously and spontaneously. The probe will adhere to the sequence and be hydrolyzed by the DNA polymerase. After the probe is broken, the fluorescent group is no longer quenched by the quenching group. Blocking, emitting a fluorescent signal, the collector can receive fluorescent signals for real-time detection. As the number of reagent convection cycles increases, the probe is continuously hydrolyzed, the fluorescence signal is continuously enhanced, and the intensity of the fluorescent signal is proportional to the concentration of the PCR amplification product.

Preferably, the methods of the invention are also applicable to the amplification of single-stranded ribonucleic acid (RNA). It is well known that many pathogens whose genetic material is RNA (such as HIV, HCV, influenza, etc.) cannot be rapidly amplified by one-step method using conventional polymerase chain reaction. The present invention can realize the combined reverse transcription and amplification of RNA templates to solve the problem of non-DNA samples due to specially designed programs and devices, and the prior thermal convection nucleic acid amplification techniques have no such description. The step includes: injecting the RT-PCR-step reagent and the sample to be tested into the reaction tube, the reaction tube contains: sample RNA, reverse transcriptase, RNase inhibitor, RNase-free buffer, DNA polymerase, triphosphate Adenine deoxynucleotide, cytosine deoxynucleotide, pyrithione triphosphate, thymidine triphosphate deoxynucleotide, divalent magnesium ion, non-primary component PCR additive (eg NP- 40, tween-20, DMSO, etc.) and at least two oligonucleotide primers that are specifically complementary to the nucleic acid sequence of the specimen, and fluorescent dyes or specific fluorescent probes that optionally bind to double-stranded DNA. Finally, use a low-density non-volatile material (such as paraffin oil or various low-melting waxes) or a highly transparent plastic cover to cover the surface of the reagent to prevent evaporation and penetration of the light source. After the above reagent is injected into the reaction tube, it is inserted into the cavity of the device of the present invention. The first step is to perform reverse transcription reaction, and the upper and lower thermostats are set to have the same temperature (35-70 ° C), due to heat transfer. The temperature inside the reagent is uniform, and the reverse transcription process can occur under this condition; after the end of the reverse transcription, the temperature below is adjusted to increase to the denaturation temperature (90 to 99 ° C), and thus a temperature gradient is formed, and the occurrence is sustained. The thermal convection, the reverse transcriptase in the reagent flowing through the bottom will no longer have transcriptional activity due to high temperature denaturation, and the DNA polymerase will undergo denaturing annealing and extension in the spontaneous circulation flow using the reverse transcribed DNA as a template. PCR step. To practice the above amplification method, the present invention provides a nucleic acid sequence amplification apparatus for use in thermoconvection PCR, which provides: a heat source of different temperatures, which can supply heat or remove heat for different specific areas within the reaction tube.

Wherein the heating device can maintain a stable temperature distribution of the sample in the test tube, and the low temperature region is lower than the high temperature region in the vertical height; the spatial temperature distribution in the reaction tube contains different specific regions, and each specific spatial region performs differently In the PCR reaction, the specific spatial region has a certain temperature range, and the temperature conditions are suitable for: 1. a denaturation reaction in which double-stranded DNA is untwisted into single-stranded DNA; 2. an annealing reaction, a complementary region of the primer and the single-stranded DNA Pairing, forming a primer-single-stranded DNA complex; 3. Extension reaction, the polymerase incorporates deoxyribonucleotide triphosphates one by one from the primer-single strand DNA pairing region to form a double-stranded product. Since a stable temperature gradient distribution in the reaction tube leads to continuous thermal convection, the reagents are repeatedly circulated for denaturing annealing and extension steps, and the amplification reaction can be completed within 30 minutes.

In the technique of the present invention, the sample reagent in the reaction vessel is subjected to a cyclic flow for denaturation annealing and an extension step, and the process is automated and spontaneously repeated. Compared with a complex electronic and programmable temperature and time cycle PCR machine, the present invention is designed. There are obvious advantages in terms of cost and cost.

The invention also provides a temperature-controlled heat convection polymerase chain reaction device, comprising: (a) an amplification reaction vessel, such as a reaction tube, which can accommodate a nucleic acid amplification reagent; (b) one or more controllable temperatures The thermostat device is preferably annular in shape and is placed outside and in contact with the reaction vessel; (c) a thermal insulation device located between the amplification reaction vessels; and (d) optionally, a real-time fluorescence detection device;

The temperature gradient distribution of the vertical space in the tube wall and the tube is established by contacting the upper and lower portions of the amplification reaction vessel through different constant temperature heat sources.

Amplification reaction vessel

There are two main mainstreams of the previous thermoconvection PCR reaction chamber. One is to connect the two ends of the thin tube (l~0.5 mm) to form a liquid convection chamber, and the other is to react in the space in the cylinder with both ends open. They have the disadvantage that the tubing is difficult to connect and is prone to bubbles when the reagent is loaded. In turn, the normal convection of the reagent is affected; and the cylindrical body at both ends is closed, and the heating sheet must be in close contact with the reagent in order to prevent leakage of the reagent, which is liable to cause pollution problems.

The reaction container of the present invention is a tubular or columnar container having one end open and the other end closed, which facilitates the addition and aspiration of reagents, and is easy to manufacture, and has a low production cost and can be discarded. The container of the present invention may be in the form of a reaction tube and may be fabricated from any suitable material such as glass, polypropylene (PE), polyethersulfone (PES), propylene (PP), polypropionate (PC). , Polypoke (PSF), etc.

2. Ring heating device:

Previous thermoconvection PCRs used a heating block to flatten the test tube for single-sided heating, which may cause uneven heating. In the present invention, a circular heating method is employed in which a hole is drilled in a heating sheet of a certain thickness, the reaction tube is placed in close contact with each other, and the heat of the heating sheet is conducted to the internal reagent through the contact surface to achieve a uniform temperature. In the present invention, there are two annular heating devices, and the lower annular device provides a higher temperature to heat around the bottom of the test tube, and the reagent is heated up and floated, and at the same time, a denaturation step in the PCR reaction occurs; when floating to the upper liquid surface, part of the heat passes through the upper portion. The annular heating piece is led out and maintained at a certain temperature at which the annealing and stretching steps in the PCR occur; at this time, the reagent sinks again due to cooling, reaches the bottom again, reheats up again, and starts the next PCR reaction. cycle. The conventional PCR reaction time usually takes 2 to 3 hours. In order to shorten the time, the PCR instrument uses a gold-plated/silver block and a cooling chip with high thermal conductivity, which achieves the purpose, but greatly increases the instrument cost. The invention eliminates the need for repeated heating and cooling of the PCR step, and saves the time consuming step of the temperature rising and lowering step, thereby achieving the purpose of rapid amplification. For primers with different annealing temperatures, the optimal reaction conditions for temperature controlled thermoconvection PCR of the upper annular heating device can be adjusted.

3. Thermal insulation:

The invention adopts the method of ring heating to drill holes on a heating sheet of a certain thickness, and respectively inserts the reaction tubes into the upper and the bottom of the test tube to make them in close contact. In the present invention, the heat insulating material is used to fill the two heating sheets in the middle, and the advantages are as follows:

a. The change of room temperature will affect the flow field and velocity of liquid convection in the tube, and the heat insulation device of the invention The setting can reduce the influence of external environmental temperature changes on the flow field in the tube, and maintain the consistent reaction of the reagents in the tube under different external conditions;

b. The temperature of the upper and lower heating fins themselves is different, which also affects the temperature control due to air convection and heat conduction. The thermal insulation device of the present invention can reduce the temperature interference between the two heating sheets, thereby maintaining The reaction of the reagent in the tube is consistent; c The tube will also dissipate heat during the heating process, thereby affecting the temperature distribution of the adjacent tubes. The heat insulating device of the invention can block the heat conduction between adjacent tubes, reduce the mutual temperature influence, and maintain the uniformity of the reagents in the tube. Reaction.

The heat insulating device of the present invention can use any material having a low heat transfer coefficient such as glass wool, wood, heat resistant foam, mica flakes, heat resistant plastic or the like.

4. Fluorescence detection device

Using fluorescent dyes or probes, the amount of PCR amplification product can be monitored by fluorescence intensity, and as the PCR product increases, the fluorescence intensity increases, thereby achieving real-time and endpoint detection.

In the past, in order to completely heat the test tube, the whole tube was completely wrapped around the test tube. Therefore, the arrangement of the fluorescent light path can only use the method of light up and light up, so most of the real-time quantitative PCR systems can only use the optical system. Mounted above the test tube, limiting the design of the hardware. In the present invention, the bottom annular heating method is adopted. In addition to controlling the uniform temperature of the surface of the test tube and the internal reagent, the excitation light source can therefore be placed under the test tube. Therefore, the excitation beam can vertically penetrate the reagent from the middle of the bottom of the test tube. When the reagent is amplified, when the excitation light and the emission light pass through the narrow-frequency filter disc in the optical path, the excitation light is shielded, so that the upper optical receiver is received. A dedicated product fluorescent signal; a narrow-frequency filter disc can hold a variety of filters for multi-product detection. The advantages of the fluorescence detecting device of the present invention are: The conventional real-time PCR fluorescent signal collecting device and the excitation light emitting device must be designed together, so that it is necessary to separate different fluorescent signals using a complicated and expensive spectral filter group. In the present invention, the fluorescent signal collecting device and the excitation light emitting device can be separated, and on the one hand, multiple ways can be adopted on the optical path, such as: light up on the upper light, light on the lower light, and light on the side of the light test tube. On the other hand, there is no need for expensive spectroscopic filters. Group.

With the fluorescence detecting device of the method, the amplification device can be used to monitor the change of the amount of nucleic acid in real time during the amplification process. Through amplification and detection equipment, target sequences can be efficiently amplified from real-time fluorescence detection from samples to be detected containing DNA and/or RNA.

The above-mentioned methods, objects, advantages and features will be explained in detail in the following drawings. When the present invention is described, the related prior art will not be related to the prior art when the related art does not cause the technical points to be confused. Further explanation and explanation. DRAWINGS

Figure 1: Schematic diagram of the principle of nucleic acid sequence amplification based on heat convection.

Figure 2 is a cross-sectional view showing a nucleic acid amplification apparatus and a fluorescence detecting apparatus according to an embodiment of the present invention.

Figure 3: Temperature measurement of Example 2, in-tube oil-water interface (Ti) without insulation. Figure 4: Temperature measurement of Example 2, in-tube oil-water interface (Ti) with insulation. Figure 5: Single temperature control (A), dual temperature control (B) and adiabatic dual temperature control (C) in-tube oil-water interface (Ti) temperature measurement.

Figure 6: Photograph of the electrophoresis results, showing the results of the amplification of Example 2 (compared with a conventional PCR machine).

Figure 7: Photograph of the electrophoresis results, showing the results of different reagent volumes and amplification lengths. Figure 8: Photograph of the electrophoresis results, showing the results of RNA amplification at different temperatures above. Figure 9: Photograph of the electrophoresis results, showing the results of DNA amplification at different temperatures at the bottom. Figure 10: Photograph of electrophoresis results, illustrating the results of Example 2 at different reaction times. Figure 11: Real-time fluorescence record plot showing the fluorescence amplification profile of Example 2 at various concentrations. (Please explain in detail the meaning of several curves in Figure 11)

Interpretation of the numbers in the important parts of the diagram

101: reaction tube

102: sheet heater

103: Upper annular heating device

104: Temperature sensor 105 bracket

106 rod heater

107 excitation source

108 bottom annular heating device

109 Thermal insulation material 1

110 insulation material 2

111 filter glass

112 Photodetector

Some preferred embodiments of the invention are described in detail below with reference to the accompanying drawings:

Fig. 1 is a schematic view showing the operation of the nucleic acid sequence amplification method invented based on the thermal convection physical phenomenon. The described embodiment verifies the operation of the entire principle. After the reaction vessel g, which is open at one end and closed at one end, is added to the reagent, it is inserted into the heating device, and a circulation c is generated in a short time, thereby forming two specific temperature regions a and b. In the embodiment of Figure 1, the test tube is in intimate contact with the two heating devices f and d, and the heat is supplied or removed from the specific areas a and b of the sample through the tube wall, at which time a temperature gradient is established in the test tube. The flow of the reagent; the embedding of the insulating material e avoids the interference of the external environment temperature and the airflow, and also prevents the problem of mutual influence between the tube and the tube through the heat transfer of the air, providing a stable thermal condition to help stabilize the reagent formation. And the continuous circulation, thereby performing different PCR reaction steps, the specific spatial region (a, b) has a certain temperature range, and the temperature conditions are suitable for: 1. Denaturation reaction, in which double-stranded DNA is untwisted into single-stranded DNA 2. annealing reaction, primers paired with complementary regions of single-stranded DNA to form primer-single-stranded DNA complexes; , The polymerase primer - start one by one single stranded DNA dideoxy triphosphate ribonucleotides incorporated into the mating region, forming a double stranded product. Since a stable temperature gradient distribution within the reaction tube results in continuous thermal convection, the reagents are repeatedly circulated for denaturation annealing and extension steps. The following examples are given to illustrate more detailed operations.

For example, injecting reagents into a suitable tubular or columnar reaction vessel, including specimens to be tested, DNA polymerase, four deoxyribonucleotides, specific primers, fluorescent dyes, specific fluorescent probes, divalent magnesium ions, and Other PCR additives. Before the experiment, set the temperature of the two annular heating blocks of the device, and the temperature of the bottom heating block is set to 90~99 °C; The temperature of the heating block is set at 45~65°C. This temperature can be adjusted according to the primers of different annealing temperatures, and the set stable temperature can be reached within a short time. The whole tube is inserted into the heating device of the present invention (see Fig. 2), and the lower ring device provides a higher temperature to heat around the bottom of the tube, the reagent is heated up and floated, and a denaturation step in the PCR reaction occurs; when floating up to the upper surface, part The heat is led out through the upper annular heating piece and maintains a certain temperature at which the annealing and stretching steps in the PCR occur; at this time, the reagent sinks again due to cooling, and reaches the bottom again, re-heats up again, and starts PCR. The next cycle of the reaction. The reagent can reach a stable cycle in one minute and can be completely reacted after 25 to 30 minutes.

2 is a PCR nucleic acid sequence amplification and detection device using the thermal convection physical phenomenon of the present invention, and the cross-sectional view shows four components of a reaction tube, a ring heating device, a heat insulating device, and a fluorescence detecting device. Related position and function, the device shown in Figure 2 contains a heat source device that maintains different temperatures. The device is embedded in a heat-insulating material to avoid external ambient temperature and airflow interference, and also prevents heat between the pipe and the pipe through the air. The problem of transfer and mutual influence provides a stable thermal condition to help the reagent form a stable and continuous circulation. In this embodiment, the heating rod 106 heats the annular heating sheet 108 to the DNA denaturation temperature, 109 is the thermal insulation material. The thermal insulation chip 102 can heat or cool the upper annular heating piece 103. By using the temperature feedback of the thermocouple 104, the upper temperature can be adjusted to meet the amplification temperature conditions of the RNA or different primers. In the heating process, in order to avoid the influence of ambient temperature and airflow, the two heating pieces are filled with the heat insulating material (acrylic in this embodiment) to reduce the influence of the external environmental temperature change on the flow field inside the tube, and the reagent in the tube is maintained. Consistent reaction under different external conditions; also reduce the temperature interference between the two heating sheets, so as to maintain a consistent reaction of the reagents in the tube; and block the heat conduction between adjacent tubes, reduce the mutual temperature effects, and maintain a consistent reaction of the reagents in the tube. The shelf 105 supports the entire structure. During the heat convection reaction, the specific probe is hydrolyzed by DNA polymerase or the fluorescent insertion dye is embedded in the double strand to fluoresce, and the amplification process is detected in real time by the collection of the fluorescence intensity signal. The device adopts a bottom annular heating method, and the excitation beam vertically penetrates the reagent from the middle of the bottom of the test tube. When the reagent is amplified, the excitation light and the emitted light are shielded when the narrow-frequency filter optical disk passes through the optical path. So that the upper optical receiver (112) receives a specific product fluorescent signal; the narrow-frequency filter disc can be placed with a variety of filters Tablets for the detection of multiple products. The advantages of the fluorescence detecting device of the present invention are: The prior real-time PCR fluorescent signal collecting device and the excitation light emitting device must be designed together, so that it is necessary to separate different fluorescent signals using a complicated and expensive spectral filter group. In the present invention, the fluorescent signal collecting device and the excitation light emitting device can be separated, and on the one hand, multiple ways can be adopted on the optical path, such as: light up on the upper light, light on the lower light, and light on the side of the light test tube. On the other hand, there is no need for expensive spectroscopic filter groups.

The present invention is not limited to the nucleic acid sequence amplification and detection apparatus described in Figs. 1 and 2, and variations in heating mode and changes in container shape are within the scope of the present invention.

Figure 3 is a temperature measurement of Example 2; temperature recording of the oil-water interface (Ti) in the tube when there is no thermal insulation device, wherein the lowest temperature of the reagent in the test tube is at the highest upper surface, that is, the position of the mineral oil and the reagent interface, The temperature here provides a pointer to the annealing temperature at which the primer is designed. The present invention inserts a T-type thermocouple into this interface and the computer records a 15 minute temperature change (PC-Based Data Acquisition Unit MX100, Yokogawa, Japan). When the room temperature is 24 ° C, there is no heat insulation device, and the reaction tube is exposed to the air, the result shows that the average temperature of the interface is 65.2 ° C, and the maximum temperature difference is 2.7 ° C.

Figure 4 is a temperature measurement of Example 2; the temperature of the oil-water interface (Ti) in the tube when there is a heat insulating device, wherein the lowest temperature of the reagent in the test tube is at the highest liquid level, that is, the position of the mineral oil and the reagent interface, The temperature here provides a pointer to the annealing temperature at which the primer is designed. The present invention inserts a thermocouple of a T-type into this interface and records a temperature change of 15 minutes by a computer (PC-Based Data Acquisition Unit MX100, Yokogawa, Japan). When the reaction tube is in a room temperature of 24 ° C, there is a heat insulation device (in this embodiment, acrylic), the measurement results show that the average temperature is 64.3 ° C, the maximum temperature difference is 0.6 ° C, compared to Ti without insulation The temperature difference (2.7 ° C) is stable.

Figure 5 is the temperature measurement of Example 2; Group A uses a single temperature control, only one annular heating piece (95 ° C) heats the bottom of the test tube; Group B has two sets of upper and lower annular heating pieces (95 ° C / 65 °C), but there is no heat insulation between the two heating sheets; Group C has two sets of upper and lower annular heating sheets (95 °C / 65 °C), and the tubes are covered with heat-insulating material while heating. Insert the T-type thermocouple into this interface and record the temperature change for 15 minutes with a computer (PC-Based Data Acquisition Unit MX100, Yokogawa, Japan) ₀ The results show a. When the room temperature is 24 ° C, only a single temperature control, Ti can not reach 65 ° C and the temperature difference fluctuates greatly (5.3 ° C); b. Use the upper and lower temperature control ( 95 ° C / 65 ° C), when the room temperature is 24 ° C, no insulation setting, the results show an average temperature of 65.2 ° C, temperature difference of 2.7 ° C; c. using two upper and lower temperature control (95 ° C / 65 ° C) When the room temperature is 24 ° C and there is a heat insulating device (acrylic in this embodiment), the result shows an average temperature of 64.3 ° C and a temperature difference of 0.6 ° C. By comparison, the dual temperature control and thermal insulation device of the present invention can achieve the most ideal amplification conditions.

Fig. 6 shows the results of the amplification of Example 2. The temperature of the two annular heating devices was set before the experiment, and the bottom temperature was set to 95 ° C; the upper temperature was set to 65 ° C. The opposite high temperature zone, low temperature zone and convection zone are formed in the test tube, the reagent is heated up and floated, and the denaturation step in the PCR reaction occurs at the same time; when floating up to the upper liquid surface, part of the heat is led out through the upper annular heating piece and maintains a certain temperature, At this temperature, the annealing and extension steps in the PCR occur; at this point, the reagent sinks again due to cooling, and after reaching the bottom, it is again heated up again, and the next cycle of the PCR reaction is started. In this example, the reagents of the positive experimental group and the negative control group (the sample was replaced with water) were separately injected into the reaction tube, and the surface of the reagent was covered with a small amount of paraffin oil. The reaction tube was inserted vertically into the hole of the heating device and allowed to stand for 30 minutes. The traditional machine setting parameters are as follows: 95 ° C for 10 minutes; 95 ° C for 20 seconds, 65 ° C for 20 seconds and 72 ° C for 30 seconds, for 35 cycles; and finally 72 ° C for 7 minutes. The total time is 1 hour and 50 minutes. Finally, 2 μΐ of the product was taken from the tube for agarose gel electrophoresis analysis. It can be seen from the electropherogram that the device of the present invention is equivalent to the brightness (Ρ2) of the conventional PCR instrument amplified fragment (169 bps) (P1); the negative control results of both methods (N1, N2) are negative, but the present invention The primer dimer is weaker than the conventional PCR instrument. The present invention saves nearly four times longer in response time than conventional PCR machines.

Figure 7 illustrates the correlation between different reagent volumes and amplifiable lengths. The principle of the invention is to establish thermal convection in a reaction tube, i.e., a change in density of the liquid caused by a temperature gradient difference, thereby causing fluid movement, called " Natural convection, the phenomenon of spontaneous convection is completely different from the flow forced by the driving device. When the flow field is stable, the reagent will form a similar flow path. When the path is longer, the longer the reaction time will be. , which is equivalent to increasing the reaction time of each step of PCR (denaturation, annealing, extension). In this figure, the length between 2 and 5 mm is used as the diameter of the reaction tube. When the reagent volume is 75 μl, It takes about 18~25 seconds for the reagent to complete one cycle. When the reagent volume increases to 100 microliters, the reagent cycle time is increased to 28~33 seconds. The results of the agarose gel electrophoresis showed that when the reagent volume was only 75 μl (1, 2), the product was not obvious; after increasing the reagent volume to 100 μl (3, 4), the length of 300 bases was guaranteed. The base pair product was successfully amplified.

Fig. 8 illustrates the amplification results of Example 2, and the present invention can be used to amplify not only DNA of different lengths but also RNA of different lengths. Set the temperature of the two annular heating devices before the experiment, the bottom temperature is set to 48 ° C; the upper temperature is also set to 48 ° C, this temperature can be adjusted according to different needs (42 ° C ~ 55 ° C), five The set stable temperature can be reached in minutes. The reagents of the positive experimental group and the negative control group (substitute for water replacement) were separately injected into the reaction tube, and the surface of the reagent was covered with a small amount of paraffin oil. The reaction tube was inserted vertically into the hole of the heating device and allowed to stand for 20 minutes to complete the reverse transcription step. After that, the bottom temperature was adjusted to 95 ° C, the upper temperature was adjusted to 65 ° C, the thermal convection PCR reaction was started, and the nucleic acid amplification reaction was completed after 20 minutes. The three fragments shown in the figure are the results of amplification of three lengths of RNA, and the lengths of the three fragments are 858 bp, 371 bp, and 175 bp, respectively.

Figure 9 illustrates the results of DNA amplification at different temperatures at the bottom. The temperature of the two annular heating blocks of the experimental setting device is 90, 95 and 99 ° C at the bottom; the fixed setting is 65 ° C above, and after the short-term time reaches the set stable temperature, the whole tube is inserted. In the heating device of the present invention, the lower ring device provides a higher temperature to heat around the bottom of the test tube, the reagent is heated up and floated, and a denaturation step in the PCR reaction occurs; when floating up to the upper liquid surface, part of the heat is led through the upper annular heating piece. And maintaining a certain temperature at which the annealing and stretching steps in the PCR occur; at this time, the reagent sinks again due to cooling, reaches the bottom and re-heats up again, and starts the next cycle of the PCR reaction. The reagent reached a stable cycle in one minute and the reaction was complete after 25 to 30 minutes. The results of agarose gel electrophoresis show that the present invention can be successfully amplified at the bottom temperature setting of 90 (2), 95 (3) and 99 ° C (4), and its brightness is comparable to that of a conventional machine (1).

Figure 10 illustrates the results of Example 2 at various reaction times. The experimental specimens were assayed for 13 tubes using a hepatitis B virus plasmid (pHBV-48, GenBank No. NC003977) at a concentration of 10,000 copies per tube, under the same reagent and plasmid concentrations. The 13 tubes are simultaneously inserted into the apparatus of the present invention to be heated, and the tubes are taken out into the ice at regular intervals to stop the circulation. Reaction, time points are 10 minutes (1), 11 minutes (2), 12 minutes (3), 13 minutes (4), 14 minutes (5), 15 minutes (6), 16 minutes (7), 17 minutes (8), 18 minutes (9), 19 minutes (10), 20 minutes (11), 25 minutes (12), 30 minutes (13). The results of agarose gel electrophoresis showed that the device could detect obvious amplified bands at the 12th minute after the reaction. After 14 minutes, the difference was not significant at each time point, indicating that the reaction could be completed within 20 minutes. Compared with PCR, the time consumption is significantly reduced.

Fig. 11 is a view showing the results of performing C-PCR amplification of DNA in Example 3 while performing fluorescence detection. Set the temperature of the two annular heating devices before the experiment, the bottom temperature is set to 95 ° C; the upper temperature is set to 65 ° C, this temperature can be adjusted according to different primers, and the set stable temperature can be reached after five minutes. . The reagents of the positive experimental group and the negative control group (model water replacement) were separately injected into the reaction tube, and the surface of the reagent was covered with a small amount of paraffin oil. The reaction tube was inserted vertically into the hole of the heating device and allowed to stand for 30 minutes. The excitation source (480 nm LED) was turned on every five minutes for three seconds, and a 530 nm filter glass was placed in front of the lens of the cool CCD to block the passage of blue light, and the image was taken with a parameter of exposure time of 200 msec. The reaction was completed after 30 minutes. The results show that the device of the present invention can be used for amplification of DNA and for real-time detection, and the data analysis shows that the device of the present invention has a good linearity for quantitative detection of nucleic acids. Example

Example 1:

1. Materials and methods

1.1 reaction tube

The borosilicate glass tube with one end closed at one end has a diameter ranging from 2 to 5 mm, an overall length of 10 to 45 mm, and an outer diameter of 3 to 6 mm. It is used after cleaning and sterilization.

1.2 sample

The PCR reagent contains the following components: 2.1 p HBV DNA sample, 2 pmol of 169F primer (5,-GCA CGG GAC CAT GCA GAA CCT GCA CGA T-3', SEQ ID NO: 1), 3 pmol specific probe ( FAM 5 -TGCTGTACAAAACCTTCGGACGGAAACTGCACT- 3 BHQ, SEQ ID NO: 2), 2 pmol of 169R primer (5,-GCA AGC CAG GAG AAA CGG ACT GAG GCC CAC T-3', SEQ ID NO: 3), 8 μΐ PCR Polymerization LightCycler FastStart DNA Master Hybridization Mixture (Roche, Germany), 4 mM divalent magnesium ion, total volume 55 μl.

1.3 device

The amplification and fluorescence detecting device of the thermal convection polymerase chain reaction of the present invention comprises the following components: a plurality of reaction tubes with one end open at one end, a ring heating device, a heat insulating device, a fluorescence detecting device and a support frame, as shown in FIG. 2 Shown.

1.4 Process

Set the temperature of the two annular heating devices before the experiment, the bottom temperature is set to 95 ° C; the upper temperature is set to 65 ° C, this temperature can be adjusted according to different primers, and the set stable temperature can be reached after five minutes. . The reagents of the positive experimental group and the negative control group (model water replacement) were separately injected into the reaction tube, and the surface of the reagent was covered with a small amount of paraffin oil. The reaction tube was inserted vertically into the hole of the heating device and allowed to stand for 30 minutes.

2. Results

2.1 Temperature measurement and comparison

In order to verify the effect of two annular heating devices and thermal insulation devices on the temperature stability inside the tube, we use the electric dipole method to measure the temperature (T1) at the top of the reagent liquid level in the tube. This temperature stability ensures the annealing and extension of the primer. The steps went smoothly. When the bottom temperature is set to 95 °C, the T1 temperature is measured for 30 minutes under three different conditions: (i) single temperature control, only bottom ring heating; (ii) double temperature control, upper ring heating (65) °C); (iii) Double temperature control, upper annular heating (65 ° C), filled with insulation material (acrylic) between tubes. It was found that only a single temperature-controlled temperature difference was 5.3 ° C, and the temperature stability was improved after adding the upper ring temperature control (temperature difference of 2.7 ° C), and the experiment of adding the heat insulation device, the temperature change was only 0.6 ° C in 30 minutes. , demonstrating the effectiveness of the invention.

2.2 Amplification results

The amplification products of the thermoconvection PCR and the conventional PCR were analyzed under electrophoresis conditions (1.5% agarose, 150 volts, 40 minutes), and the results are shown in Fig. 6. The figure indicates that P is a positive experimental group, N is a negative control group; 1 is a conventional PCR instrument amplification result, and 2 is an amplification result of the device of the present invention. The temperature setting conditions of the conventional machine (T3 gradient, Biometra, Germany) are: 95 ° C for 10 minutes; 95 ° C for 20 seconds, 65 ° C for 20 seconds and 72 ° C for 30 seconds (45 cycles); 72 ° C for 7 minutes; It takes 2 hours and 15 minutes. The device of the invention does not require temperature changes and takes only 30 minutes. The results show that the device of the present invention is equivalent to the brightness (P2) of the conventional PCR instrument amplified fragment (169 bps) (P1); the negative control results of both methods (Nl, N2) are negative, but the primer dimer of the present invention Weaker than traditional PCR instruments.

Example 2

Method

1. Materials and methods

1.1 Reagents

The RT-PCR one-step reagent includes the following components: RNA sample 5 ul, upstream primer lOpmol, downstream primer lOpmol, AccessQuick Master Mix (promega) 40 ul, AMV Reverse Transcriptase 8u, DEPC water, other non-essential PCR reaction additives, total volume 80 ul.

In this example, three sets of primers of different product length fragments (858 bp, 371 bp, 175 bp) were amplified:

CA16-VP1F2: TCCCATTGCAGATATGATT (SEQ ID NO: 4); CA16-VP1R2: GTTGTTATCTTGTCTCTACTAGTG (SEQ ID NO: 5);

153Fa: CAAGCACTTCTGTTTCCC (SEQ ID NO: 6);

541R: CCCAAAGTAGTCGGTTCC (SEQ ID NO: 7);

CAF3: TGTGTTGAACCAYCACTCC (SEQ ID NO: 8);

CAR3b: TAGGTAAACAACTCGCATTT (SEQ ID NO: 9).

1.2 device

The amplification device for the thermal convection polymerase chain reaction of the present invention comprises the following components: a plurality of reaction tubes sealed at one end and one end sealed, an annular heating device, a heat insulating device, and a support frame.

1.3 Process

Set the temperature of the two annular heating devices before the experiment, the bottom temperature is set to 48 ° C; the upper temperature is also set to 48 ° C, this temperature can be adjusted according to different needs (42 ° C ~ 55 ° C), five The set stable temperature can be reached in minutes. The reagents of the positive experimental group and the negative control group (substitute for water replacement) were separately injected into the reaction tube, and the surface of the reagent was covered with a small amount of paraffin oil. The reaction tube was inserted vertically into the well of the heating device and allowed to stand for 20 minutes to complete the reverse transcription step. After that, the bottom temperature was adjusted to 95 ° C, the upper temperature was adjusted to 65 ° C, and the thermal convection PCR reaction was started. After 20 minutes, the nucleic acid amplification reaction was completed. The total reaction was 70 minutes. After the reaction, 2 μΐ of the product was taken from the tube for agar. Analysis by sugar gel electrophoresis. Electrophoresis conditions: 1.5% agarose, 150 volts, 40 minutes.

2. Results

The result is shown in Figure 8. The figure indicates that Ρ is a positive experimental group and Ν is a negative control group; the results show that the device of the present invention can be used for RNA amplification of different product lengths, and the negative control result is negative. Example 3

1. Materials and methods

1.1 Reagents

The PCR reagent contained the following components: HBV full-length plasmid diluted in 10-fold gradient, 2 pmol of 169F primer (5,-GCA CGG GAC CAT GCA GAA CCT GCA CGA T-3, SEQ ID NO: 1), 2 pmol 169R Primer (5,-GCA AGC CAG GAG AAA CGG ACT GAG GCC CAC T-3,, SEQ ID NO: 3), 8 μΐ PCR Polymerase Mixture LightCycler FastStart DNA Master Hybridization Mixture (Roche, Germany), 4 mM Divalent magnesium ion, 8 ul of Sybr-Gold fluorescent dye, total volume 80 μl.

1.2 device

The amplification and fluorescence detecting device for the thermal convection polymerase chain reaction of the present invention comprises the following components: a plurality of reaction tubes with one end open at one end, an annular heating device, a heat insulating device, a fluorescence detecting device and a support frame.

1.3 Process

Set the temperature of the two annular heating devices before the experiment, the bottom temperature is set to 95 ° C; the upper temperature is set to 65 ° C, this temperature can be adjusted according to different primers, and it can be set in five minutes. Stable temperature. The reagents of the positive experimental group and the negative control group (model water replacement) were separately injected into the reaction tube, and the surface of the reagent was covered with a small amount of paraffin oil. The reaction tube was inserted vertically into the hole of the heating device and allowed to stand for 30 minutes. The light source (480 nm LED) was turned on every five minutes for three seconds, and a 530 nm filter glass plate was placed in front of the lens of the cool CCD to block the passage of blue light, and the image was taken with a parameter of exposure time of 200 milliseconds. The reaction was completed after 30 minutes.

2. Results

The result is shown in Figure 11. The results show that the device of the present invention can be used for amplification of DNA and for real-time detection, and data analysis shows that the device of the present invention has a good linearity for quantitative detection of nucleic acids.

The results in the above Examples 1, 2 and 3 confirmed:

First, the thermal convection nucleic acid amplification and detection device according to the present invention can successfully complete the PCR reaction.

Second, for the sample of RNA, the present invention can also be successfully amplified and detected, and the transcription and amplification can be carried out in the same tube, and the overall operation increases the utility. This method is important in that many pathogens are With RNA as the genetic material, the problem of non-DNA samples can be solved by the present invention.

The present invention is not limited to the embodiments and the drawings, and various alternatives and modifications can be made to the central technical idea of the present invention. Therefore, a few drawings and embodiments are only It is intended to be illustrative and not to limit the invention.

Claims

Rights request

A method for polymerase chain reaction by thermal convection, the method comprising:

(3) polymerase chain reaction using liquid convection in the tube;

2. The method of claim 1 wherein said thermostat is one or more.

3. The method of claim 1 wherein in the reaction vessel, a low density of non-volatile material is added over the amplification reactant to prevent evaporation of the reagent and penetration of the source.

4. The method of claim 1, wherein the reaction tube has a high transparency closed lid for preventing evaporation of the reagent and penetrating the light source.

5. The method of claim 1 wherein said amplification reactant comprises a chemical material that advantageously establishes thermal convection without affecting the reaction.

6. The method of claim 1 wherein the volume of the amplification reactant is increased to increase the longitudinal reagent reaction space.

7. The method of claim 1 wherein the temperature control method heats or cools the reaction mixture using solids, liquids, gases, light or microwaves.

8. The method of claim 1 further comprising performing a reverse transcription reaction of the RNA.

9. The method of claim 1 wherein the reactants are monitored in a double-stranded DNA into which the fluorescent material is inserted during the thermal convection cycle.

10. The method of claim 1 wherein in the thermal convection cycle, the specific fluorescent probe is hydrolyzed to produce fluorescence for monitoring.

11. The method of claim 1, wherein in the thermoconvection cycle, a specific fluorescent probe hybridizes to the target sequence for monitoring.

12. A temperature-controlled heat convection polymerase chain reaction device comprising:

(a) an amplification reaction vessel in which a nucleic acid amplification reagent can be contained;

(b) one or more thermostats with controllable temperature;

(c) amplifying the insulation between the reaction vessels;

(d) optionally, a real-time fluorescence detection device;

The temperature gradient distribution of the vertical space in the tube wall and the tube can be established by contacting the upper and lower portions of the amplification reaction vessel through different constant temperature heat sources.

The nucleic acid amplification device according to claim 12, wherein the amplification reaction vessel is tubular or columnar, and one end is open and the other end is sealed. Preferably, the reaction vessel is selected from the group consisting of glass, polypropylene (PE), polyethersulfone (PES), Made of materials such as propylene (PP), polypropionate (PC) and polysulfone (PSF).

The nucleic acid amplification device according to claim 12, wherein said heat insulating means is a heat insulating material, preferably any material having a low heat transfer coefficient, more preferably selected from the group consisting of glass wool, wood, heat resistant foam, mica flakes, heat resistant Plastic or the like or a combination thereof.

The nucleic acid amplification device according to claim 12, which is adapted to inject an excitation light beam from below the reaction tube and to receive light from the detector above the reaction tube.

16. A nucleic acid amplification device according to claim 12, which is adapted to inject an excitation beam from above the reaction tube and to receive light from the detector below the reaction tube.

17. A nucleic acid amplification device according to claim 12, which is adapted to inject an excitation beam from above the reaction tube and to receive light from the detector on the side of the reaction tube.

18. A nucleic acid amplification device according to claim 12, which is adapted to inject an excitation beam from beneath the reaction tube and to receive light from the detector on the side of the reaction tube.

19. A nucleic acid amplification device according to claim 12 adapted to inject an excitation beam from above the reaction tube and to receive light from the detector above the reaction tube.

The nucleic acid amplification device according to claim 12, which is adapted to inject an excitation light beam from below the reaction tube and to receive light from the detector under the reaction tube.

A nucleic acid amplification device according to claim 12, which is suitable for injecting an excitation light beam from a side surface of a reaction tube and collecting light from a detector on a side of the reaction tube.