WO2013081462A1

WO2013081462A1 - Phytostanols for the prevention or treatment of hepatic inflammation

Info

Publication number: WO2013081462A1
Application number: PCT/NL2012/050850
Authority: WO
Inventors: Jogchum Plat; Ronit Sverdlov; Ronald Peter MENSINK; Veerle Bieghs
Original assignee: Universiteit Maastricht
Priority date: 2011-12-02
Filing date: 2012-12-03
Publication date: 2013-06-06

Abstract

The present invention relates to a composition for use in treating or preventing hepatic inflammation, in particular non-alcoholic steatohepatitis (NASH). The composition comprises a phytostanol and/or derivative thereof. The invention also relates to a method of treatment of hepatic inflammation through injection or ingestion of the composition. In the latter case, ingestion is achieved through addition of the composition according to the present invention to a food product in sufficient amounts for treatment of the inflammation. Alternatively, the method of treatment or prevention of hepatic inflammation, in particular liver inflammation such as seen in NASH, comprises the use of a food supplement.

Description

Title: Phytostanols for the prevention or treatment of hepatic

inflammation.

Field of the invention

The invention relates to the field of human medicine. In particular, the invention relates to the use of phytostanols in the prevention or treatment of hepatic inflammation in human. Background of the invention

Recent decades have seen a strong increase in the occurrence of many disease profiles linked to obesity, among which diabetes type II, insulin resistance, stroke, hypertension, atherosclerosis and fatty liver disease, as well as cancer, asthma, sleep apnoea, osteoarthritis, neurodegradation and gall bladder disease (Hotamisligil, Nature, vol. 444, pg. 860-867, 2006). However, the mechanisms by which these diseases are related to obesity remain largely unknown. In particular, obesity has been seen as a cause for fatty liver disease, which in turn has been suggested as a prerequisite for liver inflammation. Fatty liver disease, when not caused by excessive consumption of alcohol, is called nonalcoholic fatty liver disease (NAFLD). It is characterised by a benign and reversible lipid accumulation in the liver (steatosis). When the liver gets to an inflammatory state, the condition is referred to as non-alcoholic steatohepatitis (NASH). Whereas steatosis is harmless, the inflammatory component can lead to irreversible liver damage. NAFLD occurrence is rising in the general population, but only about 10 % of patients develop NASH. Also, despite the fact that many obese people have a fatty liver, not all will develop NASH. Moreover, even people with normal weight, normal plasma lipid levels and no diabetes do develop NASH. Progression of NASH may lead to advanced hepatocellular damage of the liver with features such as fibrosis, cirrhosis and liver cancer. Because no proper treatment currently exists, the condition remains chronic, with a liver transplant being the only option for severe cases. However, especially for patients with NASH, the symptoms often recur even after a transplant procedure. Currently, diagnosis and treatment of NASH are complicated. NASH is distinguished from alcoholic liver inflammation, but only liver biopsies can reveal the difference. Obtaining a biopsy an invasive technique that is associated with a small chance of severe complications. Also, NASH is generally asymptomatic, and many patients remain unaware of having contracted the disease for prolonged periods of time. This is unfortunate, because especially at the onset of NASH, dietary changes and other lifestyle- influencing treatments are well-capable of avoiding development of the severe chronic disease state. However, with the lack of recognition, the disease is free to progress, only to be noted when the chance of high liver damage being already established is very high.

Obesity has also been linked to cholesterol levels. An application has been filed for a composition for use in the prevention or treatment of liver diseases, particularly NASH, comprising administration of a compound capable of increasing the intracellular level of 27-hydroxycholesterol (WO 2012/019930 Al).

Benign effects are believed to stem from the supplementation of phytosterols to the human diet. It was shown that consumption of a few grams of phytosterols results in a decrease of serum cholesterol levels by cholesterol uptake inhibition. The effect of phytosterols in lowering plasma cholesterol levels is generally believed to be approximately equal to the effect of phytostanols, when administered in equal amounts. In order to exert their function of cholesterol uptake inhibition, these compounds have to be present in the intestines. Thus, a difference in bioavailability has no effect on the effect on cholesterol uptake. However, it is generally held that the bioavailability of phytostanols is lower than that of of phytosterols (Hallikainen et al, Eur. J. Clin. Nutr. 2000 Sep;54(9):715-25;

Miettinen et. al, Nutr. Metab. Cardiovasc. Dis. 2011 Mar; 21(3): 182-8; de Jong et al, Br. J. Nutr. 2008 Nov; 100(5):937-41). Thus, any physiological effect that is associated with both sterols and stanols, that requires them to be absorbed into the blood stream, is expected to be weaker for stanols than for sterols.

The phytosterol guggulsterone has been implicated in the treatment of inflammation (Cho et al, Gastroenterology, vol 140 (5), 2011, pages S984- S985), in particular non-alcoholic steatohepatitis (NASH). The phytosterol β- sitosterol has been implicated in certain liver inflammation pathways (Valerio et al, International Immunopharmacology 11 (2011), pages 1012-1017).

However, although it is suggested that phytosterols can be used in the treatment of inflammation types, it was found that the vascular and cellular response upon topical administration, determined by the values of MPO- inhibition, resulted in a reduction in MPO-activity in the acute inflammation model only, without a significant effect in the chronic inflammation model. (Garcia et al, Phytotherapy Research, vol 13, no 1, 1999, pages 78-80).

Recently, the effect of increased serum concentrations of phytosterols has come to be questioned. Weingartner describes how phytosterols seem to be atherogenic (Weingartner, O. et al, "Vascular effects of diet supplementation with plant sterols", J. Am. Coll. Cardiol. 2008; 51, pages 1553-1561), and Teupser implicates increased phytosterol serum levels with cardiovascular diseases (Teupser et al, Circ. Cardiovasc. Genet. 2010, 3 (4), pages 331-339). Also, Hallikainen and Clayton describe how liver failure might result from increased serum phytosterol concentrations (Hallikainen et al., Nutr Clin, Pract 2008 23: 429; Clayton et. al. Gastroenterology, 1993 Dec; 105(6): 1806- 1813).

Thus, phytosterols, though widely used for their cholesterol-lowering effects, may be harmful by themselves. For this reason, it appears that phytosterol consumption should not be increased too far beyond natural levels.

Summary of the invention

In accordance with the invention it has been found that phytostanols and/or derivatives thereof are capable of reversing hepatic inflammation. The invention therefore provides a composition for use in the treatment or prevention of hepatic inflammation, which comprises a phytostanol and/or derivative thereof. The invention further provides a method of preventing or treating hepatic inflammation, comprising administering an effective amount of a composition comprising a phytostanol and/or a derivative thereof to a subject in need thereof. In particular, the present invention is used in the treatment of non-alcoholic liver inflammation (NASH).

It is to be noted that phytostanols have been described previously for medical use. US patent 5, 502,045 describes the cholesterol-lowering effects of phytostanol fatty acid esters, as well as a method of producing them.

Brief description of the drawings

Figure 1: Lipid Measurements. (A, C) Plasma and liver cholesterol

measurements. (B, D) Plasma and liver triglycerides levels. (E) HE scoring results for steatosis. (F) Scoring outcomes for the oil red O stain. (G) Graphic representations of the oil red O stain (original magnification 200x). Group 1 is indicated by the white bars, Group 2 by black bars, Group 3 by checkered bars, and Group 4 by striped bars. *P< 0.05, **P < 0.01, and ***P < 0.001, respectively. Figure 2: Hepatic Inflammation. (A, B) Immunohistochemical staining of infiltrated macrophages and neutrophils (C) confirm the H&E staining results. (D) CD3 staining for T-cells. (E-G) Representative pictures of MAC 1, NIMP, and CD3 and the four experimental groups at a magnification of 200x. Group 1 is indicated by the white bars, Group 2 by black bars, Group 3 by checkered Figure 3: Hepatic gene expression. (A-D) Inflammatory gene expression profile analyzed with quantitative real time PCR. Relative expression was normalized to endogenous control gene Cycolphilin A. Group 1 is indicated by the white bars, Group 2 by black bars, Group 3 by checkered bars, and Group 4 by striped bars. *P< 0.05, **P < 0.01, and ***P < 0.001, respectively.

Figure 4: Foamy Kupffer Cells. (A) CD68 immunohistochemical stain with (B) HE staining for verification. (C) PCR data showing expression of Kupffer cells. (D) Representative pictures of the foamy Kupffer cell appearance with CD68 staining at a magnification of 200x. Group 1 is indicated by the white bars, Group2 by black bars, Group 3 by checkered bars, and Group 4 by striped bars. *P< 0.05, **P < 0.01, and ***P < 0.001, respectively.

Figure 5: Effect of sitostanol supplementation on bone marrow macrophages. Both 0.6 μΜ and 1.2 μΜ sitostanol supplementation decreases TNF-oc cytokine level in approximately equal amounts, relative to non-sitostanol supplemented cells.

Detailed description

The invention provides a composition for use in of the treatment or prevention of hepatic inflammation, comprising a phytostanol and/or a derivative thereof. In accordance with the invention, hepatic inflammation is defined as an immunological response to harmful stimuli. These stimuli can be pathogens, damaged cells, irritants, cholesterol, or lipids, but can also be systemic.

Hepatic inflammation is a protective reaction by an organism to remove or neutralize these stimuli and to initiate a healing process. As such, hepatic inflammation is not necessarily an undesired condition as it is associated with the onset of healing. For example, the onset of inflammation in NAFLD is benign and reversible, but once chronic, the disease is called NASH, and for severe cases a liver transplant is the only cure. Thus, the invention is primarily directed to preventing or treating chronic hepatic inflammation.

Hepatic inflammation which may be prevented or treated with the invention includes NASH, alcoholic liver disease, hepatic storage diseases, lipid storage diseases and hepatitis A, B and C. More particularly NASH, alcoholic liver disease and hepatitis A, B and C can be treated with the present invention. Most preferred is treatment of NASH. In the above, hepatic storage diseases include alpha- 1 antitrypsin deficiency and morbus Wilson.

The implication of phytosterols in inflammation, together with the recent developments as to the potentially harmful effects of increased serum concentrations of phytosterols, leads to the conclusion that increased serum levels of phytosterols had better be avoided. Given the lower bioavailability of phytostanols, it is surprising that in the present invention phytostanols are shown to have an approximately equal effect on hepatic inflammation as phytosterols.

Thus, the present invention discloses administration of a phytostanol or a derivative thereof because it has been found that a phytostanol or a derivative thereof displays an unexpected beneficiary effect on hepatic inflammation.

A composition according to the invention comprises one or more phytostanols. Phytostanols include 4-desmethylphytostanols, as well as 4- monomethylphytostanols and 4,4-dimethylphytostanols. Preferably however, 4-desmethylphytostanols are used. Derivatives of phytostanols, or mixtures of derivatives, can also be used. Derivatives include ester derivatives, in particular a fatty acid ester, a glucoside or a functional ester comprising an amino acid, a hydroxybenzoic acid, a polyphenol, an ascorbic acid and/or a hydroxycinnamic acid, or a mixture thereof. Esterified phytostanols may be formed preferentially with fatty acids (2-24 carbon atoms, more typically 16-22 carbon atoms, saturated, monounsaturated or polyunsaturated, including also special fatty acids such as conjugated fatty acids, e.g. CLA, EPA and DHA), a hydroxybenzoic acid or a hydroxycinnamic acid (ferrulic or coumaric acids) or an other organic acid such as e.g. a di- or tricarboxylic acid and/or a hydroxy acid or with any combination of the said acids. Most preferred is a phytostanol fatty acid ester. The phytostanol fatty acid ester is most preferably as disclosed in US 6, 174,560, the contents of which are incorporated herein by reference. In addition, any combination of the free and various esterified forms are also included.

The term "phytostanol in esterified form" or "phytostanol ester" refers to a phytostanol or mixture thereof having at least 60%, preferably at least 85%, most preferably at least 95% of the phytostanol(s) in esterified form. The composition comprising a phytostanol and/or a derivative thereof may comprise sitostanol, stigmastanol, campestanol, brassicastanol, guggulstanol or a mixture thereof. Preferably a composition according to the invention comprises sitostanol, campestanol or guggulstanol, and/or a derivative thereof, or a mixture of these compounds. More preferably the composition comprises at least 50 % by weight sitostanol and/or derivatives thereof, typically from 55 to 90 % by weight, expressed as percentage sitostanol in the composition. The amount of campestanol and/or derivatives thereof is typically from 10 to 45 % by weight of the composition, expressed as percentage campestanol in the composition. In addition there may be an undefined amount of other components in the composition, which is preferably less than 5 % by weight, more preferably less than 3 % by weight, and most preferably less than 1 % by weight of the composition. However, the phytostanol composition may include related compounds, such as the sterol equivalent of the mentioned phytostanols. In addition, the composition may comprise other dietary acceptable components.

Also, though the invention is primarily directed at the prevention or treatment of chronic hepatic inflammation, acute or topical inflammation may also be treated or prevented with these compositions. In addition, it has been found that other inflammation types, in particular inflammatory bowel disease, may be treated or prevented with the present invention.

In this specification the amounts of phytostanols and their esters are calculated as plant "stanol equivalents" i.e. as the total amount of free phytostanol, excluding the possible acid parts of the ester molecules.

Commercially available mixtures of one or more phytostanols in their free or esterified form can be used as such. When phytostanols in their free form are used, the particle size of the phytostanols is preferably small enough to enhance the dispersability, dissolvability and solubility of the one or more phytostanols. Particle size reduction can be accomplished by many techniques known in the art, e.g. by different dry or wet grinding or micromilling techniques described for example in US 6, 129,944, WO 98/58554 and EP 1 142 494. Other components, such as a suitable admixture can be pulverized together with the one or more phytostanols, the choice of the other components depending on the food material or dietary supplement in which the active ingredients are to be added. Examples of the admixture include various structure and flavor enhancers, as well as flours especially in case the active ingredients are to be added into bakery products. One or more phytostanols in their free form may also be used molten to prepare a food product, dietary supplement, or an ingredient to be included in such products, especially in compositions containing an emulsifier and/or a fat. Preferably a homogenous mixture that is easily used in a composition of the present invention is formed from the one or more phytostanols and an emulsifier and/or a fat by heating one or more phytostanols to their melting point, to 60 - 150 °C, typically to 130 - 150°C, and adding the emulsifier and/or fat to the phytostanol(s), either prior to or after heating. Suitable techniques that can be utilized are described e.g. in US 6, 190,720. Most preferably a blend of one or more phytostanols and emulsifier(s) and/or fat is heated until the components are dissolved. The mixture is cooled under agitation prior to adding it into the compositions of the present invention. The phytostanol in a fatty acid ester form is technically very suitable for incorporation into a wide range of different products and is especially preferred, as it has very good organoleptic properties. For this reason, they are particularly preferred for compositions intended for oral use, such as in food products.

Compositions according to the present invention can be used to treat or prevent hepatic inflammation. Thus, the invention presents a method of preventing or treating hepatic inflammation comprising administering an effective amount of a composition according to the invention to a subject in need thereof. The subject in need thereof is preferentially a mammal, more preferably human.

Administration in this respect means that a composition according to the invention is preferably administered orally or parenterally. Parenteral administration includes for instance subcutaneous and intravenous

administration.

Prevention in this respect means that a composition according to the invention is administered to a subject who is at risk of developing hepatic inflammation so as to avoid the development of hepatic inflammation. Treating in this respect means administering a composition according to the invention with the aim to diminish the hepatic inflammation and its symptoms, such that a hepatic inflammation partially of fully vanishes and that the liver returns, as much as possible, to a healthy condition. For prevention of inflammation, ingestion is the preferred means of supplementation. For treatment of hepatic inflammation, both injection and ingestion of the present invention is possible, with ingestion being the preferred means of treatment. In one embodiment of the invention, the one or more phytostanols and/or derivatives thereof according to the invention are injected, for instance intravenously or subcutaneously, as a suitable solution into a patient suffering from hepatic inflammation as defined above. Other compounds that aid in supplying the composition by injection, such as cyclodextrins, can be included in this embodiment. Such injection comprises a solution of the compounds of the invention in a sufficient amount to reduce the hepatic inflammation to baseline, or as far as possible. Repeated injections might be required to achieve this. A sufficient amount for treatment by injection is a daily dose of at least 0.1 g, more preferably 0.2 g, and most preferred daily dosages are higher than 0.4 g. A dosage of more than 0.8 g/day is optimal for use with the present invention, calculated as stanol equivalents.

Alternatively, these daily dosages may be achieved with multiple injections on a single day with accordingly decreased dosage so as to achieve a daily dosage as referred to above. Injections with lower than daily frequency of higher dosage, so as to reach an average dosage per day as defined above can also be applied. Finally, a composition according to the invention can be supplied by infusion, so as to reach the dosage range as mentioned above on a continuous or semi-continuous basis.

Oral administration is preferably achieved in the form of a food product or a dietary supplement. The amount of the one or more phytostanols and/or derivatives thereof in the food product or dietary supplement is such that the active ingredient(s) is administered at a daily dose of at least 0.1 g, preferably 0.2 g, more preferably 0.4 g, and typically at a daily dose of 0.4 to 20 g, preferably 0.5 to 20 g, and more preferably 0.8 to 5 g calculated as stanol equivalents.

In another embodiment of the invention, the one or more phytostanols and/or derivatives thereof are included in a food product. The types of food in which the compounds of the invention might be included display high variety. For example, food types such as bakery products, confectionary, cereals, snacks, beverages, dairy, dairy substitutes, sauces, soups, meat, meat substitutes, fish, fish substitutes, vegetable oil-based food products and ready-mix products could be used as carrier system for the composition of the invention. Examples of these food types are given below, but it is to be noted that the type of food product for use with the present invention is not restricted to only these food types:

- bakery products and confectionery entail fresh and dry bakery products, e.g. fresh bread, other bread products, cakes, muffins, waffles, biscuits, crackers etc.

- cereal products and snacks comprise breakfast cereals, muesli, bars, such as cereal based and muesli bars, such bars possibly containing chocolate, pasta products, flours etc. beverages can be alcoholic and non-alcoholic drinks, including e.g. soft drinks, juices and juice-type mixed drinks, fortified beverages such as protein or calcium fortified beverages, probiotic drinks, sport and energy drinks, meal replacement drinks, concentrates or premixes for beverages and powdered drinks where the content of compositions of the present invention is calculated for the ready-to-use form.

dairy products include milk and milk based products, e.g. cheese, cream cheese and the like, yoghurt, frozen yoghurt, other frozen dairy foods, drinkable yoghurt, other fermented milk products, dairy beverages, ice cream, desserts, spreads etc.

dairy substitutes include non-dairy products such as soy, oat or rice based dairy substitutes e.g. imitations of milk, cheese, yoghurt, ice cream meat, fish, poultry products include for instance sausages and meat balls vegetable oil based products include for instance margarines, spreads, dressings, mayonnaise etc.

ready mixes should be read as meant for baking of e.g. breads, cakes, muffins, waffles, pizzas, pancakes; or for cooking e.g. soups, sauces, desserts, puddings). The food product of the present invention can also contain other nutritionally beneficial components, some of which may further enhance the effects of the compositions of the present invention. The food can be fortified with these components or the components can be an intrinsic part of the other food ingredients.

Examples of the nutritionally beneficial components include n-3 fatty acids, e.g. from fish oil or certain vegetable oils such as rapeseed, flaxseed and camelina oil; dietary fibre; diacylglycerol; and beneficial minor components, for example isoflavones, tocopherols, tocotrienols, carotenoids, vitamin C, folate and flavonoids. Also other vitamins and minerals (e.g. K, Mg, Ca) may be added or included in the food products of the present invention.

In such embodiment, compounds that aid in inclusion of the phytostanols and/or derivatives thereof into the food matrix are included in the invention, and these compounds can be different for every food matrix. It is understood by those skilled in the art that an array of compounds exists that can be used for this purpose, and any of those might be combined with the compounds of the invention in order to aid inclusion into a food matrix.

The amount of the phytostanol and/or derivatives thereof in the food product, calculated as stanol equivalents, is from 0.05 to 20 g per 100 g food product. Preferably this amount is from 0.1 to 20 g, more preferably from 0.2 to 15 g and most preferably from 0.5 to 15 g per 100 g food product. Thus, this amount means the sum of phytostanol in free or esterified form, expressed as stanol equivalents.

A different embodiment of the invention is defined by food supplements comprising the invention. Food supplements that could be used for this purpose might take the form of a capsule, tablet, powder, granule, syrup, dispersion or suspension, but other means of delivering a food supplement might be conceivable by those skilled in the art, and those are not to be excluded. In addition, a composition according to this embodiment of the invention may include other compounds, which includes but is not limited to antioxydants, vitamins, macro- or micronutrients, antibodies, polyphenols, enzymes or short-chain peptides, as well as salts and amino acids. Any of the nutritionally beneficial components that might be incorporated in a food product according to the invention may also be included in the dietary supplement disclosed herein. The invention will now be illustrated with the following, non-restrictive examples.

Materials and methods

Background

Experiments were performed in accordance with Dutch law for animal experimentation and approved by the Committee for Animal Welfare of the University of Maastricht. Mice were housed together in groups of 3 or 4 under standard conditions. Food and water were available ad libitum. Forty low- density lipoprotein (LDL) receptor deficient (LDLr-/-) female mice on a C57B16 background, ranging from the ages of 10 to 12 weeks, were randomly assigned to receive one of four diets. Group 1 was designated a control chow diet (36 % maize starch, 29 % sucrose, 20 % acidic caseine, 5 % cellulose, 2 % soy oil, 2 % olive oil, vitamins and minerals) void of any stanols or sterols, Group 2 was compiled of a high fat diet (40 % sucrose, 24 % acidic caseine, 15.8 % beef fat, 5.9 % cellulose, 2.9 % olive oil, 2,6 % maize starch, 2.3 % soy oil, vitamins, minerals, and 0.2 % cholesterol) without any stanols or sterols, Group 3 was comprised of a high fat diet (39 % sucrose, 23 % acidic caseine, 15.5 % beef fat, 5.8 % cellulose, 3.1 % plant stanol esters, 2.1 % soy oil, 2.1 % olive oil, vitamins, minerals, and 0.2 % cholesterol) with effectively 2% stanols, and lastly as a comparative example the mice in Group 4 were fed a high fat diet (39 % sucrose, 23 % acidic caseine, 15.5 % beef fat, 5.8 % cellulose, 3.1 % plant sterol esters, 2.1 % soy oil, 2.1 % olive oil, vitamins, minerals, and 0.2 % cholesterol) with effectively 2% sterols. Key components of the high fat diet were 16% lard, 0.2% cholesterol and either 2% sterols or 2% stanols as prescribed for each group. Ten mice were randomly allocated to each of the four diets.

One day previous to the start of the experiment the mice were weighed and 100-200 μΐ of blood were collected in a capillary tube after four hours of fasting via an incision in the tail vein. On day 0 the feeding of specialized diets and injections began according to each group. On the 21st day after the start of the experiment, the animals were weighed and fasted for four hours and had another 100-200μ1 of blood drawn and collected in a capillary tube via an incision in the tail vein. Afterwards the mice were sacrificed via cervical dislocation and immediately had their livers removed via a laparotomy consisting of an incision from the pelvis to the rib cage to gain access into the abdomen. The livers were then dissected into several pieces and

were either preserved in liquid nitrogen for storage at -80°C, or in 4% formaldehyde for tissue fixation.

Liver Lipid Analysis

Homogenization of approximately 50 mg of frozen liver tissue was completed at 5000 rpm for 30 seconds with 1.0 mm glass beads along with 1.0 ml SET Buffer (sucrose 250 mmol/L, EDTA 2 mmol/L, and Tris 10 mmol/L). A total of three freeze-thaw cycles and passage three times through a 27-gauge syringe needle ensured cell destruction. The homogenate was used to measure protein, triglyceride, and cholesterol content. Protein material was diluted 20 times. To measure the protein content, 25 μΐ of the diluted sample was pipetted into a flat bottom micro-plate. After adding 200 μΐ of the reagents (50 parts A, 1 part B) and letting the mixture stand for 30 minutes at 37°C, the absorbance was measured utilizing the enzymatic color test bicinchoninic acid (BCA) method (Pierce, Rockford, IL) at a wavelength of 560 nm with a Benchmark 550 Micro- plate reader (170-6750XTU; Bio-Rad, Hercules, CA).

For triglycerides (diluted 5 times) and cholesterol (undiluted) measurements, 7.5 μΐ of homogenate were pipetted onto their respective flat bottom measure plates in which 200 μΐ of their respective reagents were mixed in and set to incubate for 45 minutes at room temperature (Roche GPO-PAP kit). Both triglycerides and cholesterol had their absorbencies read at 490 nm. All of the protocols were followed according to manufacturer's instructions and read on a Benchmark 550 Micro-plate reader (170-6750XTU; Bio-Rad, Hercules, CA). Concentrations of triglycerides and cholesterol were set relative to the protein content of the sample; i.e. lipid component divided by protein, divided by 100 giving the actualized concentration in mg/dl.

Plasma Lipid Analysis

Plasma cholesterol and triglyceride measurements were again tested with the enzymatic color tests. Diluted cholesterol serum plasma samples (2 times dilution for control diet; 15 times dilution for high fat diet) were pipetted in 7.5 μΐ volumes into a flat bottom micro-plate. Then, 200 μΐ of the cholesterol reagent was added, mixed, and incubated at room temperature for 45 minutes. Absorbance was measured at the 490 nm wavelength with a Benchmark 550 Micro-plate reader. For the triglyceride portion, the high fat diet samples were diluted twice whereas the control diet did not need to be diluted. Again, 7.5 μΐ of each sample was pipetted into a flat bottom micro-plate. Subsequently, 200 μΐ of reagent A was added, mixed, and after 15 minutes of incubation read at a wavelength of 545 nm for the initial absorbance. Another 40 μΐ of reagent B was added for 30 minutes of incubation at room temperature. The final absorbance was then measured at 545 nm. The concentration of triglycerides was then calculated by subtracting the initial concentrations from the final concentrations. All protocols were followed according to the manufacturer's regulations (cholesterol CHOD-PAP; 1489232; Roche, Basel, Switzerland; serum triglyceride determination kit, TR0100; Sigma-Aldrich; NEFAC, ACS- ACOD, 999-75406; Wako Chemicals, Neuss, Germany) and a Benchmark 550 Micro-plate Reader (170-6750XTU; Bio-Rad, Hercules, CA) was used to determine the measurements. Immunohistochemistry and Histological Analysis

Liver tissues were fixated in formaldehyde, embedded in paraffin, and cut into 4 pm sections. A hematoxylin and eosin (HE; Hematoxilin 4085.9002;

Klinipath Duiven, The Netherlands; and Eosin, E4382; Sigma-Aldrich) stain was performed to assess the general condition of the liver including hepatic inflammation, fat accumulation, and the foamy appearance of Kupffer Cells. First, the slides had the paraffin removed with xylol and descending concentrations of ethanol from 100% to 50%. Next, the samples were colored for 10 seconds in hematoxylin, washed, and then dipped in eosin staining solution for 3 minutes. Dehydration of the slides was obtained through several washings in ascending degrees of ethanol, 70% to 100% (Sigma-Aldrich Co. St. Luis, MO). Slides were preserved by adding two drops of Entellan (Merk KGaA; Darmstadt, Germany) and a glass cover slip. The hematoxylin dye gave the nuclei a purple/blue hue and eosin provided the cytoplasm a pink/red hue enabling visual differentiation.

Stained sections were scored in a blind manner by a specialized animal pathologist. In regards to inflammation, a score of zero denoted no aggregates of inflammatory cells in the tissue; a score of one was designated for moderate cell infiltration, a score of two for large amounts of cells aggregates, and a score of three for large clusters of inflammatory marked cells over the entire tissue. Sections were scored for the quantity of fat droplets and for the foamy appearance of Kupffer cells. A scoring system of 0 to 3 was used to designate minimal amounts to severe steatosis and the abundant foamy appearance of Kupffer cells.

To distinguish between inflammatory cell types and further demonstrate their presence, immunohistochemical staining for T-lymphocytes (CD3), Kupffer cells (CD68), infiltrated macrophages (MACl), and neutrophils (NIMP) were completed utilizing 7 pm thick frozen liver sections. Hydrogen peroxide was utilized to block endogenous peroxidase activity, and 4% fetal calf serum was used to block non-specific binding sites. CD3 positive cells were stained with a polyclonal rabbit anti-human CD 3 antibody (dilution 1:200), CD68 positive cells with monoclonal mouse anti-human antibody (dilution 1: 100; CD3 and CD68 antibodies: Biolegend, San Diego, USA), and MACl positive cells with polyclonal rabbit anti-human MACl antibody (DAKO R0841; dilution 1: 1000). For the CD3, CD68, and MACl stains the ABC-kit was used for amplification (first incubations: Avidin D 1:5 dilution, Biotin 1:5 dilution; second

incubations: Avidin D 1:50 dilution, Biotin 1:50 dilution; Vector Laboratories Inc. Burlingame, CA) The NIMP stain for neutrophils does not require amplification and uses a rat-anti-mouse Ly6-C, clone NIMPR14 (dilution 1: 100; Biolegend, San Diego, USA). The secondary antibody applied to the CD3, CD68, and MACl stains was a biotinylated polyclonal rat anti-rabbit IgG (DAKO E0468; 1:300 dilution). The NIMP stain has a polyclonal rabbit anti- rat immunoglobulin horse radish peroxidase (DAKO E0450 1: 100 dilution) secondary antibody. The detection kit AEC (3-Amino-9-ethylcarbazole; A85SK- 4200. Si; Bio-connect, Huissen, The Netherlands) was used as a color substrate for all of the stains to identify the positive cells, and hematoxylin (4085.9002, Klinipath, Duiven, The Netherlands) was applied as nuclear counter stain. All sections were preserved with two drops aqueous mounting medium (S302580; DAKO, Glostrup, Denmark) and a glass cover slip.

To verify the quantification of fat, 7 pm thick frozen sections were stained with oil red O (ORO; O0725; Sigma-Aldrich) the neutral lipid marker. First, the samples were fixated for one hour in 3.7% formaldehyde. These were then stained with 0.2% oil red utilizing triethyl-phospate (60%) as the solvent for 30 minutes. Mayer's hematoxylin (4085.9002, Klinipath, Duiven, The

Netherlands) was used as the counterstain for the sections, rinsed under running water, and preserved with a glass cover slip using 10% glycerol in PBS. The lipid droplets stained red were quantified on a scale of 0 to 3. A score of 0 was designated to those samples with very few indications of lipid deposits, a score of one for mild amounts, a score of two for moderate amounts, and a score of 3 for severe steatosis.

Nikon digital camera model DMX1200 and ACT-1 v2.63 software from Nikon Corporation were used to photograph each section. For the

immunohistochemical staining six pictures were randomly taken of each sample and for the oil red 0 stain four pictures were randomly taken both at a 200x magnification. The positive cells for each picture were then counted or scored and noted as cells or lipid droplets per square millimeter respectively.

RNA extraction, cDNA synthesis and RT-PCR

Approximately 25 mg of frozen liver tissue was used as the source for total RNA extraction. Homogenization of the frozen liver tissue was completed at 5000 rpm for 30 seconds with 1.0 mm glass beads along with 1.0 ml Tri Reagent (Sigma Aldrich T9424) to disassociate nucleoprotein complexes. After allowing samples to stand for 5 minutes, 200 μΐ of chloroform were pipetted into each of the tubes. These were then shaken vigorously, left to rest for 10 minutes, and then centrifuged at 12000x g for 15 minutes at 4°C. The RNA from the upper aqueous phase was delicately removed and placed into a new tube. To this new tube, 0.5 ml of isopropanol was added and then the mixed sample was centrifuged for 10 minutes again at 4°C. After removing the supernatant, the RNA pellet that precipitated was resuspended in 0.5 ml of 70% ethanol and again centrifuged for 5 minutes at 4°C. The pellet was again isolated and re-dissolved in 200 μΐ sterile water.

In order to verify the purity and concentration of the isolated RNA, the NanoDrop program (NanoDrop 1000 V3.1.2; NanoDrop Technologies

Montchanin, DE) was used. A drop, 1.5 μΐ, of each sample was measured by the NanoDrop device. After confirmation of purity and rendering pipettable concentrations, the master mix of iScript mix (4 μΐ per sample) and iScript Reverse Transcriptase (1 μΐ per sample) were added to the mix plate along with 15 μΐ (500 ng per reaction) of isolated RNA from each sample (Bio-Rad Hercules, CA). This plate was then placed in the thermal PCR cycler to generate cDNA.

Samples were plated onto a 384 PCR well plate for the testing of the following genes: CD68, MCP1, IL-16, TNFct, ICAM, and Cyclophilin A. Along with the 5 μΐ of each cDNA sample (2 ng), Master Mix (10 μΐ IQ SYBR Green Supermix with fluoresceine), primers (0.8 μΐ) and sterile water (4.2 μΐ) were added for each sample specific for each gene. For the targeted genes, the primers were developed by using Primer Express v2.0 (Applied Biosystems, Foster City, CA) utilizing the default settings. Cyclophylin A (Ppia) was the endogenous control gene used to standardize the amount of cDNA made (Table 1). SDS ABi

7900HT with PowerSybr Green mastermix (432900 land 4368708; both

Applied Biosystems, Foster City, CA) were used to perform the real-time PCR. This was completed according to manufacturer's protocols by utilizing

chemicals from Sigma Chemical Co. The PCR results were analyzed using the relative standard curve method.

Table 1: primer sequences used in RT-PCR.

Gene Primer Forward Primer Reverse

CD68 TGACCTGCTCTCTCTAAGGCTACA TCACGGTTGCAAGAGAAACATG

ICAM TTCTTGGTGGTGAGCCTGAGAAGAG CAAGTACCTGGCTGTGCAGATTAG

IL-16 AGAATGAGCTGTTATTTGAGGTTGATG GTGAGAAATCTGCAGCTGGATGT

MCP-1 CATAGCAGCCACCTTCATTCC TCTGCACTGAGATCTTCCTAT

TNFct CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACC C

Ppia TTCCTCCTTT C AC AG AATT ATT C C A CCGCCAGTGCCATTATGG Data Analysis

Results are presented as mean standard error of the mean (± SEM).

Differences between groups were assessed by ANOVA and significant effects were analyzed by post hoc Bonferroni corrections. These differences are considered statistically significant at P<0.05 indicated by one asterisk, a P- value of <0.01 with two asterisks, and three asterisks indicating a significance level of P<0.001. All analyses were performed using a commercially available statistics package (GraphPad Prism version 5; GraphPad Software Inc, San Diego, CA, U.S; www.graphpad.com).

Example 1

Both stanols and sterols significantly decrease plasma and liver cholesterol The following effects were seen in mice with the SS diet supplementation. The high fat diet (Group 2) dramatically increases plasma and liver cholesterol levels compared to the other three groups (Groups 1, 3, 4; Figure 1A, C). Both the plasma and liver triglyceride measurements do not show significant differences between groups (Figure IB, D respectively). There is a trend toward lower amounts of liver triglycerides in Groups 3 and 4, but this is not significant. The HE scoring for steatosis does not show any differences between the four different dietary supplementations (Figure IE). However, the oil red 0 stain for lipid droplet deposits in cells demonstrates significant differences between the groups, exhibiting higher levels of steatosis in the high fat diet group (Group 2) versus the control (Group 1) and the groups supplemented with stanols (Group 3) or the comparative group supplemented with sterols (Group 4; Figure IF). Thus, both plasma and liver cholesterol are decreased with approximately equal magnitude by supplementation with both stanols and sterols. In addition, a decrease in hepatic inflammation is observed upon supplementation with both stanols and sterols. Example 2

Hepatic inflammation, is decreased with stanol supplementation Quantification of cell types is valued as a good indication of activities within the liver. To gain a more detailed picture of the effect on inflammation of stanols and sterols, several immunohistochemical stains were preformed to detect the presence of infiltrated macrophages (MACl), neutrophils (NIMP), and T-lymphocytes (CD3). MACl stained cells show significant differences between the high fat diet group (Group 2) in comparison to the control group (Group 1), and the high fat diets with stanol supplementation (Group 3), and the control group with sterol supplementation (Group 4). See Figure 2 A. No significant difference is observed between control sterol supplementation and stanol supplementation according to the invention. Representative pictures of the MACl staining display perceptible differences in infiltrated macrophages with large aggregates of positive red stained cells in the high fat diet group (Figure 2E).

Neutrophil-positive cells are also prominent in the high fat diet group, but these are significantly lowered in the high-fat diet comprising a stanol composition according to the invention (group 3). The composition according to the invention also displays better performance than the control high fat sterol diet (Group 4), but this result is not statistically significant. Both the sterol control group 4 and the stanol group 3 display increased effectiveness relative to the control group 1 (see also Figure 2F) in approximately equal magnitude.. Results from the HE stain reveal significant differences in inflammation between the high fat diet group (Group 2) and the remaining three groups (Groups 1, 3, 4; Figure 2C). Both Group 3 according to the invention and control Group 4 perform better than control 1, but there is no difference between group 3 and control group 4. T-lymphocytes do not show any significant differences between any of the four diet groups (Figure 2D). Pictorial representations reiterate that T-cells show no marked differences between any and all groups, as was confirmed via statistical analysis (Figure 2G).

Thus, overall it is concluded that both stanol-supplemented Group 3 according to the invention and the sterol-supplemented control Group 4 have the effect of diminishing hepatic inflammation relative to the high fat diet (Group 2) and the regular chow diet (Group 1) in approximately equal magnitude.

Example 3

Hepatic gene expression, demonstrates decreased inflammation through the addition of stanols and sterols

To investigate changes at the mRNA level due to the differences between the diets, several genes involved in hepatic inflammatory pathways were examined. The genes inspected with real time PCR were: MCP1, IL-16, TNFa, and I CAM. Significant differences between the high fat diet group (Group 2) and the remainder of the three diet groups (Groups 1, 3, 4) were found in every single gene tested with high statistical significance (Figure 3A-D). MCP1, IL- 1β-, ICAM- and TNFoc-expression resulted in approximately equally reduced expression for the stanol-supplemented group according to the invention (Group 3), relative to the control sterol supplemented group (Group 4).

To conclude, evidence points toward an increased inflammatory status when comparing the high fat diet group (Group 2) to the control group (Group 1). Inflammation is reduced in approximately equal magnitude by the

incorporation of 2% stanols in the diet (Group 3) as well as by the

incorporation of 2% sterols in the diet (control Group 4). Example 4

Foamy kupffer cells are significantly reduced with stanols, more than with sterols

As an integral part of the liver, Kupffer cells are elaborately involved in the inflammatory condition of the liver. The CD68 immunohistochemical stain demonstrates significant differences between the high fat diet (Group 2) and the control group (Group 1) as well as the group supplemented with stanols (Group 3) or the control group supplemented with sterols (Group 4). See Figure 4A. There is no significant difference between stanol or sterol

supplementation. Representative pictures for the CD68 immune stain portray the visible appearance of foamy Kupffer cells in the high fat diet group (Group 2) while not in the other three groups (Group 1, 3, 4). The staining of these foamy Kupffer cells are perceptible at a magnification of 200x with the presence of many red positive cells in Group 2 (Figure 4D).

Verification with the HE stain also displays the same statistical significance; both the 2% stanols according to the invention and the 2% sterols control group (Groups 3 and 4, respectively) as well as the control group (Group 1) show minimal amounts of foamy Kupffer cells when compared to the high fat diet group (Group 2; Figure 4B).

Also, the real time PCR data for CD68 demonstrates that although Group 2 has a higher expression than any of the Groups 1, 3, and 4, the expression of both the stanol-supplemented group 3 and the sterol-supplemented control group 4 is reduced by an approximately equal magnitude (Figure 4C). Thus, it is concluded that stanols and sterols work at decreasing hepatic inflammation in a similar magnitude, when supplemented orally with equal amounts. Example 5

Sitostanol decreases TNF-a

BM cells were isolated from the bones (femur and tibiae) of the hind limbs of wild-type (C57/B16) mice. Cells were cultured for 8 days in Roswell Park Memorial Institute (RPMI1640) cell culture medium supplemented with 10% FCS, 1% P/S, 1% L-Glutamine, 20 mM Hepes (RPMI-10) (Gibco invitrogen, Breda, the Netherlands) and 20% LCM (L929-cell conditioned medium which contains M-CSF) to differentiate into bone marrow derived (BMD)

macrophages.

Wild-type bone macrophages (3.5 x 10⁵ cells/well) were distributed over a 24 wells microplate (1.9 cm²/well) in RPMI-10 (500 ul/well) and allowed to attach. The cells were washed with RPMI-10 once and then stimulated with RPMI-10, cyclodextrin (end concentration; 0.2 uM) or sitostanol (end concentration; 0.6 uM or 1.2 uM) for 3 hours. Subsequently, the cells were washed again with RPMI-10 medium, and stimulated with lipopolysaccharide (LPS) (Sigma- Aldrich, Zwijndrecht, the Netherlands; end concentration 100 ng/ml) for 4 hours. The levels of TNF-a cytokine in the supernatant was determined via a standard TNF-a ELISA kit. The levels of TNF-a are then expressed in pg/ml. The results are shown in Figure 5.

It was found that sitostanol supplementation at 0.6 and 1.2 μΜ decreases the TNF-a cytokine level in approximately equal amounts, relative to non- sitostanol supplemented cells.

Claims

1. A composition for use in the treatment or prevention of hepatic inflammation, comprising a phytostanol and/or a derivative thereof.

2. A composition according to claim 1, wherein the phytostanol is a 4- desmethylphytostanol.

3. A composition according to any of the preceding claims, wherein the phytostanol comprises sitostanol, stigmastanol, campostanol, brassicastanol, guggulstanol or a mixture thereof.

4. A composition according to any of the preceding claims wherein the derivative of a phytostanol comprises a fatty acid ester, a glucoside or a functional ester comprising an amino acid, a hydroxybenzoic acid and/or a hydroxycinnamic acid, or a mixture thereof, of said phytostanol.

5. A composition according to any of the preceding claims wherein the hepatic inflammation is NASH, alcoholic liver disease, lipid storage disease, hepatitis A, B or C, or a hepatic storage disease, such as alpha- 1 antitrypsin deficiency or morbus Wilson.

6. A composition according to claim 5 wherein the hepatic inflammation is NASH, alcoholic liver disease or hepatitis A, B or C.

7. A composition according to claim 6 wherein the hepatic inflammation is NASH.

8. A composition according to any of the preceding claims wherein the treatment or prevention comprises administration of a daily dose of one or more phytostanols, or derivatives thereof, of at least 0.1 g, calculated as stanol equivalents.

9. A method of preventing or treating hepatic inflammation comprising administering an effective amount of a composition according to any of the preceding claims to a subject in need thereof.

10. A method according to claim 9 wherein the composition is administered orally or parenterally.

11. A method according to claim 10 wherein the composition is administered orally in the form of a food product and/or dietary supplement.

12. A method according to claim 11 wherein the dietary supplement is in the form of a capsule, tablet, powder, granule, syrup, dispersion or suspension.

13. A method according to claim 11 wherein the food product is selected from the group consisting of bakery products, confectionary, cereals, snacks, beverages, dairy, dairy substitutes, sauces, soups, meat, meat substitutes, fish, fish substitutes, vegetable oil-based food products and ready-mix products.

14. A method according to any one of claims 9-13 comprising administering the phytostanol and/or derivative thereof in a daily dose of at least 0.1 g, calculated as stanol equivalents.