WO2013081199A1 - Kit for detecting hepatitis b virus and method for detecting hepatitis b virus using same - Google Patents

Abstract

Disclosed is a kit for detecting HBV in a test sample. Further disclosed is a method for the real-time detection of HBV in a test sample using the kit. The detection method enables the rapid real-time confirmation of the detection results using only a small number of copies of a test sample.

Description

Hepatitis B virus detection kit and method for detecting hepatitis B virus using the same

The present invention discloses a kit for detecting hepatitis B virus and a method for detecting hepatitis B virus using the same. Also disclosed are oligonucleotides suitable for use in the method.

Hepatitis B virus (HBV) is a virus of the Hepadnaviridae strain that specifically infects the human body. It is known that about 500 million people worldwide are infected with HBV. The incubation period of HBV is 60-110 days, and in patients who do not recover from infection after 90-95% complete recovery through various clinical stages, HBV genomic DNA is inserted into and assimilated into the genomic DNA of human hepatocytes for chronic active hepatitis. , Cirrhosis, liver cancer, etc. will develop. Infection with HBV, like other diseases, causes chronic viral infections, lymphoma diseases and chronic kidney disorders. Chronic infection is a disease with a high mortality rate that develops into a more powerful form of the disease and eventually leads to the death of the patient.

Therefore, there is a need for a method for detecting HBV quickly and accurately.

One embodiment provides a kit for detection of HBV.

In one embodiment, a method of detecting HBV in a sample in real time is disclosed.

According to one embodiment, a group consisting of a primer having a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and a primer having a nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4 and a probe having a nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6 It provides a kit for real-time detection of HBV selected from.

In one embodiment, the forward primer oligonucleotide comprises an oligonucleotide of SEQ ID NO:

CTCGTGTTACAGGCGGGGTTTTTCTTGTTGACX ₁ X ₂ (SEQ ID NO: 7), wherein X ₁ is absent or A and X ₂ is absent or A.

In other embodiments, the forward primer oligonucleotide can be an oligonucleotide of SEQ ID NO: 1 or SEQ ID NO: 2:

CTCGTGTTACAGGCGGGGTTTTTCTTGTTGAC (SEQ ID NO: 1), and

CTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAA (SEQ ID NO: 2).

In other embodiments, the reverse primer oligonucleotide can be an oligonucleotide of SEQ ID NO: 3 or SEQ ID NO: 4:

AACGCCGCAGACACATCCAGCGA (SEQ ID NO: 3), and

AAGAAGATGAGGCATAGCAGCAGGATGAAGAGGAA (SEQ ID NO: 4).

In one embodiment, the probe may be an oligonucleotide of SEQ ID NO: 5 or SEQ ID NO:

TGGCCAAAATTCrGrCrArGTCCCCAACCTCCAAT (SEQ ID NO: 5), and

AAACGCCGrCrArGrACACATCCAGCGA (SEQ ID NO: 6), wherein the nucleotides “rG”, “rC: and“ rA ”are ribonucleotides.

The probe may have a detectable label linked to each end or both ends of the 3 'end and the 5' end.

In one embodiment, as above, there is provided a kit comprising forward and reverse primers. The kit may further comprise the probe. The kit can be suitably used to accurately, sensitively and rapidly detect HBV in a sample.

The kit may further comprise a cleavage reagent capable of cleaving reverse transcriptase activity, polymerase activity and the internal site of the probe oligonucleotide. The cleavage reagent may be selected from the group consisting of RNase H, Kamchatka crab duplex specific nuclease, endonucleases, and nicking endonucleases. The kit may further comprise uracil-N-glycosylase.

According to one embodiment, the method initiates real-time detection of HBV in a sample, comprising the steps of: a) providing a sample to confirm the presence of HBV; b) extracting RNA from the sample; c) a nucleic acid comprising said RNA and uracil-N-glycosylase, DNA polymerase, reverse transcriptase, appropriate deoxynucleoside triphosphate, DNA and RNA nucleic acid sequences substantially detectable with HBV target DNA and a detectable label Combining the binding probe, the reaction buffer, and the upstream and downstream primers to form an amplification solution; d) incubating the amplification solution for an appropriate temperature and for a sufficient time to activate uracil-N-glycosylase and remove contaminated residual template nucleic acid; e) incubating the amplification solution for an appropriate temperature and for a sufficient time to inactivate uracil-N-glycosylase and contact the RNA and downstream primers with reverse transcriptase to synthesize cDNA; f) incubating the amplification solution for an appropriate temperature and for a sufficient time to inactivate reverse transcriptase and denature the cDNA; g) temperature cycling the amplification solution between a minimum denaturation temperature and an elongation temperature under conditions where the nucleic acid sequence in the probe can form an RNA: DNA heteroduplex with a complementary DNA sequence in a PCR fragment of the HBV target DNA. thermally cycling, wherein the upstream and downstream primers in combination amplify a target nucleic acid or a section thereof, wherein the portion is provided in any length as the only portion present in the HBV genome; h) reaction of a plurality of nucleic acid probes with a target nucleic acid sequence comprising a detectable label, respectively, under conditions such that said first nucleic acid probe of said plurality of nucleic acid probes comprising a first detectable label hybridizes with said target nucleic acid or portion thereof Forming a mixture; i) changing the structure or conformation of said nucleic acid probe to activate a detectable label; j) repeating steps (g) and (h) using a second nucleic acid probe from the plurality of nucleic acid probes in the reaction mixture, wherein the plurality of activated detectable labels are formed; And k) detecting an increase in signal emitted from the label on the probe in real time, wherein the increase in signal indicates the presence of HBV in the sample.

In one aspect, the real-time increase in signal emitted from the label on the probe results from RNase H cleavage of the heteroduplex formed between the probe and a strand of the PCR fragment.

In another embodiment, the method can be used to determine the amount of HBV in a sample.

According to one embodiment, a kit for detecting HBV is provided. The kit includes a first primer and a second primer. The kit may further comprise the probe disclosed above.

According to one embodiment, the kit comprises a mixture comprising dATP, dCTP, dGTP, and dTTP; DNA polymerase; RNase HII; And a buffer solution.

The experiments of the embodiments disclosed herein used conventional molecular biological techniques known in the art, unless otherwise indicated. Such techniques are well known to those skilled in the art and are fully described in the literature. See, for example, Ausubel, et al., Ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008) and Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989).

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The specification also provides definitions of terms to aid in the interpretation of the description and the claims. As a result, if a definition does not match another definition, the definition will be defined as described herein.

"Target DNA" or "target RNA" or "target nucleic acid" or "target nucleic acid sequence" means a nucleic acid that is targeted by DNA amplification. The target nucleic acid sequence serves as a template for amplification in a PCR reaction or reverse transcription-PCR reaction. Target nucleic acid sequences include natural and synthetic molecules. The target nucleic acid can be, for example, but not limited to genomic DNA or genomic RNA.

The term “nucleotide” is a deoxyribonucleotide or ribonucleotide that exists in single- or double-stranded form, and is interpreted to include analogs of nucleotides unless otherwise specified.

The term “probe” refers to a linear oligomer with natural or modified monomers or bonds, including deoxyribonucleotides and / or ribonucleotides that can hybridize to a specific polynucleotide sequence. For example, the probe may be single stranded for maximum efficiency in hybridization.

The probe according to one embodiment may be a sequence that is perfectly complementary to the polynucleotide sequence that is a template, but may be a sequence that is substantially complementary to the extent that it does not prevent specific hybridization. Conditions suitable for hybridization are as described above.

As used herein, the term "substantially complementary" means that two nucleic acid strands that are sufficiently complementary in a sequence anneal and form a stable duplex. The complementarity need not be complete; For example, there may be several mismatches of base pairs between two nucleic acids. However, if the number of mismatches is so large that hybridization does not occur even under minimal stringent hybridization conditions, the sequence is not a substantially complementary sequence. When two sequences are to be interpreted herein as "substantially complementary" it is meant that the sequences are sufficiently complementary to allow each other to hybridize under selected reaction conditions, such as stringent hybridization conditions. The relationship between sufficient complementarity of nucleic acids and stringency of hybridization to achieve specificity is well known in the art. Two substantially complementary strands may include, for example, one to many mismatches, so long as they are completely complementary or, for example, sufficiently to allow for differences between paired and unpaired sequences. Can be. Thus, a "substantially complementary" sequence can mean a sequence having up to 99, 95, 90, 80, 75, 70, 60, 50%, or any percent base pair complementarity between the numbers in the double stranded region. .

The term “substantially complementary sequence” means a sequence that can hybridize with a polynucleotide that is a template under stringent conditions known in the art. The term “stringent conditions” refers to Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic acid hybridization, A Practical Approach , IRL Press, Washington, DC (1985), stringent conditions can be determined by controlling temperature, ionic strength (buffer concentration) and the presence of compounds such as organic solvents, and the like, depending on the sequence being hybridized. For example, stringent conditions may be a) washed with a temperature of 50 ° C. and 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate, or b) hybridization buffer (50% formamide, 2). x SSC and 10% dextran sulfate), followed by washing at 55 ° C. with EDTA-containing 0.1 × SSC.

The term “primer” refers to a single strand of single strand that can act as a starting point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers at suitable temperatures. Means oligonucleotides.

Suitable lengths of primers are typically 15-35 nucleotides, depending on various factors, such as temperature and the use of the primer. Short primers may generally require lower temperatures to form a hybridization complex that is sufficiently stable with the template. The terms "forward primer" and "reverse primer" refer to primers that bind to the 3 'end and the 5' end, respectively, of a predetermined portion of the template to be amplified by the polymerase chain reaction.

The sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template to perform the primer-specific function. Therefore, the primer set according to one embodiment does not need to have a sequence that is perfectly complementary to the nucleotide sequence that is a template, and it is interpreted that it is sufficient to have sufficient complementarity within a range capable of hybridizing to the sequence and acting as a primer.

Primers according to one embodiment are hybridized or annealed to one site of the template to form a double chain structure. Conditions for nucleic acid hybridization suitable for forming such double chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al. Hybridization, A Practical Approach , IRL Press, Washington, DC (1985).

HBV is a DNA virus with a coat belonging to Hepadnaviridae, which is known as a pathogen that infects liver cells to induce inflammation and cause liver damage. The HBV is serologically divided into 8 subtypes according to the surface antigen (HBsAg) of the virus, the HBV is, for example, HBV A type, HBV B type, HBV C type, HBV D type, HBV E type, HBV F type, HBV G type and HBV H type.

According to one embodiment, HBV specific primers commonly recognized for various HBV types to detect HBV were prepared by adjusting the size of the amplification products to 50 to 200 bp to be suitable for real-time PCR reactions.

In the primer set and probe for detecting HBV according to one embodiment, the probe may be labeled by different detectable means. The detectable means means compounds, biomolecules or biomolecular analogs, etc., which can be linked, coupled, or attached to a probe to determine density, concentration, amount, etc. in a conventional manner. For example, a fluorescent labeling factor, a luminescent material, a bioluminescent material, an isotope, etc. which are commonly used, but are not limited thereto. According to one embodiment, the 5 'end of the probe is one fluorescent labeling factor selected from the group consisting of FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and NED Is labeled with 6-TAMRA, BHQ-1,2,3, Iowa Black RQ-Sp and MGBNFQ (molecular grove binding non-fluorescence quencher), one fluorescence inhibitor selected from the group (Quencher) It may be labeled with. The fluorescent labeling factors are currently commercially available in large numbers and are readily available commercially. The fluorescent labeling factor has different excitation and emission wavelengths depending on the type, and the method of use is also different. Fluorescent labeling factors can be labeled on the probes according to conventional methods known in the art. Cataclyphic probe according to an embodiment is a PCR by modifying the 5 'end with a fluorescent labeling factor (for example, Texas Red 615, etc.) the 3' end with a fluorescent inhibitor (for example, Iowa Black RQ-Sp, etc.) It can be added to the reaction solution. The fluorescence generation process of the catalytic probe is as described above.

According to one embodiment, the probe may be a Kata cleaves probes (probe Catacleave ^TM). Cataclyb probe technology differs from TaqMan ^™ in that cleavage of the probe is accomplished by a second enzyme, RNase H, which does not have DNA polymerase activity. Catalytic probes have a base sequence, ie, a cleavage site, within the probe molecule that is the target of an endonuclease such as, for example, a restriction enzyme or an RNase. According to one embodiment, the cataclyb probe has a chimeric structure consisting of DNA at the 5 'and 3' ends of the probe and a cleavage site made of RNA. The DNA sequence portion of the probe may be labeled terminally or internally with a FRET pair. In a real-time PCR reaction involving a cataclybine probe, the PCR reactant may comprise an RNase H enzyme that specifically cuts the RNA sequence portion of the RNA-DNA duplex. When the RNA sequence portion in the probe is cleaved by the enzyme, two half probes (ie, donor and acceptor) are separated from the target amplicon at the reaction temperature and diffuse into the reaction buffer. Once the donor and acceptor are separated, Fluorescence Resonance Energy Transfer (FRET) can be reversed and donor divergence monitored in the same way as a TaqMan ^™ probe. The cleavage and separation will regenerate the position on the amplicon for the binding of additional catacleb probes. In this way, multiple probe cleavages are possible until one amplicon acts as a target or the primer extends through the binding site of the catacleb probe. On the other hand, for a detailed description of the cataclibe probe Anal. Biochem. 333: 246-255, 2004 and US Pat. No. 6,787,304, which is incorporated herein by reference.

The term “oligonucleotide” may in some cases be mixed with “primer” or “polynucleotide”.

Oligonucleotides can be synthesized and prepared by appropriate methods (such as chemical synthesis), according to methods known in the art. Oligonucleotides can also be purchased commercially.

The terms "annealing" and "hybridization" can be used interchangeably, where one nucleic acid and another nucleic acid cause the formation of duplexes, triplexes, or other high-dimensional structures by base pairing interactions. I mean. In one embodiment, the primary interaction is base specific by Watson / Crick and Hoogsteen-type hydrogen bonding, such as, for example, A / T and G / C. In one embodiment, base-stacking and hydrophobic interactions can also contribute to duplex stability.

Those skilled in the art will be able to design the desired PCR primers from the HBV genomic sequence. Synthesized oligos can generally be 22 to 36 bp in length, depending on the melting temperature (Tm) value near 55 ° C.

The term “lable” or “detectable label” may refer to any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, which binding may be covalent or non-covalent. Can be. Preferably, the label is detectable and may be the nucleotide or nucleotide polymer detectable to the experimenter of the present invention. Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants. Detectable labels also include any useful linker molecule (e.g., biotin, avidin, strapavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni ²⁺ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors / acceptors, acridinium esters, dyes and calorimetric substrates It includes. In addition, detectable labels may be considered in indicating a change in mass, such as in the case of surface plasmon resonance detection. Those skilled in the art will readily be able to recognize useful detectable labels not mentioned above, and these may also be used in the practice of the present invention.

The DNA polymerase may be, for example, a heat stable DNA polymerase obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus (Pfu). In addition, RNase H includes, but is not limited to, thermally stable RNase H enzymes such as, for example, Pyrococcus furiosus RNase H II, Pyrococcus horikoshi RNase H II, Thermococcus litoralis RNase HI or Thermus thermophilus RNase HI. Buffer solutions are compounds that are added to amplification reactions that modify the stability, activity, and / or lifetime of one or more components of the amplification reaction by adjusting the pH of the amplification reaction, and such buffer solutions are well known in the art, For example, it may be, but is not limited to, Tris, Tricine, MOPS, or HEPES. In addition, the kit may comprise a dNTP mixture (dATP, dCTP, dGTP, dTTP) and a DNA polymerase cofactor. The primer set and probe may be packaged in one reaction vessel, strip or microplate, and may be packaged by methods known in the art.

Another aspect includes separating total DNA from a subject sample; Performing real-time PCR by mixing the separated total DNA and the kit; And it provides a method for detecting the HBV comprising the step of confirming the presence of HBV from the real-time PCR results.

The method of detecting the HBV will be described in detail for each step as follows. First, the method may include separating total DNA from a sample of interest. The detection method according to one embodiment may be applied to a sample that is expected to be infected with HBV. The sample includes, but is not limited to, bodily fluids such as cultured cells, animal or human liver cells, blood, plasma, serum, semen, saliva or mucus. Isolation of the DNA can be made through various methods known in the art. Specific methods for this are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001), which is incorporated herein by reference.

Next, mixing the separated total DNA and the kit may include performing a real-time PCR.

According to one embodiment, the HBV detection kit can be carried out using conventional real-time PCR methods and apparatus. The real-time PCR method is a method of detecting and quantitating fluorescence appearing in real time every cycle of PCR by the principle of DNA polymerase and FRET using a device in which a thermal cycler and a spectral fluorescent photometer are integrated. This method distinguishes specific amplification products from non-specific amplification products and makes it easy to obtain analysis results in an automated fashion. Devices that can be used in the real-time PCR method include, but are not limited to, AB real-time PCR devices 7900, 7500, 7300, Stratagene Mx3000p, BioRad Chromo 4 and Roche Lightcycler 480 devices. In the PCR process, the laser of the real-time PCR device may implement a peak as shown in FIG. 1 by detecting a fluorescent labeling factor labeled on a probe of the amplified PCR product.

In the method of detecting HBV according to one embodiment, the real-time PCR reaction can be carried out under conventional conditions known in the art, for example, after initial denaturation at 95 ° C. for 10 minutes, Denaturation (10 seconds at 95 ° C.), annealing and reaction of RNase HII (10 seconds at 55 ° C.) and elongation (elongation (30 seconds at 72 ° C.)) can be carried out under 60 conditions. HBV which can be detected by the said method is as above-mentioned.

Finally, it may include the step of confirming the presence of HBV from the real-time PCR results.

The presence or absence of the HBV can be confirmed by calculating the C _t value, which is the number of cycles when the PCR amplification product is amplified by a certain amount from the curve displayed by detecting the fluorescent labeling factor labeled on the probe of the PCR product amplified in the real-time PCR process. . The C _t value may, for example, be determined to be present in the HBV virus when it is 15 to 50, or 20 to 45. Meanwhile, the calculation of the C _t value may be automatically performed by a program included in the real time PCR device.

According to the kit for detecting the HBV and the method for detecting the HBV using the kit, it is possible to quickly check the detection result in real time with only a small number of target samples.

The disclosed embodiments have many advantages, including the ability to detect HBV nucleic acid sequences in a sample in real time. The detection method is fast, accurate and suitable for high efficiency.

Amplification

When the nucleic acid is separated from the sample and the primer is selected, nucleic acid amplification is performed by polymerase chain reaction (PCR) or Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence It can be performed by a variety of methods including amplification reactions such as based amplification (NASBA), cleavage fragment length polymorphism, isothermal and chimeric primer-initiated amplification of nucleic acid, ramification-extension amplification method or other suitable nucleic acid amplification method.

"Polymerase chain reaction" or "PCR" generally means a method for amplifying in vitro a desired nucleotide sequence. The process is described in detail in US Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188, the contents of which are incorporated herein in their entirety. In general, the PCR process consists of placing an oligonucleotide primer complementary to the opposite strand of the double stranded target sequence in excess of two molar concentrations into a reaction mixture comprising the desired target sequence (s). The reaction mixture is subjected to a thermal cycling program in the presence of DNA polymerase, to amplify the desired target sequence between the DNA primer sets.

One of the most widely used techniques for studying gene expression is the use of first-stranded cDNA as a template for mRNA sequence (s) for amplification by PCR. Often interpreted as PCR or reverse transcriptase-PCR, the method takes advantage of the high sensitivity and specificity of the PCR process and is widely used for the detection and quantification of RNA.

The reverse transcriptase-PCR process, performed as an end-point or real time assay, involves two steps of separate molecular synthesis: (i) synthesis of cDNA from an RNA template; And (ii) replication of the newly synthesized cDNA via PCR amplification. In an attempt to address technical issues often associated with reverse transcriptase-PCR, a number of protocols have been developed, taking into account the three basic steps of the process: (a) denaturation of RNA and hybridization of reverse primers; (b) synthesis of cDNA; And (c) PCR amplification. In the so-called "uncoupled" reverse transcriptase-PCR process (e.g., two step reverse transcriptase-PCR) reverse transcription is an independent step using optimal buffer conditions for reverse transcriptase activity. Is performed. Following cDNA synthesis, the reaction was diluted with diminished MgCl ₂ and deoxyribonucleoside triphosphate (dNTP) concentrations to conditions optimal for Taq DNA polymerase activity, and then PCR was subjected to standard conditions (US Pat. 4,683,202). In contrast, the "coupled" reverse transcriptase PCR method uses a common buffer for reverse transcriptase and Taq DNA polymerase activity. In the first version, the annealing of the reverse primer is a separate step before the addition of the enzyme and then added to a single reaction vessel. In another version, reverse transcriptase activity is a component of thermostable Tth DNA polymerase. Annealing and cDNA synthesis are performed in the presence of Mn ²⁺ , and then PCR is performed in the presence of Mg ²⁺ after Mn ²⁺ is removed by chelating reagent. Finally, the “continuous” method (eg, one step reverse transcriptase-PCR) allows the reverse transcriptase-PCR 3 step to prevent opening of the reaction tube for addition of components or enzymes. Integrate into one continuous reaction. Continuous reverse transcriptase-PCR is described as a single enzyme system using the thermostable Taq DNA polymerase and Tth polymerase's reverse transcriptase activity and a two enzyme system using AMV reverse transcriptase and Taq DNA polymerase with a starting temperature of 65 ° C. do. The RNA denaturation step is omitted.

Reverse transcription, the first step in real time, uses one of the template specific DNA primers to generate complementary DNA strands. In traditional PCR reactions this product is denatured and the second template specific primer is expanded to bind the cDNA to form duplex DNA. This product is amplified in the next step of temperature cycling. In order to maintain the highest sensitivity, it is important that the RNA is not degraded prior to the synthesis of cDNA. Since RNA: DNA hybrids can be the substrate of RNase H, the presence of RNase H in the reaction buffer will result in unwanted degradation of the RNA: DNA hybrid formed in the first step of the process. There are two main ways to overcome this problem. One is to physically separate RNase H from the rest of the reverse transcription reaction by using a wax-like membrane that can melt during the high temperatures of the beginning of the DNA denaturation step. The second method is to modify RNase H to inactivate at reverse transcription temperature which is generally 45-55 ° C. Several methods are known in the art, including reacting RNase H with an antibody or including reversible chemical modifications. For example, hot start RNase H is disclosed.

Additional examples of RNAse H enzymes and hot start RNAse H enzymes that can be used in the present invention are disclosed in US Patent Application 2009/0325169 to Walder et al.

One step reverse transcriptase-PCR offers several advantages over unlinked reverse transcriptase-PCR. One step reverse transcriptase-PCR is the handling of reaction mixture reagents and nucleic acid products compared to unlinked reverse transcriptase-PCR (e.g., opening a reaction tube for the addition of components or enzymes between two reactions). Are less demanding, thus less labor intensity and less time required. One step reverse transcriptase-PCR also requires less sample and can reduce the risk of contamination. The sensitivity and specificity of one-step reverse transcriptase-PCR has proven to be suitable for studying the expression level of one or several genes in the detection of a given sample or pathogenic RNA. In general, this process limits the use of gene-specific primers to initiate cDNA synthesis.

The ability to measure the kinetics of PCR reactions by real-time detection in combination with these reverse transcriptase-PCR techniques allows for accurate and precise determination of RNA copy numbers with high sensitivity. This was followed by fluorescence monitoring of the PCR product during the amplification process by a fluorescent double-labeled hybridization probe technique, such as the 5 'fluorescence generating nuclease assay (Taq-Man) or the endonuclease assay (CataCleave), which will be described below. This is possible by detecting reverse transcriptase-PCR products through measurement.

Real time methods were developed to monitor amplification during the PCR process. These methods generally use a fluorescently labeled probe that binds to newly synthesized DNA or a die that increases in fluorescence emission when intercalated to two strands of DNA.

Real-Time PCR of HBV Target Nucleic Acid Sequences Using CataCleave Probes

The probe is generally designed such that in the absence of a target, donor emission can be extinguished by fluorescence resonance energy transfer (FRET) between two chromophores. A donor chromophore delivers energy to an acceptor chromophore in an excited state when the pair of chromophores is located at close range. This transfer always occurs non-radially, through dipole-dipole coupling. Any process that sufficiently increases the distance between chromophores reduces the FRET efficiency, allowing radioactive detection of donor chromophore release. Common receptor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, Texas Red and the like. Receptor chromophores are chosen such that the emission spectra of the donor and the excitation spectra can overlap. For example, this binding pair is FAM-TAMRA. There may also be nonfluorescent receptors that quench a wide range of donors. Other examples of suitable donor-receptor FRET pairs are well known to those skilled in the art.

Common examples of FRET probes that can be used for real-time detection of PCR include molecular beacons (eg US Pat. No. 5,925,517), Taq-Man probes (eg US Pat. Nos. 5,210,015 and No. 5). 5,487,972), and CataCleave probes (eg, US Pat. No. 5,763,181). Molecular beacons are single-stranded oligonucleotides, in which the probe is designed to form a secondary structure that is close to the donor and acceptor chromophores, thereby reducing donor release. At the appropriate reaction temperature, the beacons are unstructured and in particular bind to amplicons. Once unwound, the distance between the donor and acceptor chromophores increases, resulting in a change in FRET and the ability to monitor donor release using a special instrument. Taq-Man and CataCleave techniques differ from molecular beacons in that the FRET probes used are cleaved, leaving the donor and acceptor chromophores sufficiently low to alter the FRET.

The Taq-Man technique utilizes single stranded oligonucleotide probes labeled with a donor chromophore at the 5 'end and labeled with a receptor chromophore at the 3' end. The DNA polymerase used for amplification must have 5 '-> 3' exonuclease activity. Taq-Man probes bind to one strand of the amplicon as the primers bind. While the DNA polymerase stretches the primers, the polymerase will eventually encounter the bound Taq-Man probe. At this time, the exonuclease activity of the polymerase will sequentially degrade the Taq-Man probe starting at the 5 'end. As the probe is degraded, the mononucleotide containing the probe comes out of the reaction buffer. As the donor diffuses from the receptor, the FRET changes. Release from the donor is monitored to confirm probe cleavage. Because of the action of Taq-Man, a particular amplicon can only be detected once per cycle of PCR. Extension of the primer through the Taq-Man target site produces a double stranded product and prevents further binding of the Taq-Man probe until the amplicon is denatured in the next PCR cycle.

The content of US Pat. No. 5,763,181, incorporated herein by reference, discloses another real-time detection method (named CataCleave). The CataCleave technique differs from Taq-Man in that the cleavage of the probe is performed by a secondary enzyme without polymerase activity. CataCleave probes have a sequence in the target molecule of an endonuclease such as, for example, a restriction enzyme or an RNase. In one embodiment, the CataCleave probe has a chimeric structure, wherein the 5 'and 3' ends of the probe are made of DNA and the cleavage site is made of RNA. The DNA sequence portion of the probe is labeled with a FRET pair at or inside the sock end. The PCR reaction includes an RNase H enzyme that can specifically cleave the RNA sequence portion of the RNA-DNA double strand. After cleavage, both halves of the probe dissociate in the target amplicon at the reaction temperature and disperse into the reaction solution. As donor and receptor are separated, FRET is changed in the same way as Taq-Man probe, and donor release can be monitored. Cleavage and dissociation will reproduce sites for further CataCleave binding. In this way, a single amplicon can be repeated multiple times as a target or probe cleavage until the primer is stretched through the CataCleave probe binding site.

Labeling of HBV-specific CataCleave Probes

The term “probe” includes polynucleotides comprising specific moieties designed to hybridize in a sequence-specific manner having complementary regions of specific nucleic acid sequences, such as, for example, target nucleic acid sequences. In one embodiment, the oligonucleotide probe ranges from 15 to 60 nucleotides. More preferably, the oligonucleotide probe ranges from 18 to 45 nucleotides. The exact sequence and length of the oligonucleotide probes of the present invention will depend in part on the nature of the target polynucleotide to which the probe binds. Bonding locations and lengths may vary to achieve the desired annealing and denaturation properties in certain embodiments. Guidance for selecting such designs can be found in the literature, which discloses a Taq-man assay or CataCleave, US Pat. Nos. 5,763,181, 6,787,304, and 7,112,422, which are incorporated herein by reference in their entirety. do.

As used herein, the term "label" or "detectable lebel" shall mean any label of a CataCleave probe comprising a fluorescent dye compound bound to the probe by covalent or non-covalent bonds. Can be.

As used herein, the term "fluorochrome" refers to a fluorescent compound that emits light that is excited by light of shorter wavelengths than emitted light. The term "fluorescent donor or or fluorescence donor" means a fluorescent dye that emits light as measured in the assays disclosed herein. More specifically, the fluorescent donor provides light absorbed by the fluorescent acceptor. The term “fluorescent acceptor or fluorescence acceptor” refers to a second fluorescent dye or quenching molecule that absorbs energy emitted from a fluorescent donor. The second fluorescent dye absorbs energy emitted from the fluorescent donor and emits light of a longer wavelength than the light emitted by the fluorescent donor. The quenching molecule absorbs the energy released by the fluorescent donor.

Any luminescent molecule, preferably a fluorescent dye and / or fluorescent quencher, can be used in the practice of the present invention. The light emitting molecule is, for example, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-diethylaminocowmarin-3-carboxylic acid, fluorescein, Oregon Green 488, Oregon Green 514, tetramethyltamine, rhodamine X, Texas red dye, QSY 7, QSY33, Dabcyl, BODIPY FL , BODIPY 630/650, BODIPY 6501665, BODIPY TMR-X, BODIPY TR-X, Dialkylaminocoumarin, Cy5.5, Cy5, Cy3.5, Cy3, DTPA (Eu3 +)-AMCA and TTHA (Eu3⁺AMCA includes, but is not limited to:

In one embodiment, the 3 'terminal nucleotide of the oligonucleotide probe is blocked or prevented from expanding by nucleic acid polymerase. Such blocking can be conveniently performed by attaching a reporter or quencher molecule to the terminal 3 'region of the probe.

In one embodiment, the reporter molecule is a fluorescent organic dye derived for attachment at the end of the 3 'end or 5' end of the probe via a linking moiety. Preferably, the quencher molecule is an organic dye, which may or may not be fluorescent according to embodiments of the invention. For example, in a preferred embodiment of the invention, the quencher molecule is non-fluorescent. In general, if the quencher molecule is fluorescence or simply emits energy delivered from the reporter by non-radioactive degradation, the absorption band of the quencher will substantially overlap with the absorption band of the fluorescence emission of the reporter molecule. In this specification, non-fluorescent quencher molecules that are absorbed from the excited reporter molecules but do not release radioactive energy are to be interpreted as chromogenic molecules.

The reporter-quencher pair may be selected from xanthene dyes, including, for example, fluorescein and rhodamine dyes. Various suitable forms of these compounds are widely available commercially, having substituents on phenyl moieties that can be used as binding sites for binding oligonucleotides or as binding functionality. Another group of fluorescent compounds are naphthylamines having amino groups in the alpha or beta position. The naphthylamino compounds include compounds such as 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touridinyl-6-naphthalene sulfonate. Other dyes include acridine such as 3-phenyl-7-isocyanatocomarin, 9-isothiocyanatoacridine and acridine orange; N- (p- (2-benzooxazolyl) phenyl) maleimide; Benzoxadiazole, stilbene, pyrene and the like.

In one embodiment, the reporter and quencher molecule are selected from fluorescein and non-fluorescent quencher dyes.

Various linking moieties and methodologies for attaching reporter or quencher molecules to the 5 'or 3' end of an oligonucleotide are illustrated in the following references: Eckstein, editor, Oligonucleotide and Analogues: A Practical Approach (IRL Press) , Oxford, 1991); Zuckerman et al., Nucleic Acid Research, 15: 5305-5321 (1987) (3 'thiol group on oligonucleotide); Sharma et al., Nucleic Acid Research, 19: 3019 (1991) (3 'sulfhydryl); Giusti et al., PCR Method and Applications, 2: 223-227 (1993) and Fung et al., US Pat. No. 4,757,141 (5 'phosphoamino group via Aminolink. II available from Applied Biosystems, Foster City, Calif.) Stabinsky , US Pat. No. 4,739,044 (3 'aminoalkylphosphoryl group); Agrawal et al., Tetrahedron Letters, 31: 1543-1546 (1990) (attachment via phosphoramidate linkages); Sproat et al., Nucleic Acid Research, 15: 4837 (1987) (5 'mercapto group); Nelson et al., Nucleic Acid Research, 17: 7187-7194 (1989) (3 'amino group) and the like.

Rhodamine and non-fluorescent quencher dyes may also be conveniently attached to the 3 'end of the oligonucleotide at the beginning of solid phase synthesis, see, for example, Woo et al., US Pat. No. 5,231,191; And Hobbs, Jr., US Pat. No. 4,997,928.

Attachment of HBV-specific CataCleave Probe to Solid Support

In one embodiment of the invention, the oligonucleotide probe can be attached to a solid support. Different probes can be attached to a solid support and used to detect different target sequences in a sample simultaneously. Reporter molecules with different fluorescence wavelengths can be used for different probes, thus allowing hybridization to different probes to be detected separately.

Examples of preferred forms of solid support for immobilization of oligonucleotide probes include polystyrene, avidin coated polystyrene bead cellulose, nylon, acrylamide gels and activated dextran, controlled pore glass (CPG), glass plates and Highly cross-linked polystyrene. Such solid supports are preferred in hybridization and diagnostic studies because of their chemical stability, ease of functionalization and well-defined surface area. Solid supports, such as controlled pore glass (500 mm 3, 1000 mm 3) and non-expanded high cross-linked polystyrene (1000 mm 3), are particularly preferred because of their compatibility with oligonucleotide synthesis.

Oligonucleotide probes can be attached to the solid support in a variety of ways. For example, the probe can be attached to the solid support by attaching a 3 'or 5' terminal nucleotide of the probe to the solid support. However, the probe may be attached to the solid support by a linker that distances the probe from the solid support. The linker is most preferably at least 30 atoms long, more preferably at least 50 atoms long.

Hybridization of probes immobilized on a solid support generally requires the probe to be separated from the solid support by at least 30 atoms, more preferably at least 50 atoms. To achieve this separation, the linker generally comprises a spacer located between the linker and the 3 ′ nucleoside. For oligonucleotide synthesis, the linker arm is usually cleaved with basic reagents and attached to the 3'-OH of the 3 'nucleoside by ester linkages that can free the oligonucleotide from the solid support.

Various kinds of linkers are known in the art that can be used to attach oligonucleotide probes to a solid support. The linker may be formed of any compound that does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support. The linker may be formed of homopolymer oligonucleotides that can be easily added to the linker by automated synthesis. Alternatively, polymers such as functionalized polyethylene glycols can be used as the linker. Such polymers are preferred over homopolymer oligonucleotides because they do not significantly interfere with the hybridization of the probe to the target oligonucleotide. Polyethylene glycol is particularly preferred because it is commercially available, soluble in both organic and aqueous media, convenient to functionalize, and completely stable under oligonucleotide synthesis and post-synthesis conditions.

The bond between the solid support, the linker and the probe is preferably not cleaved during the removal of the base protecting group under base conditions at high temperature. Examples of preferred bonds include carbamate and amide bonds. Immobilization of probes is well known in the art and one skilled in the art can determine immobilization conditions.

According to one embodiment of the method, the hybridization probe is immobilized on a solid support. Oligonucleotide probes are contacted with a sample of nucleic acid under conditions favorable for hybridization. In the nonhybridized state, the fluorescent label is suppressed by the quencher. Upon hybridization with the target, the fluorescent label separates from the quencher and fluoresces.

Immobilization of hybridization probes to a solid support also allows for easy separation of the target sequence hybridized to the probe from the sample. In subsequent steps, the isolated target sequence can be separated from the solid support and processed (eg, purified, amplified) by methods well known in the art, depending on the particular needs of the investigator.

Real time detection of HBV target nucleic acid sequences using CataCleave probes.

The labeled oligonucleotide probe may be HBV in a sample. It can be used as a probe for real time detection of target nucleic acid sequences.

CataCleave oligonucleotide probes are first synthesized with DNA and RNA sequences complementary to those found in PCR amplicons containing the selected HBV target sequences. In one embodiment, the probe is labeled with a FRET pair, eg, one end of the probe is a fluorescein molecule and the other end is a non-fluorescent quencher molecule. Thus, when the probe is hybridized with a PCR amplicon, an RNA: DNA heteroduplex form is formed that can be cleaved by RNase H activity.

RNase H hydrolyzes RNA in RNA-DNA hybrids. The enzyme was first identified in bovine mammary glands but has since been found in a variety of organisms. RNase H activity is ubiquitous in eukaryotes and bacteria. Although RNase H consists of a protein family of various molecular weights and nuclear lytic activity, substrate requirements appear similar between the various isotypes. For example, most of the RNase Hs studied so far function as endonucleases and produce divalent cations (eg, Mg ²⁺ , to produce cleavage products having 5 'phosphate and 3' hydroxyl ends). Mn ²⁺ ).

RNase HI from E. coli is the best known of the RNase H family. In addition to RNase HI, a second E. coli RNase H, RNase HII was cloned and characterized (Itaya, M., Proc. Natl. Acad. Sci. USA, 1990, 87, 8587-8591). RNase HI consists of 155 amino acids, compared to 213 amino acids. E. coli RNase HII shows only 17% homology with E. coli RNase HI. RNase H cloned from S. typhimurium differs from E. coli RNase HI in only 11 positions and consists of 155 amino acids (Itaya, M. and Kondo K., nucleic acids Res., 1991, 19, 4443 -4449).

Proteins exhibiting RNase H activity were cloned and purified from several viruses, other bacteria and yeasts (Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many cases, proteins with RNase H activity appear as fusion proteins in which RNase H is fused to the amino or carboxy terminus of another enzyme, usually a DNA or RNA polymerase. The RNase H domain has been consistently found to be highly homologous to E. coli RNase HI, but the other domains are substantially diverse, resulting in very high molecular weight and other properties of the fusion protein.

Two classes of RNase H in higher eukaryotes have been defined based on differences in molecular weight, the effects of divalent cations, sensitivity to sulfhydryl reagents and immunological cross-reactivity (Busen et al., Eur J. Biochem., 1977, 74, 203-208). RNase HI enzymes have a molecular weight in the range of 68-90 kDa, have been reported to be activated by Mn ²⁺ or Mg ²⁺ and are insensitive to sulfhydryl reagents. In contrast, RNase H II enzymes have a molecular weight in the range of 31-45 kDa, require Mg ²⁺ , show high sensitivity to sulfhydryl reagents, and have been reported to be inhibited by Mn ²⁺ (Busen, W. , and Hausen, P., Eur. J. Biochem., 1975, 52, 179-190; Kane, CM, Biochemistry, 1988, 27, 3187-3196; Busen, W., J. Biol. Chem., 1982, 257, 7106-7108.).

Enzymes with RNase HII properties were purified almost homogeneously from the human placenta (Frank et al., Nucleic acids Res., 1994, 22, 5247-5254). This protein has a molecular weight of about 33 kDa, is activated in a pH range of 6.5-10 and is reported to have an optimal pH of 8.5-9. The enzyme requires Mg ²⁺ and has been reported to be inhibited by Mn ²⁺ and n-ethyl maleimide. The product of the cleavage reaction has 3 'hydroxyl and 5' phosphate ends.

According to one embodiment, real time nucleic acid amplification is performed on the target polynucleotide in the presence of thermostable nucleic acid polymerase, RNase H activity, a pair of PCR amplification primers that can hybridize to the HBV target polynucleotide, and a labeled CataCleave oligonucleotide probe. . During the real-time PCR reaction, cleavage of the probe by RNase H separates the fluorescent donor from the fluorescent quencher such that the fluorescence of the probe increases in real time following the real-time detection of the HBV target DNA sequence in the sample.

In one embodiment, real time nucleic acid amplification enables real time detection of a single target DNA molecule in up to about 45 PCR amplification cycles.

Example of real-time detection of HBV gene sequence in a sample

First, the method includes the step of separating total DNA from a subject sample. The detection method according to one embodiment may be applied to a sample that is expected to be infected with HBV. The sample includes, but is not limited to, bodily fluids such as cultured cells, animal or human liver cells, blood, plasma, serum, semen, saliva or mucus. Isolation of the DNA can be made through various methods known in the art. Specific methods for this are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001), which is incorporated herein by reference.

Next, the method includes mixing the separated total DNA and related reaction components to perform real time PCR.

According to one embodiment, a device for performing temperature cycling and real-time detection of the resultant amplified product is commercially available. Devices that can be used in the real-time PCR method include, but are not limited to, Applied Biosystems Incorporated's real-time PCR devices 7900, 7500, 7300, Stratagene's Mx3000p, BioRad's Chromo 4 and Roche Lightcycler 480 devices. During the real-time PCR, these instruments monitor the change in emission intensity from the detectable label and convert the information into graphical and / or numerical information that can be analyzed to determine whether the target template is present in the test sample.

In the method of detecting HBV according to one embodiment, the real-time PCR reaction can be carried out under conventional conditions known in the art, for example, after initial denaturation at 95 ° C. for 10 minutes, Denaturation (10 seconds at 95 ° C.), annealing and reaction of RNase HII (10 seconds at 55 ° C.) and elongation (elongation (30 seconds at 72 ° C.)) can be carried out under 60 conditions. HBV which can be detected by the said method is as above-mentioned.

Finally, it may include the step of confirming the presence of HBV from the real-time PCR results.

The presence or absence of the HBV can be confirmed by calculating the C _t value, which is the number of cycles when the PCR amplification product is amplified by a certain amount from the curve displayed by detecting the fluorescent labeling factor labeled on the probe of the PCR product amplified in the real-time PCR process. . The C _t value may, for example, be determined to be present in the HBV virus when it is 15 to 50, or 20 to 45. Meanwhile, the calculation of the C _t value may be automatically performed by a program included in the real time PCR device.

The enzyme "Hot Start" RNase HII used in the Examples below is a reversibly modified RNase HII. When the modified enzyme is used in the reaction with Tris based buffer and the temperature is raised to 95 ° C., the pH of the solution drops and RNase H activity is restored. This method allows for the inclusion of RNase H in the reaction mixture prior to the start of reverse transcription. RNase HII and details thereof are disclosed in US Provisional Application No. 61 / 347,984, filed May 25, 2010, which is incorporated herein by reference in its entirety.

Table 1 shows the sequences of the pris and probes.

Table 2 shows the Ct values (the number of cycles when PCR amplification products were amplified a certain amount) based on the amplification curve of FIG. 1.

Table 3 shows the Ct values (number of cycles when the PCR amplification product was amplified by a certain amount) based on the amplification curve of FIG. 2.

According to the HBV detection method according to one embodiment, the detection result can be quickly confirmed in real time even with only a small number of target samples.

1 is a CataCleave ^™ (closed circle, solid line) obtained by real-time PCR using primer set HBV-F5e (SEQ ID NO: 1) / HBV-R9 (SEQ ID NO: 4) for HBV genotype A (subtype ADW2) species And amplification curves of SYBR Green I (open circle, dotted line).

FIG. 2 shows CataCleave ^™ (closed circle, solid line) obtained by real-time PCR using primer set HBV-F5d (SEQ ID NO: 2) / HBV-R5b (SEQ ID NO: 3) for HBV genotype A (subtype ADW2) species And amplification curves of SYBR Green I (open circle, dotted line).

Hereinafter, one or more embodiments will be described in more detail with reference to Examples. However, these examples are provided to illustrate one or more embodiments illustratively and the scope of the present invention is not limited to these examples.

Example 1: Preparation of primers and probes for real-time detection of HBV

Primers used for the real-time detection of HBV are obtained after obtaining the nucleotide sequence of the surface antigen gene region on the genome of HBV genotype A (subtype ADW2) species (GenBank accession number: AM282986.1, GI: 109637932), Primer sets available for real-time PCR were selected through the Beacon Designer Software (Premier Biosoft International) program. The base sequence of the selected primers was again analyzed by BLAST to confirm that the primer base sequence was capable of amplifying only a part of the surface antigen gene of HBV genotype A (subtype ADW2).

The probe was prepared by the catacleb probe (CataCleave ^TM probe) that can specifically bind to the template target of the PCR to detect the amount of the PCR product to increase in real time in real time PCR. Since the amount of the PCR product is confirmed by the fluorescence generated from the probe during the PCR process, the probe has a higher sensitivity than the gel electrophoresis method for identifying the conventional PCR product. The probe was selected in the nucleotide sequence of the surface antigen gene of HBV, a template amplified by the primer set, by the same method as the preparation of the primer, labeled 5 'end with Texas 615, Iowa Black RQ-Sp 3 'end was labeled. The determined primers and probes were synthesized by commissioning Integrated DNA Technologies.

On the other hand, the base sequences of the primers and probes used in this experiment are shown in Table 1.

Table 1

Sequence number	Primer / Probe Name	Sequence (5'-3 ')
One	HBV-F5e	CTCGTGTTACAGGCGGGGTTTTTCTTGTTGAC
2	HBV-F5d	CTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAA
3	HBV-R5b	AACGCCGCAGACACATCCAGCGA
4	HBV-R9	AAGAAGATGAGGCATAGCAGCAGGATGAAGAGGAA
5	HBV-P1	TEX615 / TGGCCAAAATTCrGrCrArGTCCCCAACCTCCAAT / IAbRQSp
6	HBV-P2	TEX615 / AAACGCCGrCrArGrACACATCCAGCGA / IAbRQSp
7	HBV-FX	CTCGTGTTACAGGCGGGGTTTTTCTTGTTGACX 1 X 2

In Table 1 above, SEQ ID NO: 5 and SEQ ID NO: 6 indicate that they have detectable labels at the 5 'and 3' ends, respectively, and the lowercase "r" means RNA base (ie rG is riboguanosine). , TEX615 represents Texas Red 615, and IAbRQSp represents Iowa Black ^TM RQ-Sp for short wavelength emission. Further, in SEQ ID NO: 7, X ₁ is absent or A and X ₂ is absent or A.

Example 2 Detection of HBV Using Real-Time PCR

Total DNA of HBV for use as a template in a real time PCR reaction was extracted according to methods known in the art. All real-time PCR reactions in this example were performed by mixing 15 μl and 10 μl DNA of the master mix (total reaction volume 25 μl). 1260 μl of the master mix contained 210 μl of buffer (32 mM HEPES ((4- (2-hydroxyethyl) -1- (piperazinethanesulfonic acid) -KOH, pH 7.8, 100 mM potassium acetate, 4 mM magnesium acetate, 0.11% bovine serum albumin, 1% dimethylsulfoxide), 6.3 μl of 100 μM forward primer (SEQ ID NO: 1 or SEQ ID NO: 2), 6.3 μl of 100 μM reverse primer (SEQ ID NO: 3 or SEQ ID NO: 4), 100 μM 4.2 μl of cataclybine probe (SEQ ID NO: 5 or SEQ ID NO: 6), 84 μl of dNTP mix (10 mM dGTP, dCTP, dATP, dTTP), 42 μl Platinum Taq DNA Polymerase (Invitrogen), 42 μl Pfu RNase HII ( Invitrogen) and 865.2 μl of distilled water.

The reactants are ① denatured at 95 ° C. for 10 seconds, ② annealing of primers and cataclibe probes at 55 ° C. for 10 seconds, and reaction of RNase HII and ③ elongation reactions at 72 ° C. for 30 seconds for 60 times. Repeatedly performed the real time PCR reaction. PCR amplification was observed in real time using LightCycler 480 Software v1.5.0.

Example 3: Detection experiment of HBV SE365

For HBV genotype A (subtype ADW2) species, a forward primer of HBV-F5e (SEQ ID NO: 1), a reverse primer set of HBV-R9 (SEQ ID NO: 4), and a catacleb probe (HBV-P2 (SEQ ID NO: 6)) Real time PCR was performed. Experiments using the primer set and SYBR green were compared. 1 is a result showing an amplification curve by the real-time PCR reaction. In addition, Table 2 below shows the results obtained by calculating the C _t value (the number of cycles when a certain amount of PCR amplification products is amplified) from the amplification curve of FIG. 1. The initial copy number of the template in this experiment was 5,000,000. The following results show that when a real-time PCR reaction was performed using the primer set and the cataclybe probe, only five copies could be amplified. As a result of amplification using SYBR green in a comparative experiment, at least 50 copies were required to obtain the same Ct value. On the other hand, no fluorescence was detected in the negative control group in which distilled water was added instead of the RNA template.

TABLE 2

Number of copies of the template	SYBR	HBV-F5e / HBV-R9HBV-P2
Distilled water	N	N
5	46.51	39.59
50	37.00	39.76
500	34.49	35.55
5,000	29.15	31.12
50,000	25.62	27.53
500,000	22.43	24.46
5,000,000	18.32	20.43

Example 4: Detection experiment of HBV SE365 using real time PCR

For the HBV genotype A (subtype ADW2) species, a forward primer of HBV-F5d (SEQ ID NO: 2), a reverse primer set of HBV-R5b (SEQ ID NO: 3), and a catalytic probe (HBV-P1 (SEQ ID NO: 5)) Real time PCR was performed. Experiments using the primer set and SYBR green were compared. Figure 2 is a result showing the amplification curve by the real-time PCR reaction. In addition, Table 3 below shows the C from the amplification curve of FIG._tThe value (the number of cycles when the PCR amplification product was amplified by a certain amount) is calculated and shown. The initial copy number of the template in this experiment was 10,000,000. The following results show that when performing a real-time PCR reaction using the primer set and the cataclybe probe, only 10 copies can be amplified. In the present example, the Ct value of the degree when detected in 500 copies of the HBV template using the primer and probe set of Example 3 was It appeared at 10 or 100 copies. On the other hand, no fluorescence was detected in the negative control group in which distilled water was added instead of the RNA template.

TABLE 3

Number of copies of the template	SYBR	HBV-F5d / HBV-R5bHBV-P1
Distilled water	N	N
10	37.94	37.55
100	35.53	35.09
1,000	30.84	30.63
10,000	27.59	27.10
100,000	24.00	23.56
1,000,000	20.55	20.10
10,000,000	17.05	16.69

By using the primer set and the cataclibe probe from the results of Examples 1 to 4, HBV can be efficiently detected even with a smaller amount of samples compared to the conventional method, and it takes time and effort to detect HBV from the sample. You can see the savings.

Claims (20)

1. A first primer having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; And a second primer having a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 5.
2. The kit of claim 1, wherein the kit further comprises a probe having a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6.
3. The kit of claim 2, wherein the kit further comprises amplification polymerase activity and RNase H activity.
4. The kit of claim 1, wherein the kit further comprises reverse transcriptase activity.
5. The fluorescent labeling agent of claim 2, wherein the 5 'end of the probe is selected from the group consisting of FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and NED. Is labeled with 6-TAMRA, BHQ-1,2,3, Iowa Black RQ-Sp and MGBNFQ (molecular grove binding non-fluorescence quencher), one fluorescence inhibitor selected from the group (Quencher) Kit labeled.
6. The kit of claim 1, wherein the kit comprises a mixture comprising dATP, dCTP, dGTP and dTTP; DNA polymerase; RNase H II; And a buffer solution.
7. The kit of claim 1, wherein the kit further comprises uracil-N-glycosylase.
8. The kit of claim 3, wherein the RNase H activity is thermostable RNase H activity or hot start RNase H activity.
9. a) HBV by reacting a target nucleic acid with a first primer oligonucleotide, a second primer oligonucleotide, and a first probe oligonucleotide in the presence of polymerase activity, cleaving agent, and deoxynucleoside triphosphate Amplifying a target nucleic acid of said first primer oligonucleotide and said second oligonucleotide may anneal with said target nucleic acid, said first probe oligonucleotide having a DNA sequence and an RNA sequence in a molecule, said first detectable label Wherein the DNA and RNA sequences of the probe oligonucleotide are substantially complementary to the target nucleic acid, wherein the RNA sequence of the first probe oligonucleotide may be cleaved by the cleavage reagent and cleavage of the RNA sequence within the probe To emit a detectable signal from the label. Wherein the amplification is performed under conditions such that an RNA sequence in the probe oligonucleotide forms an RNA: DNA heteroduplex with a complementary sequence in the target nucleic acid; And

   b) detecting an increase in the signal emitted from the first label on the first probe oligonucleotide, wherein the increase in the signal indicates the presence of HBV in the sample. .
10. 10. The method of claim 9, wherein the target nucleic acid is cDNA of HBV RNA.
11. a) providing a sample to confirm the presence of HBV;

    b) extracting RNA of the HBV;

    c) contacting said RNA with reverse transcriptase activity in the presence of nucleotides to produce cDNA complementary to said RNA;

    d) reacting the cDNA with a first primer oligonucleotide, a second primer oligonucleotide, and a first probe oligonucleotide in the presence of polymerase activity, cleaving agent, and deoxynucleoside triphosphate. amplifying the cDNA, wherein the first primer oligonucleotide and the second oligonucleotide can anneal with the cDNA, the first probe oligonucleotide having a DNA sequence and an RNA sequence in a molecule and comprising a first detectable label Wherein the DNA and RNA sequences of the probe oligonucleotides are substantially complementary to the cDNA, the RNA sequence of the first probe oligonucleotide can be cleaved by the cleavage reagent, and cleavage of the RNA sequence within the probe is performed on the label. Emit a detectable signal from the amplification The step is performed under conditions to form a hetero-duplex DNA;: the RNA sequence within the probe oligonucleotide sequence complementary to the RNA in the cDNA And

    e) detecting an increase in the signal emitted from the first label on the first probe oligonucleotide, wherein the increase in the signal indicates the presence of HBV in the sample.
12. The method of claim 11, wherein steps c) and d) are performed simultaneously or sequentially.
13. 12. The second probe oligo of claim 11, wherein the reaction mixture of step d) has a DNA sequence and an RNA sequence in a molecule and comprises a second detectable label, wherein the DNA and RNA sequence is substantially complementary to the cDNA. Further comprising a nucleotide, wherein the second probe oligonucleotide has a different nucleotide sequence from the first probe oligonucleotide, and the RNA sequence of the second probe oligonucleotide may be cleaved by the cleavage reagent; The increase in signal emitted from the second label on the second probe oligonucleotide in step e) indicates the presence of HBV in the sample.
14. The method of claim 9 or 11, wherein the method further comprises the following steps:

    Determining the number of critical amplification cycles when the emission intensity of the signal from the first and second labels reaches a fixed threshold above the baseline value; And

    Calculating the amount of HBV in the sample by comparing the number of critical amplification cycles determined for the HBV in the sample with the number of reference critical amplification cycles determined for the known amount of HBV.
15. 12. The group of claim 9 or 11, wherein said cleavage reagent consists of RNase H, Kamchatka crab duplex specific nuclease, endonucleases, and nicking endonucleases. Which is selected from.
16. The method of claim 9 or 11, wherein the first probe oligonucleotide and the second probe oligonucleotide are bound to each other by an oligonucleotide linker, wherein the oligonucleotide linker can be cleaved by an enzyme.
17. 12. The method of claim 9 or 11, wherein the first primer comprises an oligonucleotide of SEQ ID NO: 7.
18. 12. The method of claim 9 or 11, wherein the first primer is an oligonucleotide of SEQ ID NO: 1 or SEQ ID NO: 2.
19. 12. The method of claim 9 or 11, wherein the second primer is an oligonucleotide of SEQ ID NO: 3 or SEQ ID NO: 4.
20. The method of claim 9 or 11, wherein the probe is an oligonucleotide of SEQ ID NO: 5 or SEQ ID NO: 6. 13.

Images