WO2013081201A1 - Kit for detecting hiv-1 and method for detecting hiv-1 - Google Patents

Abstract

Disclosed is a kit for detecting HIV-1 from a test sample. Also disclosed is a method for detecting in real-time HIV-1 from a test sample by using the kit. According to the method for detecting, the detection result can be rapidly confirmed in real-time even from a test sample having a low number of copies.

Description

Kit for detecting HIV-1 and method for detecting HIV-1 using same

The present invention discloses a kit for detecting HIV-1 and a method for detecting HIV-1 using the same. Also disclosed are oligonucleotides suitable for use in the method.

Human Immunodeficiency virus type-1 (HIV-1) is an infectious factor of AIDS, one of the most important diseases to date, with more than 33 million people worldwide. About 7,000 people are newly infected with HIV every day, and about 6,000 people die from AIDS and related diseases. Since the HIV virus, an AIDS causative agent, was isolated in the early 1980s, many researchers around the world have tried to overcome AIDS, but no effective preventive and therapeutic vaccines have been developed.

There are two types of HIV, HIV-1 and HIV-2. Both types of HIV are transmitted through sexual contact, through blood, or through maternal infection, resulting in clinically indistinguishable AIDS. However, HIV-2 is somewhat contagious and the duration between initial infection and onset is longer in HIV-2.

Worldwide, the prevalent virus is HIV-1. Relatively rare HIV-2 viruses are concentrated in West Africa and are rarely found elsewhere. HIV-1 species can be classified into four groups: group M, which is "major", group O, which is "outlier", and groups N and P, which are two new groups. These four groups represent four isolated species in which apes immunodeficiency virus has been introduced into humans.

Group O appears to be limited to Central-West Africa, and group N, found in Cameroon in 1998, is very rare. In 2009, a new species was found in a Cameroonian woman closely related to the gorilla apes immunodeficiency virus. This was named group P. More than 90% of HIV-1 infections belong to group M. Within group M there are at least nine genetically different subtypes (or clades) of HIV-1. These subtypes are subtypes A, B, C, D, F, G, H, J and K.

In the late 1990s, various kinds of diagnostic kits have been researched and developed. The representative diagnostic methods are immunological methods using antibodies that can recognize specific proteins of viruses. These methods are less sensitive compared to nucleic acid test assays. Methods for detecting HIV-1 have also been developed for culturing cells and using nucleic acid probes. These methods require very high expertise and take a long time. To overcome this limitation, various diagnostic assay research techniques using PCR have been performed. In these methods, specific portions of nucleic acids are exponentially amplified in an appropriate reaction mixture comprising at least DNA polymerase and template specific primers.

Therefore, there is a need for developing a method for detecting HIV-1 contaminated samples quickly and accurately.

According to an exemplary embodiment, a method for real time detection of HIV-1 in a sample is provided.

In one embodiment, there is provided a sample to be tested for the presence of HIV-1, extracting RNA from the sample; DNA and RNA nucleic acid sequences substantially complementary to the RNA, uracil-n-glycosylase, DNA polymerase, reverse transcriptase, appropriate deoxynucleoside triphosphate, HIV-1 target DNA Generating an amplification medium by mixing a nucleic acid binding probe comprising a detectable label with a reaction buffer, an upstream primer and a downstream primer; Thermally cycling the amplification medium between a denaturation temperature and an elongation temperature, wherein the combination of upstream and downstream primers amplifies the target nucleic acid or a section thereof; Wherein the nucleic acid sequence in the probe is unique to the HIV-1 genome under conditions such that the DNA sequence can form an RNA: DNA heteroduplex with the complementary DNA sequence in the PCR fragment of the HIV-1 target DNA. ), Which may have any length; Generating a reaction mixture of a plurality of nucleic acid probes each comprising a target nucleic acid sequence and a detectable label, wherein a first nucleic acid probe of the plurality of nucleic acid probes comprising a first detectable label is the target nucleic acid or Being capable of hybridizing to some; Using a second nucleic acid probe from the plurality of nucleic acid probes in the reaction mixture, wherein a plurality of activated detectable labels are generated; And detecting a real-time increase in signal release from the label of the probe, wherein the increase in the signal indicates the presence of an HIV-1 target DNA in the sample. do.

In one aspect, the real-time increase in signal release from the label on the probe is due to RNase H cleavage of the heteroduplex formed between the base probe and one of the PCR fragment strands.

In another embodiment, the method can be used to determine the amount of HIV-1 RNA in a sample.

The method includes determining a threshold cycle number at which the intensity of the plurality of activated detectable labels reaches a predetermined threshold value that is above a baseline value; And calculating the amount of HIV-1 RNA in the sample by comparing the threshold cycle number determined for the target nucleic acid in the sample with the threshold cycle number determined for a known amount of target nucleic acid in the standard solution.

According to an exemplary embodiment, there is provided a kit for detecting HIV-1 comprising a first primer, a second primer, and a probe, capable of sensitive and accurate detection of HIV-1.

According to one embodiment, the kit for real-time detection of HIV-1, having a first primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 Is provided.

According to one embodiment, selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19 There is provided a kit for real-time detection of HIV-1 having a second primer.

According to one embodiment, there is provided a kit for real-time detection of HIV-1 having a probe selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25.

In one embodiment, the kit may comprise a first primer selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 8.

In one embodiment, the kit may comprise a second primer having a nucleotide sequence of SEQ ID NO.

In one embodiment, the kit may comprise a probe having the nucleotide sequences of SEQ ID NO: 20 and SEQ ID NO: 21.

In one embodiment, the first primer oligonucleotide is X ₁ is C or G, X ₂ is C or T, X ₃ is G or T, X ₄ is A or G, and X ₅ is A or G X ₆ is A or G or T, X ₇ is T or C, X ₈ is T or C, X ₉ is T or C, and X ₁₀ is T or C,

X ₁ AGX ₂ AX ₃ TX ₄ CAX ₅ ATGGCAGTX ₆ X ₇ TX ₈ ATX ₉ CAX ₁₀ AATT (SEQ ID NO: 26).

In one embodiment, the first primer oligonucleotide is X ₁ is A or G, X ₂ is C or T, X ₃ is C or A, X ₄ is C or T, and X ₅ is A or G And X ₆ is A or G, SEQ ID NO: 27

CAGGAX ₁ TTX ₂ GGGATACCX ₃ TACAATCCTCAAAGTCAGGGAGX ₄ × ₅ GTAGAX ₆ TCCATGAAT (SEQ ID NO: 27).

In one embodiment, the first primer oligonucleotide is X ₁ is A or G or C or T, X ₂ is A or G, X ₃ is G or C or T, X ₄ is A or G, X ₅ is A or G or C, X ₆ is T or A, X ₇ is A or G, X ₈ is T or G, X ₉ is G or A or C, X ₁₀ is C or T X ₁₁ is A or T, X ₁₂ is G or C or C, X ₁₃ is G or A, X ₁₄ is A or G or T or C, X ₁₅ is T or C or G, X ₁₆ is T or C, and X ₁₇ is A or C, SEQ ID NO: 28

CCX ₁ X ₂ X ₃ X ₄ GX ₅ X ₆ X ₇ GX ₈ GX ₉ X ₁₀ X ₁₁ TAX ₁₂ CAGGX ₁₃ X ₁₄ X ₁₅ X ₁₆ X ₁₇ oligonucleotides having the sequence of CTA (SEQ ID NO: 28).

In one embodiment, the first primer oligonucleotide is X ₁ is A or T, X ₂ is G or A, X ₃ is C or A or G, X ₄ is T or C or A, X ₅ Is A or T or G, X ₆ is G or A, X ₇ is A or G, X ₈ is C or T, X ₉ is T or G or A, X ₁₀ is A or G, X ₁₁ is T or A, X ₁₂ is T or C, X ₁₃ is T or C, X ₁₄ is T or C, X ₁₅ is T or C, X ₁₆ is T or C, X ₁₇ Is T or A, X ₁₈ is T or G, X ₁₉ is A or G, and X ₂₀ is T or C, SEQ ID NO: 29:

Oligo having a sequence of CX ₁ X ₂ X ₃ X ₄ X ₅ GX ₆ X ₇ X ₈ X ₉ X ₁₀ X ₁₁ ACAX ₁₂ X ₁₃ CX ₁₄ X ₁₅ ACTATX ₁₆ X ₁₇ X ₁₈ X ₁₉ TX ₂₀ (SEQ ID NO: 29) Nucleotides.

In one embodiment, the first primer oligonucleotide is X ₁ is C or T, X ₂ is T or C, X ₃ is C or T, X ₄ is A or G, and X ₅ is T or C X ₆ is T or C, X ₇ is A or T, X ₈ is A or T, X ₉ is G or A, X ₁₀ is A or G, X ₁₁ is T or C, X ₁₂ is A or G, X ₁₃ is A or T or G, X ₁₄ is T or G, and X ₁₅ is T or C or G, SEQ ID NO: 30:

TX ₁ TX ₂ TGX ₃ TX ₄ TCX ₅ CX ₇ GX ₈ AAX ₉ AX ₁₀ X ₁₁ CCX ₁₂ GX ₁₃ AAATX ₁₄ X ₁₅ (SEQ ID NO: 30).

In one embodiment, the first primer oligonucleotide is X ₁ is G or A, X ₂ is T or C, X ₃ is C or T, X ₄ is A or G, and X ₅ is A or G , X ₆ is T or C or G, X ₇ is A or T or C or G, X ₈ is A or G, X ₉ is C or T, X ₁₀ is C or T, X ₁₁ Is C or T, X ₁₂ is C or A, X ₁₃ is C or T, X ₁₄ is T or A, X ₁₅ is T or A, X ₁₆ is A or G, and X ₁₇ is SEQ ID NO: 31 which is A or G:

X ₁ X ₂ CCTTX ₃ CCAX ₄ X ₅ X ₆ X ₇ GGX ₈ TX ₉ TX ₁₀ TGX ₁₁ TX ₁₂ TCX ₁₃ CTGX ₁₄ AAX ₁₅ AX ₁₆ X ₁₇ (SEQ ID NO: 31).

The probe may be coupled with a detectable label, as described above, either at its 3'-end and 5'-end or at both ends.

In one embodiment, a kit is provided comprising a first primer and a second primer, as described above. The kit further comprises a probe as described above. Such kits are suitable and useful for the accurate, sensitive and rapid detection of HIV-1 in a sample.

The kit may further comprise a cleaving agent capable of cleaving reverse transcriptase activity, polymerase activity and the internal site of the probe oligonucleotide. Cleavage agents can be selected from the group consisting of RNase H, Kamchatka crab duplex specific nuclease, endonucleases, and nicking endonucleases.

According to one embodiment, the method comprises dATP, dCTP, dGTP, dTTP, and dUTP; DNA polymerase; RNase H II; It may further comprise a mixture comprising uracil-N-glycosylase, and a buffer solution.

The experiments of the embodiments disclosed herein used conventional molecular biological techniques known in the art, unless otherwise indicated. Such techniques are well known to those skilled in the art and are fully described in the literature. See, for example, Ausubel, et al., Ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008) and Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989).

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The specification also provides definitions of terms to aid in the interpretation of the description and the claims. As a result, if a definition does not match another definition, the definition will be defined as described herein.

"Target DNA" or "target RNA" or "target nucleic acid" or "target nucleic acid sequence" means a nucleic acid that is targeted by DNA amplification. The target nucleic acid sequence serves as a template for amplification in a PCR reaction or reverse transcription-PCR reaction. Target nucleic acid sequences include natural and synthetic molecules. The target nucleic acid can be, for example, but not limited to genomic DNA or genomic RNA.

The term "polynucleotide" is a double stranded DNA or cDNA, or a single stranded DNA or RNA and includes nucleotide analogues unless otherwise noted.

The term “probe” refers to a linear oligomer with natural or modified monomers or bonds, including deoxyribonucleotides and / or ribonucleotides that can hybridize to a specific polynucleotide sequence. In addition, the probe can be labeled with a detectable label that modifies the signal in the presence of an amplicon either through direct hybridization or through hybridization combined with an enzyme mediated process. The probe may be single or double stranded.

The probe according to one embodiment may be a sequence that is perfectly complementary to the polynucleotide sequence that is a template, but may be a sequence that is substantially complementary to the extent that it does not prevent specific hybridization. Conditions suitable for hybridization are as described above.

As used herein, the term "substantially complementary" means that two nucleic acid strands that are sufficiently complementary in a sequence anneal and form a stable duplex. The complementarity need not be complete; For example, there may be several mismatches of base pairs between two nucleic acids. However, if the number of mismatches is so large that hybridization does not occur even under minimal stringent hybridization conditions, the sequence is not a substantially complementary sequence. When two sequences are to be interpreted herein as "substantially complementary" it is meant that the sequences are sufficiently complementary to allow each other to hybridize under selected reaction conditions, such as stringent hybridization conditions. The relationship between sufficient complementarity of nucleic acids and stringency of hybridization to achieve specificity is well known in the art. Two substantially complementary strands may include, for example, one to many mismatches, so long as they are completely complementary or, for example, sufficiently to allow for differences between paired and unpaired sequences. Can be. Thus, a "substantially complementary" sequence may mean a sequence having up to 100, 95, 90, 80, 75, 70, 60, 50%, or any percent base pair complementarity between the numbers in the double stranded region. .

The term “substantially complementary sequence” means a sequence that can hybridize with a polynucleotide that is a template under stringent conditions known in the art. The term “stringent conditions” refers to Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic acid hybridization, A Practical Approach , IRL Press, Washington, DC (1985), stringent conditions can be determined by controlling temperature, ionic strength (buffer concentration) and the presence of compounds such as organic solvents, and the like, depending on the sequence being hybridized. It may be determined differently.

The term “primer” refers to a single stranded oligonucleotide that can act as an initiation point for template-directed DNA synthesis under suitable conditions (ie nucleoside triphosphate and polymerase) at a suitable temperature in suitable buffer. do.

Suitable lengths of primers are typically 15-35 nucleotides, depending on various factors, such as temperature and the use of the primer. Short primers may generally require lower temperatures to form a hybridization complex that is sufficiently stable with the template. The term “oligonucleotide” may in some cases be mixed with “primer” or “polynucleotide”. The terms "forward primer" and "reverse primer" refer to primers that bind to the 3 'end and the 5' end, respectively, of a predetermined portion of the template to be amplified by the polymerase chain reaction.

The sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template to perform the primer-specific function. Thus, a primer set according to one embodiment does not need to have a sequence that is perfectly complementary to the nucleotide sequence that is a template. The primer may be designed based on the nucleotide sequence of the template, for example, may use a computer program such as Primer Express (Applied Biosystems, Inc.).

Primers according to one embodiment are hybridized or annealed to one site of the template to form a double chain structure. Conditions for nucleic acid hybridization suitable for forming such double chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al. Hybridization, A Practical Approach , IRL Press, Washington, DC (1985).

According to one embodiment, HIV-1 specific primers that are commonly recognized for various HIV-1 genus virus types to detect HIV-1 genus viruses are 10-35 bp in length and are suitable for real-time PCR reactions. It was prepared by adjusting the size of the amplification product to 50 to 300 bp.

In one embodiment, a probe set and a probe for detecting a virus of genus HIV-1 may be labeled by different detectable means. The detectable means means compounds, biomolecules or biomolecular analogs, etc., which can be linked, coupled, or attached to a probe to determine the density, concentration, amount, etc. in a conventional manner. For example, a fluorescent labeling factor, a luminescent material, a bioluminescent material, an isotope, etc. which are commonly used, but are not limited thereto. According to one embodiment, the 5 'end of the probe is labeled with one fluorescent labeling factor selected from the group consisting of FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670 and NED The 3 'end may be labeled with one fluorescent inhibitor (Quencher) selected from the group consisting of 6-TAMRA, BHQ-1,2,3 and MGBNFQ (molecular grove binding non-fluorescence quencher). The fluorescent labeling factor has different excitation and emission wavelengths depending on the type, and the method of use is also different. Fluorescent labeling factors can be labeled on the probes according to conventional methods known in the art. Cataclyphic probe according to one embodiment may be added to the PCR reaction solution by modifying the 5 'end with a fluorescent labeling factor (eg, FAM) and the 3' end with a fluorescent inhibitor (eg, TAMRA). The fluorescence emission of the catalytic probe was described above.

According to one embodiment, the probe may be subjected to internal nucleic acid enzymatic processing such as release from a detectable label that is increased in the presence of an amplicon. One embodiment of the probe is a CataCleave ^™ probe. The catalytic probe is Anal. Biochem. 333: 246-255, 2004 and US Pat. No. 6,787,304, which is incorporated herein by reference.

According to one embodiment, the catacril probe is a single stranded polynucleotide having an enzyme mediated cleavage site targeted by an endonuclease, such as a restriction enzyme or RNase H.

According to one embodiment, the probe has a chimeric structure of a cleavage site, wherein the 5 'and 3' ends comprise DNA and RNA. The DNA sequence portion of the probe is labeled at the end or inside with a FRET pair. Emission from the donor is quenched by FRET in an unprocessed state. In a real time PCR assay comprising the probe, the reaction comprises an RNase H enzyme that specifically cleaves the RNA sequence of the probe when hybridized to a DNA template. Hybridization generally occurs at temperatures similar to those used in TaqMan reactions. When the RNA sequence portion of the probe is cleaved by the enzyme, two portions of the probe, donor and acceptor, are separated from the target amplicon at the reaction temperature and diffuse into the reaction buffer. If the distance between the donor and the acceptor is increased, causing the reversal of the FRET, the emission of the donor in proportion to the number of amplicons can be increased and monitored in real time. Cleavage and dissociation regenerate the sites on the amplicon to which the cataclyphic probe can bind. In this way, a single amplicon can serve as a plurality of targets for probe cleavage until the primer is extended through the cataclib binding site.

According to one embodiment, a method of detecting HIV-1 of groups M, O, and N in a sample is provided. Representative clinical isolates include HIV-1 I-2496, HIV-1 BK132, HIV-1 DJ259, HIV-1 SE365, HIV-1 UG274, HIV-1 42368, HIV-1 BZ126, HIV-1 BZ162, It may be selected from the group consisting of HIV-1 POC44951, HIV-1 HH8793, HIV-1 BCF-KITA, HIV-1 I-2481, HIV-1 BCF06, and HIV-1 BCF11, but is not limited thereto.

Oligonucleotides can be synthesized and prepared by appropriate methods (such as chemical synthesis), according to methods known in the art. Oligonucleotides can also be purchased commercially.

The terms "annealing" and "hybridization" can be used interchangeably, where one nucleic acid and another nucleic acid cause the formation of duplexes, triplexes, or other high-dimensional structures by base pairing interactions. I mean. In one embodiment, the primary interaction is base specific by Watson / Crick and Hoogsteen-type hydrogen bonding, such as, for example, A / T and G / C. In one embodiment, base-stacking and hydrophobic interactions can also contribute to duplex stability.

Those skilled in the art will be able to design the desired PCR primers from the HIV-1 genomic sequence. Synthesized oligos can generally be 20 to 26 bp in length, depending on the melting temperature (Tm) value near 55 ° C.

The term “lable” or “detectable label” may refer to any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, which binding may be covalent or non-covalent. Can be. Preferably, the label is detectable and may be the nucleotide or nucleotide polymer detectable to the experimenter of the present invention. Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants. Detectable labels also include any useful linker molecule (e.g., biotin, avidin, strapavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni ²⁺ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors / acceptors, acridinium esters, dyes and calorimetric substrates It includes. In addition, detectable labels may be considered in indicating a change in mass, such as in the case of surface plasmon resonance detection. Those skilled in the art will readily be able to recognize useful detectable labels not mentioned above, and these may also be used in the practice of the present invention.

Uracil-N-glycosylase can be obtained from the cold-cooled deep sea bacteria BMTU 3346, Psychrobacter species HJ147, or Bacillus species HJ141, as long as they maintain the activity of uracil-N-glycosylase. Obtained from mutants.

The DNA polymerase can be obtained from Thermus aquaticis, Thermococcus litoralis, Pyrococcus furiosis, Thermus flavus, Thermus thermophilis, Pyrococcus woesei, Thermus ubiquitous, Thermus litoralis, Thermotoga maritime, or Thermus filiformis, and maintain the activity of the DNA polymerase. Obtained from mutants.

The reverse transcriptases can be obtained from Avian Myeloblastosis Virus or Moloney Murine Leukemia Virus, and from their mutants as long as they maintain the activity of the reverse transcriptase enzyme.

The cleaving agents include RNase H, Kamchatka crab duplex specific nuclease, endonucleases, and nicking endonucleases, exonuclease and nuclease activity. It may be selected from the group consisting of enzymes including.

The deoxynucleoside triphosphate mixture may comprise deoxythymidine triphosphate in addition to or in place of deoxyuridine triphosphate.

Enzyme mediated cleavable sequences are one or more RNAs and DNAs.

The cleavage site may be present at a position capable of exhibiting the activity of a detectable label upon cleavage of the probe.

The plurality of nucleic acid probes may further comprise a first probe site and a second probe site that are linked by an enzyme mediated cleavage sequence.

The first probe site may be one or more RNAs and DNAs, and the second probe site may be one or more RNAs and DNAs.

The detectable label is a 5 'end of the first probe site, a 3' end of the first probe site, a 5 'end of the second probe site, a 3' end of the second probe site, a first probe site or a second probe site. At least one may be coupled to the 5 'terminus of the enzyme-mediated cleavage sequence, to the 5' terminus of the enzyme-mediated cleavage sequence, and to the interior of the enzyme mediated cleavage sequence.

The detectable label can be selected from the group consisting of fluorescent molecules, radioisotopes, enzymes, or chemiluminescent catalysts.

The detectable label includes one or more internally labeled FORSTER resonance energy transfer (FRET) pairs, an externally labeled FRET pair, and a FRET bound to the 3 ′ end of the first probe site and the 5 ′ end of the second probe site. May be a pair.

One embodiment provides a kit comprising a forward primer and a reverse primer, disclosed above. The kit may further comprise the probe described above. The kit is suitable and useful for the detection of accurate, rapid, high sensitivity of the target HIV-1 gene in a sample.

The kit may further comprise a cleaving agent capable of cleaving reverse transcriptase activity, polymerase activity and the internal site of the probe oligonucleotide. The cleavage agent may be selected from the group consisting of RNase H, Kamchatka crab duplex specific nuclease, endonucleases, and nicking endonucleases. The kit may further comprise uracil-N-glycosylase as described above.

According to one embodiment, the probe may be a hybridization probe such as a molecular beacon.

According to one embodiment, the molecular beacon is a single stranded polynucleotide labeled with donor and acceptor labels forming a FRET pair. One embodiment of the FRET pairs is FAM and TAMRA. In the unhybridized state, molecular beacons form a secondary structure in which the donor and quencher moiety form a sufficient FRET and are positioned such that the donor's emission signal is low. The probe is designed to unfold the probe in the presence of an amplicon and to hybridize to the target. Increasing the separation distance between the donor and the quencher causes a reversal of the FRET, and the release of the donor proportional to the number of amplicons can be monitored in real time.

According to another embodiment, the probe may be subjected to exonucleolytic enzymatic processing such that release from the detectable label is increased in the presence of an amplicon. One embodiment of such a probe is a TaqMan probe.

According to one embodiment, the TaqMan probe is a linear polynucleotide labeled with a fluorescent donor at the 5 'end and a quencher molecule at the 3' end. Release from the donor is quenched by FRET in an unprocessed state. In a typical PCR reaction cycle, the temperature initially increases, causing denaturation of the template and amplicons. The temperature is then reduced to allow for specific hybridization to the template of primers and TaqMan probes. DNA polymerase extends bidirectional primers to synthesize additional amplicons. During extension, the polymerase meets the 5 'end of the probe and the 5'-> 3 'exonuclease activity of the polymerase causes the probe to begin to degrade from the 5' end to form a single nucleotide. do. This enzymatic progression activity releases the fluorescent donor into the reaction solution. If the distance between the donor and the acceptor is increased, causing the reversal of the FRET, the emission of the donor in proportion to the number of amplicons can be increased and monitored in real time.

According to another embodiment, separating total RNA from a sample; Mixing the isolated RNA and related reaction components to perform real time PCR; And it provides a detection method of HIV-1 comprising the step of confirming the presence of HIV-1 based on the results of the real-time PCR.

The disclosed embodiments have many advantages, such as being able to detect HIV-1 nucleic acid sequences in a sample in real time. The detection method can be applied quickly, accurately and with high efficiency.

Amplification

When RNA is isolated from a sample and a primer is selected, nucleic acid amplification is achieved by polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA), ligase chain reaction (LCR), and rolling circle amplification (RCA) (US Pat. No. 5,871,921). ), Cleavage Fragment Length Polymorphism (US Pat. No. 5,719,028), Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acid (ICAN), Ramification-extension Amplification Method (US Pat. No. 5,719,028 and US Pat. No. 5,942,391) or other suitable It can be carried out by various methods including amplification method of DNA. The polymerase chain reaction is the most commonly used method for amplifying specific target DNA sequences.

"Polymerase chain reaction" or "PCR" generally means a method for amplifying in vitro a desired nucleotide sequence. The process is described in detail in US Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188, the contents of which are incorporated herein in their entirety. In general, the PCR process consists of placing an oligonucleotide primer complementary to the opposite strand of the double stranded target sequence in excess of two molar concentrations into a reaction mixture comprising the desired target sequence (s). The reaction mixture is subjected to a thermal cycling program in the presence of DNA polymerase to amplify the desired target sequence between the DNA primer sets.

The DNA polymerase is, for example, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus litoralis, Pyrococcus woesei, Thermus ubiquitous, Thermus litoralis, Thermotoga maritime, Thermus filicusis or Piorocfu Thermally stable DNA polymerase obtained from. In addition, RNase H includes, but is not limited to, thermally stable RNase H enzymes such as, for example, Pyrococcus furiosus RNase H II, Pyrococcus horikoshi RNase H II, Thermococcus litoralis RNase HI or Thermus thermophilus RNase HI. Buffer solutions are compounds that are added to amplification reactions that modify the stability, activity, and / or lifetime of one or more components of the amplification reaction by adjusting the pH of the amplification reaction, and such buffer solutions are well known in the art, For example, it may be, but is not limited to, Tris, Tricine, MOPS, or HEPES. The primer set and probe may be packaged in one reaction vessel, strip or microplate, and may be packaged by methods known in the art.

One of the most widely used techniques for studying gene expression is the use of first-stranded cDNA as a template for mRNA sequence (s) for amplification by PCR. Often interpreted as PCR or reverse transcriptase-PCR, the method takes advantage of the high sensitivity and specificity of the PCR process and is widely used for the detection and quantification of RNA.

The reverse transcriptase-PCR process, performed as an end-point or real time assay, involves two steps of separate molecular synthesis: (i) synthesis of cDNA from an RNA template; And (ii) replication of the newly synthesized cDNA via PCR amplification. In an attempt to address technical issues often associated with reverse transcriptase-PCR, a number of protocols have been developed, taking into account the three basic steps of the process: (a) denaturation of RNA and hybridization of reverse primers; (b) synthesis of cDNA; And (c) PCR amplification. In the so-called "uncoupled" reverse transcriptase-PCR process (e.g., two step reverse transcriptase-PCR) reverse transcription is performed as an independent step using optimal buffer conditions for reverse transcriptase activity. do. Following cDNA synthesis, the reaction was diluted with diminished MgCl ₂ and deoxyribonucleoside triphosphate (dNTP) concentrations to conditions optimal for Taq DNA polymerase activity, and then PCR was subjected to standard conditions (US Pat. 4,683,202). In contrast, the "coupled" reverse transcriptase PCR method uses a common buffer for reverse transcriptase and Taq DNA polymerase activity. In the first version, the annealing of the reverse primer is a separate step before the addition of the enzyme and then added to a single reaction vessel. In another version, reverse transcriptase activity is a component of thermostable Tth DNA polymerase. Annealing and cDNA synthesis are performed in the presence of Mn ²⁺ , and then PCR is performed in the presence of Mg ²⁺ after Mn ²⁺ is removed by chelating reagent. Finally, the “continuous” method (eg, one step reverse transcriptase-PCR) allows the reverse transcriptase-PCR 3 step to prevent opening of the reaction tube for addition of components or enzymes. Integrate into one continuous reaction. Continuous reverse transcriptase-PCR is described as a single enzyme system using the thermostable Taq DNA polymerase and Tth polymerase's reverse transcriptase activity and a two enzyme system using AMV reverse transcriptase and Taq DNA polymerase with a starting temperature of 65 ° C. do. The RNA denaturation step is omitted.

Reverse transcription, the first step in real time, uses one of the template specific DNA primers to generate complementary DNA strands. In traditional PCR reactions this product is denatured and the second template specific primer is expanded to bind the cDNA to form duplex DNA. This product is amplified in the next stage of temperature cycling. In order to maintain the highest sensitivity, it is important that the RNA is not degraded prior to the synthesis of cDNA. Since RNA: DNA hybrids can be the substrate of RNase H, the presence of RNase H in the reaction buffer will result in unwanted degradation of the RNA: DNA hybrid formed in the first step of the process. There are two main ways to overcome this problem. One is to physically separate RNase H from the rest of the reverse transcription reaction by using a wax-like membrane that can melt during the high temperatures of the beginning of the DNA denaturation step. The second method is to modify RNase H to inactivate at reverse transcription temperature which is generally 45-55 ° C. Several methods are known in the art, including reacting RNase H with an antibody or including reversible chemical modifications. The various RNases H used in the disclosed method will be described in detail later.

Examples of RNAse H enzymes that can be used in the present invention are disclosed in US Patent Application 2009/0325169 to Walder et al.

One step reverse transcriptase-PCR offers several advantages over unlinked reverse transcriptase-PCR. One step reverse transcriptase-PCR is the handling of reaction mixture reagents and nucleic acid products compared to unlinked reverse transcriptase-PCR (e.g., opening a reaction tube for the addition of components or enzymes between two reactions). Are less demanding, thus less labor intensity and less time required. One step reverse transcriptase-PCR also requires less sample and can reduce the risk of contamination. The sensitivity and specificity of one-step reverse transcriptase-PCR has proven to be suitable for studying the expression level of one or several genes in the detection of a given sample or pathogenic RNA. In general, this process limits the use of gene-specific primers to initiate cDNA synthesis.

The ability to measure the kinetics of PCR reactions by real-time detection in combination with these reverse transcriptase-PCR techniques allows for accurate and precise determination of RNA copy numbers with high sensitivity. This is accomplished during the amplification process by a fluorescent double-labeled hybridization probe technique, such as a 5 'fluorescence generating nuclease assay (eg TaqMan) or endonuclease assay (eg CataCleave), which will be described below. It is possible by detecting reverse transcriptase-PCR products through fluorescence monitoring and measurement of PCR products.

Real time methods were developed to monitor amplification during the PCR process. These methods generally use a fluorescently labeled probe that binds to newly synthesized DNA or a die that increases in fluorescence emission when intercalated to two strands of DNA.

Real-Time PCR of HIV-1 Target Nucleic Acid Sequences Using CataCleave Probes

The probe is generally designed such that in the absence of a target, donor emission can be extinguished by fluorescence resonance energy transfer (FRET) between two chromophores. A donor chromophore delivers energy to an acceptor chromophore in an excited state when the pair of chromophores is located at close range. This transfer always occurs non-radially, through dipole-dipole coupling. Any process that sufficiently increases the distance between chromophores reduces the FRET efficiency, allowing radioactive detection of donor chromophore release. Common receptor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, Texas Red and the like. Receptor chromophores are chosen such that the emission spectra of the donor and the excitation spectra can overlap. For example, this binding pair is FAM-TAMRA. There may also be nonfluorescent receptors that quench a wide range of donors. Other examples of suitable donor-receptor FRET pairs are well known to those skilled in the art.

Common examples of FRET probes that can be used for real-time detection of PCR include molecular beacons, TaqMan probes (eg, US Pat. Nos. 5,210,015 and 5,487,972), and CataCleave probes (eg, US Patent No. 5,763,181). Molecular beacons are single-stranded oligonucleotides, in which the probe is designed to form a secondary structure that is close to the donor and acceptor chromophores, thereby reducing donor release. At the appropriate reaction temperature, the beacons are unstructured and in particular bind to amplicons. Once unwound, the distance between the donor and acceptor chromophores increases, resulting in a change in FRET and the ability to monitor donor release using a special instrument. TaqMan and CataCleave techniques differ from molecular beacons in that the FRET probes used are cleaved, causing the donor and receptor chromophores to fall far enough to alter FRET.

The TaqMan technique utilizes a single stranded oligonucleotide probe labeled with a donor chromophore at the 5 'end and labeled with a receptor chromophore at the 3' end. The DNA polymerase used for amplification must have 5 '-> 3' exonuclease activity. TaqMan probes bind to one strand of the amplicon as the primers bind. While the DNA polymerase stretches the primer, the polymerase will eventually encounter the bound TaqMan probe. At this point, the exonuclease activity of the polymerase will degrade the TaqMan probe sequentially starting at the 5 'end. As the probe is degraded, the mononucleotide containing the probe comes out of the reaction buffer. As the donor diffuses from the receptor, the FRET changes. Release from the donor is monitored to confirm probe cleavage. Because of the action of TaqMan, a particular amplicon can only be detected once every cycle of PCR. Extension of the primer through the TaqMan target site produces a double stranded product and prevents further binding of the TaqMan probe until the amplicon is denatured in the next PCR cycle.

The content of US Pat. No. 5,763,181, incorporated herein by reference, discloses another real-time detection method (named CataCleave). The CataCleave technique differs from TaqMan in that cleavage of the probe is performed by secondary enzymes lacking polymerase activity. CataCleave probes have a sequence in the target molecule of an endonuclease such as, for example, a restriction enzyme or an RNase. In one embodiment, the CataCleave probe has a chimeric structure, wherein the 5 'and 3' ends of the probe are made of DNA and the cleavage site is made of RNA. The DNA sequence portion of the probe is labeled with a FRET pair at or inside the sock end. The PCR reaction includes an RNase H enzyme that can specifically cleave the RNA sequence portion of the RNA-DNA double strand. After cleavage, both halves of the probe dissociate in the target amplicon at the reaction temperature and disperse into the reaction solution. As donor and receptor are separated, FRET is changed in the same way as TaqMan probes, and donor release can be monitored. Cleavage and dissociation will reproduce sites for further CataCleave binding. In this way, a single amplicon can be repeated multiple times as a target or probe cleavage until the primer is stretched through the CataCleave probe binding site.

Labeling of HIV-1-specific CataCleave Probes

The term “probe” includes polynucleotides comprising specific moieties designed to hybridize in a sequence-specific manner having complementary regions of specific nucleic acid sequences, such as, for example, target nucleic acid sequences. In one embodiment, the oligonucleotide probe ranges from 15 to 60 nucleotides. More preferably, the oligonucleotide probe ranges from 18 to 45 nucleotides. The exact sequence and length of the oligonucleotide probes of the present invention will depend in part on the nature of the target polynucleotide to which the probe binds. Bonding locations and lengths may vary to achieve the desired annealing and denaturation properties in certain embodiments. Instructions for selecting such designs can be found in the literature, which discloses a TaqMan assay or CataCleave, US Pat. Nos. 5,763,181, 6,787,304, and 7,112,422, which are incorporated herein by reference in their entirety.

As used herein, the term "label" or "detectable lebel" shall mean any label of a CataCleave probe comprising a fluorescent dye compound bound to the probe by covalent or non-covalent bonds. Can be.

As used herein, the term "fluorochrome" refers to a fluorescent compound that emits light that is excited by light of shorter wavelengths than emitted light. The term "fluorescent donor or or fluorescence donor" means a fluorescent dye that emits light as measured in the assays disclosed herein. More specifically, the fluorescent donor provides light absorbed by the fluorescent acceptor. The term “fluorescent acceptor or fluorescence acceptor” refers to a second fluorescent dye or quenching molecule that absorbs energy emitted from a fluorescent donor. The second fluorescent dye absorbs energy emitted from the fluorescent donor and emits light of a longer wavelength than the light emitted by the fluorescent donor. The quenching molecule absorbs the energy released by the fluorescent donor.

Any luminescent molecule, preferably a fluorescent dye and / or fluorescent quencher, can be used in the practice of the present invention. The light emitting molecule is, for example, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-diethylaminocowmarin-3-carboxylic acid, fluorescein, Oregon Green 488, Oregon Green 514, tetramethyltamine, rhodamine X, Texas red dye, QSY 7, QSY33, Dabcyl, BODIPY FL , BODIPY 630/650, BODIPY 6501665, BODIPY TMR-X, BODIPY TR-X, Dialkylaminocoumarin, Cy5.5, Cy5, Cy3.5, Cy3, DTPA (Eu3 +)-AMCA and TTHA (Eu3⁺AMCA includes, but is not limited to:

In one embodiment, the 3 'terminal nucleotide of the oligonucleotide probe is blocked or prevented from expanding by nucleic acid polymerase. Such blocking can be conveniently performed by attaching a reporter or quencher molecule to the terminal 3 'region of the probe.

In one embodiment, the reporter molecule is a fluorescent organic dye derived for attachment at the end of the 3 'end or 5' end of the probe via a linking moiety. Preferably, the quencher molecule is an organic dye, which may or may not be fluorescent according to embodiments of the invention. For example, in a preferred embodiment of the invention, the quencher molecule is non-fluorescent. In general, if the quencher molecule is fluorescence or simply emits energy delivered from the reporter by non-radioactive degradation, the absorption band of the quencher will substantially overlap the absorption band of the fluorescence emission of the reporter molecule. In this specification, non-fluorescent quencher molecules that are absorbed from the excited reporter molecules but do not release radioactive energy are to be interpreted as chromogenic molecules.

The reporter-quencher pair may be selected from xanthene dyes, including, for example, fluorescein and rhodamine dyes. Various suitable forms of these compounds are widely available commercially, having substituents on phenyl moieties that can be used as binding sites for binding oligonucleotides or as binding functionality. Another group of fluorescent compounds are naphthylamines having amino groups in the alpha or beta position. The naphthylamino compounds include compounds such as 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touridinyl-6-naphthalene sulfonate. Other dyes include acridine such as 3-phenyl-7-isocyanatocomarin, 9-isothiocyanatoacridine and acridine orange; N- (p- (2-benzooxazolyl) phenyl) maleimide; Benzoxadiazole, stilbene, pyrene and the like.

In one embodiment, the reporter and quencher molecule are selected from fluorescein and non-fluorescent quencher dyes.

Various linking moieties and methodologies for attaching reporter or quencher molecules to the 5 'or 3' end of an oligonucleotide are illustrated in the following references: Eckstein, editor, Oligonucleotide and Analogues: A Practical Approach (IRL Press) , Oxford, 1991); Zuckerman et al., Nucleic Acid Research, 15: 5305-5321 (1987) (3 'thiol group on oligonucleotide); Sharma et al., Nucleic Acid Research, 19: 3019 (1991) (3 'sulfhydryl); Giusti et al., PCR Method and Applications, 2: 223-227 (1993) and Fung et al., US Pat. No. 4,757,141 (5 'phosphoamino group via Aminolink. II available from Applied Biosystems, Foster City, Calif.) Stabinsky , US Pat. No. 4,739,044 (3 ′ aminoalkylphosphoryl group); Agrawal et al., Tetrahedron Letters, 31: 1543-1546 (1990) (attachment via phosphoramidate linkages); Sproat et al., Nucleic Acid Research, 15: 4837 (1987) (5 'mercapto group); Nelson et al., Nucleic Acid Research, 17: 7187-7194 (1989) (3 ′ amino group) and the like.

Rhodamine and non-fluorescent quencher dyes may also be conveniently attached to the 3 'end of the oligonucleotide at the beginning of solid phase synthesis, see, for example, Woo et al., US Pat. No. 5,231,191; And Hobbs, Jr., US Pat. No. 4,997,928.

Real-time Detection of HIV-1 Target Nucleic Acid Sequences Using CataCleave Probes.

The labeled oligonucleotide probe can be used as a probe for real time detection of HIV-1 target nucleic acid sequences in a sample.

CataCleave oligonucleotide probes are first synthesized with DNA and RNA sequences that are complementary to sequences found in PCR amplicons containing selected HIV-1 target sequences. In one embodiment, the probe is labeled with a FRET pair, eg, one end of the probe is a fluorescein molecule and the other end is a non-fluorescent quencher molecule. Thus, when the probe hybridizes with a PCR amplicon, an RNA: DNA heteroduplex form is formed that can be cleaved by RNase H activity.

RNase H hydrolyzes RNA in RNA-DNA hybrids. The enzyme was first identified in bovine mammary glands but has since been found in a variety of organisms. RNase H activity is ubiquitous in eukaryotes and bacteria. Although RNase H consists of a protein family of various molecular weights and nuclear lytic activity, substrate requirements appear similar between the various isotypes. For example, most of the RNase Hs studied so far function as endonucleases and produce divalent cations (eg, Mg ²⁺ , to produce cleavage products having 5 'phosphate and 3' hydroxyl ends). Mn ²⁺ ).

RNase HI from E. coli is the best known of the RNase H family. In addition to RNase HI, a second E. coli RNase H, RNase HII was cloned and characterized (Itaya, M., Proc. Natl. Acad. Sci. USA, 1990, 87, 8587-8591). RNase HI consists of 155 amino acids, compared to 213 amino acids. E. coli RNase HII shows only 17% homology with E. coli RNase HI. RNase H cloned from S. typhimurium differs from E. coli RNase HI in only 11 positions and consists of 155 amino acids (Itaya, M. and Kondo K., Nucleic Acids Res., 1991, 19, 4443 -4449).

Proteins exhibiting RNase H activity were cloned and purified from several viruses, other bacteria and yeasts (Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many cases, proteins with RNase H activity appear as fusion proteins in which RNase H is fused to the amino or carboxy terminus of another enzyme, usually a DNA or RNA polymerase. The RNase H domain has been consistently found to be highly homologous with Escherichia coli RNase HI, but the other domains are substantially diverse, resulting in a wide variety of molecular weights and other characteristics of the fusion protein.

Two classes of RNase H in higher eukaryotes have been defined based on differences in molecular weight, the effects of divalent cations, sensitivity to sulfhydryl reagents and immunological cross-reactivity (Busen et al., Eur J. Biochem., 1977, 74, 203-208). RNase HI enzymes have a molecular weight in the range of 68-90 kDa, have been reported to be activated by Mn ²⁺ or Mg ²⁺ and are insensitive to sulfhydryl reagents. In contrast, RNase H II enzymes have a molecular weight in the range of 31-45 kDa, require Mg ²⁺ , show high sensitivity to sulfhydryl reagents, and have been reported to be inhibited by Mn ²⁺ (Busen, W. , and Hausen, P., Eur. J. Biochem., 1975, 52, 179-190; Kane, CM, Biochemistry, 1988, 27, 3187-3196; Busen, W., J. Biol. Chem., 1982, 257, 7106-7108.).

Enzymes with RNase HII properties were purified almost homogeneously from human placenta (Frank et al., Nucleic Acids Res., 1994, 22, 5247-5254). This protein has a molecular weight of about 33 kDa, is activated in a pH range of 6.5-10 and is reported to have an optimal pH of 8.5-9. The enzyme requires Mg ²⁺ and has been reported to be inhibited by Mn ²⁺ and n-ethyl maleimide. The product of the cleavage reaction has 3 'hydroxyl and 5' phosphate ends.

According to one embodiment, real-time nucleic acid amplification is carried out at the target polynucleotide in the presence of thermostable nucleic acid polymerase, RNase H activity, PCR amplification primer pairs capable of hybridizing to HIV-1 target polynucleotides, and labeled CataCleave oligonucleotide probes. Is performed. During the real-time PCR reaction, cleavage of the probe by RNase H separates the fluorescent donor from the fluorescent quencher such that the fluorescence of the probe increases in real time following the real-time detection of HIV-1 target DNA sequences in the sample.

In one embodiment, real time nucleic acid amplification enables real time detection of a single target DNA molecule in up to about 40 PCR amplification cycles as shown in FIG. 7.

Example of real-time detection of HIV-1 gene sequence in a sample

First, the method includes separating total RNA from a subject sample. The detection method according to one embodiment may be applied to a sample that is expected to be infected with HIV-1. The sample includes, but is not limited to, bodily fluids such as cultured cells, animal or human liver cells, blood, plasma, serum, semen, saliva or mucus. Isolation of the DNA can be made through various methods known in the art. Specific methods for this are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001), which is incorporated herein by reference.

Next, the method includes mixing the isolated total RNA and related reaction components to perform real time PCR.

According to one embodiment, the method may further include performing a reverse transcription reaction on the separated total RNA before performing the real-time PCR. Since the method targets a virus in the HIV-1 genus RNA virus, the isolated RNA must be transformed into DNA, a template that can be used for real-time PCR reactions. Reverse transcription reactions can be carried out using a variety of reverse transcriptase enzymes well known in the art isolated from Avian Myeloblastosis Virus (AMV) or Moloney Murine Leukemia Virus (MMLV).

According to one embodiment, a device for performing temperature cycling and real-time detection of the resultant amplified product is commercially available. Devices that can be used in the real-time PCR method include, but are not limited to, Applied Biosystems Incorporated's real-time PCR devices 7900, 7500, 7300, Stratagene's Mx3000p, BioRad's Chromo 4 and Roche Lightcycler 480 devices. During the real-time PCR, these instruments monitor the change in emission intensity from the detectable label and convert the information into graphical and / or numerical information that can be analyzed to determine whether the target template is present in the test sample.

In the detection method of HIV-1 according to one embodiment, the real-time PCR reaction may be carried out under conventional conditions known in the art, for example, initial denaturation was performed at 95 ° C. for 10 minutes. Thereafter, denaturation (10 seconds at 95 ° C.), annealing, and reaction of RNase HII (10 seconds at 55 ° C.) and elongation (elongation, 30 seconds at 72 ° C.) may be performed under the conditions of performing 60 times in total. HIV-1 detectable by the above method is as described above.

Finally, it may include the step of confirming the presence of HIV-1 from the real-time PCR results.

The presence or absence of the HIV-1 is confirmed by calculating the C _t value, which is the number of cycles when the PCR amplification product is amplified by a certain amount from the curve displayed by detecting a fluorescent labeling factor labeled on the probe of the PCR product amplified in the real-time PCR process Can be. For example, the C _t value may determine that HIV-1 exists when 10 to 45. Meanwhile, the calculation of the C _t value may be automatically performed by a program included in the real time PCR device.

The invention will be explained in more detail with reference to the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

The enzyme "Hot Start" RNase HII is a reversibly modified RNase HII. When the modified enzyme is used in the reaction with Tris based buffer and the temperature is raised to 95 ° C., the pH of the solution drops and RNase H activity is restored. This method allows for the inclusion of RNase H in the reaction mixture prior to the start of reverse transcription. RNase HII and details thereof are disclosed in US Provisional Application No. 61 / 347,984, filed May 25, 2010, which is incorporated herein by reference in its entirety.

Table 1 shows the sequences of the pris and probes.

Table 3 shows exemplary combinations of forward, reverse primers and probes.

According to the HIV-1 detection method according to one embodiment, the detection result can be quickly confirmed in real time even with a small number of samples.

Figure 1 shows RT-PCR amplification through 10-fold serial dilution of HIV-1, group M, subtype C RNA according to a preferred embodiment of the present invention.

Figure 2 shows RT-PCR amplification through 10-fold serial dilution of HIV-1, group M, subtype D RNA according to a preferred embodiment of the present invention.

Figure 3 shows RT-PCR amplification through 10-fold serial dilution of HIV-1, group M, subtype F RNA according to a preferred embodiment of the present invention.

4 shows a graphical plot of Cp values against copy number of template for RT-PCR response of HIV-1, group M, subtype C detection.

5 shows a graphical plot of Cp values against copy number of template for RT-PCR response of HIV-1, group M, subtype D detection.

FIG. 6 shows a graphical plot of Cp values against copy number of template for RT-PCR response of HIV-1, group M, subtype F detection.

Figure 7 shows RT-PCR amplification through 10-fold serial dilution of HIV-1, group O RNA according to one embodiment of the present invention.

FIG. 8 shows a graphical plot of Cp values against copy number of template for RT-PCR response of HIV-1, group O.

Hereinafter, one or more embodiments will be described in more detail with reference to Examples. However, these examples are provided to illustrate one or more embodiments illustratively and the scope of the present invention is not limited to these examples.

Example 1 Detection of HIV-1 Group M

RNA templates used for detection of HIV-1 group M were purchased from Seracare Life Sciences and are listed in Table 2. 10-fold serial dilution in 5 mM HEPES (4- (2-hydroxyethyl) -1- (piperazineethanesulfonic acid) -KOH, pH 7.8) prepared the most diluted sample to contain 1-10 copies of the RNA template. 2 μl in each dilution was used as RNA template in one-step RT-PCR with 23 μl PCR mix. The final concentration of each component in the RT-PCR reaction is as follows: 1 X PCR reaction buffer, 400 uM of each dATP dCTP dGTP and dUTP, 200 uM of dTTP, 80 nM forward primer (SEQ ID NO: 1), 80 nM reverse primer (SEQ ID NO: 8), 60 nM cataclyve probe (SEQ ID NO: 18), 5 U hot-start RNase HII, 0.4 U thermostable UDG (Bacillus ssp.), 2.5 U Platinum Taq DNA Polymerase (Life Technologies) and 2 U Superscript III Reverse Transcriptase (Life Technologies). One-step RT-PCR reactions were performed using the following cycle parameters on a LightCycler 480 real-time PCR instrument (Roche): first strand cDNA synthesis at 50 ° C. for 15 minutes, reverse transcription by heating at 95 ° C. for 5 minutes. The enzyme was inactivated, the RNase HII and the DNA polymerase were activated, followed by 50 denaturation at 95 ° C. for 10 seconds, annealing at 55 ° C. for 10 seconds and stretching at 65 ° C. for 30 seconds. Detection of fluorescence was carried out in each cycle during the 65 ° C. stretching process.

Examples of RT-PCR shown in FIGS. 1-3 are performed using RNA templates from groups M, subtype C, subtype D and subtype F of HIV-1, respectively. These results demonstrate that multiple subtypes can be detected when no more than 11 copies of genomic RNA are used as a template. 4-6 show graphs showing plots of Cp values of amplification curves for each RNA dilution versus log (copy number) of the template. Each plot shows linearity for a response of at least 10 ⁵ for each sample and an excellent linear fit to the data with r ² values of 0.99 and above. The efficiency of these reactions was 91% for subtype C, 91% for subtype D, and 97% for subtype F. Table 2 below shows the list of HIV-1 species used in this experiment and the minimum limits detected in each species. These results indicate inclusion across all subtypes of HIV-1 group M tested.

Example 2: Detection of HIV-1 Group O

RNA templates used for detection of HIV-1 group O were purchased from Seracare Life Sciences and are listed in Table 2. Ten-fold serial dilutions in 5 mM HEPES (4- (2-hydroxyethyl) -1- (piperazineethanesulfonic acid) -KOH, pH 7.8) were prepared so that the most diluted sample contained 1 to 11 copies of the RNA template. 1 μl in each dilution was used as RNA template in one-step RT-PCR with 24 μl PCR mix. The final concentration of each component in the RT-PCR reaction is as follows: 1 X PCR reaction buffer, 300 nM forward primer (SEQ ID NO: 1), 300 nM reverse primer (SEQ ID NO: 8), 200 nM cataclybine probe (SEQ ID NO: 8) No. 18), 5 U hot-start RNase HII, 2 U Platinum Taq DNA Polymerase (Life Technologies) and 0.5 U Superscript III reverse transcriptase (Life Technologies). One-step RT-PCR reactions were performed using the following cycle parameters on a LightCycler 480 real-time PCR instrument (Roche): first strand cDNA synthesis at 50 ° C. for 15 minutes, reverse transcription by heating at 95 ° C. for 5 minutes. The enzyme was inactivated, RNase HII and DNA polymerase were activated, followed by 50 cycles of denaturation at 95 ° C. for 10 seconds, annealing at 55 ° C. for 10 seconds and extension at 72 ° C. for 30 seconds. Detection of fluorescence was carried out in each cycle during the 72 ° C. stretching process.

Example of RT-PCR shown in Figure 7 was performed using an RNA template derived from HIV-1, group O, strain I-2481. Table 2 below shows the list of HIV-1 Group O used in this experiment and the minimum limits detected in each species. These results demonstrate that multiple species of HIV-1 group O can be detected when no more than 11 copies of genomic RNA are used as a template. 8 shows a graph showing a plot of the Cp values of the amplification curves for each RNA dilution versus the log (copy number) of the template. Plots show linearity for a response of at least 10 ⁵ for each sample, with an excellent linear fit to the data with r ² values of 0.99 and above. The efficiency of detection reaction of I-2481 was 82%. These results indicate that all subtypes of tested HIV-1 group O are included.

Table 1

SEQ ID NO:	Probe / Primer	Base sequence (5'-3 ')
One	HIV-Pol-F3	GCAGTACAAATGGCAGTATTCATCCACAATT
2	HIV-Pol-F7	CAGCAGTACAAATGGCAGTATTCATCCA
3	HIV-Pol-N-F42	CAGGAATTCGGGATACCCTACAATCCTCAA
4	HIV-Pol-N-F43	AGGAATTCGGGATACCCTACAATCCTCAAA
5	HIV-Pol-N-F58	ACAATCCTCAAAGTCAGGGAGTAGTAGAAT
6	HIV-Pol-N-F66	CAAAGTCAGGGAGTAGTAGAATCCATGAAT
7	HIV-1_F10-JO	CCAAGGGGAAGTGACATAGCAGGAACTACTA
8	HIV-1_F11-JO	CCAAGGGGAAGTGACATAGCAGGAACTACT
9	HIV-1_R6-JO	CTGACAGGGCTATACATTCTTACTATTTTATT
10	HIV-Pol-R9	TTTCTGCTGTCCCTGTAATAAACCCGAAAATTT
11	HIV-Pol-R21	TCTCTGCTGTCCCTGTAATAAACCCGAAAATTT
12	HIV-Pol-R22	CTCTGCTGTCCCTGTAATAAACCCGAAAATTT
13	HIV-Pol-R23	TCTGCTGTCCCTGTAATAAACCCGAAAATTT
14	HIV-Pol-R26_O	CTCTGCTGTCTCTGTAATAGACCCGAAAATTT
15	HIV-Pol-R27_O	CTCTGCTGTCTCTGTAATAGACCCGAAAATT
16	HIV-Pol-R28_O	CTCTGCTGTCTCTGTAATAGACCCGAAAATTTT
17	HIV-Pol-O-R39	GTCCTTTCCAAATAGGATCTCTGCTATCTC
18	HIV-Pol-O-R46	CCAAATAGGATCTCTGCTATCTCTGTAATA
19	HIV-Pol-O-R47	AAATAGGATCTCTGCTATCTCTGTAATAGA
20	HIV-1_CCProbe5	FAM / TACCCTTCAGrGrArArCAAATAGGATGGAT / IABkFQ
21	HIV-1_CCProbe8	FAM / GGAGAAATTTATAArArArGrATGGATAATCCTGG / IABkFQ
22	HIV-1_CCProbe24	FAM / TTAAAAGAAAAGGGGrGrGrArUTGGGGGGTACA / IABkFQ
23	HIV-1_CCProbe25	FAM / TTAAAAGAAAAGGGGGrGrArUrUGGGGGGTACA / IABkFQ
24	HIV-1_CCProbe27	FAM / TGTACCCCCCArArUrCrCCCCCTTTTCTTTTAA / IABkFQ
25	HIV-1_CCProbe28	FAM / TTAAAAGAAAAGG * GG * rGrGrArUTG * GG * GG * GTACA / EDQ
26	HIV-1_FPX	X 1 AGX 2 AX 3 TX 4 CAX 5 ATGGCAGTX 6 X 7 TX 8 ATX 9 CAX 10 AATT
27	HIV-1_FPX2	CAGGAX 1 TTX 2 GGGATACCX 3 TACAATCCTCAAAGTCAGGGAGX 4 X 5 GTAGAX 6 TCCATGAAT
28	HIV-1_FPX3	CCX 1 X 2 X 3 X 4 GX 5 X 6 X 7 GX 8 GX 9 X 10 X 11 TAX 12 CAGGX 13 X 14 X 15 X 16 X 17 CTA
29	HIV-1_RPX	CX 1 X 2 X 3 X 4 X 5 GX 6 X 7 X 8 X 9 X 10 X 11 ACAX 12 X 13 CX 14 X 15 ACTATX 16 X 17 X 18 X 19 TX 20
30	HIV-1_RPX2	TX 1 TX 2 TGX 3 TX 4 TCX 5 CX 6 GX 7 AAX 8 AX 9 X 10 CCX 11 GX 12 AAATX 13 X 14 X 15
31	HIV-1_RPX3	X 1 X 2 CCTTX 3 CCAX 4 X 5 X 6 X 7 GGX 8 TX 9 TX 10 TGX 11 TX 12 TCX 13 CTGX 14 AAX 15 AX 16 X 17

In Table 1, the probes of SEQ ID NOs: 20-25 are shown to have detectable labels at the 5 'and 3' ends, and the nucleotides "rA", "rG", "rU" and "rC" are ribonucleotides, Nucleotide G * is 8-Aza-7-Deaza-dG.

Further, in SEQ ID NO: 26, X ₁ is C or G, X ₂ is C or T, X ₃ is G or T, X ₄ is A or G, X ₅ is A or G, X ₆ is A or G or T, X ₇ is T or C, X ₈ is T or C, X ₉ is T or C, and X ₁₀ is T or C.

In SEQ ID NO: 27, X ₁ is A or G, X ₂ is C or T, X ₃ is C or A, X ₄ is C or T, X ₅ is A or G, X ₆ is A or G.

In SEQ ID NO: 28, X ₁ is A or G or C or T, X ₂ is A or G, X ₃ is G or C or T, X ₄ is A or G, X ₅ is A or G or C, X ₆ is T or A, X ₇ is A or G, X ₈ is T or G, X ₉ is G or A or C, X ₁₀ is C or T, X ₁₁ is A or T is X ₁₂ is G or C or C, X ₁₃ is G or A, X ₁₄ is A or G or T or C, X ₁₅ is T or C or G and X ₁₆ is T or C And X ₁₇ are A or C.

In SEQ ID NO: 29, X ₁ is A or T, X ₂ is G or A, X ₃ is C or A or G, X ₄ is T or C or A, X ₅ is A or T or G , X ₆ is G or A, X ₇ is A or G, X ₈ is C or T, X ₉ is T or G or A, X ₁₀ is A or G, X ₁₁ is T or A , X ₁₂ is T or C, X ₁₃ is T or C, X ₁₄ is T or C, X ₁₅ is T or C, X ₁₆ is T or C, X ₁₇ is T or A, X ₁₈ is T or G, X ₁₉ is A or G, and X ₂₀ is T or C.

In SEQ ID NO: 30, X ₁ is C or T, X ₂ is T or C, X ₃ is C or T, X ₄ is A or G, X ₅ is T or C, X ₆ is T or C, X ₇ is A or T, X ₈ is A or T, X ₉ is G or A, X ₁₀ is A or G, X ₁₁ is T or C, X ₁₂ is A or G , X ₁₃ is A or T or G, X ₁₄ is T or G, and X ₁₅ is T or C or G.

In SEQ ID NO: 31, X ₁ is G or A, X ₂ is T or C, X ₃ is C or T, X ₄ is A or G, X ₅ is A or G, X ₆ is T or C or G, X ₇ is A or T or C or G, X ₈ is A or G, X ₉ is C or T, X ₁₀ is C or T, X ₁₁ is C or T, X ₁₂ is C or A, X ₁₃ is C or T, X ₁₄ is T or A, X ₁₅ is T or A, X ₁₆ is A or G, and X ₁₇ is A or G.

TABLE 2

virus	group	Subtype	Separator name	Starting concentration (copy)	Limit of Detection (Copy)
HIV-1	M	A	I-2496	1.84E + 05	2
HIV-1	M	B	BK132	1.14E + 06	11
HIV-1	M	C	DJ259	3.83E + 05	4
HIV-1	M	D	SE365	6.46E + 05	6
HIV-1	M	D	UG274	1.23E + 06	12
HIV-1	M	A / E	42368	1.96E + 06	19
HIV-1	M	F	BZ126	2.76E + 06	3
HIV-1	M	F	BZ162	9.98E + 05	10
HIV-1	M	A / G	POC44951	4.66E + 06	5
HIV-1	M	G	HH8793	5.74E + 05	57
HIV-1	M	H	BCF-KITA	6.50E + 05	65
HIV-1	O		I-2481	1.1E + 06	11
HIV-1	O		BCF06	7.7E + 05	8
HIV-1	O		BCF11	5.8E + 05	6

Other exemplary combinations of forward and reverse primers and probes are shown in Table 3 below.

TABLE 3

Primer Pair (SEQ ID NO)		Probe (SEQ ID NO)
Forward primer	Reverse primer
One	10, 11, 12, 13, 14,15, 16, 17, 18, 19	22, 23, 24, 25
2	10, 11, 12, 13, 14,15, 16, 17, 18, 19	22, 23, 24, 25
3	10, 11, 12, 13, 14,15, 16, 17, 18, 19	22, 23, 24, 25
4	10, 11, 12, 13, 14,15, 16, 17, 18, 19	22, 23, 24, 25
5	10, 11, 12, 13, 14,15, 16, 17, 18, 19	22, 23, 24, 25
6	10, 11, 12, 13, 14,15, 16, 17, 18, 19	22, 23, 24, 25
7	9	20, 21
8	9	20, 21

Any patent, patent application, publication or other disclosure material disclosed herein is incorporated herein by reference in its entirety. Where any material, or portions thereof, incorporated herein by reference is inconsistent with the definitions, statements, or other disclosures herein, it is to be construed to be inserted only to the extent that there is no contradiction between the inserted materials and the current disclosure.

Claims (20)

1. SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, and 8:

   GCAGTACAAATGGCAGTATTCATCCACAATT (SEQ ID NO: 1),

   CAGCAGTACAAATGGCAGTATTCATCCA (SEQ ID NO: 2),

   CAGGAATTCGGGATACCCTACAATCCTCAA (SEQ ID NO: 3),

   AGGAATTCGGGATACCCTACAATCCTCAAA (SEQ ID NO: 4),

   ACAATCCTCAAAGTCAGGGAGTAGTAGAAT (SEQ ID NO: 5),

   CAAAGTCAGGGAGTAGTAGAATCCATGAAT (SEQ ID NO: 6),

   CCAAGGGGAAGTGACATAGCAGGAACTACTA (SEQ ID NO: 7), and

   A first primer comprising an oligonucleotide of a nucleotide sequence selected from the group consisting of CCAAGGGGAAGTGACATAGCAGGAACTACT (SEQ ID NO: 8),

   SEQ ID NOs: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19

   CTGACAGGGCTATACATTCTTACTATTTTATT (SEQ ID NO: 9),

   TTTCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 10),

   TCTCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 11),

   CTCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 12),

   TCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 13),

   CTCTGCTGTCTCTGTAATAGACCCGAAAATTT (SEQ ID NO: 14),

   CTCTGCTGTCTCTGTAATAGACCCGAAAATT (SEQ ID NO: 15),

   CTCTGCTGTCTCTGTAATAGACCCGAAAATTTT (SEQ ID NO: 16),

   GTCCTTTCCAAATAGGATCTCTGCTATCTC (SEQ ID NO: 17),

   CCAAATAGGATCTCTGCTATCTCTGTAATA (SEQ ID NO: 18), and

   A kit for detecting HIV-1, comprising a second primer comprising an oligonucleotide of a nucleotide sequence selected from the group consisting of AAATAGGATCTCTGCTATCTCTGTAATAGA (SEQ ID NO: 19).
2. The method of claim 1, wherein the nucleotides "rA", "rG", "rU", and "rC" are ribonucleotides and the nucleotides "G ^* " are 8-aza-7-deaza-dG (8-Aza-7 -Deaza-dG), SEQ ID NOs: 20, 21, 22, 23, 24 and 25:

   TACCCTTCAGrGrArArCAAATAGGATGGAT (SEQ ID NO: 20),

   GGAGAAATTTATAArArArGrATGGATAATCCTG (SEQ ID NO: 21),

   TTAAAAGAAAAGGGGrGrGrArUTGGGGGGTACA (SEQ ID NO: 22),

   TTAAAAGAAAAGGGGGrGrArUrUGGGGGGTACA (SEQ ID NO: 23),

   TGTACCCCCCArArUrCrCCCCCTTTTCTTTTAA (SEQ ID NO: 24), and

   TTAAAAGAAAAGG ^* GG ^* rGrGrArUTG ^* GG ^* GG ^* GTACA Kit which further comprises a probe comprising an oligonucleotide of a nucleotide sequence selected from the group consisting of (SEQ ID NO: 25).
3. The kit of claim 1, further comprising amplifying polymerase activity and RNase H activity.
4. The kit of claim 1, further comprising reverse transcriptase activity.
5. The fluorescence of claim 2, wherein the 5 ′ end of each probe is selected from the group consisting of FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE 563 and NED. Labeled with a fluorescence label, and the 3 'end of each probe is from the group consisting of 6-TAMRA, BHQ-1,2,3, Iowa Black RQ-Sp, and molecular grove binding non-fluorescence quencher (MGBNFQ) A kit labeled with one fluorescent quencher selected.
6. The composition of claim 1, further comprising dATP, dCTP, dGTP, and dTTP; DNA polymerase; RNase HII; And a mixture comprising a buffer solution.
7. The kit of claim 1, further comprising uracil-N-glycosylase.
8. The kit of claim 2, wherein the probe is bound to a solid support.
9. The kit of claim 2, wherein the probe is in free form in solution.
10. 6. The kit of claim 5, wherein said amplification polymerase activity is that of a thermostable DNA polymerase.
11. 6. The kit of claim 5, wherein the RNase H activity is the activity of thermostable RNase H.
12. The kit of claim 5, wherein the RNase H activity is hot start RNase H activity.
13. a) HIV by reacting the target nucleic acid with the first primer oligonucleotide, the second primer oligonucleotide and the first probe oligonucleotide in the presence of polymerase activity, cleaving agent, and deoxynucleotide triphosphate. Amplifying a target nucleic acid of −1, wherein the first primer oligonucleotide and the second oligonucleotide may be annealed to the target nucleic acid, the first probe oligonucleotide having a DNA sequence and an RNA sequence in a molecule, and A detectable label, wherein the DNA and RNA sequences of the probe oligonucleotide are substantially complementary to the target nucleic acid, the RNA sequence of the first probe oligonucleotide may be cleaved by the cleavage agent, and Cleavage of the RNA sequence results in a detectable signal from the label Causing release of the amplification, and the amplification is performed under conditions such that an RNA sequence in the probe oligonucleotide forms an RNA: DNA heteroduplex with a complementary sequence in a target nucleic acid; And

    b) detecting the increase in signal release from the first label on the first probe oligonucleotide, wherein the increase in signal indicates the presence of HIV-1 in the sample. Way.
14. The method of claim 13, wherein the target nucleic acid is cDNA of HIV-1 RNA.
15. The method of claim 13, wherein steps a) and b) are performed simultaneously or sequentially.
16. The method of claim 13,

    c) determining the number of threshold amplification cycles in which the intensity of signal emission from said first and second labels reaches a predetermined threshold value above a baseline value; And

    d) calculating the amount of HIV-1 in the sample by comparing the number of threshold amplification cycles determined for HIV-1 in the sample with a reference threshold amplification cycle number determined for known amounts of HIV-1. How to do.
17. The method of claim 13, wherein the first primer is SEQ ID NO: 1, 2, 3, 4, 5 and 6:

    GCAGTACAAATGGCAGTATTCATCCACAATT (SEQ ID NO: 1),

    CAGCAGTACAAATGGCAGTATTCATCCA (SEQ ID NO: 2),

    CAGGAATTCGGGATACCCTACAATCCTCAA (SEQ ID NO: 3),

    AGGAATTCGGGATACCCTACAATCCTCAAA (SEQ ID NO: 4),

    ACAATCCTCAAAGTCAGGGAGTAGTAGAAT (SEQ ID NO: 5), and

    Comprises an oligonucleotide selected from the group consisting of CAAAGTCAGGGAGTAGTAGAATCCATGAAT (SEQ ID NO: 6),

    The second primer has the following SEQ ID NOs: 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19:

    TTTCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 10),

    TCTCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 11),

    CTCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 12),

    TCTGCTGTCCCTGTAATAAACCCGAAAATTT (SEQ ID NO: 13),

    CTCTGCTGTCTCTGTAATAGACCCGAAAATTT (SEQ ID NO: 14),

    CTCTGCTGTCTCTGTAATAGACCCGAAAATT (SEQ ID NO: 15),

    CTCTGCTGTCTCTGTAATAGACCCGAAAATTTT (SEQ ID NO: 16),

    GTCCTTTCCAAATAGGATCTCTGCTATCTC (SEQ ID NO: 17),

    CCAAATAGGATCTCTGCTATCTCTGTAATA (SEQ ID NO: 18), and

    And an oligonucleotide selected from the group consisting of AAATAGGATCTCTGCTATCTCTGTAATAGA (SEQ ID NO: 19).
18. 16. The probe of claim 15 wherein the nucleotides "rA", "rG", "rU", and "rC" are ribonucleotides, and the nucleotides "G ^* " are 8-aza-7-deaza-dG Phosphorus, SEQ ID NOs: 22, 23, 24, and 25:

    TTAAAAGAAAAGGGGrGrGrArUTGGGGGGTACA (SEQ ID NO: 22),

    TTAAAAGAAAAGGGGGrGrArUrUGGGGGGTACA (SEQ ID NO: 23),

    TGTACCCCCCArArUrCrCCCCCTTTTCTTTTAA (SEQ ID NO: 24), and

    TTAAAAGAAAAGG ^* GG ^* rGrGrArUTG ^* GG ^* GG ^* GTACA (SEQ ID NO: 25) comprising a oligonucleotide selected from the group consisting of.
19. The method of claim 13, wherein the first primer is SEQ ID NO: 7 or 8:

    CCAAGGGGAAGTGACATAGCAGGAACTACTA (SEQ ID NO: 7), or

    An oligonucleotide of CCAAGGGGAAGTGACATAGCAGGAACTACT (SEQ ID NO: 8), and the second primer is set forth in SEQ ID NO: 9:

    And a oligonucleotide of CTGACAGGGCTATACATTCTTACTATTTTATT (SEQ ID NO: 9).
20. 20. The method of claim 19, wherein the probes are nucleotides "rA", "rG", "rU" and "rC" are ribonucleotides of SEQ ID NO: 20 or 21:

    TACCCTTCAGrGrArArCAAATAGGATGGAT (SEQ ID NO: 20),

    And an oligonucleotide of GGAGAAATTTATAArArArGrATGGATAATCCTG (SEQ ID NO: 21).

Images