WO2013081202A1

WO2013081202A1 - Oligonucleotide for detecting e. coli o157:h7 and usage of same

Info

Publication number: WO2013081202A1
Application number: PCT/KR2011/009138
Authority: WO
Inventors: 리준; 쳉윈덴; 에이 옵다이크제이슨
Original assignee: 삼성테크윈 주식회사
Priority date: 2011-11-29
Filing date: 2011-11-29
Publication date: 2013-06-06

Abstract

Provided is an oligonucleotide, a kit, and a method for detecting E. coli O157:H7. Also disclosed is a method for detecting in real-time E. coli O157:H7 from a test sample by using the kit. According to the method for detecting, the detection result can be rapidly confirmed in real-time even from a test sample having a low number of copies.

Description

E. oligonucleotides for detecting cO157: H7 species and uses thereof

E. coli O157: H7 oligonucleotides suitable for detection oligonucleotide and the oligonucleotide with a nucleotide E. coli O157: discloses a kit and method for detecting H7 species.

Since E. coli O157: H7 was first known in 1982 as the cause of the onset of hemorrhagic colitis, it has become widespread worldwide, with thousands of infected in Japan and more than 20,000 infected and 250 killed in the United States each year. It is one of the food poisoning bacteria. In addition, E. coli O157: H7 is known as a major cause of hemorrhagic colitis along with the bacteria of the genus Campylobacter , Salmonella , and Shigella . Since E. coli O157: H7 is mainly transmitted through food such as meat, dairy products, and drinking water, a method for quickly and economically confirming the presence of E. coli O157: H7 in a sample such as food is required. A common method for detecting E. coli O157: H7 is to incubate the sample in selective medium, isolate the bacteria suspected of E. coli O157: H7, and then identify it by biochemical or immunological methods. Immunological methods using antibodies can detect bacteria with high accuracy. However, a large amount of sample is required and an antibody is required for each diagnosis.

In one embodiment, oligonucleotides are provided that can be suitably used to accurately, sensitively and rapidly detect E. coli 0157: H7 species. The oligonucleotide may be a first primer comprising the sequence of SEQ ID NO: 16, 3, 4, or 6; It may be a second primer comprising the sequence of SEQ ID NO: 7, 8, 9, 10, or 11. The oligonucleotide may comprise the sequence of SEQ ID NO: 17 or 18. In one embodiment, the first primer may have a sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may have a sequence of SEQ ID NO: 12, 13, or 14.

In addition, in one embodiment, a composition is provided comprising an oligonucleotide that can be suitably used to accurately, sensitively and rapidly detect E. coli 0157: H7 species. The composition may comprise a first primer comprising a sequence of SEQ ID NO: 16, 3, 4, or 6; A second primer comprising the sequence of SEQ ID NO: 7, 8, 9, 10, or 11 may be included. The composition may comprise the sequence of SEQ ID NO: 17 or 18. In one embodiment, the first primer may have a sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may have a sequence of SEQ ID NO: 12, 13, or 14.

In one embodiment, a kit for detecting E. coli 0157: H7 species is provided.

The E. coli 0157: H7 species detection kit may comprise a first primer comprising a sequence of SEQ ID NO: 16, 3, 4, or 6; A second primer comprising the sequence of SEQ ID NO: 7, 8, 9, 10, or 11 may be included. The kit may further comprise a probe consisting of a DNA sequence and an RNA sequence. The kit may comprise the sequence of SEQ ID NO: 17 or 18. In one embodiment, the first primer may be one of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may be one of SEQ ID NO: 12, 13, or 14.

Various combinations of first primers, second primers, and probesE. coliOf O157: H7 It can be used to sample the target nucleic acid or fragment thereof. The combination may be as follows, but is not limited thereto.

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 1, a second primer comprising a nucleotide sequence of SEQ ID NO: 7, and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 1, a second primer comprising a nucleotide sequence of SEQ ID NO: 8, and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 1, a second primer comprising a nucleotide sequence of SEQ ID NO: 10, and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 2, a second primer comprising a nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 2, a second primer comprising a nucleotide sequence of SEQ ID NO: 10, and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 3, a second primer comprising a nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 3, a second primer comprising a nucleotide sequence of SEQ ID NO: 10, and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 4, a second primer comprising a nucleotide sequence of SEQ ID NO: 11, and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 5, a second primer comprising a nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NOs: 12 to 14;

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 5, a second primer comprising a nucleotide sequence of SEQ ID NO: 10, and a nucleotide sequence of SEQ ID NOs: 12 to 14; or

A probe having any one of a first primer comprising a nucleotide sequence of SEQ ID NO: 6, a second primer comprising a nucleotide sequence of SEQ ID NO: 9, and a nucleotide sequence of SEQ ID NOs: 12-14.

In one embodiment, the kit for detection of E. coli 0157: H7 species may comprise one of the following oligonucleotides:

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 1 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 7 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 1 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 8 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 contiguous nucleotides selected from the nucleotide sequence of SEQ ID NO: 1 and a second primer comprising at least 10 or 15 contiguous nucleotides selected from the nucleotide sequence of SEQ ID NO: 10; A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 2 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 7 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 2 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 10; A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 3 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 7 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 3 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 10; A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 4 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 11; A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 5 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 7 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14;

A first primer comprising 10 or 15 consecutive nucleotides selected from the nucleotide sequences of SEQ ID NO: 5 and a second primer comprising 10 or 15 consecutive nucleotides selected from the nucleotide sequences of SEQ ID NO: 10 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14; or

A first primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 6 and a second primer comprising at least 10 or 15 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 9 A probe having a primer set and a nucleotide sequence of any one of SEQ ID NOs: 12 to 14.

In another embodiment, a method of detecting E. coli 0157: H7 species from a sample is provided.

The method comprises (a) amplifying a target nucleic acid of E. coli 0157: H7 in a sample to increase the copy number of the target nucleic acid, wherein the amplification comprises the nucleotide sequence of SEQ ID NO: 16, 3, 4, or 6 Hybridizing with a target nucleic acid in the sample to obtain a hybridized product of the target nucleic acid and the primer, wherein the first primer and the second primer comprising the nucleotide sequence of SEQ ID NO: 7, 8, 9, 10 or 11 are obtained. Using nucleic acid polymerase to expand the first and second primers of the hybridized product to produce an extended primer product; (b) hybridizing the target nucleic acid with one or more probe oligonucleotides that can hybridize with the target nucleic acid to obtain a hybridization product of the target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence and is detected Possible markers are linked; (c) contacting the hybridized product of the target nucleic acid : probe with RNase H to cleave the probe to cause separation of the probe fragment from the target nucleic acid; And (d) detecting the detectable label. The first primer may have a sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6. The probe oligonucleotide may have an oligonucleotide of SEQ ID NO: 17 or 18. The probe oligonucleotide may be one of the oligonucleotides of SEQ ID NO: 12, 13, 14. The probe oligonucleotide can be labeled with a detectable label, such as, for example, a fluorescence resonance energy transfer (FRET) pair.

In another embodiment, a method of detecting a target RNA sequence of E. coli 0157: H7 species from a sample is provided. The method comprises the steps of (a) reverse transcripting E. coli 0157: H7 target RNA in the presence of reverse transcriptase activity and reverse amplification primers to generate target cDNA of the target RNA; (b) amplifying the target cDNA of E. coli 0157: H7 in the sample to increase the copy number of the target nucleic acid, wherein the amplification comprises a first sequence comprising the nucleotide sequence of SEQ ID NO: 16, 3, 4, or 6 A second primer comprising a primer and a nucleotide sequence of SEQ ID NOs: 7, 8, 9, 10 or 11 is hybridized with a target nucleic acid in the sample to obtain a hybridized product of the target nucleic acid and the primer, and template-dependent nucleic acid polymerase Using to extend the first and second primers of the hybridized product to produce an extended primer product; (c) hybridizing the target nucleic acid with at least one probe oligonucleotide substantially complementary to the target cDNA to obtain a hybridization product of a target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence, and detects Possible markers are linked; (d) cleaving the probe by contacting RNase H with the hybridized product of the target nucleic acid : probe oligonucleotide; And (e) detecting an increase in signal release from the label on the probe, wherein the increase in signal indicates the presence of E. coli 0157: H7 RNA in the sample. The first primer may have a sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6. The probe oligonucleotide may have an oligonucleotide of SEQ ID NO: 17 or 18. The probe oligonucleotide may be one of the oligonucleotides of SEQ ID NO: 12, 13, 14. The probe oligonucleotide can be labeled with a detectable label, such as, for example, a FRET pair.

The experiments of the embodiments disclosed herein used conventional molecular biological techniques known in the art, unless otherwise indicated. Such techniques are well known to those skilled in the art and are fully described in the literature. See, for example, Ausubel, et al., Ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008) and Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989).

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The specification also provides definitions of terms to aid in the interpretation of the description and the claims. As a result, if a definition does not match another definition, the definition will be defined as described herein.

As used herein, the term “amplification” refers to any process for increasing the copy number of a nucleotide sequence. Amplification of nucleic acids refers to the process by which nucleotides (eg, DNA or RNA) are incorporated into a nucleic acid.

The term "nucleotide" refers to a combination of base-sugar-phosphate. Nucleotides are, for example, monoliths of nucleic acids such as DNA or RNA. The term “nucleotide” includes ribonucleoside triphosphates such as rATP, rCTP, rGTP, or rUTP, and deoxy-ribonucleoside triphosphates such as dATP, dCTP, dGTP, or dTTP.

The term "nucleoside" refers to a combination of base-sugars, ie a combination lacking phosphate in nucleotides. The terms "nucleoside" and "nucleotide" can be used interchangeably in the art. For example, the nucleotide deoxyuridine, dUTP is deoxynucleoside triphosphate. For example, it acts as a DNA monomer, such as dUMP or deoxyuridine monophosphate, and is inserted into DNA. In this regard, even if no dUTP moiety is present in the DNA output, the dUTP may be considered inserted.

The term “polymerase chain reaction (PCR)” generally refers to an amplification method that increases the copy number of the target nucleic acid (s) in a sample. The process is described in detail in US Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188, the contents of which are incorporated herein by reference. The sample may comprise a single nucleic acid or multiple nucleic acids. In general, PCR comprises two or more expandable primer nucleic acids in a reaction mixture comprising the target nucleic acid (s). The primer is complementary to the opposite strand of the double-stranded target sequence. The reaction mixture is subjected to thermal cycling in the presence of nucleic acid polymerase and nucleic acid monomers such as dNTP and / or rNTP to amplify the target nucleic acid by extension of the primer. In general, the temperature change cycling includes the following procedure; Annealing and hybridizing the primer and the target nucleic acid; Expanding said primers using nucleic acid polymerase; And denaturing the hybridized primer extension product and target nucleic acid. The term "reverse transcriptase-PCR (RT-PCR)" refers to a single strand of DNA prior to multiple cycles of DNA-dependent DNA polymerase primer expansion using RNA template and reverse transcriptase, or enzymes with reverse transcriptase activity. PCR to generate cDNA molecules. The term "multiplex PCR" generally refers to a PCR that produces, by two or more kinds of primer sets, two or more amplified target products in a single reaction.

The term "nucleic acid" means a polymer comprising two or more nucleotides. The term “nucleic acid” is used interchangeably with the terms “polynucleotide” or “oligonucleotide” herein. Nucleic acids include DNA and RNA. The structure of the nucleic acid may be double-stranded and / or single-stranded.

The term “nucleic acid analog” means a nucleic acid comprising one or more nucleotide analogues and / or one or more phosphate ester analogs and / or one or more pentose sugar analogs. Examples of nucleic acid analogs include nucleic acids in which phosphate ester and / or sugar phosphate ester bonds have been replaced by bonds of the same kind, such as N- (2-aminoethyl) -glycine amide and other amides. Nucleic acid analogs may be nucleic acids comprising one or more nucleotide analogues and / or one or more phosphate ester analogs and / or one or more pentose sugar analogs and may form a double helix by hybridization.

The terms “annealing” and “hybridization” can be used interchangeably, meaning that one nucleic acid and another nucleic acid interact with base-pairs to form a double, triple or higher order structure. In one embodiment, the primary interaction is the reaction of A / T and G / C by base-specific, eg, hydrogen bonding of Watson / Click and Hoogsteen-type. In one embodiment, base-stacking and hydrophobic interactions can also contribute to the stability of the double helix.

The term “nucleotide” is a deoxyribonucleotide or ribonucleotide that exists in single- or double-stranded form, and is interpreted to include analogs of nucleotides unless otherwise specified.

The term “primer” refers to a single strand of single strand that can act as a starting point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers at suitable temperatures. Means oligonucleotides. Suitable lengths of primers are typically 15-30 nucleotides, depending on various factors, such as temperature and the use of the primer. Short primers may generally require lower temperatures to form a hybridization complex that is sufficiently stable with the template. The terms "forward primer" and "reverse primer" refer to primers that bind to the 3 'end and the 5' end, respectively, of a predetermined portion of the template to be amplified by the polymerase chain reaction. The sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template to perform the primer-specific function. Therefore, the primer set according to one embodiment does not need to have a sequence that is perfectly complementary to the nucleotide sequence that is a template, and it is interpreted that it is sufficient to have sufficient complementarity within a range capable of hybridizing to the sequence and acting as a primer. The design of such primers can be easily carried out by those skilled in the art with reference to the nucleotide sequence of the polynucleotide to be a template, for example, by using a primer design program (for example, PRIMER 3 program). On the other hand, the primer according to one embodiment is hybridized or annealed to one site of the template to form a double chain structure. Conditions for nucleic acid hybridization suitable for forming such double chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach , IRL Press, Washington, DC (1985). For example, the primer may include at least 10 or 15 contiguous nucleotides in the base sequence of any one of SEQ ID NOs 1 to 12, wherein the primer is a base of any one of SEQ ID NOs 1 to 12. It may be a nucleotide having a sequence. In addition, the primer may be a nucleotide having any one of the nucleotide sequences of SEQ ID NO: 3, 6-12 or 16. In one embodiment the primer may be any one of SEQ ID NOs: 1-12.

The term "probe" refers to a nucleic acid having a sequence complementary to a target nucleic acid sequence and capable of hybridizing with the target nucleic acid to form a double helix. The probe sequence may be completely complementary to the target nucleic acid sequence. The probe can be labeled such that the target nucleic acid can be detected simultaneously with PCR.

The term "target nucleic acid" or "target sequence" includes the full length of a target nucleic acid or fragment thereof that can be amplified and / or detected. The target nucleic acid may be between two primers used for amplification.

The term "hybrid oligonucleotide" refers to an oligonucleotide molecule comprising DNA and RNA moieties in a single molecule. The hybrid oligonucleotide includes one or more DNA portions and one or more RNA portions, such as, for example, DNA-RNA, RNA-DNA, or DNA-RNA-DNA oligonucleotides.

In one embodiment, the oligonucleotide set for detecting E. coli 0157: H7 comprises (i) a first primer having an oligonucleotide of SEQ ID NO: 16, 3, 4, or 6 (ii) SEQ ID NO: 7, 8, 9 A second primer having an oligonucleotide of 10, or 11; The oligonucleotide set may further comprise a probe selected from SEQ ID NOs: 17 or 18. In one embodiment, the first primer may be any one of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may be any one of SEQ ID NO: 12, 13, or 14. In one embodiment, these oligonucleotides may have a sequence of at least 10, or at least 15 consecutive SEQ ID NOs: 1-12.

Primer pairs of the first and second primers according to one embodiment are specific for a portion of the I segment of E. coli 0157: H7. The I segment is at positions 312001-315400 of the E. coli 0157: H7 genome (GenBank: AE005174.2.). The sequence of this I fragment is set forth in SEQ ID NO: 15.

In one embodiment, the probe may have a DNA-RNA-DNA hybrid structure. The probe may be a nucleic acid or a nucleic acid analog. In addition, the probe may be a protected nucleic acid. For example, the DNA or RNA portion of the probe may be partially methylated to prevent degradation by RNA-specific enzymes such as, for example, RNase H.

The probe can be modified. For example, the base portion of the probe can be partially or fully methylated. Such modifications can inhibit enzyme or chemical degradation. The —OH group at the 5 ′ end or 3 ′ end of the nucleic acid probe may be blocked. The 3 ′ terminal OH group of the nucleic acid probe may be blocked, making expansion impossible by template-dependent nucleic acid polymerase.

The probe may have a detectable label. The detectable label can be any chemical moiety that can be detected by any method known in the art. Examples of detectable labels can include any moiety that can be detected by spectroscopy, photochemistry or by biochemical, immunochemical or chemical means. Suitable methods of labeling nucleic acid probes may be selected depending on the type of label and the location and probe of the label. Examples of labels include enzymes, enzyme substrates, isotopes, fluorescent dies, chromophores, chemiluminescent labels, electrochemical luminescent labels, ligands with specific binding partners, and reactions with one another. And other labels capable of increasing, modifying or decreasing the strength of the detection signal. These labels can withstand temperature changes during the temperature change cycling of PCR.

The detectable label can be a fluorescence resonance energy transfer (FRET) pair. The detectable label is a FRET pair comprising a fluorescent donor and a fluorescent acceptor separated by an appropriate distance, and the fluorescence emission of the donor is quenched by the acceptor. However, when the donor-acceptor pair is separated by cleavage, the fluorescence emission of the donor is increased. When the pairs are in close proximity to one another, a donor chromophore may transfer energy to the acceptor chromophore in an excited state. This shift is always non-radiative and occurs through dipole-dipole coupling. Any process that sufficiently increases the distance between the chromophores will reduce the FRET efficiency so that the release of donor chromophores can be detected radioactively. Examples of donor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, and Texas Red. Acceptor chromophores are chosen such that their excitation spectrum overlaps the emission spectrum of the donor. An example of such a pair is FAM-TAMRA. In addition, examples of such detectable labels are non-fluorescent acceptors capable of quenching a wide range of donors. Other examples of suitable donor-acceptor FRET pairs are well known in the art.

In one embodiment, the probe may be present in dissolved or free form in solution. In other embodiments, the probe can be immobilized on a solid support. Different probes may be attached to the solid support and used to simultaneously detect different target sequences in the sample. Reporter molecules with different fluorescence wavelengths can be used for different probes, and thus can be separated and detected by allowing different probes to hybridize.

Examples of preferred types of solid supports for immobilization of the oligonucleotide probes include polystyrene, avidin coated polystyrene bead cellulose, nylon, acrylamide gel and activated dextran, controlled pore glass (CPG), glass Plates and high cross-linked polystyrene. These solid supports are widely used in hybridization and diagnostic studies because of their chemical stability, ease of functionalization and defined surface area. Solid supports such as controlled pore glass (500 A, 1000 A) and non-swelling high cross-linked polystyrene (1000 A) are particularly preferred in terms of being compatible with oligonucleotide synthesis.

The probe can be attached to the solid support in various ways. For example, the probe can be attached to the solid support by having a 3 'or 5' terminal nucleotide of the probe attached to the solid support. However, the probe may be attached to the solid support by a linker that provides separation of the probe from the solid support. The linker may be most preferably 30 atoms or more in length, and more preferably 50 atoms or more in length.

Hybridization of the probe immobilized on the solid support generally requires separation of at least 30 atoms, more preferably at least 50 atoms from the solid support. To achieve this separation, the linker generally comprises a spacer located between the linker and the 3 ′ nucleoside. For oligonucleotide synthesis, the linker arm is generally attached to the 3'-OH of the 3 'nucleoside, with an ester bond that can be cleaved with a basic reagent to release the oligonucleotide from the solid support. .

Various kinds of linkers are known in the art that can be used to attach the probes to a solid support. The linker may be in the form of any compound that does not severely interfere with the hybridization of the target sequence with the probe attached to the solid support. The linker may be in the form of a homopolymeric oligonucleotide so that the linker can be easily added by automated synthesis. Alternatively, polymers such as functionalized polyethylene glycols can be used as the linker. Such polymers are preferred over single polymerizable oligonucleotides because they do not seriously interfere with the hybridization of the probes attached to the solid support. In particular, polyethylene glycol is more desirable because it is commercially available, is soluble in organic and water soluble media, can be easily functionalized, and is completely stable under oligonucleotide synthesis and post-synthesis conditions. Do.

The bond between the solid support, the linker and the probe should preferably not be cleaved during the removal of base protecting groups under high temperature base conditions. Examples of preferred bonds include carbamate and amide bonds. Immobilization of probes is well known in the art and one skilled in the art will readily be able to determine the immobilization conditions.

According to one embodiment of the method, the hybridization probe may be bound to a solid support. The oligonucleotide probe is contacted with a nucleic acid sample under conditions suitable for hybridization. In the unhybridized state, the fluorescent label is quenched by the acceptor. Upon hybridization to the target, the fluorescent label is separated from the quencher and the fluorescence emission is increased.

In addition, the immobilization of the hybridized probe to the solid support allows the target sequence to which the probe hybridizes to be easily separated from the sample. In a later step, the isolated target sequence can be separated from the solid support and used in experiments by methods well known in the art as required by the investigator (eg, purification, amplification, etc.).

The oligonucleotides according to one embodiment can be used for amplification and detection of target nucleic acids. The amplification may involve extending the primers using template-dependent polymerase, resulting in the formation of PCR fragments or amplicons. The amplification may be Polymerase Chain Reaction or Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence Based Amplification (NASBA), Cleavage Fragment Length Polymorphism, Isothermal and Chimeric Primer-initiated Amplification may be performed using an amplification method such as Amplification of Nucleic Acid, Ramification-extension Amplification Method or other suitable nucleic acid amplification method. The amplification may include simultaneous real time detection of the target nucleic acid.

The term "PCR fragment" or "amplicon" refers to a polynucleotide molecule (or collectively several molecules) produced upon amplification of a specific target nucleic acid. Such PCR fragments generally, but not exclusively, refer to DNA PCR fragments. PCR fragments may be single-stranded or double-stranded, or mixtures thereof in any concentration ratio. PCR fragments may be 100-500 nucleotides or more in length.

Amplification "buffers" are compounds added to modify the stability and / or activity of one or more elements of the amplification reaction by modulating the amplification reaction. The buffer reagent of the present invention is compatible with PCR amplification and RNase H cleavage activity. Examples of buffers include, but are not limited to, HEPES ((4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid), MOPS (3- (N-morpholino) -propanesulfonic acid), and acetate or phosphate containing buffers, and the like. PCR buffers may also generally comprise about 70 mM KCl and about 1.5 mM or more MgCl ₂ , and about 50-200 mM of each of the dATP, dCTP, dGTP and dTTP. -May include additives for effectively optimizing PCR or PCR reactions.

Additives are compounds added to modify the stability and / or activity of one or more elements of the composition. In one embodiment, the composition is an amplification reaction composition. In one embodiment, the additive inactivates the contaminated enzyme, stabilizes the folding of the protein, and / or reduces the aggregation of the protein. Examples of additives that may be included in the amplification reaction include betaine, formamide, KCl, CaCl ₂ , MgOAc, MgCl ₂ , NaCl, NH ₄ OAc, NaI, Na (CO ₃ ) ₂ , LiCl, MnOAc, NMP, trehalose ( trehalose), dimethyl sulfoxide ("DMSO"), glycerol, ethylene glycol, dithiothreitol ("DTT"), pyrophosphatase (the inorganic pyrophosphatase from Thermoplasma acidophilum ("TAP")) ), Bovine serum albumin ("BSA"), propylene glycol, glycineamide, CHES, Percoll, aurintricarboxylic acid, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40, Triton X-100, CHAPS, CHAPSO, Mackernium, LDAO (N-dodecyl-N, N-dimethylamine-N-oxide), Zwittergent 3-10, Xwittergent 3-14, Xwittergent SB 3-16, Empigen, NDSB-20, T4G32, E. Coli SSB, RecA, nicking endonuclease, 7-deazaG, dUTP, anionic surfactant, cationic surfactant, non-ionic surfactant, zwitte rgent, sterols, osmolytes, cations, and other chemicals, proteins, or cofactors that can alter the efficiency of amplification. In one embodiment, two or more additives may be included in the amplification reaction. If the additive does not interfere with the activity of RNase H, it may be optionally added to increase the selectivity of primer annealing.

As used herein, the term “thermostable”, as applied to an enzyme, maintains biological activity at increased temperatures (eg, 55 ° C. or higher), or repeats heating and cooling It refers to an enzyme that can maintain biological activity in the course of the cycle. Thermostable polynucleotide polymerases are found to be particularly used in amplification reactions.

As used herein, the term “Thermostable polymerase” is an enzyme that is relatively stable to heat and eliminates the need to add an enzyme before each PCR cycle. Examples of thermostable polymerases are thermophilic bacteriaThermus aquaticus (Taq polymerase),Thermus thermophilus (Tth polymerase),Thermococcus litoralis (Tli or VENT polymerase),Pyrococcus furiosus (Pfu or DEEPVENT polymerase),Pyrococcus woosii (Pwo polymerase) and polymerases isolated from other Pyrococcus species,Bacillus stearothermophilus (Bst polymerase),Sulfolobus acidocaldarius (Sac polymerase),Thermoplasma acidophilum (Tac polymerase),Thermus rubber (Tru polymerase),Thermus brockianus (DYNAZYME polymerase)Thermotoga neapolitana (Tne polymerase),Thermotoga maritime (Tma) andThermotoga Other species of the genus (Tsp polymerase), andMethanobacterium thermoautotrophicum Polymerases isolated from (Mth polymerase), including but not limited to. The PCR reaction may comprise one or more thermostable polymerase enzymes having complementary features that lead to efficient amplification of the target sequence. For example, nucleotide polymerase, which has high processivity (the ability to copy larger nucleotide segments), has other nucleotides with proofreading ability (the ability to correct errors while stretching the target nucleic acid sequence). Complemented with polymerase, it produces a PCR reaction that can copy long target sequences with high fidelity. The thermostable polymerase may be used in the form of a wild type. Alternatively, the polymerase may be modified to include mutations that comprise fragments of the enzyme or which provide advantageous features for enhancing the PCR reaction. In one embodiment, the heat stable polymerase may be Taq polymerase. Many variants of Taq polymerase with increased properties are known, which are AmpliTaq, AmpliTaq Stoffel fragments, SuperTaq, SuperTaqplus, LA Taq, LApro Taq, and EX Taq.

One of the most widely used techniques for studying gene expression is the use of first-stranded cDNA as a template for mRNA sequence (s) for amplification by PCR. Often interpreted as PCR or reverse transcriptase-PCR, the method takes advantage of the high sensitivity and specificity of the PCR process and is widely used for the detection and quantification of RNA.

The reverse transcriptase-PCR process, performed as an end-point or real time assay, involves two steps of separate molecular synthesis: (i) synthesis of cDNA from an RNA template; And (ii) replication of the newly synthesized cDNA via PCR amplification. In an attempt to address technical issues often associated with reverse transcriptase-PCR, a number of protocols have been developed, taking into account the three basic steps of the process: (a) denaturation of RNA and hybridization of reverse primers; (b) synthesis of cDNA; And (c) PCR amplification. In the so-called "uncoupled" reverse transcriptase-PCR process (e.g., two step reverse transcriptase-PCR) reverse transcription is performed as an independent step using optimal buffer conditions for reverse transcriptase activity. do. Following cDNA synthesis, the reaction was diluted with diminished MgCl ₂ and deoxyribonucleoside triphosphate (dNTP) concentrations to conditions optimal for Taq DNA polymerase activity, and then PCR was subjected to standard conditions (US Pat. 4,683,202). In contrast, the "coupled" reverse transcriptase PCR method uses a common buffer for reverse transcriptase and Taq DNA polymerase activity. In the first version, the annealing of the reverse primer is a separate step before the addition of the enzyme and then added to a single reaction vessel. In another version, reverse transcriptase activity is a component of thermostable Tth DNA polymerase. Annealing and cDNA synthesis are performed in the presence of Mn ²⁺ , and then PCR is performed in the presence of Mg ²⁺ after Mn ²⁺ is removed by chelating reagent. Finally, the “continuous” method (eg, one step reverse transcriptase-PCR) allows the reverse transcriptase-PCR 3 step to prevent opening of the reaction tube for addition of components or enzymes. Integrate into one continuous reaction. Continuous reverse transcriptase-PCR is described as a single enzyme system using the thermostable Taq DNA polymerase and Tth polymerase's reverse transcriptase activity and a two enzyme system using AMV reverse transcriptase and Taq DNA polymerase with a starting temperature of 65 ° C. do. The RNA denaturation step is omitted.

Reverse transcription, the first step in real time, uses one of the template specific DNA primers to generate complementary DNA strands. In traditional PCR reactions this product is denatured and the second template specific primer is expanded to bind the cDNA to form duplex DNA. This product is amplified in the next stage of temperature cycling. In order to maintain the highest sensitivity, it is important that the RNA is not degraded prior to the synthesis of cDNA. Since RNA: DNA hybrids can be the substrate of RNase H, the presence of RNase H in the reaction buffer will result in unwanted degradation of the RNA: DNA hybrid formed in the first step of the process. There are two main ways to overcome this problem. One is to physically separate RNase H from the rest of the reverse transcription reaction by using a wax-like membrane that can melt during the high temperatures of the beginning of the DNA denaturation step. The second method is to modify RNase H to inactivate at reverse transcription temperature which is generally 45-55 ° C. Several methods are known in the art, including reacting RNase H with an antibody or including reversible chemical modifications. The various RNases H used in the disclosed method will be described in detail later.

Examples of RNAse H enzymes that can be used in the present invention are disclosed in US Patent Application No. 2009/0325169 to Walder et al., Which is incorporated herein by reference.

One step reverse transcriptase-PCR offers several advantages over unlinked reverse transcriptase-PCR. One step reverse transcriptase-PCR is the handling of reaction mixture reagents and nucleic acid products compared to unlinked reverse transcriptase-PCR (e.g., opening a reaction tube for the addition of components or enzymes between two reactions). Are less demanding, thus less labor intensity and less time required. One step reverse transcriptase-PCR also requires less sample and can reduce the risk of contamination. The sensitivity and specificity of one-step reverse transcriptase-PCR has proven to be suitable for studying the expression level of one or several genes in the detection of a given sample or pathogenic RNA. In general, this process limits the use of gene-specific primers to initiate cDNA synthesis.

The ability to measure the kinetics of PCR reactions by real-time detection in combination with these reverse transcriptase-PCR techniques allows for accurate and precise determination of RNA copy numbers with high sensitivity. This is accomplished during the amplification process by a fluorescent double-labeled hybridization probe technique, such as a 5 'fluorescence generating nuclease assay (eg TaqMan) or endonuclease assay (eg CataCleave), which will be described below. It is possible by detecting reverse transcriptase-PCR products through fluorescence monitoring and measurement of PCR products.

Detection of post-amplified amplicons is time consuming and labor intensive. Real time methods were developed to monitor amplification during the PCR process. These methods generally use a fluorescently labeled probe that binds to newly synthesized DNA or a die that increases in fluorescence emission when intercalated to two strands of DNA.

The probe is generally designed so that donor emission can be extinguished by fluorescence resonance energy transfer (FRET) between two chromophores in the absence of a target. A donor chromophore transfers energy to an acceptor chromophore in an excited state when the pair of chromophores is located at close range. This transfer always occurs non-radially, through dipole-dipole coupling. Any process that sufficiently increases the distance between chromophores reduces the FRET efficiency, allowing radiological detection of donor chromophore emissions. Common acceptor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, Texas Red, and the like. The acceptor chromophore is chosen so that the emission spectrum and the excitation spectrum of the donor can overlap. For example, this binding pair is FAM-TAMRA. There may also be non-fluorescent acceptors that quench a wide range of donors. Other examples of suitable donor-acceptor FRET pairs are well known to those skilled in the art.

Common examples of FRET probes that can be used for real-time detection of PCR include molecular beacons, TaqMan probes (eg, US Pat. Nos. 5,210,015 and 5,487,972), and CataCleave probes (eg, US Patent No. 5,763,181). Molecular beacons are single-stranded oligonucleotides, in which the probes are designed to form secondary structures that are close to donor and acceptor chromophores, which can reduce donor release. At the appropriate reaction temperature, the beacons are unstructured and in particular bind to amplicons. Once unwound, the distance between the donor and acceptor chromophore increases, causing the FRET to change, allowing the use of a special instrument to monitor donor emission. TaqMan and CataCleave techniques differ from molecular beacons in that the FRET probes used are cleaved, causing the donor and acceptor chromophores to fall far enough to alter the FRET.

The TaqMan technique utilizes a single stranded oligonucleotide probe labeled with a donor chromophore at the 5 'end and an acceptor chromophore at the 3' end. The DNA polymerase used for amplification must have 5 '-> 3' exonuclease activity. TaqMan probes bind to one strand of the amplicon as the primers bind. While the DNA polymerase stretches the primer, the polymerase will eventually encounter the bound TaqMan probe. At this point, the exonuclease activity of the polymerase will degrade the TaqMan probe sequentially starting at the 5 'end. As the probe is degraded, the mononucleotide containing the probe comes out of the reaction buffer. As the donor diffuses from the acceptor, the FRET changes. Release from the donor is monitored to confirm probe cleavage. Because of the action of TaqMan, a particular amplicon can only be detected once every cycle of PCR. Extension of the primer through the TaqMan target site produces a double stranded product and prevents further binding of the TaqMan probe until the amplicon is denatured in the next PCR cycle.

The content of US Pat. No. 5,763,181, incorporated herein by reference, discloses another real-time detection method (named CataCleave). The CataCleave technique differs from TaqMan in that cleavage of the probe is performed by secondary enzymes lacking polymerase activity. CataCleave probes have a sequence in the target molecule of an endonuclease such as, for example, a restriction enzyme or an RNase. In one embodiment, the CataCleave probe has a chimeric structure, wherein the 5 'and 3' ends of the probe are made of DNA and the cleavage site is made of RNA. The DNA sequence portion of the probe is labeled with a FRET pair at or inside the sock end. The PCR reaction includes an RNase H enzyme that can specifically cleave the RNA sequence portion of the RNA-DNA double strand. After cleavage, both halves of the probe dissociate in the target amplicon at the reaction temperature and disperse into the reaction solution. As the donor and acceptor are separated, the FRET is changed in the same way as the TaqMan probe, and donor emission can be monitored. Cleavage and dissociation will reproduce sites for further CataCleave binding. In this way, a single amplicon can be repeated multiple times as a target or probe cleavage until the primer is stretched through the CataCleave probe binding site.

In one embodiment, the probe used in the method is a CataCleave probe. Examples of suitable CataCleave probes include oligonucleotides comprising one of the sequences of SEQ ID NOs: 17 or 18. In one embodiment, the probe is one of the sequences of SEQ ID NOs: 12, 13, or 14.

The sequences of SEQ ID NOs: 1-14 and 16-18 are shown in Table 1 below.

Table 1

SEQ ID NO:	order	Primer / Probe Name
One	TTAACGAGCTGTATGTCGTGAGAAT	O157-IF
2	AACGAGCTGTATGTCGTGAGAATC	O157-I-F1
3	CCCTCCAAATGAAATTCCAACA	O157-I-F2
4	GGCTTTGTTGCAAGGCTATG	O157-I2-F
5	CGAGCTGTATGTCGTGAGAATC	O157-I3-F
6	CAAGCCTATTCAGAGCATGG	O157-I4-F
7	ATGGATCATCAAGCTCTAAGAAAGAAC	O157-IR
8	AGTGTCGTCTGTATGGATCATCAAG	O157-I-R1
9	CCTCAAGCGAAGATGCAAAAT	O157-I-R2
10	TGGATCATCAAGCTCTAAGAAAGAAC	O157-I-R3
11	GATTGCAACTGCTCATCAGG	O157-I2-R
12	ATAGGCTTrGrArArGCAGTGCA, wherein the rG and 9th-12th positions may be ribonucleotides.	O157-I-P1
13	ATAGGCTTrGrArArGCAGTGCAT, wherein the rG and 9-12th positions may be ribonucleotides.	O157-I-P2
14	TCAGAGCATGrGrArArATAAAACTT, the rG and positions 11-14 may be ribonucleotides.	O157-I-P3
16	X ₁ X ₁ X ₂ X ₂ CGAGCTGTATGTCGTGAGAATX ₃ X ₁ does not exist in the 1st and 2nd positions or T, X ₂ does not exist in the 3rd and 4th positions, or A, 2nd X ₃ does not exist Or is C
17	ATAGGCTTGAAGCAGTGCAX ₁ , wherein X ₁ is absent or at least three consecutive nucleotides at positions 9-14 are ribonucleotides.
18	TCAGAGCATGGAAATAAAACTT, wherein three or more consecutive nucleotides at positions 10-14 are ribonucleotides.

Probes of SEQ ID NO: 12, 13, 14, 17 or 18 may have a detectable label bound to the 5 'and 3' ends, respectively. In one embodiment, the 5 'terminus may be FAM (6-carboxyfluorescein), and the 3' terminus may be coupled to Black Hole Quencher (BHQ) for short wavelength emission.

In one embodiment, the kit for detecting E. coli 0157: H7 in a sample comprises the oligonucleotides described above.

The kit further comprises a reagent for nucleic acid amplification. The reagent may further comprise one or more selected from the group consisting of one or more dNTPs, rNTPs, nucleic acid polymerases, uracil N-glycosylase (UNG) enzymes, buffers, and cofactors (eg, Mg ²⁺ ). Can be. The nucleic acid polymerase may be selected from the group consisting of DNA polymerase, RNA polymerase, and reverse transcriptase. The nucleic acid polymerase may be heat stable. The nucleic acid polymerase may retain its activity, for example, at increased temperatures of 95 ° C. or higher. Thermostable DNA polymerase is isolated from heat-resistant bacteria selected from the group consisting of Thermus aquaticus, Thermus flavus, Thermus ruber, Thermus thermophilus, Bacillus stearothermophilus, Thermus lacteus, Thermus rubens, Thermotoga maritima, Thermococcus littoralis, and Methanothermus fervidus. have. An example of a thermostable DNA polymerase is Taq polymerase. The Taq polymerase is known to have optimal activity at about 70 ° C.

When the probe is hybridized with the target DNA, the E. coli 0157: H7 detection kit may further include an element capable of specifically cleaving an RNA portion of the DNA-RNA hybrid. The cleavage element may be RNase H. The cleavage element can cleave the RNA portion either specifically or nonspecifically. The specific RNA cleavage element may be RNase HI. The nonspecific RNA cleavage element may be RNase HII. RNase H can hydrolyze RNA in RNA-DNA hybrids. For the activity of RNase H, divalent ions (eg Mg ²⁺ , Mn ²⁺ ) are required. RNase H cleaves RNA 3'-OP bonds to produce 3'-hydroxyl and 5'-phosphate end products. RNase H may be selected from the group consisting of Pyrococcus furiosus RNase HII, Pyrococcus horikoshi RNase HII, Thermococcus litoralis RNase HI, and Thermus thermophilus RNase HI. The RNase H may be heat stable. For example, the RNase H can maintain its activity during denaturation in PCR. The cleavage element may be reversibly modified in the form of a thermostable RNase HII, which is inactivated in the modified form and activated in the unmodified form, wherein the modification is the binding of the RNase HII to the ligand, the intersection of the RNase HII Binding, or chemical reaction of amino acid residues in RNase HII, and the enzymatic activity of the modified RNase HII can be restored by adjusting the pH of the sample comprising the RNase HII or by applying heat.

The RNA portion of the probe, including the DNA sequence and the RNA sequence, is cleaved by the cleavage element and separated. This separation can occur spontaneously by decreasing the melting temperature of the cleaved composite or can be enhanced by factors such as temperature rise. Separate fragments can be detected by several methods known in the art.

In one embodiment, a method of detecting E. coli 0157: H7 in a sample comprises the following steps: (a) amplifying a target nucleic acid of E. coli 0157: H7 in a sample to increase the copy number of the target nucleic acid As a step, the amplification is carried out in the sample a first primer comprising a nucleotide sequence of SEQ ID NO: 16, 3, 4, or 6 and a second primer comprising a nucleotide sequence of SEQ ID NO: 7, 8, 9, 10 or 11 Hybridizing with a target nucleic acid to obtain a hybridized product of the target nucleic acid and the primers, and extending the first and second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product. Comprising; (b) hybridizing the target nucleic acid with one or more probe oligonucleotides that can hybridize with the target nucleic acid to obtain a hybridization product of the target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence and is detected Possible markers are linked; (c) contacting the hybridized product of the target nucleic acid : probe with RNase H to cleave the probe to cause separation of the probe fragment from the target nucleic acid; And (d) detecting the detectable label. In one embodiment, the first primer may comprise the sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may comprise a sequence of SEQ ID NO: 12, 13, or 14.

Amplification of the target sequence in the sample may be performed by a nucleic acid amplification method such as Polymerase Chain Reaction or Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence Based Amplification (NASBA), Cleavage Fragment Length Polymorphism, Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acid, Ramification-extension Amplification Method or appropriate amplification methods for amplification of nucleic acids can be performed.

In one embodiment, the method comprises amplifying a target nucleic acid fragment of E. coli 0157: H7, wherein the amplifying step comprises a first primer of SEQ ID NO: 16, 3, 4, or 6 and SEQ ID NO: 7, 8, 9 Hybridizing a second, 10, or 11 second primer to a target nucleic acid in a sample to obtain a hybridized product; And expanding the primers of the hybridized product using template-dependent nucleic acid polymerase to produce an expanded primer product; Hybridizing the target nucleic acid fragment with the probe of SEQ ID NO: 17 or 18 to obtain a hybridized product; Cleaving the probe by contacting RNase H with the product hybridized from the target nucleic acid fragment and the probe to separate the probe fragment from the hybridized product; And detecting the detectable label. In one embodiment, the first primer may be one of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may be one of SEQ ID NO: 12, 13, or 14.

Hereinafter, the method will be described in more detail. The method comprises amplifying a target nucleic acid fragment of E. coli 0157: H7, wherein the amplifying step comprises a first primer of SEQ ID NO: 16, 3, 4, or 6 and SEQ ID NO: 7, 8, 9, 10, or 11 Hybridizing a second primer of to a target nucleic acid in a sample to obtain a hybridized product; And expanding the primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an expanded primer product. In one embodiment, the first primer may have a sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6. In one embodiment, the probe may have a sequence of SEQ ID NO: 12, 13, or 14.

The hybridization can be carried out in a liquid medium. Appropriate liquid medium can be selected as needed. The liquid medium can be, for example, water, buffers, or PCR mixtures. Examples of buffers may include, but are not limited to, PBS, Tris, MOPS, and Tricine. The hybridization can be performed under conditions that can enhance the binding of the primer and target nucleic acid, for example, can be low temperature and low salt concentration. Conditions for enhancing these hybridizations are well known in the art. The target nucleic acid can be a single-stranded or double-stranded nucleic acid. For example, a double-stranded target nucleic acid can be modified to separate into single strands. The target nucleic acid may be DNA or RNA.

Expansion of the primer depending on the template means polymerization, which is well known in the art. The nucleic acid polymerase may be heat stable.

Methods of detecting E. coli include hybridizing a target nucleic acid fragment with a probe of SEQ ID NO: 17 or 18 to obtain a hybridized product. As the probe, the sample probe described above may be used. In one embodiment, the probe has a sequence of SEQ ID NO: 12, 13, or 14. The probe may be labeled with a detectable label such as, for example, a visually detectable label. The detectable label is well known in the art and may be appropriately selected. For example, FRET pairs can be used for the purpose of detecting target sequences according to one embodiment of the invention.

The hybridization can be carried out in a liquid medium. Appropriate liquid medium can be selected as needed. The liquid medium can be, for example, water, buffers, or PCR mixtures. Examples of buffers may include, but are not limited to, PBS, Tris, MOPS, and Tricine. The hybridization can be performed under conditions that can enhance the binding of the primer and target nucleic acid, for example, can be low temperature and low salt concentration. Conditions for enhancing these hybridizations are well known in the art. The target nucleic acid can be a single-stranded or double-stranded nucleic acid. For example, a double-stranded target nucleic acid can be denatured to separate into single strands, as described above. The target nucleic acid may be DNA or RNA.

The method of detecting E. coli 0157: H7 includes cleaving the probe by contacting RNase H with the product hybridized with the product from the target nucleic acid fragment and separating the probe fragment from the hybridized product. The hybridized product and RNase H may be contacted with each other in a liquid medium. Appropriate liquid medium can be selected as needed. The liquid medium can be, for example, water, buffers, or PCR mixtures. Examples of buffers may include, but are not limited to, PBS, Tris, MOPS, and Tricine. The hybridization can be performed under conditions that can enhance the binding of the primer and target nucleic acid, for example, can be low temperature and low salt concentration.

The RNase H may be RNase HI or RNase HII. RNase H can hydrolyze RNA in RNA-DNA hybrids. For the activity of RNase H, divalent ions (eg Mg ²⁺ , Mn ²⁺ ) are required. RNase H cleaves RNA 3'-OP bonds to produce 3'-hydroxyl and 5'-phosphate end products. RNase H may be selected from the group consisting of Pyrococcus furiosus RNase HII, Pyrococcus horikoshi RNase HII, Thermococcus litoralis RNase HI, and Thermus thermophilus RNase HI. The RNase H may be heat stable. For example, the RNase H can maintain its activity during denaturation in PCR. The cleavage element may be reversibly modified in the form of a thermostable RNase HII, which is inactivated in the modified form and activated in the unmodified form, wherein the modification is the binding of the RNase HII to the ligand, the intersection of the RNase HII Binding, or chemical reaction of amino acid residues in RNase HII, and the enzymatic activity of the modified RNase HII can be restored by adjusting the pH of the sample comprising the RNase HII or by applying heat.

This separation may occur naturally by the binding force of the strands weakened by cleavage or may be enhanced by factors such as an increase in temperature. For example, the PCR mixture may comprise an RNase H enzyme that can specifically cleave the RNA sequence portion of the RNA-DNA duplex. After cleavage, two halves of the probe are separated from the target amplicon at the reaction temperature and diffuse into the reaction buffer. When the donor and acceptor are separated, the FRET is reversed and donor release is monitored. Cleavage and dissociation regenerate the sites to which the probe can further bind. In this way, a single amplicon can serve as a plurality of targets for probe cleavage until the primer is extended through the probe binding site.

The method for detecting E. coli 0157: H7 comprises the probe nucleic acid fragment.

One exemplary method of detecting a target E. coli 0157: H7 sequence is to provide a food sample or surface extract, mix the sample or extract and the growth medium, and incubate the number of E. coli 0157: H7 or Increasing the population (enrichment), crushing the E. coli cells (lysis), and lysate obtained above for amplification and detection of the target E. coli 0157: H7 sequence. Applying steps. Food samples include fish such as salmon, dairy products such as milk and eggs, poultry, fruit juice, ground pork, pork, ground beef or meat such as beef, vegetables such as spinach, or stainless steel, rubber, plastic, and ceramics. It may include the surface of the same natural environment, but is not limited thereto.

The limit of detection (LOD) for food contamination is described in terms of the number of colony forming units (CFUs) that can be detected on the surface of 25 g solid or 25 ml liquid food or confined spaces. . By definition, colony forming units are a measure of the number of living bacteria. Unlike indirect microscopy, which counts all dead or living cells, CFU measures live cells. One CFU (one bacterial cell) grows and forms one colony on agar plates under acceptable conditions. The United States Food Testing Inspection Service defines a minimum LOD of 1 CFU per solid food of 25 g of solid food or 25 mL of liquid food or 1 CFU per surface area.

Indeed, it is not possible to repeatedly inoculate a food sample or surface at 1 CFU and allow bacteria to survive in the suspension process. This problem can be overcome by inoculating samples at one or several target levels and analyzing the results using a statistical assessment called the Most Probable Number (MPN). E.g,E. coli Cultures can be grown to specific cell densities by measuring absorbance on a spectrometer.remind Plates in agar medium through 10-fold serial dilutions of the target and count live bacteria. This data is used to generate a standard curve for CFU / volume against smeared cell density. In order for MPN to be meaningful, test samples at different inoculation levels are analyzed. After suspension and extraction, a small amount of sample is removed for real-time analysis. The final goal is the fractionality of 25% to 75% (ie, between 25% and 75% of positive sample tests in assays using reverse transcriptase-PCR using CataCleave probes, which will be described below). recovery is achieved. The reason for choosing this percentage of validity is that it converts to a MPN value between 0.3 CFU and 1.375 CFU for a 25 g sample of solid food, 25 mL sample of liquid food, or a limited space on the surface. These MPN values can be tied to the LOD of 1 CFU / sample required. in reality,It is possible to measure (based on a standard curve) the volume of diluted inoculum to achieve their validity..

According to one embodiment, the kit comprises a mixture comprising dATP, dCTP, dGTP and dTTP; DNA polymerase; RNase H II; And a buffer solution.

The DNA polymerase may be, for example, a heat stable DNA polymerase obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus (Pfu). In addition, RNase H includes, but is not limited to, thermally stable RNase H enzymes such as, for example, Pyrococcus furiosus RNase H II, Pyrococcus horikoshi RNase H II, Thermococcus litoralis RNase HI or Thermus thermophilus RNase HI. Buffer solutions are compounds that are added to amplification reactions that modify the stability, activity, and / or lifetime of one or more components of the amplification reaction by adjusting the pH of the amplification reaction, and such buffer solutions are well known in the art, For example, it may be, but is not limited to, Tris, Tricine, MOPS, or HEPES. In addition, the kit may comprise a dNTP mixture (dATP, dCTP, dGTP, dTTP) and a DNA polymerase cofactor. The primer set and probe may be packaged in one reaction vessel, strip or microplate, and may be packaged by methods known in the art.

Another aspect includes obtaining a lysate of E. coli 0157: H7 from a subject sample; Mixing the lysate with the kit to perform real-time PCR; And it provides a method for detecting E. coli O157: H7 comprising the step of confirming the presence of E. coli O157: H7 from the real-time PCR results.

The method for detecting E. coli 0157: H7 will be described in detail for each step.

The method may include obtaining a lysate of E. coli 0157: H7 from the sample of interest.

The detection method according to one embodiment may be applied to a sample that is expected to be contaminated with E. coli 0157: H7. The sample may include, but is not limited to, for example, cultured cells, body fluids such as blood, saliva, and foods such as meat, dairy products, beverages, and the like. Since the lysate contains the DNA of E. coli 0157: H7, it can be used as a template for the real-time PCR reaction in a later step. Methods for obtaining the lysate include, for example, 1 mg / ml proteinase K, 0.3125 mg / ml sodium azide, 0.125% Triton X-100, and 12.5 mM Tris-HCl, pH 8.0 E. coli O157: H7 can be added to the solution to dissolve the solution. In addition, the DNA may be extracted from the lysate according to a method known in the art to be used as a template for real-time PCR reaction. Specific methods of extracting DNA from the lysate are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001), which is herein incorporated by reference. Inserted by reference.

Mixing the lysate and the kit may include performing a real-time PCR.

According to one embodiment, the E. coli 0157: H7 detection kit can be carried out using conventional real-time PCR methods and apparatus. The real-time PCR method is a method of detecting and quantitating fluorescence appearing in real time every cycle of PCR by the principle of DNA polymerase and FRET using a device in which a thermal cycler and a spectral fluorescent photometer are integrated. This method distinguishes specific amplification products from non-specific amplification products and makes it easy to obtain analysis results in an automated fashion. Devices that can be used in the real-time PCR method include, but are not limited to, AB real-time PCR devices 7900, 7500, 7300, Stratagene Mx3000p, BioRad Chromo 4 and Roche Lightcycler 480 devices. In the PCR process, the laser of the real-time PCR device may implement a peak as shown in FIG. 1 by detecting a fluorescent labeling factor labeled on a probe of the amplified PCR product.

In the method for detecting E. coli 0157: H7 according to one embodiment, the real-time PCR reaction can be carried out under conventional conditions known in the art, for example, initial denaturation at 95 ° C. for 10 minutes. And then subjected to denaturation (15 seconds at 95 ° C.), annealing of primers and probes, reaction of RNase HII and elongation (20 seconds at 60 ° C. or 63 ° C.) for a total of 50 to 60 times. Can be done. According to one embodiment, a total of 63 E. coli 0157: H7 can be detected by the method.

It may include the step of confirming the presence of E. coli O157: H7 from the real-time PCR results.

The E. coli O157: H7 is the presence or absence of the cycle number at which the C _p value from the curve appears to detect a fluorescent marker labeling the probe of the PCR product amplified by the real-time PCR process, PCR amplification product was amplified a predetermined amount It can confirm by calculating. For example, the C _p value may be determined that the E. coli 0157: H7 is present at 10 to 50, or 15 to 45. Meanwhile, the calculation of the C _p value may be automatically performed by a program included in the real time PCR device.

Samples that can be tested for the detection of E. coli O175: H7 are, but are not limited to, meat (eg beef including ground beef), vegetables (eg spinach), fruit juice and the like.

According to the E. coli O157: H7 species detection kit and the detection method using the kit, the detection result can be quickly confirmed in real time even with a small number of samples.

According to the E. coli 0157: H7 detection method according to one embodiment, the detection result can be quickly confirmed in real time even with a small number of samples.

Figure 1a is a result showing the amplification curve by real-time PCR reaction for E. coli O157: H7 using a kit according to one embodiment, Figure 1b shows the Cp value determined from the data of Figure 1a.

Figure 2 shows the amplification curves by real-time PCR reaction for a total of 63 E. coli O157: H7 species using a kit according to one embodiment.

3A to 3C show amplification curves by real-time PCR reactions on a total of 59 non- E. Coli O157: H7 species, compared to O157: H7 species using a kit according to one embodiment. The kits and methods according to one embodiment show high accuracy. The 59 species were divided into three groups and tested.

4A and 4B show amplification curves by real-time PCR reactions of E. coli O157: H7 species using various combinations of primers and probes. FIG. 4A shows fluorescence curves and FIG. 4B shows Cp values. Indicates.

Hereinafter, one or more embodiments will be described in more detail with reference to Examples. However, these examples are provided to illustrate one or more embodiments illustratively and the scope of the present invention is not limited to these examples.

실시예 1: Example 1: E. coliE. coli O157:H7의 실시간 검출을 위한 프라이머 및 프로브 제작 Prepare primers and probes for real-time detection of O157: H7

It was confirmed that the primer used for the real-time detection of E. coli 0157: H7 was a primer base sequence capable of amplifying only a part of the I fragment of E. coli 0157: H7. The I segment was at a position of 312001-315400 of the E. coli 0157: H7 genome (GenBank: AE005174.2.). A polynucleotide (1720 bp) of a portion of the I fragment was used in one embodiment and is shown in SEQ ID NO: 15 in Sequence Listing.

Table 1 shows the sequences of representative primers designed according to one embodiment.

The probe was prepared by catacleave probe (Catacleave ^TM probe) that can specifically bind to the template target of the PCR to be able to detect the amount of the PCR product to increase in real time in real time PCR. The 5 'end was labeled with 6-carboxyfluorescein (FAM) and the 3' end was labeled with Black Hole Quencher (Integrated DNA Technologies, Coralville, IA). The determined primers and probes were synthesized by the Roche company.

Representative sequences of the probes designed in Table 1 are shown. In addition, the probe sequence shows a label linked to the nucleotide.

실시예 2: 실시간 PCR을 이용한 Example 2: Using Real-Time PCR E. coliE. coli O157:H7의 증폭 Amplification of O157: H7

Total DNA of E. coli 0157: H7 for use as a template in real-time PCR was extracted by the following method. Appropriately cultured E. coli 0157: H7 was harvested to produce 1 mg / ml proteinase K, 0.3125 mg / ml sodium azide, 0.125% Triton X-100, and 12.5 mM Tris-HCl, pH 8.0 After dilution in 45 μl lysis solution containing, the samples were incubated at 55 ° C. for 15 minutes, inactivated proteinase K at 95 ° C. for 10 minutes, and then cooled to 4 ° C. The reaction was centrifuged to obtain a supernatant, and then the supernatant itself or DNA extracted from the supernatant was added to the real time PCR reaction according to DNA extraction methods known in the art.

All real-time PCR reactions in this example were performed by mixing 23 μl and 1 μl DNA in 1656 μl master mix. The master mix contained 180 μl of 10 × I buffer (10 × I buffer is HEPES-containing buffer (HEPES-KOH, MgCl ₂ , KCl, BSA, DMSO)), 20 μM of forward primer (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4) 72 μl, 20 μM reverse primer (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 11) 72 μL, 25 μM CataCleave probe (SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14) 14.4 μl, dNTP mix (2 mM dGTP, dCTP, dATP, dTTP) 72 μl, 36 μl Platinum Taq DNA Polymerase (Invitrogen), 14.4 μl RNase HII (Invitrogen), uracil DNA N- 7.2 μl glycosylase and 1188 μl distilled water were included.

The reactants were first subjected to uracil DNA N-glycosylase reaction and denaturation for 10 minutes at 37 ° C and 10 minutes at 95 ° C, followed by denaturation at 95 ° C for 15 seconds, primers at 60 ° C or 63 ° C for 20 seconds. And annealing (catalyst) probe, the reaction of RNase HII and elongation (50) was repeated 50 times to perform a real-time PCR reaction. After the repetition process, the mixture was cooled at 40 ° C. for 10 seconds. The reaction was performed using a Roche Lightcycler 480 instrument, and PCR amplification was observed in real time using LightCycler 480 Software v1.5.0.

The results are shown in Tables 2 to 3 and FIGS. 4A to 4B. In Tables 2 to 3 and FIGS. 4A-4B, the primers are according to the following sequence:

0157-I-F: SEQ ID NO: 1

0157-I-F1: SEQ ID NO: 2

0157-I-F2: SEQ ID NO: 3

0157-I2-F: SEQ ID NO: 4

0157-I-R: SEQ ID NO: 7

0157-I-R1: SEQ ID NO: 8

0157-I-R3: SEQ ID NO: 10

0157-I2-R: SEQ ID NO: 11

TABLE 2

Copy number	Log	O157-I-F2 / O157-I-R3	O157-I2-F / O157-I2-R	O157-I3-F / O157-IR	O157-I3-F / O157-I-R3	O157-I4-F / O157-I-R2
0.E + 00
5.E + 00	0.7
5.E + 01	1.7	32.85	41.37	34.33	45.00	35.76
5.E + 02	2.7	30.44	34.82	30.56	31.35	32.16
5.E + 03	3.7	27.05	31.39	26.66	26.67	28.63
5.E + 04	4.7	23.36	25.87	23.05	23.15	24.30
5.E + 05	5.7	19.33	22.01	19.11	18.72	20.20
5.E + 06	6.7	16.58	18.24	16.42	15.93	17.95
Slope		-3.38	-4.56	-3.64	-5.34	-3.69
Y-Intercept		39.14	48.10	40.32	49.21	42.01
PCR Efficiency		97.6	65.7	88.1	54.0	86.5

TABLE 3

Copy number	Log	O157-IF / O157-IR	O157-IF / O157-I-R1	O157-IF / O157-I-R3	O157-I-F1 / O157-IR	O157-I-F1 / O157-I-R3	O157-I-F2 / O157-IR
0.E + 00
5.E + 00	0.7		37.75	35.83
5.E + 01	1.7	32.26	31.41	34.09	34.14	34.23	36.00
5.E + 02	2.7	30.40	29.38	29.59	31.40	30.62	31.12
5.E + 03	3.7	26.14	25.87	26.70	28.06	26.66	27.49
5.E + 04	4.7	22.26	21.67	21.86	23.72	23.08	23.96
5.E + 05	5.7	18.16	17.68	18.01	19.80	19.06	19.82
5.E + 06	6.7	15.61	14.91	15.23	17.23	16.36	17.25
Slope		-3.54	-3.70	-3.63	-3.53	-3.65	-3.75
Y-Intercept		39.00	39.22	39.34	40.56	40.31	41.68
PCR Efficiency		91.7	86.2	88.5	91.9	88.0	84.8

실시예 3: 일 구체예에 따른 프로브를 이용한 Example 3: using a probe according to one embodiment E. coliE. coli O157:H7의 검출 Detection of O157: H7

For E. coli O157: H7, primer sets of O157-I-F1 (SEQ ID NO: 2) and O157-IR (SEQ ID NO: 7) and three different probes (O157-I-P1 (SEQ ID NO: 12) ), 0157-I-P2 (SEQ ID NO: 13) and 0157-I-P3 (SEQ ID NO: 14)) were used to perform real-time PCR. 1A and 1B show amplification curves, fluorescence records, and Cp values by the real-time PCR reaction. In addition, Table 4 is a result of calculating the C _p value from the amplification curve of Figure 1a. The initial copy number of the template in this experiment was 5,000,000 copies. The following results show that when performing a real-time PCR reaction using the primer set and the probe of O157-I-P2 (SEQ ID NO: 13), it is possible to amplify only 5 copies. On the other hand, no fluorescence was detected in the negative control group in which distilled water was added instead of the DNA template.

Table 4

Copy number	Log	O157 I-P1	O157 I-P2	O157 I-P3
0.E + 00
5.E + 00	0.7		37.24
5.E + 01	1.7	34.76	34.43	35.28
5.E + 02	2.7	30.86	30.95	32.30
5.E + 03	3.7	27.44	27.60	28.68
5.E + 04	4.7	23.74	23.75	24.94
5.E + 05	5.7	19.85	19.92	21.06
5.E + 06	6.7	16.94	16.95	18.17
Slope		-3.60	-3.47	-3.51
Y-Intercept		40.69	40.09	41.50
PCR Efficiency		89.7	94.3	92.5

실시예 4: Example 4: E. coliE. coli O157:H7의 포괄성 테스트(inclusivity test) Inclusivity test of O157: H7

Inclusion was tested for a total of 63 E. coli 0157: H7 species shown in Table 4 using the primer sets and probes used in Example 3. In this example, real-time PCR was performed using DNA at a concentration of 50,000 cfu / ml, which is 10 times the limit of detection (LOD). Figure 2 is a result showing the amplification curve by the real-time PCR reaction. In addition, Table 5 below shows the results obtained by calculating the C _p value from the amplification curve of FIG. 2.

From the following results, when performing a real-time PCR reaction using the primer set (SEQ ID NO: 2 and SEQ ID NO: 7) and the O157-I-P2 (SEQ ID NO: 13), PCR in all 63 E. coli O157: H7 The product was detected (100% coverage) with an average C _p value of 32.57.

Table 5

STA #	Serovar Name	Cp	RFU
0070010002	Escherichia coli O157: H7	33.47	7.095
0070010003	Escherichia coli O157: H7	33.42	7.359
0070010004	Escherichia coli O157: H7	32.72	7.722
0070010005	Escherichia coli O157: H7	32.78	7.682
0070010006	Escherichia coli O157: H7	32.64	7.389
0070010007	Escherichia coli O157: H7	32.31	7.342
0070010008	Escherichia coli O157: H7	31.74	7.543
0070010009	Escherichia coli O157: H7	32.87	7.032
0070010010	Escherichia coli O157: H7	32.06	7.373
0070010011	Escherichia coli O157: H7	32.20	7.527
0070010012	Escherichia coli O157: H7	32.27	7.800
0070010013	Escherichia coli O157: H7	32.46	8.125
0070010014	Escherichia coli O157: H7	31.87	7.713
0070010015	Escherichia coli O157: H7	31.64	8.183
0070010016	Escherichia coli O157: H7	32.16	7.659
0070010017	Escherichia coli O157: H7	32.14	7.494
0070010018	Escherichia coli O157: H7	33.23	7.254
0070010019	Escherichia coli O157: H7	32.26	7.727
0070010020	Escherichia coli O157: H7	33.07	7.766
0070010021	Escherichia coli O157: H7	32.15	7.747
0070010022	Escherichia coli O157: H7	32.43	7.924
0070010023	Escherichia coli O157: H7	32.97	7.623
0070010024	Escherichia coli O157: H7	32.98	8.065
0070010025	Escherichia coli O157: H7	32.50	7.776
0070010026	Escherichia coli O157: H7	32.52	7.003
0070010027	Escherichia coli O157: H7	32.16	7.488
0070010028	Escherichia coli O157: H7	32.26	7.518
0070010029	Escherichia coli O157: H7	32.71	7.882
0070010030	Escherichia coli O157: H7	31.79	7.802
0070010031	Escherichia coli O157: H7	32.57	7.793
0070010032	Escherichia coli O157: H7	32.54	7.716
0070010033	Escherichia coli O157: H7	32.57	7.740
0070010034	Escherichia coli O157: H7	32.64	6.956
0070010035	Escherichia coli O157: H7	33.56	7.468
0070010036	Escherichia coli O157: H7	33.66	8.055
0070010037	Escherichia coli O157: H7	32.68	7.995
0070010038	Escherichia coli O157: H7	32.77	7.776
0070010039	Escherichia coli O157: H7	32.77	8.037
0070010040	Escherichia coli O157: H7	32.62	7.587
0070010041	Escherichia coli O157: H7	32.19	7.394
0070010042	Escherichia coli O157: H7	32.63	7.140
0070010043	Escherichia coli O157: H7	32.87	7.261
0070010044	Escherichia coli O157: H7	32.54	7.772
0070010045	Escherichia coli O157: H7	32.45	8.123
0070010046	Escherichia coli O157: H7	32.46	8.123
0070010047	Escherichia coli O157: H7	32.90	7.642
0070010048	Escherichia coli O157: H7	32.47	7.667
0070010049	Escherichia coli O157: H7	32.19	7.597
0070010050	Escherichia coli O157: H7	32.92	6.996
0070010051	Escherichia coli O157: H7	32.67	7.148
0070010052	Escherichia coli O157: H7	33.00	7.598
0070010053	Escherichia coli O157: H7	31.62	7.996
0070010054	Escherichia coli O157: H7	32.85	7.610
0070010055	Escherichia coli O157: H7	32.76	7.759
0070010056	Escherichia coli O157: H7	32.33	7.615
0070010057	Escherichia coli O157: H7	32.91	7.675
0070010058	Escherichia coli O157: H7	32.53	7.092
0070010059	Escherichia coli O157: H7	32.78	7.333
0070010060	Escherichia coli O157: H7	32.62	8.023
0070010061	Escherichia coli O157: H7	32.02	8.274
0070010062	Escherichia coli O157: H7	32.21	7.933
0070010063	Escherichia coli O157: H7	32.86	7.769
0070010064	Escherichia coli O157: H7	32.70	7.782
Negative Control			0.637
Positive Control (100 copies O157 I fragment)		32.24	7.630

The results show that the primers and probes according to the invention can detect all E. coli 0157: H7 species tested with high sensitivity.

실시예 5: Example 5: E. coliE. coli O157:H7의 배타성 테스트(exclusivity test) Exclusivity test of O157: H7

A total of 59 non- E. Coli 0157: H7 species shown in Tables 6 to 8 were tested for exclusivity using the primer sets and probes used in Example 3.

Real time PCR was performed using DNA from the maximal density culture (about 2 × 10 ⁹ cfu / mL) as a template. 3A to 3C show the amplification curves by real-time PCR reactions for each species shown in Tables 6 to 8, respectively. In addition, Tables 5a to 5c are the results obtained by calculating the C _p values from the amplification curves of FIGS. 3a to 3c.

From the following results, when performing a real-time PCR reaction using the primer set (SEQ ID NO: 2 and SEQ ID NO: 7) and the probe of O157-I-P2 (SEQ ID NO: 13), 58 non- E. Coli O157: H7 No PCR product was detected in the species (98.3% exclusivity). The E. coli O55: H7 species, which showed cross-reaction in this example, are derived from the E. coli O157: H7 species, so it is believed that the PCR product was generated from the primer set and the cataclibe probe.

Table 6

		O157 I (TYE563)
STA #	Serovar Name	Cp	RFU
0020010001	Aeromonas caviae		0.644
0020020001	Aeromonas hydrophila		0.652
0040010001	Citrobacter amalonaticus		0.648
0040020001	Citrobacter braakii		0.614
0040030001	Citrobacter freundii		0.611
0040040001	Citrobacter youngae		0.614
0050010001	Edwardsiella tarda		0.603
0060010001	Enterobacter aerogenes		0.580
0060020001	Enterobacter cancerogenous		0.617
0060030001	Enterobacter cloacae		0.645
0060040001	Enterobacter intermedia		0.661
0060050001	Enterobacter sakazakii		0.656
0070010001	Escherichia coli		0.644
0070020001	Escherichia fergusonii		0.605
0070030001	Escherichia vulneris		0.620
0080010001	Klebsiella pneumoniae		0.619
0090010001	Morganella morganii		0.670
0100010001	Proteus hauseri		0.706
0100020001	Proteus mirabilis		0.666
0100030001	Proteus vulgaris		0.673
0110010001	Pseudomonas aeruginosa		0.634
0110020001	Pseudomonas putida		0.794
0120010001	Serratia marcescens		0.631
0130010001	Shigella dysenteriae		0.617
0130020001	Shigella flexneri		0.627
0130030001	Shigella sonnei		0.647
0140010001	Vibrio cholera		0.707
0150010001	Yersinia enterocolitica		0.652
Campylobacter jejuni genomic DNA (1 mg)			0.766
Negative control			0.651
Positive Control (1x10 ³ copies O157 I fragment)		28.77	5.667

TABLE 7

		O157 I (TYE563)
STA #	Serovar Name	Cp	RFU
0070040001	Escherichia coli O157: H1		0.743
0070050001	Escherichia coli O157: H2		0.755
0070060001	Escherichia coli O157: H4		0.718
0070070001	Escherichia coli O157: H5		0.726
0070080001	Escherichia coli O157: H11		0.763
0070090001	Escherichia coli O157: H12		0.754
0070100001	Escherichia coli O157: H15		0.781
0070110001	Escherichia coli O157: H16		0.753
0070120001	Escherichia coli O157: H18		0.775
0070130001	Escherichia coli O157: H19		0.763
0070150001	Escherichia coli O157: H29		0.766
0070160001	Escherichia coli O157: H42		0.675
0070170001	Escherichia coli O157: H43		0.680
0070190001	Escherichia coli O157: H45		0.711
0070200001	Escherichia coli O157: HNM		0.708
0070210001	Escherichia coli O157: HN		0.707
0070230001	Escherichia coli O55: H7	17.88	6.078
0070240001	Escherichia coli O91: HNM		0.676
0070250001	Escherichia coli O111: H12		0.760
0070270001	Escherichia coli O117: H4		0.739
0070280001	Escherichia coli O103: H2		0.785
0070290001	Escherichia coli O115: HNM		0.731
0070300001	Escherichia coli O118: H12		0.704
0070310001	Escherichia coli O121: HNM		0.775
0070320001	Escherichia coli O142: HNM		0.800
0070330001	Escherichia coli O145: HNM		0.706
0070340001	Escherichia coli O146: H21		0.694
0070350001	Escherichia coli O163: H19		0.739
Negative Control			0.687
Positive Control (10000 copies O157 I fragment)		25.36	6.394

Table 8

		O157 I (TYE563)
STA #	Serovar Name	Cp	RFU
0070220001	Escherichia coli O26: H11		0.692
0070260001	Escherichia coli O111: H8		0.633
TSB only			0.684
Positive Control (1e7 copies O157 I fragment)		17.74	6.293

Using the primer sets and probes from the results of Examples 1 to 5, E. coli O157: H7 can be efficiently detected with a smaller amount of samples compared to the conventional methods, and a set of primer sets and probes can be detected. It can be seen that since E. coli O157: H7 of various species can be detected at one time, it can save time and effort in detecting E. coli O157: H7 from a sample.

Any patent, patent application, publication or other disclosure material disclosed herein is incorporated herein by reference in its entirety. Where any material, or portions thereof, incorporated herein by reference is inconsistent with the definitions, statements, or other disclosures herein, it is to be construed to be inserted only to the extent that there is no contradiction between the inserted materials and the current disclosure.

Claims

(a) a first primer comprising at least 10 consecutive nucleotides of the nucleotide sequences of SEQ ID NOs: 16, 3, 4, or 6;

(b) a second primer comprising at least 10 contiguous nucleotides of the nucleotide sequences of SEQ ID NOs: 7, 8, 9, 10 or 11; And

(c) E. coli. A kit for detecting E. coli 0157: H7 in a sample, comprising a probe linked to a detectable label, comprising an RNA sequence and a DNA sequence substantially complementary to a target gene of O157: H7.
The method of claim 1, wherein the E. coli. The target gene of O157: H7 is a polynucleotide having a nucleotide sequence of SEQ ID NO: 15, or a fragment thereof.
The method of claim 1, wherein the kit,

(d) amplification activity for PCR amplification of the target DNA sequence to generate a PCR fragment of E. coli 0157: H7; And

(e) Kit further comprising RNase H activity.
The kit of claim 1, wherein the kit further comprises a positive, internal, and negative control.
The kit of claim 4, wherein the kit further comprises uracil-N-glycosylase.
The kit of claim 1, wherein the detectable label is a fluorescent label.
The kit of claim 1, wherein the probe is labeled with a fluorescence resonance energy transfer (FRET) pair.
The kit of claim 1, wherein the probe is immobilized on a solid support.
The kit of claim 1, wherein the probe is in free form in solution.
The kit of claim 3, wherein the RNase H activity is thermostable RNase H activity.
The kit of claim 3, wherein the RNase H activity is hot start RNase H activity.
The kit of claim 1, wherein the probe comprises a sequence of SEQ ID NO: 17 or SEQ ID NO: 18:

ATAGGCTTGAAGCAGTGCAX 1 (SEQ ID NO: 17), wherein X 1 is absent or T, at least 3 of the nucleotides present in positions 9 to 14 of the nucleotide sequence of SEQ ID NO: 17 are ribonucleotides,

TCAGAGCATGGAAATAAAACTT (SEQ ID NO: 18), three or more of the nucleotides present in positions 10 to 14 of the nucleotide sequence of SEQ ID NO: 18 are ribonucleotides.
The kit of claim 1, wherein the probe is one or more selected from the group consisting of oligonucleotides of SEQ ID NO: 12 to SEQ ID NO: 14

ATAGGCTTrGrArArGCAGTGCA (SEQ ID NO: 12), rG and rA present at positions 9-12 in the nucleotide sequence of SEQ ID NO: 12 are each ribonucleotides,

ATAGGCTTrGrArArGCAGTGCAT (SEQ ID NO: 13), rG and rA present in positions 9 to 12 of the nucleotide sequence of SEQ ID NO: 13 are each ribonucleotides,

TCAGAGCATGrGrArArATAAAACTT (SEQ ID NO: 14), rG and rA present in positions 11 to 14 of the nucleotide sequence of SEQ ID NO: 14 are ribonucleotides, respectively.
(a) amplifying a target nucleic acid of E. coli 0157: H7 in a sample to increase the copy number of the target nucleic acid, wherein the amplification is performed by at least 10 consecutive sequences of SEQ ID NOs: 16, 3, 4, or 6; A first primer comprising a nucleotide and a second primer comprising at least 10 consecutive nucleotides among the nucleotide sequences of SEQ ID NOs: 7, 8, 9, 10 or 11 by hybridizing with the target nucleic acid in the sample to the target nucleic acid and the Obtaining a hybridized product of the primers and expanding the first and second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an expanded primer product;

(b) hybridizing the target nucleic acid with one or more probe oligonucleotides that can hybridize with the target nucleic acid to obtain a hybridization product of the target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence and is detected Possible markers are linked;

(c) cleaving the probe by contacting RNase H with the hybridized product of the target nucleic acid : probe oligonucleotide; And

(d) the method comprising: detecting an increase in the signal emitted from the marker on the probe, an increase in the signal samples of the E. coli O157: the sample containing the step to indicate that a nucleic acid existing H7 E. coli O157: How to detect H7.
The method of claim 14, wherein the probe oligonucleotide is an oligonucleotide of SEQ ID NO: 17 or SEQ ID NO: 18.

ATAGGCTTGAAGCAGTGCAX 1 (SEQ ID NO: 17), wherein X 1 is absent or T, at least 3 of the nucleotides present in positions 9 to 14 of the nucleotide sequence of SEQ ID NO: 17 are ribonucleotides,

TCAGAGCATGGAAATAAAACTT (SEQ ID NO: 18), three or more of the nucleotides present in positions 10 to 14 of the nucleotide sequence of SEQ ID NO: 18 are ribonucleotides.
The method of claim 15, wherein the probe oligonucleotide is one or more selected from the group consisting of oligonucleotides of SEQ ID NO: 12 to SEQ ID NO: 14

ATAGGCTTrGrArArGCAGTGCA (SEQ ID NO: 12), rG and rA present at positions 9-12 in the nucleotide sequence of SEQ ID NO: 12 are each ribonucleotides,

ATAGGCTTrGrArArGCAGTGCAT (SEQ ID NO: 13), rG and rA present in positions 9 to 12 of the nucleotide sequence of SEQ ID NO: 13 are each ribonucleotides,

TCAGAGCATGrGrArArATAAAACTT (SEQ ID NO: 14), rG and rA present in positions 11 to 14 of the nucleotide sequence of SEQ ID NO: 14 are each a ribonucleotide,
The method of claim 14, wherein the detectable label is a FRET pair.
15. The method according to claim 14, wherein the amplification is polymerase Chain Reaction, Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence Based Amplification, Cleavage Fragment Length Polymorphism, Isothermal and Chimeric primer-initiated Amplification of Nucleic Acid, and Ramification-extension Amplification method.
The method of claim 14, wherein steps a), b) and c) are performed simultaneously or sequentially.
(a) reverse transcripting E. coli 0157: H7 target RNA in the presence of reverse transcriptase activity and reverse amplification primers to generate target cDNA of the target RNA;

(b) amplifying the target cDNA of E. coli 0157: H7 in the sample to increase the copy number of the target nucleic acid, the amplification being at least 10 consecutive sequences of SEQ ID NOs: 16, 3, 4, or 6 A first primer comprising a nucleotide and a second primer comprising at least 10 consecutive nucleotides among the nucleotide sequences of SEQ ID NOs: 7, 8, 9, 10 or 11 by hybridizing with the target nucleic acid in the sample to the target nucleic acid and the Obtaining a hybridized product of the primers and expanding the first and second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an expanded primer product;

(c) hybridizing the target nucleic acid with at least one probe oligonucleotide substantially complementary to the target cDNA to obtain a hybridization product of a target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence, and detects Possible markers are linked;

(d) cleaving the probe by contacting RNase H with the hybridized product of the target nucleic acid : probe oligonucleotide; And

(e) the method comprising: detecting an increase in the signal emitted from the marker on the probe, an increase in the signal samples of the E. coli O157: the sample containing the step would indicate that the RNA present H7 E. coli O157: How to detect H7.