WO2013062940A1 - Engineered lower eukaryotic host strains for recombinant protein expression - Google Patents

Engineered lower eukaryotic host strains for recombinant protein expression Download PDF

Info

Publication number
WO2013062940A1
WO2013062940A1 PCT/US2012/061432 US2012061432W WO2013062940A1 WO 2013062940 A1 WO2013062940 A1 WO 2013062940A1 US 2012061432 W US2012061432 W US 2012061432W WO 2013062940 A1 WO2013062940 A1 WO 2013062940A1
Authority
WO
WIPO (PCT)
Prior art keywords
host cell
attl
seq
polypeptide
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/061432
Other languages
English (en)
French (fr)
Inventor
Bo Jiang
Rebecca D. ARGYROS
Stephanie NELSON
Robert C. Davidson
Ronghua Chen
Jun ZHUANG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Organon Pharma UK Ltd
Merck Sharp and Dohme LLC
Original Assignee
Merck Sharp and Dohme Ltd
Merck Sharp and Dohme LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck Sharp and Dohme Ltd, Merck Sharp and Dohme LLC filed Critical Merck Sharp and Dohme Ltd
Priority to AU2012329091A priority Critical patent/AU2012329091A1/en
Priority to IN2963CHN2014 priority patent/IN2014CN02963A/en
Priority to CN201280064747.2A priority patent/CN104024409A/zh
Priority to KR1020147013881A priority patent/KR20140091018A/ko
Priority to EP12843508.8A priority patent/EP2771461B1/en
Priority to JP2014538873A priority patent/JP2014532406A/ja
Priority to CA2853341A priority patent/CA2853341A1/en
Priority to US14/354,628 priority patent/US9328367B2/en
Publication of WO2013062940A1 publication Critical patent/WO2013062940A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/005Glycopeptides, glycoproteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/10Immunoglobulins specific features characterized by their source of isolation or production
    • C07K2317/14Specific host cells or culture conditions, e.g. components, pH or temperature

Definitions

  • the present invention relates to novel engineered lower eukaryotic host cells for expressing heterologous proteins and to methods of generating such strains.
  • Lower eukaryotic host cells can be engineered to produce heterologous proteins. Further, lower eukaryotic host cells can be glyco-engineered to produce glycoproteins where the N- or O-linked glycosylation are modified from their native forms.
  • glyco-engineered yeast strains 20 extensive genetic modifications have also caused fundamental changes in cell wall structures in many glyco-engineered yeast strains, predisposing some of these strains to cell lysis and reduced cell robustness during fermentation. Certain glyco-engineered strains have substantial reductions in cell viability as well as a marked increase in intracellular protease leakage into the fermentation broth, resulting in a reduction in both recombinant product
  • engineered Pichia host strains over-expressing ATTl or fragments thereof under relevant bioprocess conditions also exhibit improved viability, stability, and protein production. These strains are especially useful for heterologous gene expression.
  • the invention relates to engineered lower eukaryotic host cells that have been modified to reduce or eliminate the activity of the ATTl gene.
  • the activity of the ATTl gene can be reduced by any means.
  • the activity of the ATTl gene is reduced or eliminated by reducing or eliminating the expression of the ATTl gene (for example by using interfering R A or antisense RNA).
  • the activity of the ATTl gene is reduced or eliminated by mutating the ATTl gene or its product.
  • the activity of the ATTl gene is reduced or eliminated by degrading the
  • the activity of the ATTl gene is reduced or eliminated by using an inhibitor of ATTl, for example a small molecule inhibitor or an antibody inhibitor.
  • the invention encompasses any means of inactivating the ATTl gene or its protein including transcriptionally, translationally, or post-translationally means (for example, using repressible promoter, interfering RNA, antisense RNA, inducible protein degradation, and the like).
  • the lower eukaryotic cell is a glyco- engineered lower eukaryotic host cells.
  • the lower eukaryotic cell is a lower eukaryotic host cell that lacks OCH1 activity.
  • the lower eukaryotic host cell is a fungal host cell.
  • the lower eukaryotic cell is a fungal host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a yeast host cell. In one embodiment, the lower eukaryotic cell is a yeast host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a Pichia sp. In one embodiment, the lower eukaryotic cell is a Pichia sp. host cell that lacks OCH1 activity.
  • the present invention relates to an engineered lower eukaryotic host cell that has been modified to express a mutated form of the ATTl gene.
  • the mutation could be a single nucleotide mutation, a frame-shift mutation, an insertion, a truncation or a deletion of one or more nucleotides.
  • said mutation is a deletion of the entire ATTl gene.
  • said mutation is a deletion of a 2012/061432
  • the lower eukaryotic cell is a glyco- engineered lower eukaryotic host cell. In one embodiment, the lower eukaryotic cell is a lower eukaryotic host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a fungal host cell. In one embodiment, the lower eukaryotic cell is a fungal host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a yeast host cell. In one embodiment, the lower eukaryotic cell is a yeast host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a Pichia sp. In one embodiment, the lower eukaryotic cell is a Pichia sp. host cell that lacks OCH1 activity.
  • the host cell is Pichia pastoris and the ATTl gene encodes a polypeptide comprising the amino acid of SEQ ID NO:7 or a polymorph thereof.
  • said mutated form of the ATTl gene is a deletion of a fragment comprising amino acids 32-995 of SEQ ID NO:7.
  • said mutated form of the ATTl gene is a deletion of fragment comprising amino acids 165-995 of SEQ ID NO:7.
  • said mutated form of the ATTl gene is a deletion of fragment comprising amino acids 277-995 of SEQ ID NO:7.
  • said mutated form of the ATTl gene is a single nucleotide mutation in the nucleic acid sequence encoding SEQ ID NO:7. In another embodiment, said mutated form of the ATTl gene results in a single amino acid change in
  • the host cell is Hansenula polymorpha and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 23 or a polymorph thereof.
  • the engineered lower eukaryotic host cell of the invention exhibits an increase in culture stability, thermal tolerance and/or improved fermentation robustness compared with an ATTl naive parental host cell under similar culture conditions.
  • said engineered host cell is capable of surviving in culture at 32°C for at least 80 hours of fermentation with minimal cell lysis.
  • said engineered host cell is capable of surviving in culture at 32°C for at least
  • said engineered host cell is capable of surviving in culture at 32°C
  • the engineered lower eukaryotic host cell of the invention further comprises a mutation, disruption or deletion of one or more of functional gene products.
  • the host cell comprises a mutation, disruption or deletion of one or more genes encoding: protease activities, alpha- 1,6-mannosyltransferase activities, alpha-l,2-mannosyltransferase activities, mannosylphosphate transferase activities, ⁇ - mannosyltransferase activities, O-mannosyltransferase (P T) activities, and/or dolichol-P- Man dependent alpha(l-3) mannosyltransferase activities.
  • the host cell comprises a mutation, disruption or deletion in the OCHl gene. In one embodiment, the host cell comprises a mutation, disruption or deletion in the BMT1, BMT2, BMT3, and BMT4 genes. In one embodiment, the host cell comprises a mutation, disruption or deletion in the
  • the host cell comprises a mutation, disruption or deletion in the PEP4 and PRB1 genes. In another embodiment, the host cell comprises a mutation, disruption or deletion of the ALG3 gene (as described in US Patent
  • the host cell further comprises a mutation, disruption or deletion of all of the following genes: OCHl, BMT1, BMT2, BMT3,
  • the host cell further comprises a mutation, disruption or deletion of all of the following genes: OCHl, BMT1, BMT2, BMT3,
  • the host cell further comprises a mutation, disruption or deletion of all of the following genes: OCHl, BMT1,
  • the engineered lower eukaryotic host cell of the invention further comprises a mutation, disruption or deletion of a gene selected from the group consisting of: SSK2,
  • the engineered lower eukaryotic host cell of the invention further comprises one or more nucleic acid sequences of interest.
  • the nucleic acid sequences of interest encode one or more glycosylation enzymes.
  • the glycosylation enzymes are selected from the group consisting of glycosidases, mannosidases, phosphomannosidases, phosphatases, nucleotide sugar transporters, nucleotide sugar epimerases, mannosyltransferases, N- acetylglucosaminyltransferases, CMP-sialic acid synthases, N-acetylneuraminate-9- phosphate synthases, galactosyltransferases, sialyltransferases, and oligosaccharyltransferases. 1432
  • the engineered lower eukaryotic host cell of the invention further comprises a nucleic acid sequences encoding one or more recombinant proteins.
  • the recombinant protein is a therapeutic protein.
  • the therapeutic protein can contain or lack oligosaccharides.
  • the therapeutic proteins are selected from the group consisting of antibodies (IgA, IgG, IgM or IgE), antibody fragments, kringle domains of the human plasminogen, erythropoietin, cytokines, coagulation factors, soluble IgE receptor ⁇ -chain, urokinase, chymase, urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1,
  • the therapeutic protein is an antibody or a fragment thereof.
  • the therapeutic protein is an antibody or antibody fragment (Fc-containing polypeptide) comprising N-glycans.
  • the N-glycans comprise predominantly NANA(M ) Gal(i.4)Mari 3 GlcNAc3 ⁇ 4.
  • the N-glycans comprise predominantly NANA2Gal 2 Man3GlcNAc2.
  • the present invention further provides an engineered lower eukaryotic host cell comprising a disruption, deletion or mutation of the ATTl gene in the genomic DNA,
  • nucleic acid encoding an ATTl polypeptide or a f agment thereof.
  • the lower eukaryotic cell is glyco-engineered. In one embodiment, the lower eukaryotic cell lacks OCHl activity. In one embodiment, the lower eukaryotic host cell is a fungal host cell. In one embodiment, the lower eukaryotic cell is a fungal host cell that lacks OCHl activity. In one embodiment, the lower eukaryotic host cell is a yeast host cell. In one embodiment, the lower eukaryotic cell is a yeast host cell that lacks OCHl
  • the fragment is a "functional fragment" of ATTl or a "dominant-negative fragment” of ATTl .
  • a “functional fragment” of an ATTl gene or polypeptide refers to a fragment that has ATTl activity.
  • a gene or polypeptide refers to a fragment that negatively interferes with the function of the intact ATTl gene or its polypeptide product, so that even in the presence of the endogenous nai've ATTl gene, such a fragment is capable of increasing the cell culture stability, thermal tolerance and/or improved fermentation robustness of a host cell (for example, fragments 1- 31aa and l-164aa, in Example 11).
  • host cell is Pichia pastoris and the
  • ATTl polypeptide comprises the amino acid sequence of SEQ ID NO:7 or a polymorph thereof.
  • the host cell is Pichia pastoris and the functional fragment comprises or consists of amino acids 1-296 of SEQ ID NO:7.
  • the host cell is Pichia pastoris and the dominant-negative fragment comprises or consists of amino acids 1-31 of SEQ ID NO:7.
  • the host cell is Pichia pastoris and the dominant-negative fragment comprises or consists of amino acids 1-164 of SEQ ID NO:7.
  • the host cell is H. polymorpha and the ATT1 polypeptide comprises the amino acid sequence of SEQ ID NO:23 or a polymorph thereof.
  • the engineered host cell comprises an over-expression cassette comprising a nucleic acid sequence encoding SEQ ID NO:7 or a natural variant (polymorph) of said polypeptide.
  • the invention also relates to an engineered lower eukaryotic host cell, wherein the host cell has been modified to increase expression of a nucleic acid sequence encoding an ATT1 polypeptide or a fragment thereof.
  • the lower eukaryotic host cell is glyco-engineered.
  • the lower eukaryotic cell lacks OCH1 activity.
  • the lower eukaryotic host cell is a fungal host cell.
  • the lower eukaryotic cell is a fungal host cell that lacks OCH1 activity.
  • the lower eukaryotic host cell is a yeast host cell.
  • the lower eukaryotic cell is a yeast host cell that lacks OCH1 activity.
  • the lower eukaryotic host cell is a Pichia sp. In one embodiment, the lower eukaryotic cell is a Pichia sp. host cell that lacks OCH1 activity. In one embodiment, host cell is Pichia pastoris and the ATT1 polypeptide comprises the amino acid sequence of SEQ ID NO:7 or a polymorph thereof. In one embodiment, the host cell is Pichia pastoris and the functional fragment comprises or consists of amino acids 1-296 of SEQ ID NO:7. In one embodiment, the host cell is Pichia pastoris and the dominant-negative fragment comprises or consists of amino acids 1-31 of SEQ ID NO:7.
  • the host cell is Pichia pastoris and the dominant- negative fragment comprises or consists of amino acids 1-164 of SEQ ID NO:7.
  • the host cell is H. polymorpha and the ATTI polypeptide comprises the amino acid sequence of SEQ ID NO:23 or a polymorph thereof.
  • the engineered host cell comprises an over-expression cassette comprising a nucleic acid sequence encoding SEQ ID NO:7 or a natural variant (polymorph) of said polypeptide.
  • the engineered lower eukaryotic host cell of the invention which has been modified to increase expression of ATTI or a fragment thereof, further comprises a mutation, disruption or deletion of one or more functional gene products.
  • the host cell comprises a mutation, disruption or deletion of one or more genes encoding protease activities, alpha- 1,6-mannosyltransferase activities, alpha- 1,2- mannosyltransferase activities, manriosylphosphate transferase activities, ⁇ - mannosyltransferase activities, O-mannosyltransferase (PMT) activities, and or dolichol-P- Man dependent alpha(l-3) mannosyltransferase activities.
  • the host cell comprises a mutation, disruption or deletion in the OCH1 gene. In one embodiment, the host cell comprises a mutation, disruption or deletion in the BMT1, BMT2, BMT3, and BMT4 genes. In one embodiment, the host cell comprises a mutation, disruption or deletion in the PNOl, MNN4, and MNN4L1 genes. In one embodiment, the host cell comprises a mutation, disruption or deletion in the PEP4 and PRB1 genes. In another embodiment, the host cell comprises a mutation, disruption or deletion of the ALG3 gene (as described in US Patent Publication No. US2005/0170452).
  • the host cell further comprises a mutation, disruption or deletion of all of the following genes: OCH1, BMT1, BMT2, BMT3, BMT4, PNOl, MNN4, and MNN4L1. In one embodiment, the host cell further comprises a mutation, disruption or deletion of all of the following genes: OCH1, BMT1, BMT2, BMT3, BMT4, PNOl, MNN4, MNN4L1, PEP4 and PRB1. In one embodiment, the host cell further comprises a mutation, disruption or deletion of all of the following genes: OCH1, BMT1, BMT2, BMT3, BMT4, PNOl, MNN4, MNN4L1, ALG3, PEP4 and PRB1.
  • the engineered lower eukaryotic host cell of the invention further comprises a mutation, disruption or deletion of a gene selected from the group consisting of: SSK2, RT12, SDS23, NOT5, DRS1, CRZ1, CTKl, RGD2, AV02, YMR196W, PEX1, TYW1, P0M152, YPR84W, AK5, AZF1.
  • the engineered lower eukaryotic host cell of the invention which has been modified to increase expression of ATT1 or a fragment thereof, further comprises one or more nucleic acid sequences of interest.
  • the nucleic acid sequences of interest encode one or more glycosylation enzymes.
  • the glycosylation enzymes are selected from the group consisting of glycosidases, mannosidases, phosphomannosidases, phosphatases, nucleotide sugar transporters, mannosyltransferases, N- acetylglucosaminyltransferases, UDP-N-acetylglucosamine transporters, galactosyltransferases, sialyltransferases, and oligosaccharyltransferases.
  • the nucleic acid sequences of interest encode one or more recombinant proteins.
  • the recombinant protein is a therapeutic protein.
  • the therapeutic protein is selected from the group consisting of antibodies (IgA, IgG, IgM or IgE), antibody fragments, kringle domains of the human plasminogen, erythropoietin, cytokines, coagulation factors, soluble IgE receptor a-chain, urokinase, chymase, urea trypsin inhibitor, IGF-binding protein, epidermal 1432
  • growth factor growth hormone-releasing factor
  • annexin V fusion protein angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor- 1, osteoprotegerin,
  • the therapeutic protein is an antibody or a fragment thereof. In one embodiment, the therapeutic protein is an antibody or antibody fragment (Fc-containing polypeptide) comprising N-glycans.
  • the N- glycans comprise predominantly NANA (M) Gal(i-4)Man3GlcNAc2. In one embodiment, the N- glycans comprise predominantly NANA2Gal2Man3GlcNAc2.
  • the engineered lower eukaryotic host cell of the invention which has been modified to increase expression of ATTl or a fragment thereof, exhibits an increase in culture stability, thermal tolerance or improved fermentation robustness compared with the ATTl naive parental host cell under similar culture conditions.
  • said host cell is capable of surviving in culture at 32°C for at least 80
  • said host cell is capable of surviving in culture at 32°C for at least 80 hours of fermentation after induction (for example, methanol induction) with minimal cell lysis. In one embodiment, said host cell is capable of surviving in culture at 32°C for at least 100 hours of fermentation with minimal cell lysis.
  • said host cell is capable of surviving in culture in at 32°C for at least 100
  • the invention provides a H. polymorpha host cell that has been modified to
  • the invention also provides a H. polymorpha host cell which
  • the invention also provides an engineered H. polymorpha host cell, wherein
  • the host cell has been modified to increase expression of a nucleic acid encoding SEQ ID NO: 1
  • the invention also provides engineered lower eukaryotic host cells comprising a disruption, deletion or mutation (e.g., a single nucleotide mutation, insertion mutation, or deletion mutation) of a nucleic acid sequence selected from
  • ATTl gene the 3' un-translated region (UTR) of ATTl, a nucleic acid sequence that is a degenerate variant of the coding sequence of the P. pastoris ATTl gene and related nucleic acid sequences and fragments, in which the host cells have an increase in culture stability, thermal tolerance or improved fermentation robustness compared to a host cell without the disruption, deletion or mutation.
  • UTR 3' un-translated region
  • the invention also relates to methods of using the engineered lower eukaryotic host cells of the invention for producing heterologous polypeptides and other metabolites.
  • the invention provides for methods for producing a heterologous polypeptide in any of the Pichia sp. host cells described above comprising culturing said host cell under conditions favorable to the expression of the heterologous polypeptide; and, optionally, isolating the heterologous polypeptide from the host cell.
  • the invention also comprises a method for producing a heterologous polypeptide in an engineered lower eukaryotic host cell, said method comprising: (a) introducing a polynucleotide encoding a heterologous polypeptide into an engineered host cell which has been modified to reduce or eliminate the activity of an ATTl gene which is an ortholog to the Pichia pastoris ATTl gene; (b) culturing said host cell under conditions favorable to the expression of the heterologous polypeptide; and, optionally, (c) isolating the heterologous polypeptide from the host cell.
  • the lower eukaryotic host cell is glyco-engineered.
  • the lower eukaryotic cell lacks OCH1 activity.
  • the lower eukaryotic host cell is a fungal host cell. In one embodiment, the lower eukaryotic cell is a fungal host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a yeast host cell. In one embodiment, the lower eukaryotic cell is a yeast host cell that lacks OCH1 activity. In one embodiment, the lower eukaryotic host cell is a Pichia sp. In one embodiment, the lower eukaryotic cell is a Pichia sp. host cell that lacks OCH1 activity.
  • the host cell is Pichia pastoris and the ATTl gene encodes a polypeptide comprising the amino acid of SEQ ID NO:7 or a polymorph thereof.
  • the host cell is Hansenula polymorpha and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:23 or a polymorph thereof.
  • the invention also comprises a method for producing a heterologous polypeptide in an engineered lower eukaryotic host cell, said method comprising: (a) introducing a polynucleotide encoding a heterologous polypeptide into an engineered host cell which has been modified to overexpress an ATTl gene which is an ortholog of the Pichia pastoris ATTl gene of SEQ ID NO:7; (b) culturing said host cell under conditions favorable to the expression of the heterologous polypeptide; and, optionally, (c) isolating the heterologous polypeptide from the host cell.
  • the heterologous polypeptide may be operably linked to a methanol inducible promoter, and the host cell is cultured under conditions favorable to expression of the heterologous polypeptide in the presence of methanol.
  • the lower eukaryotic host cell is glyco-engineered.
  • the lower eukaryotic cell is a lower eukaryotic host cell that lacks OCHl activity.
  • the lower eukaryotic host cell is a fungal host cell.
  • the lower eukaryotic cell is a fungal host cell that lacks OCHl activity.
  • the lower eukaryotic host cell is a yeast host cell.
  • the lower eukaryotic cell is a yeast host cell that lacks OCHl activity. In one embodiment, the lower eukaryotic host cell is a Pichia sp. In one embodiment, the lower eukaryotic cell is a Pichia sp. host cell that lacks OCHl activity. In another embodiment, the host cell is Pichia pastor is and the ATT1 gene encodes a polypeptide comprising the amino acid of SEQ ID NO:7 or a polymorph thereof. In another embodiment, the host cell is Hansenula polymorpha and the ATT1 gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:23 or a polymorph thereof.
  • the invention also provides a method for producing a heterologous polypeptide in an engineered H. polymorpha host cells, said method comprising: (a) introducing a polynucleotide encoding a heterologous polypeptide into an engineered H. polymorpha host cell that has been modified to reduce or eliminate expression of a nucleic acid encoding SEQ ID NO:23, a natural variant thereof or a fragment thereof; (b) culturing said cell under conditions favorable to the expression of the heterologous polypeptide; and, optionally, (c) isolating the heterologous polypeptide from the host cell.
  • the invention also provides a method for producing a heterologous polypeptide in an engineered H. polymorpha host cells, said method comprising: (a) introducing a polynucleotide encoding a heterologous polypeptide into an engineered H. polymorpha host cell that has been modified to increase expression of a nucleic acid encoding SEQ ID NO:23, a natural variant thereof or a fragment thereof; (b) culturing said cell under conditions favorable to the expression of the heterologous polypeptide; and, optionally, (c) isolating the heterologous polypeptide from the host cell.
  • the invention also provides a method for making any of the host cells of the invention, comprising introducing a heterologous polynucleotide into the cell which homologously recombines with the endogenous ATTl gene and partially or fully deletes the endogenous ATTl gene or disrupts the endogenous ATTl gene.
  • the invention provides methods for the genetic integration of a heterologous nucleic acid sequence into a host cell comprising a disruption, deletion or mutation of the ATTl gene in the genomic DNA of the host cell.
  • These methods comprise the step of introducing a sequence of interest into the host cell comprising a disrupted, deleted or mutated nucleic acid sequence derived from a sequence selected from the group consisting of the coding sequence of the P. pastoris ATTl gene, a nucleic acid sequence that is a degenerate variant of the coding sequence of the P. pastoris ATTl gene and related nucleic acid sequences and fragments.
  • the invention also provides isolated polynucleotides encoding the P. pastoris
  • the invention also provides isolated polynucleotides encoding mutants of the ATTl gene (single nucleotide mutations, frame-shift mutations, insertions, truncations or deletions).
  • the invention also provides vectors and host cells comprising these isolated polynucleotides or fragments of these polynucleotides.
  • the invention further provides isolated polypeptides comprising or consisting of the polypeptide sequence encoded by the P. pastoris ATTl gene, by a fragment of the P. pastoris ATTl gene, or an ortholog or polymorph of the P. pastoris ATTl gene. Antibodies that specifically bind to the isolated polypeptides of the invention are also encompassed herein.
  • the invention comprises an expression vector comprising a nucleic acid encoding a wild-type or mutated ATTl gene selected from the group consisting of: a nucleotide sequence encoding SEQ ID NO:7 or a fragment thereof; a nucleotide sequence encoding SEQ ID NO:8 or a fragment thereof; a nucleotide sequence encoding SEQ ID NO: 9 or a fragment thereof ; a nucleotide sequence encoding SEQ ID NO: 10 or a fragment thereof; and a nucleotide sequence encoding SEQ ID NO:23 or a fragment thereof.
  • the isolated nucleic acid encodes a polypeptide comprising or consisting essentially of residues 1-296, 1-31 or 1-164 of SEQ ID NO:7.
  • the invention comprises an expression vector comprising a nucleic acid encoding a wild-type or mutated ATTl gene selected from the group consisting of: SEQ ID NO:24 or a fragment thereof, SEQ ID NO:25 or a fragment thereof, SEQ ID NO:26 or a fragment thereof, SEQ ID NO:27 or a fragment thereof, SEQ ID NO:28 or a or a fragment thereof, SEQ ID NO:29 or a fragment thereof, SEQ ID NO:30 or a fragment thereof, SEQ ID NO:31 or a fragment thereof, and SEQ ID NO:32 or a fragment thereof.
  • an isolated host cell expressing said nucleic acid exhibits an increase in culture stability, thermal tolerance and/or improved fermentation robustness compared to an ATTl naive parental host cell under similar conditions.
  • the invention also comprises vectors and host cells comprising the nucleic acids of the invention, and the polypeptides encoded by these nucleic acids.
  • Figures 1A-B shows a sequence alignment between Saccharyomyces cerevisiae GAL4 and Pichia pastoris ATTl amino acid sequences.
  • Figures 2A-D show N-glycan MALDI-TOF mass spectrometry traces using secreted and whole-cell proteins from four strains YGLY17108 (Fig. 2A), YGLY17177 (Fig.
  • Figures 3A-B show plasmid maps of pGLY8045 and pGLY6391.
  • Figures 4A-G show plasmid maps of pGLY5933-5936 (Figs. 4A-D, respectively) and pGLY5947-pGLY5949 (Figs. 4E-G, respectively).
  • Figure S shows the DNA constructs and integration strategy used to replace the endogenous ATTl gene in non-mutagenized Pichia strains to test temperature-resistance and fermentation robustness phenotypes.
  • Figures 6A-C show photographs (Fig. 6A-B) and correlating table (Fig. 6C) illustrating improved growth of Pichia pastoris ATTl mutants compared with growth of control host cells.
  • Figure 7 shows strain lineages from yGLY6903 through yGLY17108.
  • Figure 8 shows ATTl mutant lineages from yGLY17108 (GFI5.0) background.
  • Figure 9 shows strain lineages from yGLY6903 through yGLY22835 and yGLY17159.
  • Figure 10 shows a plasmid map of pGLY8369.
  • Figure 11 shows a plasmid map of pGLY9959.
  • Figure 12 shows a plasmid map of pGLY5883.
  • Figure 13 shows strain lineages from NRRL 11430 through yGLY13979.
  • Figures 14A-H show plasmid maps.
  • Figs. A4A-D show plasmid maps of pGLY9955-pGLY9958, respectively;
  • Figs.l4E-H show plasmid maps of pGLY9960- pGLY9963, respectively. 2012/061432
  • Figure 15 shows a graph illustrating reduced lysis for Pichia strains with
  • Figure 16 shows a graph illustrating protein titer for the Pichia ATTl over- expression strain yGLY13979+ TEF-ATT1 1-655.
  • Figure 17 shows a table indicating induction time, strain lysis, and protein
  • Figure 18 shows an alignment of & cerevisiae Gal4, P. pastoris ATTl and H.
  • Figures 19A and 19B show the effects of different ATTl truncations on cell robustness and product titers.
  • Figure 20 shows the effect of different ATTl modifications in cell lysis in
  • Figure 21 shows a restriction map of plasmid pGLY5952.
  • the K colifP The K colifP.
  • pastoris shuttle vector is depicted circularly as it is maintained in E. coli.
  • P. pastoris ATTl gene flanking the S. cerevisiae ARR3 gene (driven by the P. pastoris
  • RPL10 promoter as a selectable marker.
  • the plasmid is digested with Sfil to linearize and remove the pUC19 region, and selected for on medium
  • Figure 22 shows an SDS-PAGB of GFI2.0 ATTl wild type and attlA
  • Figure 23 shows supernatant DNA Quantification of GFI2.0 ATTl wild type
  • Fermentation samples of GFI2.0 ATTl wild type Fermentation samples of GFI2.0 ATTl wild type.
  • Figure 24 shows an SDS-PAGE of GFI2.0 ATTl wild type and attlA
  • Fermentation Supematants Fermentation samples of GFI1.0 ATTl wild type and attlA
  • Figure 25 shows supernatant DNA Quantification of GFI1.0 ATT1 wild type and attlA Fermentation Supernatants. Fermentation samples of GFI1.0 ATT1 wild type and attlA strains were taken every ⁇ 24h and clarified supernatant was obtained by centrifugation
  • a "polynucleotide” and “nucleic acid” includes DNA and RNA in single stranded form, double-stranded form or otherwise.
  • a "polynucleotide sequence” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA or RNA, and means a series of two or more nucleotides. Any polynucleotide comprising a nucleotide sequence set forth herein (e.g., promoters of the present invention) forms part of the present invention.
  • a "coding sequence” or a sequence “encoding” an expression product, such as an RNA or polypeptide is a nucleotide sequence (e.g., heterologous polynucleotide) that, when expressed, results in production of the product (e.g., a polypeptide comprising SEQ ID NO: 1
  • a "protein”, “peptide” or “polypeptide” e.g., a heterologous polypeptide such
  • SEQ ID NO: 7 or as an immunoglobulin heavy chain and/or light chain includes a contiguous string of two or more amino acids.
  • amino acid sequence refers to a series of two or more amino acids in a protein, peptide or polypeptide.
  • the scope of the present invention includes the isolated polynucleotides set forth herein, e.g.,
  • An isolated polynucleotide or polypeptide will, preferably, be an essentially homogeneous composition of molecules but may contain some heterogeneity.
  • a coding sequence (e.g., of a heterologous polynucleotide, e.g., reporter gene or immunoglobulin heavy and/or light chain) is "operably linked to", "under the control of,
  • RNA and translational control sequence when the sequence directs RNA polymerase mediated transcription of the coding sequence into RNA, preferably mR A, which then may be RNA spliced (if it contains introns) and, optionally, translated into a protein encoded by the coding sequence.
  • the present invention includes vectors or cassettes which comprise a nucleic acid encoding a wildtype ATTl or a mutated ATTl coding region (including single nucleotide mutations, frameshift mutations, insertions, truncations and deletions in the ATTl gene).
  • the present invention also includes vectors that lead to over-expression of ATTl or a fragment of ATTl which is able to increase culture stability, thermal tolerance, and/or improved fermentation robustness when overexpressed.
  • the term "vector” includes a vehicle (e.g., a plasmid) by which a DNA or RNA sequence can be introduced into a host cell, so as to transform the host and, optionally, promote expression and/or replication of the introduced sequence.
  • Suitable vectors for use herein include plasmids, integratable DNA fragments, and other vehicles that may facilitate introduction of the nucleic acids into the genome of a host cell (e.g. , Pichia pastoris).
  • Plasmids are the most commonly used form of vector but all other forms of vectors which serve a similar function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels, et al., Cloning Vectors: A Laboratory Manual, 1985 and Supplements, Elsevier, N.Y., and Rodriguez et al. (eds.), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, 1988, Buttersworth, Boston, MA.
  • a polynucleotide e.g., a heterologous polynucleotide, e.g., encoding an immunoglobulin heavy chain and/or light chain
  • expression system means a host cell and compatible vector which, under suitable conditions, can express a protein or nucleic acid which is carried by the vector and introduced to the host cell.
  • Common expression systems include fungal host cells (e.g., Pichia pastoris) and plasmid vectors, insect host cells and Baculovirus vectors, and mammalian host cells and vectors.
  • BLAST ALGORITHMS Altschul, S.F., et al, J. Mol. Biol. (1990) 215:403-410; Gish, W., et al, Nature Genet. (1993) 3:266-272; Madden, T.L., et al, Meth. Enzymol. (1996) 266:131-141; Altschul, S.F., et al, Nucleic Acids Res. (1997) 25:3389-3402; Zhang, J., et al, Genome Res. (1997) 7:649-656; Wootton, J.C., et al., Comput. Chem.
  • the invention relates to engineered lower eukaryotic host cells that have been modified to reduce or eliminate the activity of the ATTl gene.
  • the lower eukaryotic host cell is glyco-engineered.
  • the lower eukaryotic host cell lacks OCH1 activity.
  • the lower eukaryotic host cell is a fungal host cell.
  • the lower eukaryotic host cell is a fungal host cell that lacks OCH1 activity.
  • the lower eukaryotic host cell host cell is a yeast host cell.
  • the lower eukaryotic host cell host cell is a yeast host cell that clacks OCH1 activity.
  • the lower eukaryotic host cell is a Pichia sp. In one embodiment, lower eukaryotic host cell is a Pichia sp. that lacks OCH1 activity.
  • the fungal host cell is selected from the group consisting of: Pichia pastoris, Pichia angusta (Hansenula polymorpha), Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanoHca, Yarrowia Lipolytica, Kluyveromyces lactis, Zygosaccharomyces rouxii, Zygosacchar
  • the fiingal host cell is Pichia pastoris.
  • the fungal host cell is Hansenula
  • ATTl gene activity refers to a cell that has an increase in culture stability, thermal tolerance and/or improved fermentation robustness compared with an ATTl naive parental host cell under similar culture conditions.
  • the gene can be deleted in a glyco-engineered host cell (for example, an OCHI minus lower eukaryotic host cell) and the ability of the cell (with the ATTl gene deletion) to survive in a glyco-engineered host cell (for example, an OCHI minus lower eukaryotic host cell) and the ability of the cell (with the ATTl gene deletion) to survive in a glyco-engineered host cell (for example, an OCHI minus lower eukaryotic host cell) and the ability of the cell (with the ATTl gene deletion) to survive in
  • an "ATTl naive host cell” refers to a host cell that comprises a wild-type ATTl gene in its native genomic state.
  • an ATTl naive host cell refers to a Pichia pastoris strain comprising in its native genomic state an
  • ATTl gene encoding the polypeptide of SEQ ID NO:7 or a natural variant (polymorphs) thereof.
  • an "engineered cell” refers to cell that has been altered using
  • glyco-engineered cell refers to cell that has been genetically engineered to produce glycoproteins where the N- or O-linked
  • glycosylation are modified from their native form, either through inactivation or deletion of genes or through the heterologous expression of glycosyltransferases or glycosidases.
  • thermo tolerance refers to increase in temperature resistance
  • the invention encompasses any engineered lower eukaryotic host cell which
  • the invention also relates to an engineered lower eukaryotic host cell which has been modified to (i) reduce or eliminate expression of an ATTl gene or polypeptide which is an ortholog of the Pichia pastoris ATTl gene, (ii) express a mutated form of an ATTl gene which is an ortholog of the Pichia pastoris ATTl gene, or (iii) to over-express an ATTl gene which is an ortholog of the Pichia pastoris ATTl gene or a fragment of said gene; wherein said cell exhibits an increase in culture stability, thermal tolerance, and/or improved fermentation robustness when compared to an ATTl naive parental host cell.
  • the invention relates to an engineered lower eukaryotic host cell which has been modified to reduce or eliminate expression of an ATTl gene or polypeptide which is an ortholog of the Pichia pastoris ATTl gene or to express a mutated form of an ATTl gene which is an ortholog of the Pichia pastoris ATTl gene; wherein said cell exhibits an increase in culture stability, thermal tolerance, and/or improved fermentation robustness when compared to an ATTl naive parental host cell.
  • the invention relates to a lower eukaryotic host cell which has been modified to over-express an ATTl gene which is an ortholog of the Pichia pastoris ATTl gene, or a functional or dominant-negative fragment of said gene; wherein said cell exhibits an increase in culture stability, thermal tolerance, and/or improved fermentation robustness when compared to an ATTl naive parental host cell.
  • an ortholog to the Pichia pastoris ATTl gene is a gene that has sequence similarity to the Pichia pastoris ATTl gene and has ATTl activity. In one embodiment, the sequence similarity will be at least 25%.
  • a person of skill in the art would be able to identify such orthologs using only routine experimentation. For example, the H. polymorpha ATTl ortholog has been identified as described in Example 9. Other fungal/yeast orthologs could be similarly identified, for example by the use of reciprocal
  • Pichia stipitis SEQ ID NO:24 (XP_001385092.2)
  • Aspergillus nidulans SEQ ID NO:28 (CBF76786.1)
  • Sacchromyces cerevisiae SEQ ID NO:32 (CAA97969.1 )
  • the host cells of the invention could be in haploid, diploid, or polyploid state.
  • the invention encompasses a diploid cell wherein only one endogenous chromosomal
  • ATTl gene has been mutated, disrupted, truncated or deleted.
  • the engineered lower eukaryotic host cell of the invention is selected from the group consisting of: Pichia pastoris, Pichia angusta (Hansenula polymorpha), Pichia flnlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia min ta ⁇ Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanoUca, Yarrowia Lipolytica, Kluyveromyces lactis, Zygosaccharomyces rouxii,
  • the host cell is selected from the group consisting of any Pichia cell, such as Pichia pastoris, Pichia angusta (Hansenula polymorpha), Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta ⁇ Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, and Pichia methanoUca.
  • Pichia cell such as Pichia pastoris, Pichia angusta (Hansenula polymorpha), Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta ⁇ Ogataea minuta, Pichia lindner
  • the host cell is an engineered Pichia pastoris host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:7 or a natural variant of said polypeptide.
  • the host cell is an engineered H. polymorpha host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:23 or a natural variant of said polypeptide.
  • the host cell is an engineered Pichia stipitis host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:24 or a natural variant of said polypeptide.
  • the host cell is an engineered Pichia guilliermondii host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:25 or a natural variant of said polypeptide.
  • the host cell is an engineered Kluyveromyces lactis host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:26 or a natural variant of said polypeptide.
  • the host cell is an engineered Aspergillus niger host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:27 or a natural variant of said polypeptide.
  • the host cell is an engineered Aspergillus idulans host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:28 or a natural variant of said polypeptide.
  • the host cell is an engineered Aspergillus flavus host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:29 or a natural variant of said polypeptide.
  • the host cell is an engineered Debaryomyces hansenii host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:30 or a natural variant of said polypeptide.
  • the host cell is an engineered Zygosaccharomyces rouxii host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:31 or a natural variant of said polypeptide.
  • the host cell is an engineered Sacchromyces cerevisiae host cell and the ATTl gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:32 or a natural variant of said polypeptide.
  • the engineered lower eukaryotic host cells of the invention further comprise a mutation, disruption or deletion of one or more of genes.
  • the engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion of one or more genes encoding protease activities, alpha- 1,6- mannosyltransferase activities, alpha- 1,2-mannosyltransferase activities mannosylphosphate transferase activities, ⁇ -mannosyltransferase activities, O-mannosyltransferase PMT) activities, and/or dolichol-P-Man dependent alpha(l-3) mannosyltransferase activities.
  • an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion in the OCHI gene. In one embodiment, an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion in the BMT1, BMT2, BMT3, and BMT4 genes. In one embodiment, an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion in the PNOl , MNN4, and MNN4L1 genes. In one embodiment, an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion in the PEP4 and PRB1 genes.
  • an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion of the ALG3 gene (as described in US Patent Publication No. US2005/0170452).
  • an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion of all of the following genes: OCHI, BMT1, BMT2, BMT3, BMT4, PNOl, M N4, and MNN4L1.
  • an engineered lower eukaryotic host cell of the invention comprises a mutation, disruption or deletion of all of the following genes: OCH1, BMT1, BMT2, BMT3, BMT4, PNOl, MNN4, M N4L1, PEP4 and PRBl.
  • an engineered lower enkaryotic host cell of the invention comprises a mutation, disruption or deletion of all of the following genes: OCH1, BMT1, BMT2, B T3, BMT4, PNOl, MNN4, MNN4L1, ALG3, PEP4 and PRBl.
  • the host cell of the invention can be cultivated in a medium that includes one or more Pmtp inhibitors.
  • Pmtp inhibitors include but are not limited to a benzylidene thiazolidinedione.
  • Examples of benzylidene thiazolidinediones are 5- [[3,4bis( phenylmethoxy) phenyl]methylene]-4-oxo-2-thioxo-3-thiazolidineacetic Acid; 5- [[3-(l-25 Phenylethoxy)-4-(2-phenylethoxy)]phenyl]methylene]-4-oxo-2-thioxo-3- thiazolidineacetic Acid; and 5-[ [3-(l-Phenyl-2-hydroxy)ethoxy)-4-(2- phenylethoxy)]phenyl]methylene] ⁇ -oxo-2-thioxo3-thiazolidineacetic acid.
  • an engineered lower eukaryotic host cell of the invention lacks OCH1 activity.
  • the invention comprises a lower eukaryotic host cell ⁇ e.g., Pichia sp.) that has been modified to: (i) reduce or eliminate expression of an ATT1 gene or polypeptide, (ii) express a mutated form of an ATT1 gene, or (iii) over-express an ATT1 gene or a fragment of the ATT1, wherein the cell lacks OCH1 activity.
  • Lower eukaryotic cells lacking OCH1 activity have been described in the art and have been shown to be temperature sensitive.
  • an engineered lower eukaryotic host cell of the invention is further genetically engineered to include a nucleic acid that encodes an alpha-l,2-mannosidase that has a signal peptide that directs it for secretion.
  • the host cell of the invention is engineered to express an exogenous alpha- 1 ,2-mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5.
  • the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the host cell, where it trims N- glycans such as Man s GlcNAc 2 to yield Man 5 GlcNAc 2 .
  • N- glycans such as Man s GlcNAc 2
  • Man 5 GlcNAc 2 Man 5 GlcNAc 2 .
  • Lower eukaryotic host cells expressing such alpha-l,2-mannosidase activity have been described in the art, see, e.g., Choi et al., 2003.
  • the glyco-engineered lower eukaryotic host cell of the invention lacks OCH1 activity and comprises an alphal,2 mannosidase. 1432
  • engineered lower eukaryotic host cells ⁇ e.g., Pichia
  • ATT1 gene or polypeptide (ii) express a mutated form of an ATT1 gene, or (iii) over-express an AT l gene or a fragment of the ATT1, are further genetically engineered to eliminate
  • glycoproteins having alpha-mannosidase-resistant N-glycans by deleting or disrupting one or more of the beta-mannosyltransferase genes ⁇ e.g., BMT1, ⁇ 2, BMT3, and ⁇ 4) (See,
  • beta-mannosyltransferases using interfering RNA, antisense RNA, or the like.
  • engineered lower eukaryotic host cells ⁇ e.g., Pichia sp.) of the present invention that have been modified to: (i) reduce or eliminate expression of an
  • ATTl gene or polypeptide (ii) express a mutated form of an ATTl gene, or (iii) over-express an ATTl gene or a fragment of the ATTl, are further genetically engineered to eliminate
  • glycoproteins having phosphomannose residues e.g., by deleting or disrupting one or more of the phosphomannosyl transferase genes (i.e., PNOl, MNN4 and MNN4L1 (see e.g., U.S.
  • Patent Nos. 7,198,921 and 7,259,007) or by abrogating translation of RNAs encoding one or more of the phosphomannosyltransferases using interfering RNA, antisense RNA, or the like.
  • engineered lower eukaryotic host cells ⁇ e.g., Pichia sp.
  • gene or a fragment of the ATTl may be further genetically engineered to include a nucleic
  • STT3B protein STT3C protein, STT3D protein, or combinations thereof such as those
  • invention further comprises a promoter operably linked to a polynucleotide encoding a
  • heterologous polypeptide ⁇ e.g., a reporter or immunoglobulin heavy and/or light chain.
  • invention further comprises methods of using the host cells of the invention, e.g., methods for expressing the heterologous polypeptide in the host cell.
  • the engineered lower eukaryotic cells of the invention e.g., methods for expressing the heterologous polypeptide in the host cell.
  • host cell of the invention may be also genetically engineered so as to express particular glycosylation patterns on polypeptides that are expressed in such cells.
  • host cells of the present invention may be modified to produce polypeptides comprising N-glycans.
  • the host cells of the invention may be engineered to produce high
  • N-glycan and "glycoform” are used
  • N-linked oligosaccharide e.g., one that is attached by an N-linked oligosaccharide
  • glycoproteins contain an N-acetylglucosamine residue linked to the amide nitrogen of an
  • glycoproteins Predominant sugars found on glycoproteins are glucose, galactose, mannose, fucose, N-acetylgalactosamine (GalNAc), N-acetylglucosamine
  • sialic acid e.g., N-acetyl-neuraminic acid (NANA)
  • NANA N-acetyl-neuraminic acid
  • N-glycans have a common pentasaccharide core of Ma3 ⁇ 4GlcNAc 2
  • Man refers to mannose
  • Glc refers to glucose
  • NAc refers to N-acetyl
  • GlcNAc refers to
  • Man 3 Man 3 GlcNAc2
  • trimannose Man 3 GlcNAc2
  • N-glycans are classified
  • N-glycan has five or more mannose residues.
  • a "complex" type N-glycan has five or more mannose residues.
  • GlcNAc typically has at least one GlcNAc attached to the 1,3 mannose arm and at least one GlcNAc
  • Complex N-glycans may also have
  • Gal galactose
  • GalNAc N- acetylgalactosamine
  • sialic acid or derivatives e.g., "NANA” or “NeuAc”, where “Neu” refers to neuraminic
  • Complex N-glycans may also have intrachain substitutions comprising "bisecting" GlcNAc and core fucose ("Fuc"). Complex N-glycans may also have
  • a “hybrid” N-glycan has at least one GlcNAc on the terminal of the 1,3 mannose arm of the
  • trimannose core and zero or more mannoses on the 1,6 mannose arm of the trimannose core.
  • N-glycans are also referred to as "glycoforms”.
  • PNGase or “glycanase” refers to peptide N-glycosidase F (EC 3.2.2.18).
  • engineered lower eukaryotic host cells are engineered lower eukaryotic host cells
  • the high mannose N-glycans are selected from the group consisting of
  • the host cell of the invention is engineered to produce glycoproteins that have predominantly Man8-ioGlcNAc2 N-glycans (Example 13).
  • the N-glycans are selected from the group consisting of Man 5 GlcNAc 2 (Example 13), GlcNAcMan s GlcNAc 2 , GalGlcNAcMan 5 GlcNAc 2 , and NANAGalGlcNAcMan 5 GlcNAc2.
  • the N-glycans are selected from the group consisting of Man 3 GlcNAc2, GlcNACfl. 4)Man 3 GlcNAc2, NANA ( i.4)GlcNAC( M )Man 3 GlcNAc2, and NANA( M )Gal(M ) Man3GlcNAc ] .
  • the N-glycans comprise predominantly a Man3GlcNAc 2 structure.
  • the N-glycans comprise predominantly NANA ⁇ i_ )Gal(i-4) an 3 GlcNAc2.
  • the N-glycans comprise predominantly ANA2Gal2Man 3 GlcNAc 2 .
  • the host cell of the invention is engineered to produce glycoproteins that have galactosylated N-glycans (Example 1). In one embodiment, the host cell of the invention is engineered to produce glycoproteins that have sialylated N-glycans (Example 2 and WO2011/149999).
  • excess cell lysis is defined by either greater than 80% cells were lysed by microscopic examination, or greater than 30 microgram ml DNA concentration in the supernatant determined by Picogreen assay.
  • UV mutagenesis was performed as described by Winston (Winston 2008). Briefly, Pichia strains were grown in 40 ml YSD liquid medium overnight at 24°C. Upon reaching an OD 6 oo of 5, an aliquot of 10 6 to 10 7 cells was transferred onto the surface of a 100 mm YSD agar Petri dish, and treated, with the lid off, with 5 mJ/cm 2 of UV irradiation.
  • the Petri dish was immediately covered with aluminum foil (to prevent photo-induced DNA repair) and the mutagenized cells were allowed to recover at 24°C for 18 hours in the dark. Then, these recovered cells were transferred to 35°C incubator to select for temperature-resistant mutants. After 7-10 days incubation at 35°C, colonies were picked and re-streaked onto fresh YSD 2 061432
  • Host strain YGL17108 has been
  • Gal2GlcNAc2Man3GlcNAc2 N-glycans (Bobrowicz et al. 2004, and U.S. Patent No.
  • Host strain YGL22835 has been engineered to produce sialylated glycoproteins having predominantly N AN A2Gal2GlcN Ac2Man3 GlcN Ac2 N-glycans (Hamilton et al. 2006
  • glyco-engineered host strain YGLY17108 was derived originally
  • a lysis score of 0.5 indicates minimal lysis (more than 95% intact cells), and a lysis score of
  • Genome-sequencing was performed on the four independently isolated mutants and the parental strains to identify and characterize the mutations responsible for the increased thermal tolerance and fermentation robustness. After genome-wide comparisons between the mutants and their corresponding parents, from 1 to 9 non-synonymous nucleotide alterations (indicated by a "+" in Table 2) were identified in each of these 4 mutants. Most of these non-synonymous mutations are caused by single-nucleotide variants with one exception of a 5 bp insertion found in the YGLY17159 mutant.
  • YGLY17178 contained only one non-synonymous SNV, which is a single non-sense mutation within an uncharacterized transcription factor, which was named ATTl (acquiring thermal tolerance). Non-sense or frame-shift mutations in the ATTl gene were also identified in the other three mutants, indicating that mutations of this transcription factor are associated with the temperature resistance and fermentation robustness phenotypes.
  • ATTl acquiring thermal tolerance
  • Non-sense or frame-shift mutations in the ATTl gene were also identified in the other three mutants, indicating that mutations of this transcription factor are associated with the temperature resistance and fermentation robustness phenotypes.
  • Figures 1A-B show the sequence homology between ScGAL4 and ?pATTl.
  • Pichia pastoris does not metabolize galactose, so the
  • Pichia ATT1 gene (SEQ ID NO:l) codes for a 995 amino acid protein
  • N-glycan profiles obtained from the isolated mutants were virtually indistinguishable to the N-glycan profiles obtained from their non-mutagenized parent strains, confirming that all four mutants retained their capability to make complex human glycans.
  • Representative N-glycan MALDI traces of YGL17108, YGL17177, YGLY22835, and YGLY17159 are shown in Figures 2A-D.
  • the N-glycan profiles of mutants YGLY17172 and YGLY17178 are indistinguishable from that of mutant YGL17177.
  • the Fc-fusion expressing strain was generated by integrating the plasmid pGLY6391 ( Figure 3B), which harbored the AOXlp-driven TNFR-Fc fusion gene, into the THR1 locus of YGL17159. After fermentation under standard platform conditions at 24 °C and 32 °C in 1L DasGip bioreactors (Hopkins et al, 2011), the recombinant protein products secreted from both the parent and the mutant were purified and evaluated.
  • Plasmid pGLY5933 ( Figure 4A) was constructed by cloning a 2 kb genomic DNA fragment immediately upstream of the ATT1 ORF in front of the ALG3 terminator, followed by the lacZ-URA5-lacZ URAblaster, and then connected to a 1.9kb genomic DNA 2
  • this ATTl-upstream-URAblaster-ATTl- downstream DNA fragment was transformed into a non-mutagenized host strain ⁇ e.g.
  • this URAblaster-cassette replaced the endogenous ATTl gene, deleting 90% of
  • genomic DNA polymerase chain reaction (PCR) assays were conducted using the following oligos as PCR primers:
  • TTTCGAAAGTGGCTTGGAAT SEQ ID NO:12, 2370 bp upstream of ATTl start
  • AGTCTGCGCTTTCCATGTCT SEQ ID NO:16, 365 bp upstream of the ATTl start
  • Plasmid pGLY5947 ( Figure 4E) was constructed by cloning a 2.3 kb DNA
  • Plasmid pGLY5948 ( Figure 4F) and pGLY5949 ( Figure 4G) contain the
  • Plasmid pGLY5934 (Figure 4B) is almost identical to pGLY5947, except that it also contains a 5 bp (TGAATC, SEQ ID NO:18) frame-shift insertion after the 31st amino
  • a lysis score of 0.5 indicates minimal lysis (more than 95% intact cells), and a lysis score of
  • control strain displayed heavy lysis and was not viable within 24 hours of MeOH induction at
  • ATTl (l-655aa, SEQ ID NO:l l) truncation mutants displayed slightly higher degrees of cell lysis (lysis score of 2.5 or 3) during the later stages of the induction phase (see Table 3).
  • UV-induced mutants for example, compare YGL27601 with YGL17159;
  • Table 4 Lysis scores of parental controls compared to PpATTl deletion and truncation strains fermented at 32°C.
  • P. pastoris TEF promoter (SEQ ID NO: 6) was synthesized using oligonucleotides and manufacturer's methods as described by Genscript (Piscataway, NJ) and cloned into the plasmid, pGLY8369 ( Figure 10) using the restriction sites Bglll EcoRI to generate plasmid pGLY9959 ( Figure 11).
  • Plasmid pGLY8369 is a roll-in Escherichia colilP. pastoris shuttle plasmid that contains the P. pastoris AOXl promoter and the S. cerevisiae ARR3 gene as a selectable marker, which confers resistance to arsenite.
  • the P. pastoris TEF promoter (SEQ ID NO: 6) was synthesized using oligonucleotides and manufacturer's methods as described by Genscript (Piscataway, NJ) and cloned into the plasmid, pGLY8369 ( Figure 10) using the restriction sites Bglll Eco
  • pastoris wild type ATTl open reading frame (Pp01g00680, SEQ ID NO:l) was synthesized using oligonucleotides by Genscript and manufacturer's methods, and inserted into pGLY8369 ( Figure 10) and pGLY9959 ( Figure 11) using restriction sites EcoRI Fsel to generate plasmids pGLY9955 (Fig. 14A) and pGLY9960 (Fig. 14E), respectively.
  • Truncated versions or fragments of ATTl encoding the first 107 amino acids (1-107 aa, SEQ ID NO:3) of SEQ ID NO:7, the first 164 amino acids (1-164 aa, SEQ ID NO:4) of SEQ ID NO:7 and the first 655 amino acids (1-655 aa, SEQ ID NO:5) of SEQ ID NO:7 were subsequently generated from pGLY9955 (Fig. 14A) to yield the AOXl-driven ATTl truncated allele containing plasmids, named pGLY9956 (Fig. 14B), pGLY9957 (Fig. 14C), pGLY9958 (Fig. 14D), respectively, and from pGLY9960 (Fig.
  • Plasmid pGLY5883 was generated by fusing DNA sequences encoding the ⁇ and y chains of the Trastuzumab anti-HER2 monoclonal antibody (Carter, 1992) individually to the P. pastoris AOX1 promoter and is depicted in Figure 12.
  • DNA from this plasmid was digested with Spel to linearize the DNA and was transformed by standard electroporation methods (Pichia kit, Invitrogen, Carlsbad, CA) into the P. pastoris glyco-engineered strain YGLY8316, which has been modified to produce complex-type human N-glycans with terminal p-l,4-galactose (described as GFI5.0; Davidson U.S. Patent No.
  • Clones were selected on medium containing Zeocin and further screened by standard cultivation in 96 deep well plates and 0.5L Sixfors multifermentation fermenters (ATR Biotech, Laurel, MD; Barnard, 2010). One positive expression clone was picked and named YGLY13979 (strain lineage shown in Figure 13).
  • Plasmids pGLY9955, pGLY9956, pGLY9957, pGLY9958, pGLY9960, pGLY9961, pGLY9962, and pGLY9963 were linearized with Spel and transformed by electroporation ⁇ Pichia kit, Invitrogen, Carlsbad, CA) into strain YGLY13979 and clones were selected on YSD medium containing 1 mM and 3 mM sodium arsenite.
  • Clones that overexpress the full length and various truncations of ATTl were further isolated on YSD media and then confirmed to contain the desired ATTl expression constructs by PCR using primers RCD1019 (SEQ ID NO:19 5'- CAGATCTTCCAACATTCGTACACG-3') and AOXlseq (SEQ ID NO:20 5'- GCTTACTTTCATAATTGCGACTGGTTCC-3') for the AOX1 -driven constructs and RCD1019 and TEFseq (SEQ ID NO:21 5'-CGCAGTCCCACACGCACTCGTACATG-3') for the TEF-driven constructs.
  • PCR positive clones were selected and cultivated in a modified version of an Applikon (Foster City, CA) micro24 5ml mini-fermenter apparatus, along with the parental strain YGLY13979 ( Figure 13, also expressing the same anti-HE 2 mAb).
  • Seed cultures were prepared by inoculating strains from YSD plates to a Whatman 24-well Uniplate (10 ml, natural polypropylene) containing 3.5 ml of 4% BMGY medium (Invitrogen, Carlsbad, CA) buffered to pH 6.0 with potassium phosphate buffer. The seed cultures were grown for approximately 65-72 hours in a temperature controlled shaker at 24°C and 650 rpm agitation.
  • Micro24 plate (Type : REG2). Thirty microliters of Antifoam 204 (1 :25 dilution, Sigma Aldrich) was added to each well.
  • the Micro24 was operated in Microaerobicl mode and the fermentations were controlled at 200% dissolved oxygen, pH at 6.5, temperature at 24°C and agitation at 800rpm.
  • the induction phase was initiated upon observance of a dissolved oxygen (DO) spike after the growth phase by adding bolus shots of methanol feed solution (100% [w/w] methanol, 5 mg/1 biotin and 12.5 ml/1 PTM2 salts), 50 ⁇ 1 in the morning and 125 ⁇ 1 in the afternoon.
  • methanol feed solution 100% [w/w] methanol, 5 mg/1 biotin and 12.5 ml/1 PTM2 salts
  • the cell-free culture supernatant was harvested by centrifugation at 2500 x g in a Beckman swinging bucket centrifuge and subjected to protein A purification by standard methods (Jiang, 2011).
  • Antibody was quantified by reverse phase HPLC and calculated on a per liter basis. Supernatant was also subjected to the Picogreen (Invitrogen, Carlsbad, Ca) double stranded DNA quantification assay as a method to quantitatively measure cell breakage or lysis.
  • Pichia strains over-expressing ATT1 full length ORF (denoted as FL): (YGLY27927, YGLY27928, YGLY27929, YGLY27930, YGLY27931, and YGLY27932) along with the parental (YGLY13979) and ATTl knockout (YGLY27638) control anti-HER2 expressing strains were cultured in 1L Fedbatch Pro fermenters (DASGIP Biotools, Shrewsbury, MA) using a glycerol feedbatch followed by limiting-methanol feed induction process at 24°C as previously described (Hopkins et al., 2011).
  • DASGIP Biotools Shrewsbury, MA
  • the two over-expression strains YGLY27929 and YGLY27930 produced 473 and 458 mg/L of anti-HER2 mAb compared to 842 mg L for the ATTl knockout strain (in 73 hours of induction). Lysis of the over-expression strains was slightly elevated compared to the ATTl knockout strain, but survival to 50h of induction with moderate lysis represents a significant improvement over the parental glyco-engineered anti- HER2 expressing strain, and demonstrates the utility of over-expression of ATTl in addition to deletion/truncation of this gene.
  • H. polymorpha ATTl ortholog (GenBank EFW98022.1) was identified by performing BLAST sequence similarity search against the GenBank non-redundant protein database.
  • Figure 18 shows an alignment of S. cerevisiae Gal4, P. pastoris ATTl and H. polymorpha ATTl.
  • H. polymorpha also as known as Ogataea parapolymorpha or Pichia angusta, is a methylotrophic yeast commonly used for expressing heterologous recombinant proteins. Similar to P. pastoris, H. polymorpha also has lost its ability to utilize galactose as a carbon source because it has lost most of the genes involved in galactose metabolism.
  • GenBank non-redundant protein database by BLAST
  • H. polymorpha ATTl ortholog GenBank EFW98022.1
  • Hp ATTl polymorpha ATTl ortholog
  • ORF open reading frame
  • ScGAL4 S. cerevisiae ATTl ortholog
  • the DNA cassettes were constructed very similarly to pGLY5948 or pGLY5949 described in Example 4, except that they contain, in their 5' cross-over region, DNA fragments encoding for the N-terminal l-143aa, l-196aa, l-216aa, l-276aa, l-296aa, l-341aa, l-539aa, l-622aa, l-655aa, l-728aa, l-802aa, or l-828aa of the ATTl protein of SEQ ID NO:7.
  • a complete ATTl deletion strain as well as strains harboring the N-terminal l-31aa, l-164aa fragments of ATTl which were described in Example 4.
  • Figs. 19A and 19B The results of these experiments are shown in Figs. 19A and 19B.
  • the control strain which contained the full-length ATT1 gene, only survived ⁇ 40 hours of methanol induction at 32°C ( Figure 19A).
  • the ATT1 deletion strains lasted more than 80 hours induction, demonstrating that inactivating ATTl activity dramatically improved fermentation robustness during fermentation.
  • the ATTl (1-296 aa) fragment did not provide any robustness protection during fermentation.
  • the strain containing ATTl (l-164aa) fragment exhibited the most robust phenotype. Because the l-164aa fragment contains the complete DNA-binding and dimerization regions, but is devoid of any transcriptional activation regions of the protein, the l-164aa fragment could bind to the promoters of the target genes as non- active dimers, and prevent other transcriptional factors that might activate these target genes from binding, thus resulting in transcriptional repressions. If this is the case, one could predict that the l-164aa ATTl fragment should also compete with the full length ATTl protein for promoter-binding and interfere with the ATTl normal transcriptional activities.
  • control strain which contains the wild type ATTl gene intact, normally lasted around 120 hours of induction, at which time point the cell lysis became too high to continue.
  • the strain containing the full-length ATTl overexpression cassette also displayed approximately the same level of robustness improvement, and was viable for about 170 hours after induction.
  • the l-164aa fragment containing strain displayed the highest level of cell robustness, and finished more than 340 hours of induction at 24°C in the 15L bioreactor.
  • P. pastoris glycoengineered strain YGLY23506 is a GFI2.0 strain, which secretes proteins with predominantly MansGlcNAc2 N-glycans. (The construction of other Pichia strains, which are able to secrete MansGlcNAc 2 has been previously described in Choi et al., 2003.) This host strain lineage has been sequentially modified by knockout of the yeast OCH1 gene as well as several other members of the mannosyl transferase family, including the four BMT ⁇ -mannosyl transferase genes and phosphomannosyl transferases.
  • This strain engineering also includes expression of an alpha- 1,2-mannosidase, which results in trimming of the core MangGlcNAc 2 N-glycan to a uniform MansGlcNAc 2 form form.
  • This particular strain has also been engineered to secrete an N-terminal H9G3 histidine-tagged soluble form of HIV gpl20 from strain JR-FL (Varadarajan, 2005; Pang, 1991; Genbank AAB05604.1) containing amino acids 33-556 fused to the S. cerevisiae alpha factor prepro signal peptide.
  • Strain YGLY23506 was then transformed with plasmid pGLY5952, the Ppattl::ArsR knockout plasmid ( Figure 21) using standard electroporation and clones were selected on YSD medium containing ImM sodium arsenite. Positive knockout clones were identified by PCR as described above. PCR confirmed strains YGLY30447, YGLY30448, YGLY30449, and YGLY30450 were saved as GFI2.0 attlA clones derived from YGLY23506.
  • P. pastoris glycoengineered strain YGLY23512 is a GFII.O strain, which secretes proteins with predominantly Man g .ioGlcNAc 2 N-glycans. (The construction of other Pichia strains, which are able to secrete Man 8 .ioGlcNAc 2 has been previously described in Choi et al., 2003.) This host strain lineage has been modified by knockout of the yeast N- glycosylation machinery similar to YGLY23506 but this strain does not express an alpha- mannosidase.
  • strain YGLY23512 was transformed with plasmid pGLY5952 ( Figure 21), the Ppattl::ArsR knockout plasmid using standard electroporation and clones were selected on YSD medium containing lmM sodium arsenite. Positive knockout clones were identified by PCR as described above. PCR confirmed strains YGLY30451, YGLY30452, YGLY30453, and YGLY30454 were saved as GFI1.0 attlA clones ofYGLY23512.
  • a dose of 1.33 mL/L of methanol containing 2.5mg/mL Pepstatin A and 1.59mg/mL Chymostatin, 0.64 mg/ml ⁇ 4 was added prior to methanol induction.
  • the culture temperature was measured by the ptlOO sensor and controlled at 24 ⁇ 0.5 °C.
  • the pH was controlled at 6.0 ⁇ 0.1 during batch and fed-batch and 5.0 ⁇ 0.1 during induction phase using 30% NH40H. No acid addition was done and the pH was allowed to reach the set point before inoculation using 30% NH40H.
  • the airflow was controlled at 0.7 wm for 1L.
  • the DO set point of 20% (of saturation with air at atmospheric conditions, 1.7mg/L) was maintained throughout the run by agitation speed (450 - 1200 rpm) cascaded onto 02 addition to the fixed airflow rate. Foaming was controlled by the addition of antifoam (Antifoam 204, Sigma-Aldrich) in the initial batch medium. An initial charge of 0.128 g/L of antifoam was added to the media before inoculation. A constant feed of 100% Methanol contaimng PTM2 and Biotin was initiated after the transition phase at constant feed rate (1.5 g l hr). The pH was gradually decreased to 5 from 6 in 120 min (line increment to 6.5 in 60 min whereas to 7 in further 60 min).
  • Temp was maintained at 24°C. Every 24 hours of induction, 1.33 mL/L of methanol containing 2.5 mg mL Pepstatin A and 1.59 mg/mL of Chymostatin was added. At the end of induction, all controls and pumps were stopped. Harvest was performed at room temperature. Primary clarification was then performed by centrifugation. The whole cell broth was transferred into 800ml centrifuge bottles and centrifuged at 4°C for 30 minutes at 13,000 x g (8500RPM).
  • Examples 5-8, and 11 illustrate that engineered Pichia host strains overexpressing ATTl under relevant bioprocess conditions also exhibit improved viability, stability, and protein production ( Figures 15-17).
  • ScSUC2 S. cerevisiae invertase
  • OCH1 Alpha-l,6-mannosyltransferase
  • K1MNN2-2 K. lactis UDP-GlcNAc transporter
  • Beta-mannose-transfer (beta-mannose elimination)
  • BMT2 Beta-mannose-transfer (beta-mannose elimination)
  • BMT3 Beta-mannose-transfer (beta-mannose elimination)
  • BMT4 Beta-mannose-transfer (beta-mannose elimination)
  • NN4L1 MNN4-like 1 (charge elimination)
  • MmSLC35A3 Mouse orthologue of UDP-GlcNAc transporter
  • PNOl Phosphornannosylation of N-linked oligosaccharides (charge elimination)
  • MNN4 Mannosyltransferase (charge elimination)
  • CiMNS 1 Secreted Coccidioides immitis mannosidase I
  • LmSTT3D Leishmania major oligosaccharyl transferase subunit D REFERENCES
  • SEQ ID P. pastoris primer within the ATTl ORF, 1070 bp after the start to NO: 17 confirm the absence of the wild-type ATTl ORF

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2012/061432 2011-10-28 2012-10-23 Engineered lower eukaryotic host strains for recombinant protein expression Ceased WO2013062940A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU2012329091A AU2012329091A1 (en) 2011-10-28 2012-10-23 Engineered lower eukaryotic host strains for recombinant protein expression
IN2963CHN2014 IN2014CN02963A (https=) 2011-10-28 2012-10-23
CN201280064747.2A CN104024409A (zh) 2011-10-28 2012-10-23 用于重组蛋白表达的经工程改造的低等真核宿主菌株
KR1020147013881A KR20140091018A (ko) 2011-10-28 2012-10-23 재조합 단백질 발현을 위한 조작된 하등 진핵 숙주 균주
EP12843508.8A EP2771461B1 (en) 2011-10-28 2012-10-23 Engineered lower eukaryotic host strains for recombinant protein expression
JP2014538873A JP2014532406A (ja) 2011-10-28 2012-10-23 組換えタンパク質発現のための操作された下等真核宿主株
CA2853341A CA2853341A1 (en) 2011-10-28 2012-10-23 Engineered lower eukaryotic host strains for recombinant protein expression
US14/354,628 US9328367B2 (en) 2011-10-28 2012-10-23 Engineered lower eukaryotic host strains for recombinant protein expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161552674P 2011-10-28 2011-10-28
US61/552,674 2011-10-28

Publications (1)

Publication Number Publication Date
WO2013062940A1 true WO2013062940A1 (en) 2013-05-02

Family

ID=48168381

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/061432 Ceased WO2013062940A1 (en) 2011-10-28 2012-10-23 Engineered lower eukaryotic host strains for recombinant protein expression

Country Status (9)

Country Link
US (1) US9328367B2 (https=)
EP (1) EP2771461B1 (https=)
JP (1) JP2014532406A (https=)
KR (1) KR20140091018A (https=)
CN (1) CN104024409A (https=)
AU (1) AU2012329091A1 (https=)
CA (1) CA2853341A1 (https=)
IN (1) IN2014CN02963A (https=)
WO (1) WO2013062940A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014066134A1 (en) * 2012-10-22 2014-05-01 Merck Sharp & Dohme Corp. Crz1 mutant fungal cells
US20150017686A1 (en) * 2012-02-16 2015-01-15 Merck Sharp & Dohme Corp. Methods for reducing mannosyltransferase activity in lower eukaryotes
US9328367B2 (en) 2011-10-28 2016-05-03 Merck Sharp & Dohme Corp. Engineered lower eukaryotic host strains for recombinant protein expression
US9701751B2 (en) 2009-09-03 2017-07-11 Merck Sharp & Dohme Corp. Anti-GITR antibodies
WO2017194699A1 (en) * 2016-05-13 2017-11-16 University Of Copenhagen A cell-based array platform

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SG11201707056UA (en) * 2015-03-03 2017-09-28 Sandoz Ag Constitutive yeast LLP promoter-based expression system
JP2018038286A (ja) * 2016-09-05 2018-03-15 国立大学法人神戸大学 新規宿主細胞及びそれを用いた目的タンパク質の製造方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020137134A1 (en) 2000-06-28 2002-09-26 Gerngross Tillman U. Methods for producing modified glycoproteins
US20040014170A1 (en) 2000-05-17 2004-01-22 Masami Miura Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby
US20060040353A1 (en) 2000-06-28 2006-02-23 Davidson Robert C Production of galactosylated glycoproteins in lower eukaryotes
US20060160179A1 (en) 2003-12-24 2006-07-20 Piotr Bobrowicz Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins
US20060211085A1 (en) 2004-04-29 2006-09-21 Piotr Bobrowicz Methods for reducing or eliminating alpha-mannosidase resistant glycans for the production of glycoproteins
WO2011006389A1 (zh) 2009-07-15 2011-01-20 Chen Defang 一种宝石连接结构

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1194756A4 (en) * 1999-04-21 2004-12-29 Wyeth Corp METHODS OF IDENTIFYING N-TYPE ION CHANNEL INACTIVATION MODULATORS
US20060148000A1 (en) * 1999-04-21 2006-07-06 Wyeth Methods for identifying modulators of N-type ion channel inactivation
JP2004527204A (ja) * 2000-04-24 2004-09-09 ワイエス ペプチド結合対の特異的相互作用を有する新規な細胞系
AR087433A1 (es) * 2011-08-08 2014-03-26 Merck Sharp & Dohme Analogos de insulina n-glicosilados
CA2853341A1 (en) 2011-10-28 2013-05-02 Merck Sharp & Dohme Corp. Engineered lower eukaryotic host strains for recombinant protein expression

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040014170A1 (en) 2000-05-17 2004-01-22 Masami Miura Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby
US20020137134A1 (en) 2000-06-28 2002-09-26 Gerngross Tillman U. Methods for producing modified glycoproteins
US20060040353A1 (en) 2000-06-28 2006-02-23 Davidson Robert C Production of galactosylated glycoproteins in lower eukaryotes
US20060160179A1 (en) 2003-12-24 2006-07-20 Piotr Bobrowicz Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins
US20060211085A1 (en) 2004-04-29 2006-09-21 Piotr Bobrowicz Methods for reducing or eliminating alpha-mannosidase resistant glycans for the production of glycoproteins
WO2011006389A1 (zh) 2009-07-15 2011-01-20 Chen Defang 一种宝石连接结构

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
"Vectors: A Survey of Molecular Cloning Vectors and Their Uses", 1988, BUTTERSWORTH
ALTSCHUL, S.F. ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
BATES ET AL., J. BIOL. CHEM., vol. 281, no. 1, 2006, pages 90 - 98
DATABASE GENBANK [online] 25 July 2011 (2011-07-25), KUBERL, A. ET AL.: "Pichia pastoris CBS 7435 chromosome 1, complete replicon sequence.", XP003033736, Database accession no. FR839628 *
GISH, W. ET AL., NATURE GENET., vol. 3, 1993, pages 266 - 272
KRIJGER, J.J. ET AL.: "A novel, lactase-based selection and strain improvement strategy for recombinant protein expression in Kluyveromyces lactis.", MICROB. CELL FACT., vol. 11, no. 112, 20 August 2012 (2012-08-20), pages 1 - 12, XP021128994 *
NAKAYAMA ET AL., EMBO J, vol. 11, no. 7, 1992, pages 2511 - 2519
POUWELS ET AL.: "Cloning Vectors: A Laboratory Manual", 1985, ELSEVIER
See also references of EP2771461A4
WOOG KIM ET AL., J. BIOL. CHEM., vol. 281, no. 10, 2006, pages 6261 - 6272
YOKO-O ET AL., FEBS LETTERS, vol. 489, no. 1, 2001, pages 75 - 80
ZACHARIAE, W. ET AL.: "Glucose repression of lactose/galactose metabolism in Kluyveromyces lactis is determined by the concentration of the transcriptional activator LAC9 (K1GAL4).", NUCLEIC ACIDS RES., vol. 21, no. 1, 1993, pages 69 - 77, XP055150371 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9701751B2 (en) 2009-09-03 2017-07-11 Merck Sharp & Dohme Corp. Anti-GITR antibodies
US10400040B2 (en) 2009-09-03 2019-09-03 Merck Sharp & Dohme Corp. Anti-GITR antibodies
US9328367B2 (en) 2011-10-28 2016-05-03 Merck Sharp & Dohme Corp. Engineered lower eukaryotic host strains for recombinant protein expression
US20150017686A1 (en) * 2012-02-16 2015-01-15 Merck Sharp & Dohme Corp. Methods for reducing mannosyltransferase activity in lower eukaryotes
US9416389B2 (en) * 2012-02-16 2016-08-16 Merck Sharp & Dohme Corp. Methods for reducing mannosyltransferase activity in lower eukaryotes
WO2014066134A1 (en) * 2012-10-22 2014-05-01 Merck Sharp & Dohme Corp. Crz1 mutant fungal cells
US10100343B2 (en) 2012-10-22 2018-10-16 Merck Sharp & Dohme Corp. CRZ1 mutant fungal cells
WO2017194699A1 (en) * 2016-05-13 2017-11-16 University Of Copenhagen A cell-based array platform

Also Published As

Publication number Publication date
KR20140091018A (ko) 2014-07-18
US9328367B2 (en) 2016-05-03
JP2014532406A (ja) 2014-12-08
EP2771461A4 (en) 2015-06-17
CN104024409A (zh) 2014-09-03
EP2771461B1 (en) 2019-12-04
US20140302557A1 (en) 2014-10-09
CA2853341A1 (en) 2013-05-02
IN2014CN02963A (https=) 2015-07-03
EP2771461A1 (en) 2014-09-03
AU2012329091A1 (en) 2014-05-01

Similar Documents

Publication Publication Date Title
US8771989B2 (en) Vectors and yeast strains for protein production: Ca2+ ATPase overexpression
US9328367B2 (en) Engineered lower eukaryotic host strains for recombinant protein expression
AU2009215739A1 (en) Vectors and yeast strains for protein production
US9428784B2 (en) Methods for increasing N-glycan occupancy and reducing production of hybrid N-glycans in pichia pastoris strains lacking ALG3 expression
WO2013066765A1 (en) Mutation of tup1 in glycoengineered yeast
US10100343B2 (en) CRZ1 mutant fungal cells
EP2956158A1 (en) Methods for increasing n-glycan occupancy and reducing production of hybrid n-glycans in pichia pastoris strains lacking alg3 expression
US20140287463A1 (en) Engineered pichia strains with improved fermentation yield and n-glycosylation quality
WO2013062886A1 (en) Controlling o-glycosylation in lower eukaryotes
US20150299690A1 (en) Engineered lower eukaryotic host strains deficient in grr1 activity for recombinant protein
Class et al. Patent application title: ENGINEERED LOWER EUKARYOTIC HOST STRAINS FOR RECOMBINANT PROTEIN EXPRESSION Inventors: Bo Jiang (Norwich, VT, US) Rebecca D. Argyros (Hartford, VT, US) Stephanie Nelson (White River Junction, VT, US) Robert C. Davidson (Enfield, NH, US) Robert C. Davidson (Enfield, NH, US) Ronghua Chen (Needham Heights, MA, US) Jun Zhuang (Wellesley, MA, US)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12843508

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2853341

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014538873

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14354628

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2012329091

Country of ref document: AU

Date of ref document: 20121023

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012843508

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20147013881

Country of ref document: KR

Kind code of ref document: A