WO2013060020A1 - Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée - Google Patents

Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée Download PDF

Info

Publication number
WO2013060020A1
WO2013060020A1 PCT/CN2011/081500 CN2011081500W WO2013060020A1 WO 2013060020 A1 WO2013060020 A1 WO 2013060020A1 CN 2011081500 W CN2011081500 W CN 2011081500W WO 2013060020 A1 WO2013060020 A1 WO 2013060020A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
amino acid
acid selected
polypeptide
ser
Prior art date
Application number
PCT/CN2011/081500
Other languages
English (en)
Chinese (zh)
Inventor
许迅
郑颖
Original Assignee
上海市第一人民医院
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 上海市第一人民医院 filed Critical 上海市第一人民医院
Priority to PCT/CN2011/081500 priority Critical patent/WO2013060020A1/fr
Publication of WO2013060020A1 publication Critical patent/WO2013060020A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/515—Angiogenesic factors; Angiogenin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates to the field of biomedicine, and in particular to a novel class of small peptides inhibiting neovascularization, which are polypeptides derived from Placenta Growth Factor (P1GF).
  • P1GF Placenta Growth Factor
  • the invention also relates to methods of making and using the polypeptides and pharmaceutical compositions comprising the polypeptides. Background technique
  • new blood vessels is an extremely complex process that includes: expansion of existing blood vessels, increased vascular permeability, degradation of perivascular matrix, activation and proliferation of endothelial cells, migration, and formation of new capillary-like lumens.
  • ocular photopathic neovascularization is routinely treated with laser photocoagulation, photodynamic therapy (PDT), and thermal transpup i l lary therapy (TTT).
  • PDT photodynamic therapy
  • TTT thermal transpup i l lary therapy
  • the systemic administration is often unable to achieve sufficient drug concentration in the ocular tissue due to the blood-aqueous barrier and the blood-retinal barrier; local administration, such as intravitreal injection, greater than 76.5 kDa is theoretically difficult to penetrate.
  • the retina acts on the retina and choroidal neovascularization.
  • the drug must penetrate the lipophilic corneal epithelial cells in close contact with the hydrophilic corneal stroma, so that only the appropriate fat-soluble, low molecular weight or transporter with the ocular surface tissue (eg: Amino acid transporters, oligopeptide transporters, etc.) bind to the drug to reach the anterior chamber.
  • the extent to which the drug dissolves in hydrophilic tears, aqueous humor, and vitreous humor is positively correlated with its effectiveness.
  • the bioavailability of ophthalmic drugs is very low; to increase it, the concentration of the drug can be increased.
  • Compounds used to treat neovascularization of tumors are more toxic and side effects, and are not administered at high doses both systemically and locally.
  • exogenous proteins with large molecular weight are also sensitive foreign sources, which can cause immune damage to ocular tissues such as uvea.
  • angiostatin is composed of plasminogen Kringle 1-4 (plasminogen Kringle 1-4).
  • the composition can significantly inhibit the growth of vascular-dependent tumors, but due to its large molecular weight and complex spatial conformation, there are cumbersome recombination and purification processes and endotoxin residues in the preparation process.
  • the drugs currently used for the treatment of ocular neovascularization are very limited, such as recombinant anti-human VEGF monoclonal antibody bevac i vonab (Avast in), recombinant anti-human VEGF monoclonal antibody fragment ranib i vonab ( Lucent is), etc., but they are expensive and need to be administered repeatedly through the vitreous cavity, even causing risks such as vascular embolism.
  • Another object of the invention is to provide a process and use comprising the polypeptide.
  • a polypeptide represented by the following formula I, or a pharmaceutically acceptable salt thereof is provided in a first aspect of the invention.
  • XaaO is no, or 1-3 amino acids constitute a peptide
  • Xaal is an amino acid selected from the group consisting of Thr or Ser
  • Xaa2 is an amino acid selected from the group consisting of: Ala, Val, Leu or lie;
  • Xaa3 is an amino acid selected from the group consisting of: Asn, Gin, His, Lys or Arg;
  • Xaa4 is an amino acid selected from the group consisting of Val, Ile, Leu, Met, Phe or Ala
  • Xaa5 is an amino acid selected from the group consisting of Thr or Ser
  • Xaa6 is an amino acid selected from the group consisting of Met, Leu, Phe, or lie;
  • Xaa7 is an amino acid selected from the group consisting of Gin or Asn
  • Xaa8 is an amino acid selected from the group consisting of Leu, lie, Val, Met, Ala or Phe
  • Xaa9 is an amino acid selected from the group consisting of Leu, Ile, Val, Met, Ala or Phe
  • XaalO is an amino acid selected from the group consisting of : Lys, Arg Gin or Asn;
  • Xaall is an amino acid selected from the group Ile, Leu Val, Met, Ala or Phe;
  • Xaal2 is an amino acid selected from the group consisting of Arg, Pro Lys ⁇ Gin or Asn;
  • Xaal3 is an amino acid Ser or Thr selected from the group consisting of;
  • Xaal4 is an amino acid selected from the group consisting of Gly, Pro, or Ala;
  • Xaal5 is an amino acid selected from the group consisting of Asp, Glu;
  • Xaal6 is an amino acid selected from the group consisting of Arg, Lys, Gin or Asn;
  • Xaal7 is an amino acid Pro or Ala selected from the group consisting of
  • XaalS is an amino acid Ser or Thr selected from the group consisting of;
  • Xaal9 is an amino acid selected from the group consisting of Tyr, Trp, Phe, Thr or Ser;
  • Xaa20 is an amino acid selected from the group consisting of Val, Ile, Leu, Met, Phe or Ala
  • Xaa21 is an amino acid selected from the group consisting of Glu or Arg
  • Xaa22 is an amino acid selected from the group consisting of Leu or Ser;
  • Xaa23 is an amino acid Thr or Arg selected from the group consisting of;
  • Xaa24 is an amino acid Phe or Ser selected from the group below ;
  • Xaa25 is an amino acid Ser or Arg selected from the group consisting of
  • Xaa26 is an amino acid selected from the group consisting of Gin or Ser;
  • Xaa27 is an amino acid His or Arg selected from the group consisting of;
  • Xaa28 is an amino acid selected from the group consisting of: None, or 1-3 amino acids constituting a peptide; and the polypeptide has an activity of inhibiting angiogenesis, and the polypeptide is 27-33 amino acids in length.
  • polypeptide is 28-31 amino acids in length.
  • Xaa28 is a peptide consisting of three amino acids.
  • XaaO is Lys, Glu, Pro-Iie-Lys or lie-Lys.
  • polypeptide is selected from the group consisting of:
  • amino acid sequence represented by SEQ ID NO: 1 is formed by substitution, deletion or addition of 1-5 (preferably 1-3, more preferably 1-2) amino acid residues, and has inhibition A polypeptide derived from (a) angiogenic function.
  • the derivative polypeptide retains 70% of the angiogenic activity of the polypeptide of SEQ I 1 .
  • the derivative polypeptide has 80% identity, preferably 90%; more preferably 95% identity with SEQ ID NO: 1.
  • the invention also provides dimeric and multimeric forms of the compounds of formula I which inhibit angiogenic function.
  • an isolated nucleic acid molecule encoding the above-described polypeptide of the invention.
  • a pharmaceutical composition comprising:
  • the dosage form of the composition is an eye drop (e.g., periocular and intraocular injection, ophthalmic gel or ophthalmic ointment).
  • the composition is a sustained release dosage form.
  • a polypeptide or a pharmaceutically acceptable salt of the invention for the preparation of a medicament for inhibiting angiogenesis or for preventing diseases associated with angiogenesis.
  • the angiogenesis-related disease is selected from the group consisting of neovascular ophthalmopathy, tumor, ischemic heart disease, non-inflammatory cardiomyopathy, coronary arteriosclerosis, occlusive arteriosclerosis, Arterial embolism, arterial thrombosis, Berger's disease, chronic inflammation, inflammatory bowel disease, ulcer, rheumatoid arthritis, scleroderma, psoriasis, infertility or sarcomatosis.
  • the neovascular eye disease comprises involvement of the choroid, retina, cornea or iris, including age-related macular degeneration, proliferative diabetic retinopathy, retinal vascular occlusive disease, retinopathy of prematurity, corneal infection , neovascular glaucoma and so on.
  • a method of inhibiting angiogenesis in a mammal comprising the steps of: administering to a subject in need thereof a polypeptide of the invention or a pharmaceutically acceptable salt thereof.
  • the object is a human.
  • the angiogenesis is angiogenesis associated with neovascular eye disease. It is to be understood that within the scope of the present invention, the above-described various technical features of the present invention and the technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here. DRAWINGS
  • Figure 1 shows the results of purity identification of the small peptide ZY3 by high performance liquid chromatography.
  • Figure 2 shows the effect of small peptide ZY3 on the proliferation of human umbilical vein endothelial cells HUVECs.
  • the small peptide ZY3 has an obvious inhibitory effect on endothelial cell proliferation.
  • the VEGF+ small peptide ZY3 group significantly inhibited the proliferation of HUVECs, *P ⁇ 0.05, **P ⁇ 0.01, and the difference was statistically significant.
  • Figure 3 shows the effect of small peptide ZY3 on the lumen formation of human umbilical vein endothelial cells HUVECs. It can be seen that the small peptide ZY3 has an effect of inhibiting the formation of endothelial cells.
  • Figures 3a, 3b, and 3c show the inhibitory effect of small peptide ZY3 on lumen formation of HUVECs.
  • Figure 3a shows the VEGF group
  • Figure 3b shows the VEGF+ZY3 (16 ( ⁇ M) group
  • Figure 3c shows that compared with the VEGF group, VEGF and each concentration of the small peptide ZY3 group have a significant inhibitory effect on the lumen formation of HUVECs, *P ⁇ 0.05, the difference was statistically significant.
  • Figure 4 shows the effect of small peptide ZY3 on neovascularization in the chorioallantoic membrane of chicken embryo: Small peptide ZY3 has an obvious effect of inhibiting neovascularization.
  • Figures 4a-4c show 3-5 grade microvessel count results over a 2.5 mm range of filter paper.
  • Figure 4a is the PBS group
  • Figure 4b is the ⁇ 3 (10 ⁇ 1/tablet) group
  • Figure 4c is the ⁇ 3 (50 ⁇ 1/tablet) group
  • Figure 4d is the VEGF+ group of small peptides in the ZY3 group, which significantly inhibits chicken embryo urine compared to the VEGF group.
  • the number of neovascularization in the capsule was inhibited in a concentration-dependent manner, **P ⁇ 0.01, and the difference was statistically significant.
  • Figure 5 shows the effect of small peptide ZY3 on the pathological neovascularization of the cornea in mice. It can be seen that the small peptide ZY3 has an effect of inhibiting neovascularization.
  • Figures 5a-5c show the corneal neovascularization area in mice
  • Figure 5a is the VEGF group
  • Figure 5b is the ⁇ 3 (0.5 ⁇ 1/granule) group
  • Figure 5c is the ⁇ 3 (2 ⁇ 1/granule) group
  • Figure 5d is the VEGF+ relative to the VEGF group.
  • Small peptide ZY3 in different concentration groups had significant inhibition of corneal pathological neovascularization, **P ⁇ 0.01, the difference was statistically significant.
  • the present inventors After extensive and intensive research, the present inventors have for the first time prepared a small molecule polypeptide derived from placental growth factor and having an angiogenesis-inhibiting function with a molecular weight of less than 5 kD (e.g., only about 3 kD). Specifically, the present inventors applied bioinformatics methods, based on homology analysis and biological characteristics analysis, designed several candidate sequences, synthesized by solid phase method, and isolated and purified to obtain high-purity small peptide ZY3.
  • the small peptide of the invention has small molecular weight and can penetrate various eye tissue barriers; has good water solubility, can maintain high concentration in neutral tears, aqueous humor and vitreous humor; has high safety and has low toxicity to biological tissues. Eye bioavailability is high, which reduces the dose and reduces systemic side effects. On the basis of this, the present invention has been completed. Placental growth factor
  • Placenta Growth Factor is a member of the VEGF family and was isolated and purified from human placental cDNA library by Magl ione et al. in 1991. In addition to the human placenta, the presence of P1GF is also detected in the heart, lungs, thyroid, and skeletal muscle. According to the selective splicing of the P1GF gene, four different isoforms can be produced: P1GF-KP1GF131), P1GF-2 (P1GF152), P1GF-3 (P1GF203), P1GF-4 (P1GF224), which differ in size and secretion characteristics and receptor affinity.
  • the two P1GF monomers exert a biological effect by forming a secretory homodimeric glycoprotein and binding to its receptor, thereby mediating subsequent signal transduction.
  • P1GF can also bind to VEGF to form a heterodimer, affecting the signal transduction pathway of VEGF.
  • P1GF can promote the proliferation of vascular endothelial cells, especially microvascular endothelial cells, and can act as a chemokine of endothelial cell growth factor to regulate endothelial cell growth and stimulate angiogenesis.
  • P1GF also promotes the migration of monocytes and endothelial cells and increases the permeability of endothelial cells.
  • VEGF can also induce neovascularization
  • the neovascularization induced by P1GF has normal physiological characteristics without other abnormal changes. These neovascular vessels do not undergo edema, hemangioma, and opacity caused by VEGF-induced neovascularization. Sexual increase and other phenomena. Active polypeptide
  • polypeptide of the present invention refers to a peptide ZY3 amino acid sequence having an angiogenesis inhibitory activity.
  • a protein or polypeptide of (TANVTM QLLKIRSGDRPSYVELTFSQH, as set forth in SEQ ID NO: 1).
  • the term also encompasses variant forms of the sequence of SEQ ID NO: 1 which have an angiogenic inhibitory function.
  • variants include (but are not limited to): 1-5 (usually 1-4, preferably 1-3, more preferably 1-2, optimally 1) amino acid deletions, insertions And/or substitution, and addition or deletion of one or several (usually within 5, preferably within 3, more preferably within 2) amino acids at the C-terminus and/or N-terminus.
  • 1-5 usually 1-4, preferably 1-3, more preferably 1-2, optimally 1 amino acid deletions, insertions And/or substitution, and addition or deletion of one or several (usually within 5, preferably within 3, more preferably within 2) amino acids at the C-terminus and/or N-terminus.
  • amino acids usually not altered.
  • the addition or deletion of one or more amino acids at the C-terminus and/or N-terminus will generally not alter the structure and function of the protein.
  • the term also encompasses polypeptides of the invention in monomeric and multimeric forms. The term also includes both linear and non-linear polypeptides (e.g., cyclic peptides).
  • the invention also encompasses active fragments, derivatives and analogs of ZY3 polypeptides.
  • fragment refers to a polypeptide that substantially retains an angiogenic function or activity.
  • a polypeptide fragment, derivative or analog of the invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, or (ii) at one or more a polypeptide having a substituent group in one amino acid residue, or (iii) a polypeptide formed by fusing a ZY polypeptide with another compound (such as a compound which prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) an additional amino group.
  • a polypeptide formed by fusion of the acid sequence to the polypeptide sequence (subsequent protein formed by fusion with a leader sequence, a secretory sequence or a tag sequence such as 6His).
  • a preferred class of reactive derivatives means that up to 5, preferably up to 3, more preferably up to 2, and optimally 1 amino acid are similar or similar amino acids to the amino acid sequence of Formula I. Substituting to form a polypeptide. These conservative variant polypeptides are preferably produced by amino acid substitution according to Table 1.
  • the invention also provides analogs of ZY3 polypeptides.
  • the difference between these analogs and the native ZY3 polypeptide may be a difference in amino acid sequence, or may be a difference in the modification form that does not affect the sequence, or both.
  • Analogs also include analogs having residues other than the native L-amino acid (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, ⁇ -amino acids). It is to be understood that the polypeptide of the present invention is not limited to the representative polypeptides exemplified above.
  • Modifications include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those produced by glycosylation modifications in the synthesis and processing of the polypeptide or in further processing steps. Such modification can be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylation enzyme or a deglycosylation enzyme. Modified forms also include sequences having phosphorylated amino acid residues such as phosphotyrosine, phosphoserine, phosphothreonine. Also included are polypeptides modified to increase their resistance to proteolytic properties or to optimize solubility properties.
  • the polypeptide of the present invention can also be used in the form of a salt derived from a pharmaceutically or physiologically acceptable acid or base.
  • These salts include, but are not limited to, salts formed with: hydrochloric acid, hydrobromic acid, sulfuric acid, citric acid, tartaric acid, phosphoric acid, lactic acid, pyruvic acid, acetic acid, succinic acid, oxalic acid, fumaric acid, malay Acid, oxaloacetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, or isethionic acid.
  • Other salts include: salts with alkali or alkaline earth metals such as sodium, potassium, calcium or magnesium, as well as esters, carbamates or other conventional "prodrugs". Coding sequence
  • the invention also relates to polynucleotides encoding a ⁇ 3 polypeptide.
  • a preferred coding sequence is (SEQ ID NO:
  • CCTCCTACGTGGAGCTGACGTTCTCTCAGCAC which encodes the short peptide ZY3 shown in SEQ ID NO: 1.
  • the polynucleotide of the present invention may be in the form of sputum or RNA. ⁇ can be a coded chain or a non-coded chain.
  • the coding region sequence encoding the mature polypeptide may be identical to the coding region sequence shown in SEQ ID NO: 2 or may be a degenerate variant.
  • a "degenerate variant" in the present invention refers to a polypeptide encoding a sequence having the sequence of SEQ ID NO: 1, but having the corresponding coding region sequence in SEQ ID NO: 2 Differential nucleic acid sequences.
  • the full length sequence of the ZY3 nucleotide of the present invention or a fragment thereof can generally be used by PCR amplification, recombinant method or Synthetic method is obtained.
  • DNA sequences encoding the polypeptides of the present invention (or fragments thereof, or derivatives thereof) have been obtained by chemical synthesis.
  • the DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art.
  • the invention also relates to vectors comprising the polynucleotides of the invention, and to host cells genetically engineered using the vectors of the invention or the ZY polypeptide coding sequences.
  • the invention also encompasses polyclonal and monoclonal antibodies, particularly monoclonal antibodies, that are specific for a ZY3 polypeptide.
  • the polypeptide of the invention may be a recombinant polypeptide or a synthetic polypeptide.
  • the polypeptides of the invention may be chemically synthesized, or recombinant. Accordingly, the polypeptide of the present invention can be artificially synthesized by a conventional method or can be produced by a recombinant method.
  • a preferred method is to use liquid phase synthesis techniques or solid phase synthesis techniques such as Boc solid phase method, Fmoc solid phase method or a combination of both methods.
  • the solid phase synthesis can quickly obtain samples, and the appropriate resin carrier and synthesis system can be selected according to the sequence characteristics of the peptide of interest.
  • a preferred solid phase support in the Fmoc system is a Wang resin linked to a C-terminal amino acid in the peptide, a Wang resin structure is polystyrene, and an arm between the amino acids is 4-decyloxybenzyl alcohol; using 25% hexahydropyridine /dimethylformamide was treated at room temperature for 20 minutes to remove the Fmoc protecting group and extended from the C-terminus to the N-terminus according to the given amino acid sequence. After the completion of the synthesis, the synthesized proinsulin-related peptide was cleaved from the resin with trifluoroacetic acid containing 4% p-methylphenol, and the protecting group was removed.
  • the resin was removed by filtration and the diethyl ether was precipitated to obtain a crude peptide. After the solution of the obtained product was lyophilized, the desired peptide was purified by gel filtration and reverse phase high pressure liquid chromatography.
  • the resin is a PAM resin to which a C-terminal amino acid in the peptide is attached, the PAM resin structure is polystyrene, and the arm between the amino acid is 4-hydroxymethyl phenylacetamide;
  • the protecting group Boc was removed with TFA/dichloromethane (DCM) and neutralized with diisopropylethylamine (DIEA/dichloromethane).
  • the peptide chain is cleaved from the resin by treatment with hydrogen fluoride (HF) containing p-cresol (5-10%) at 0 ° C for 1 hour while removing the protecting group. 50-80%
  • HF hydrogen fluoride
  • the peptide is extracted with acetic acid (containing a small amount of mercaptoethanol), and the solution is further lyophilized and further purified by molecular sieve Sprint haddex G10 or Tsk-40f, and then purified by high pressure liquid phase to obtain the desired peptide. It can be known in the field of peptide chemistry.
  • Various coupling agents and coupling methods are coupled to each amino acid residue, and for example, dicyclohexylcarbodiimide (DCC), hydroxybenzotriazole (HOBt) or 1, 1, 3, 3-tetra can be used.
  • DCC dicyclohexylcarbodiimide
  • HOBt hydroxybenzotriazole
  • 1, 1, 3, 3-tetra 1, 1, 3, 3-tetra
  • HBTU Urea hexafluorophosphate
  • the polypeptide ZY3 of the present invention is prepared by a solid phase synthesis method according to the sequence thereof, and purified by high performance liquid chromatography to obtain a high-purity peptide lyophilized powder, which is stored in -2 CTC.
  • Another method is to produce a polypeptide of the invention using recombinant techniques.
  • the polynucleotide of the present invention can be used to express or produce a recombinant ⁇ 3 polypeptide by conventional recombinant DNA techniques. Generally speaking, the following steps are taken:
  • the recombinant polypeptide can be expressed intracellularly, or on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting method), centrifugation, osmotic sterilizing, ultra-treatment, ultra-centrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment treatment with a protein precipitant (salting method), centrifugation, osmotic sterilizing, ultra-treatment, ultra-centrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography
  • polypeptide of the present invention is short, it is conceivable to connect a plurality of polypeptides in series, to obtain an expression product in a multimeric form after recombinant expression, and then to form a desired small peptide by enzymatic cleavage or the like.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising (a) a safe and effective amount of a polypeptide of the present invention or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable carrier or excipient .
  • the amount of the polypeptide of the present invention is usually from 10 ⁇ g to 100 mg / dose, preferably from 100 to 1000 ⁇ g / dose.
  • an effective dose is from about 0.01 mg/kg to 50 mg/kg, preferably from 0.05 mg/kg to 10 mg/kg body weight of the polypeptide of the invention.
  • the polypeptides of the invention may be used alone or in combination with other therapeutic agents (e.g., formulated in the same pharmaceutical composition).
  • the pharmaceutical composition may also contain a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to a carrier for the administration of a therapeutic agent.
  • the term refers to pharmaceutical carriers which do not themselves induce the production of antibodies harmful to the individual receiving the composition and which are not excessively toxic after administration. These vectors are well known to those of ordinary skill in the art. A full discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceuticals (Mack Pub. Co., NJ 1991).
  • Such carriers include, but are not limited to, saline, buffer, dextrose, water, glycerol, ethanol, adjuvants, and combinations thereof.
  • the pharmaceutically acceptable carrier in the therapeutic composition may contain a liquid such as water, saline, glycerol and ethanol.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like may also be present in these carriers.
  • the therapeutic compositions may be in the form of injectables, such as liquid solutions or suspensions; solid forms such as liquid carriers, which may be formulated in solution or suspension prior to injection.
  • composition of the invention can be administered by conventional routes including, but not limited to, ocular, periocular, intraocular, intramuscular, intravenous, subcutaneous, intradermal or topical administration.
  • the subject to be prevented or treated may be an animal; especially a human.
  • compositions such as eye drops, injections, ophthalmic gels and ophthalmics which can be exemplified can be formulated by mixing, diluting or dissolving according to a conventional method, and occasionally adding a suitable pharmaceutical additive such as a shape Agent, disintegrant, binder, lubricant, diluent, buffer, isotonic agent (i sotoni c it i es preservative, wetting agent, emulsifier, dispersant, stabilizer and cosolvent, and The formulation process can be carried out in the usual manner depending on the dosage form.
  • the preparation of eye drops can be carried out by dissolving the short peptide ZY or a pharmaceutically acceptable salt thereof together with the base substance in sterile water (a surfactant is dissolved in sterile water) to adjust the osmotic pressure and pH to The physiological state, and optionally a suitable pharmaceutical additive such as a preservative, a stabilizer, a buffer, an isotonicity agent, an antioxidant and a tackifier, may be optionally added and then completely dissolved.
  • a suitable pharmaceutical additive such as a preservative, a stabilizer, a buffer, an isotonicity agent, an antioxidant and a tackifier
  • compositions of the invention may also be administered in the form of sustained release agents.
  • the short peptide ZY or a salt thereof can be plunged into a pellet or microcapsule in which the sustained release polymer is used as a carrier, and then the pellet or microcapsule is surgically implanted into the tissue to be treated.
  • the short peptide ZY3 or a salt thereof can also be applied by inserting a drug-coated intraocular lens.
  • the sustained-release polymer an ethylene-vinyl acetate copolymer may be exemplified.
  • the dose of the short peptide ZY3 as an active ingredient or a pharmaceutically acceptable salt thereof may be based on the weight, age, sex, and degree of symptoms of each patient to be treated. Determine it reasonably.
  • the concentration is usually about 0.1 to 10% by weight, preferably 1 to 5% by weight, and may be administered 2 to 6 times a day, 1-2 drops each time.
  • a pharmaceutical composition containing the peptide of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient has a remarkable inhibitory activity against angiogenesis. It has been confirmed by animal experiments that the polypeptide of the present invention can inhibit not only angiogenesis of the chicken chorioallantoic membrane, but also inhibit proliferation, migration, chemotaxis and lumen formation of human umbilical vein endothelial cells, and inhibit hypoxia-inducible mice. Retinal neovascularization.
  • the main advantages of the invention include:
  • polypeptide of the present invention has a small molecular weight and is permeable to the ocular tissue barrier;
  • (d) can be prepared by solid phase synthesis, with high purity, high yield and low cost;
  • polypeptide of the present invention has good stability.
  • the polypeptide of the present invention is expected to be developed into a medicament for the treatment of neovascular eye diseases and related neovascular diseases such as tumor neovascularization.
  • the invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not intended to limit the scope of the invention.
  • the experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conditions described in conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer. The suggested conditions.
  • Example 1 Example 1
  • SYMPHONY type 12-channel polypeptide synthesizer (American Protein Technologies) was used to synthesize the ZY3 polypeptide represented by SEQ ID NO: 1, respectively.
  • the specific method is as follows:
  • the small peptide ZY3 has 27 amino acids and has a molecular weight of 3092.55.
  • HUVECs Primary human umbilical vein endothelial cells HUVECs (purchased from ScienCell) were inoculated into 96-well plates at a concentration of 2 ⁇ 10 4 /ml; cells were adhered to the serum-free culture medium ECM at 37 ° C for 24 hours; Then, serum-free culture ECM was added to each well as a negative control, VEGF (100 ng/ml) (purchased from Sigma) as a positive control, VEGF (100 ng/well) + small concentration of small peptide ZY3 as a treatment group; continue After culturing for 24 hours, 20 ⁇ l of MTS solution (purchased from Promega) was added to each well; after incubating at 37 ° C for 4 hours, the absorbance of each well at 490 nm was measured by a microplate reader (Bio-Rad), according to OD490 was used to determine the proliferative activity of the cells, and finally statistical analysis was performed using SPSS 11.0.1.
  • Matrigel Matrigel (purchased from BD) 50 ⁇ l/well was added to a 96-well plate and incubated at 37 ° C for 30 minutes. After being solidified, primary human umbilical vein endothelial cells HUVECs were inoculated on the surface of Matrigel at a concentration of 8 ⁇ 10 6 /ml; and serum-free culture ECM was added to each well as a negative control.
  • VEGF 100 ng/ml
  • VEGF 100 ng/ml
  • VEGF 100 ng/ml + small concentration of small peptide ZY3 as a treatment group, and culture was continued at 37 °C.
  • the cells in the well plate were randomly taken at a magnification of 3 times to take a picture, and the sum of the maximum diameters of the lumens formed therein was calculated by the software Image-Pro Plus Program 5.1 (Media Cybernetics, Inc.). Finally, statistical analysis was performed using SPSS1 1.0.1.
  • FIG. 3 The results are shown in Figure 3.
  • the small peptide ZY3 significantly inhibited the lumen formation of human umbilical vein endothelial cells HUVECs at 6 hours in a concentration-dependent manner.
  • Figures 3a-3c show the inhibitory effect of small peptide ZY3 on lumen formation in HUVECs.
  • Figure 3a shows the VEGF group;
  • Figure 3b shows the VEGF+ZY3 (16 ( ⁇ M) group;
  • Figure 3c shows that compared with the VEGF group, VEGF and each concentration of the small peptide ZY3 group have a significant inhibitory effect on the lumen formation of HUVECs, *P ⁇ 0.05, the difference was statistically significant.
  • Example 5 Example 5
  • the chicken embryo chorioallantoic membrane model is used as follows:
  • FIG. 4 The results are shown in Fig. 4. It can be seen that compared with the PBS group, the small peptide ZY3 can significantly inhibit the angiogenesis of the chick embryo chorioallantoic membrane at low concentrations (l ( ⁇ g/tablet) and high concentration (5 ( ⁇ g/table)).
  • Figures 4a-4c show 3-5 microvessel counts in the 2.5 mm range of the filter paper.
  • Figure 4a is the PBS group;
  • Figure 4b is the ⁇ 3 (10 ⁇ 1/piece) group;
  • Figure 4c is the ⁇ 3 (50 ⁇ 1/piece) group;
  • Figure 4d Compared with the VEGF group, the small peptide ZY3 group of each concentration of VEGF+ significantly inhibited the number of neovascularization in chick embryo chorioallantoic membrane, and the inhibition was concentration-dependent, **P ⁇ 0.01, the difference was statistically significant.
  • the mouse corneal microcapsule model was used as follows:
  • mice C57BL/6 male mice (4-5 weeks old) were anesthetized by intraperitoneal injection of 2% pentobarbital (about 0.1 ml/mouse), and topical 4% oxybuprocaine hydrochloride eye drops.
  • pentobarbital about 0.1 ml/mouse
  • topical 4% oxybuprocaine hydrochloride eye drops Under the stereoscopic microscope, the OT needle and the 2 ml needle were used to make a blunt separation between the corneal stroma at a distance of 0.8-lmm from the angle of the cornea to make a pouch of about 0.6*0.8 mm in size.
  • Figure 5 shows the effect of small peptide ⁇ 3 on pathological neovascularization in the cornea of mice, showing that small peptide ⁇ 3 has an effect of inhibiting neovascularization.
  • Figures 5a-5c show the area of corneal neovascularization in mice.
  • Figure 5a is the VEGF group
  • Figure 5b is the ⁇ 3 (0.5 ⁇ l/granule) group
  • Figure 5c is the ⁇ 3 (2 ⁇ 1/granule) group
  • Figure 5d is the VEGF+ small peptide ZY3 concentration group with significant inhibition compared to the VEGF group.
  • the derived polypeptide 1 sequence is identical to SEQ ID NO 1, wherein the fourth Val is replaced by l ie;
  • the derivatized polypeptide 2 sequence is identical to SEQ ID NO 1, wherein the 12th Arg Pro is substituted;
  • the derived polypeptide 3 sequence is the same as SEQ ID NO 1, wherein The 15-bit Asp is replaced by Glu;
  • the derived polypeptide 4 sequence is identical to SEQ ID NO 1, wherein the 23rd Thr is replaced by Arg; the derived polypeptide 5 sequence is identical to SEQ ID NO 1, wherein the 8th Leu is deleted.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Ophthalmology & Optometry (AREA)
  • Vascular Medicine (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un polypeptide pour la prévention et l'inhibition de la néovascularisation et une application associée. L'invention concerne également un procédé de préparation du polypeptide, et une composition pharmaceutique contenant le polypeptide. Le polypeptide décrit dans la présente invention a un faible poids moléculaire, une bonne solubilité dans l'eau, une bonne perméabilité à diverses barrières tissulaires de l'œil, et une bonne capacité à maintenir une concentration élevée dans les larmes neutres, l'humeur aqueuse et l'humeur vitrée.
PCT/CN2011/081500 2011-10-28 2011-10-28 Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée WO2013060020A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2011/081500 WO2013060020A1 (fr) 2011-10-28 2011-10-28 Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2011/081500 WO2013060020A1 (fr) 2011-10-28 2011-10-28 Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée

Publications (1)

Publication Number Publication Date
WO2013060020A1 true WO2013060020A1 (fr) 2013-05-02

Family

ID=48167068

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2011/081500 WO2013060020A1 (fr) 2011-10-28 2011-10-28 Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée

Country Status (1)

Country Link
WO (1) WO2013060020A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9266933B2 (en) 2011-10-28 2016-02-23 Shanghai First People's Hospital Polypeptides inhibiting neovascularization and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090068679A1 (en) * 2005-05-09 2009-03-12 Frank Vitzthum Binding partners of the placental growth factor, especially antibodies directed against the placental growth factor, and production and use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090068679A1 (en) * 2005-05-09 2009-03-12 Frank Vitzthum Binding partners of the placental growth factor, especially antibodies directed against the placental growth factor, and production and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DIANA, D ET AL.: "HAIRPIN PEPTIDE TARGETING VEGF RECEPTORS: DESIGN, NMR CHARACTERIZATION AND BIOLOGICAL ACTIVITY", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 286, no. 48, 3 October 2011 (2011-10-03), pages 41680 - 41691 *
ERIKSSON, A. ET AL.: "Placenta Growth Factor-1 antagonizes VEGF-induced angiogenesis and tumor growth by the formation of functionally inactive PIGF-I/VEGF heterodimers.", CANCER CELL., vol. 1, no. 1, February 2002 (2002-02-01), pages 99 - 108, XP002967596 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9266933B2 (en) 2011-10-28 2016-02-23 Shanghai First People's Hospital Polypeptides inhibiting neovascularization and uses thereof

Similar Documents

Publication Publication Date Title
CN104341486B (zh) 一类新的抑制新生血管的多肽及其应用
EP2599788B1 (fr) Peptide inhibiteur de l'angiogenèse et son application
WO2015055148A1 (fr) Polypeptide inhibant la protéine yap et application correspondante
US9688726B2 (en) Small molecule polypeptide for inhibiting inflammation
CN104341489B (zh) 一类新的抑制新生血管的多肽及其应用
WO2016115732A1 (fr) Polypeptide pour inhiber l'angiogenèse ou la croissance, et application de ce dernier
WO2013060020A1 (fr) Nouveau petit peptide capable d'inhiber de nouveaux vaisseaux et application associée
EP2772498B1 (fr) Polypeptides inhibant la néovascularisation et leurs utilisations
EP3040343B1 (fr) Polypeptide à bas poids moléculaire destiné à prévenir et traiter l'inflammation, et son utilisation
WO2012013110A1 (fr) Polypeptide ayant une activité inhibitrice de l'angiogenèse
WO2012000409A1 (fr) Peptides à activité inhibitrice de l'angiogénèse et leurs utilisations
CN101503458B (zh) 预防和治疗血管新生的小分子多肽及其应用
CN104004066B (zh) 预防或抑制炎症反应和血管新生的小分子多肽及其应用
CN110092816B (zh) 预防和治疗纤维化的小分子多肽及其应用
CN103992376B (zh) 一种抑制新生血管的小肽及其应用
US11369657B2 (en) Small molecule polypeptide for preventing and restraining inflammation and application of same
US8933031B2 (en) Polypeptide inhibiting angiogenesis and application thereof
CN105017406B (zh) 一类新的具有神经保护功能的多肽
KR102587729B1 (ko) 펩타이드를 포함하는 당뇨망막병증의 치료용 조성물
CN103159851A (zh) 预防和抑制炎症的小分子多肽及其应用
CN103992377B (zh) 一种抑制新生血管的小肽及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11874727

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11874727

Country of ref document: EP

Kind code of ref document: A1