WO2013052663A1 - Procédés et compositions pour détecter un adn cible dans un échantillon mixte d'acides nucléiques - Google Patents

Procédés et compositions pour détecter un adn cible dans un échantillon mixte d'acides nucléiques Download PDF

Info

Publication number
WO2013052663A1
WO2013052663A1 PCT/US2012/058746 US2012058746W WO2013052663A1 WO 2013052663 A1 WO2013052663 A1 WO 2013052663A1 US 2012058746 W US2012058746 W US 2012058746W WO 2013052663 A1 WO2013052663 A1 WO 2013052663A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
primer
dna
pcr reaction
dys391
Prior art date
Application number
PCT/US2012/058746
Other languages
English (en)
Inventor
Sascha STRAUβ
Francesca Di PASQUALE
Holger Engel
John Ballantyne
Erin Kae HANSON
Original Assignee
Qiagen Gmbh
University Of Central Florida Research Foundation Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qiagen Gmbh, University Of Central Florida Research Foundation Inc. filed Critical Qiagen Gmbh
Publication of WO2013052663A1 publication Critical patent/WO2013052663A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • Y-STR genotyping is a commonly used method in the forensic field, and mostly used in the case of sexual assaults. In these situations, the evidence contains a mix of both female (victim) and male (offender) DNA and often the female component is more prominent. This makes the use of other genotyping techniques targeting autosomal STRs impossible.
  • methods of genotyping a first target DNA sample e.g., Y chromosomal DNA
  • a first target DNA sample e.g., Y chromosomal DNA
  • methods of genotyping a first target DNA sample comprising sequentially performing a first PCR reaction and a second PCR reaction on the sample, wherein the first and the second PCR reactions are performed with at least one forward primer and at least one reverse primer, and wherein at least one primer in the first PCR reaction is 5' to the corresponding primer in the second PCR reaction.
  • RNA sample comprising DNA samples from multiple sources
  • methods of amplifying Y short tandem repeats in a DNA sample comprising sequentially performing a first and second PCR reaction on the mixed sample, wherein the first and second PCR reactions are performed with at least one forward primer and at least one reverse primer, wherein at least one primer in the first PCR reaction is 5 ' to the corresponding primer in the second PCR reaction, and wherein the first PCR reaction amplifies regions surrounding Y-chromosome specific loci.
  • forward and reverse primers that bind 5 ' to a Y chromosome short tandem repeat and can amplify regions 5' to a Y-chromosome specific locus.
  • kits for amplifying a Y chromosome short tandem repeat in a mixture of DNA samples comprising at least one primer that binds 5 ' to a Y chromosome short tandem repeat and can amplify regions 5' to a Y-chromosome specific locus.
  • FIG. 1 shows a primer design for a pre-amplification strategy for a Y-chromosomal specific locus.
  • FIG. 2 shows an approach to pre-amplify specific Y-STR sequences with a nested PCR approach.
  • FIG. 3 shows an agarose gel electrophoresis after pre-amplification of the DYS19
  • FIG. 4 shows an agarose gel electrophoresis after pre-amplification of the DYS19, DYS389I, and DYS439 loci using male DNA (lanes 1 and 2), female DNA (lanes 3 and 4), and a mixture thereof (lane 5).
  • 1 ng male, 100 ng female, and a mixture thereof were used as a template.
  • GelPilot lkb Plus ladder is shown on the right side .
  • FIG. 4 shows an agarose gel electrophoresis after pre-amplification of the DYS19, DYS389I, and DYS439 loci using male DNA (lanes 1 and 2), female DNA (lanes 3 and 4), and a mixture thereof (lane 5).
  • 1 ng male, 100 ng female, and a mixture thereof were used as a template.
  • GelPilot lkb Plus ladder is shown on the right side.
  • FIG. 5 shows the sequence surrounding the Y-STR locus DYS391 (SEQ ID NO: 1) with NCFS primers in bold text and repeats in italics and underlined.
  • Forward primer DYS391F (SEQ ID NO: 32)
  • reverse primer DYS391R (SEQ ID NO: 33) are shown at the bottom.
  • FIG. 6 shows the sequence surrounding the Y-STR locus DYS393 (SEQ ID NO: 36) with NCFS primers in bold text and repeats underlined.
  • Forward primer DYS393F (SEQ ID NO: 34)
  • reverse primer DYS393R (SEQ ID NO: 35) are shown at the bottom.
  • FIG. 7 shows the 2% agarose gel electrophoresis after pre-amplification of the DYS391 locus using male or female DNA or a mixture thereof.
  • 1 ng male, 100 ng female, and a mixture thereof were used as a template.
  • Different primer combinations were tested (on the left side DYS391 for2 + DYS391 revl and on the right side DYS391 for2 + DYS391 rev2).
  • the expected amplicon length is about 400 bp and 360 bp, respectively.
  • GelPilot lOObp Plus ladder is shown on the right side.
  • FIG. 8 shows the 2% agarose gel electrophoresis after pre-amplification of the DYS393 locus using male or female DNA or a mixture thereof. 1 ng male, 100 ng female, and a mixture thereof were used templates. Primer pair DYS393 for5 + DYS393 rev3 was tested. The expected amplicon length is about 200 bp, depending on the repeats. GelPilot lOObp Plus ladder is shown on the right side.
  • FIG. 9 shows the analysis of DYS391 using 0.1 ng male or 100 ng female DNA or a mixture thereof without pre-amplification.
  • FIG. 10 shows the analysis of DYS391 using 0.1 ng male or 100 ng female DNA or a mixture thereof with 10 cycles of pre-amplification.
  • FIG. 11 shows the analysis of DYS391 using 0.1 ng male or 100 ng female DNA or a mixture thereof with 20 cycles of pre-amplification.
  • FIG. 12 shows the analysis of DYS391 using 1.0 ng male or 100 ng female DNA or a mixture thereof without pre-amplification.
  • FIG. 13 shows the analysis of DYS391 using 1.0 ng male or 100 ng female DNA or a mixture thereof with 10 cycles of pre-amplification.
  • FIG. 14 shows the analysis of DYS391 using 1.0 ng male or 100 ng female DNA or a mixture thereof with 20 cycles of pre-amplification.
  • FIG. 15 shows the analysis of DYS391 using 5.0 ng male or 100 ng female DNA or a mixture thereof without pre-amplification.
  • FIG. 16 shows the analysis of DYS391 using 5.0 ng male or 100 ng female DNA or a mixture thereof with 10 cycles of pre-amplification.
  • FIG. 17 shows the analysis of DYS391 using 5.0 ng male or 100 ng female DNA or a mixture thereof with 20 cycles of pre-amplification.
  • FIG. 18 shows the analysis of DYS393 using 1.0 ng male or 100 ng female DNA or a mixture thereof without pre-amplification.
  • FIG. 19 shows the alignment of male (top) and female (bottom) DNA sequences of DYS393 with the reverse primer identified in the rectangular box.
  • FIG. 20 shows the analysis of DYS393 using 1.0 ng male or 100 ng female DNA or a mixture thereof with 10 cycles of pre-amplification.
  • FIG. 21 shows the analysis of DYS393 using 1.0 ng male or 100 ng female DNA or a mixture thereof with 20 cycles of pre-amplification
  • FIG. 22 shows the results of the Applied Biosystems Yfiler using 10 pg of male
  • FIG. 23 shows the results of the Applied Biosystems Yfiler using 5 pg of male DNA without pre-amplification (A) and with pre-amplification (B) for several Y-STR loci.
  • FIG. 24 shows the results of the Applied Biosystems Yfiler using 263 ng female DNA with pre-amplification and shows that no artifacts were produced.
  • Ranges can be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10" is also disclosed.
  • an “increase” can refer to any change that results in a larger amount of a composition or compound, such as an amplification product, relative to a control.
  • an increase in the amount in amplification product can include but is not limited to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase.
  • the detection of an increase in expression or abundance of a DNA, mRNA, or protein relative to a control necessarily includes the detection of the presence of the DNA, mRNA, or protein in situations where the DNA, mRNA, or protein is not present in the control.
  • tissue samples can be obtained by any means known in the art including invasive and non-invasive techniques. It is also understood that methods of measurement can be direct or indirect. Examples of methods of obtaining or measuring a tissue sample can include but are not limited to tissue biopsy, tissue lavage, aspiration, tissue swab, spinal tap, magnetic resonance imaging (MRI), Computed Tomography (CT) scan, Positron Emission Tomography (PET) scan, and X-ray (with and without contrast media).
  • MRI magnetic resonance imaging
  • CT Computed Tomography
  • PET Positron Emission Tomography
  • Primers are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur.
  • a primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
  • Probes are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
  • the methods and compositions disclosed herein relate to the development of an amplification method for target sequences specific for the human Y- chromosome.
  • the problem with this kind of reaction is mostly focused on the high female background DNA in the cases of sexual assault. In these situations, the evidence will contain both female and male DNA and often the female component is more prominent.
  • the female DNA can be often amplified as well and the male DNA is "masked" by the female DNA.
  • a first target DNA sample e.g., Y chromosomal DNA
  • a DNA sample comprising a mixture of DNA donors said method comprising sequentially performing a first and second PCR reaction on the sample, wherein the first and second PCR reactions are performed with at least one forward primer and at least one reverse primer, and wherein at least one primer in the first PCR reaction binds to a location on the target DNA 5' to the corresponding primer in the second PCR reaction.
  • Y chromosomal DNA such as, for example, Y chromosome short tandem repeat (Y-STR) can serves as a target DNA.
  • the methods disclosed herein relate to genotyping a sample of DNA comprising multiple donor sources.
  • mixed sample and “mixed DNA,” refer to a sample DNA comprising DNA from multiple sources.
  • said sources can comprise at least one male donor source and at least one female donor source of DNA.
  • the methods disclosed herein describe a nested PCR reaction.
  • Nested PCR increases the specificity of DNA amplification by reducing background due to non- specific amplification of DNA.
  • Two sets of primers are used in two successive PCRs. In the first reaction, one pair of primers is used to generate DNA products, which besides the intended target, may still consist of non- specifically amplified DNA fragments.
  • the product or products are then used in a second PCR with a set of primers whose binding sites are completely or partially different from and located 3 ' of each of the primers used in the first reaction (i.e., one or more of the primers in the first set of primers binding site is located completely or partially 5' to one or more corresponding primers in the second set of primers).
  • Nested PCR is often more successful in specifically amplifying long DNA fragments than conventional PCR, but it requires more detailed knowledge of the target sequences.
  • the first PCR reaction pre-amplifies the target DNA so that further amplification rounds will not mask the presence of the target DNA.
  • methods of genotyping a first target DNA sample in a sample of DNA from multiple DNA donor sources comprising performing nested PCR on the DNA sample, wherein the nested PCR reaction comprises a first and second PCR reaction which are performed with at least one forward primer and at least one reverse primer, and wherein at least one primer in the first PCR reaction binds to a location on the target DNA 5' to the corresponding primer in the second PCR reaction.
  • the DNA sample comprises Y chromosomal DNA.
  • disclosed herein are methods of amplifying Y chromosomal DNA in a mixed male and female DNA sample, wherein the first PCR reaction selectively amplifies a region 5 ' to a Y chromosome specific locus in the Y chromosomal DNA.
  • RNA sample from multiple DNA donor sources comprising sequentially performing a first PCR reaction and a second PCR reaction on the sample, wherein the first and the second PCR reactions are performed with at least one forward primer and at least one reverse primer, wherein at least one primer in the first PCR reaction is 5' to the corresponding primer in the second PCR reaction, and wherein the first PCR reaction amplifies regions surrounding Y-chromosome specific loci.
  • At least one primer in the first reaction must by 5 ' to at least one corresponding primer in the second PCR reaction. Accordingly, it is contemplated herein that either or both forward and reverse primers can be 5 ' to the primers used in the second PCR reaction. It is therefore understood that the disclosed methods include each and every combination of first and second primer sets to accomplish a nested PCR reaction. For example, disclosed herein are methods wherein at least one forward primer and at least one reverse primer of the first PCR reaction are 5' to corresponding forward and reverse primers of the second PCR reaction. In another aspect, disclosed herein are methods wherein at least one forward or reverse primer of the first PCR reaction is 5' to the forward primer of the second PCR reaction.
  • the forward or reverse primer can be identical to the primer contained in the commercial kit (semi-nested), (ii) can overlap with the primer contained in the commercial kit except the 1 nucleotide at the 3 ' end, or (iii) can do both.
  • the forward or reverse primers can be identical to the primer contained in the commercial kit (semi- nested), (ii) can overlap with the primer contained in the commercial kit except the 1 nucleotide at the 3 ' end, or (iii) can do both, wherein the commercial kit is Applied Biosystems Yfiler PCR kit, QIAGEN Argus Y-12 QS kit, Applied Biosystems AmpFISTR kit, Y-PlexTM 5, Y-PlexTM 6, Y-PlexTM 12, or Promega PowerPlexY kit.
  • the commercial kit is Applied Biosystems Yfiler PCR kit, QIAGEN Argus Y-12 QS kit, Applied Biosystems AmpFISTR kit, Y-PlexTM 5, Y-PlexTM 6, Y-PlexTM 12, or Promega PowerPlexY kit.
  • the binding of the primers in the first reaction is their relation to the target sequence that will be amplified in the second reaction.
  • One or more of the forward and/or reverse primers of the first PCR reaction are 5 ' to the corresponding primer in the second PCR reaction. Accordingly, the binding site of one or more forward and/or reverse primers in the first PCR reaction will be 5 ' to the target DNA.
  • the target DNA is a Y chromosome short tandem repeat (Y-STR)
  • the primer or primers in the first reaction bind 5 ' to the Y-STR and amplify regions 5 ' to a Y chromosome specific locus.
  • Y chromosomal DNA in a mixed male and female DNA sample wherein at least one forward and/or reverse primer in the first PCR reaction binds 5 ' to a Y chromosome short tandem repeat and can amplify regions 5 ' to a Y-chromosome specific locus.
  • primer design One consideration of primer design is that optimal primer pairs should be specific enough to prevent amplification starting from 100 ng of female DNA. Another consideration of primer design is that optimal primer pairs should permit amplification of male DNA in the presence of a 100- to 1000- fold female background.
  • Examples of forward primer of the first PCR reaction in the disclosed methods include but are not limited to DYS390-oF (SEQ ID NO: 2), DYS456-oF (SEQ ID NO: 4), H4-oF (SEQ ID NO: 6), DYS448-oF (SEQ ID NO: 8), DYS437-oF (SEQ ID NO: 10), DYS385-oF (SEQ ID NO: 12), DYS635-oF (SEQ ID NO: 14), DYS389-oF (SEQ ID NO: 16), DYS393-oF (SEQ ID NO: 18), DYS458-oF (SEQ ID NO: 20), DYS438-oF (SEQ ID NO: 22), DYS439-oF (SEQ ID NO: 24), DYS392-oF (SEQ ID NO: 26), DYS 19-F (SEQ ID NO: 28), DYS391-F (SEQ ID NO: 30), DY
  • Examples of reverse primer of the first PCR reaction in the disclosed methods include but are not limited to DYS390-oR (SEQ ID NO: 3), DYS456-oR (SEQ ID NO: 5), H4-oF (SEQ ID NO: 7), DYS448-oR (SEQ ID NO: 9), DYS437-oR (SEQ ID NO: 1 1), DYS385-oR (SEQ ID NO: 13), DYS635-oR (SEQ ID NO: 15), DYS389-oR (SEQ ID NO: 17), DYS393-oR (SEQ ID NO: 19), DYS458-oR (SEQ ID NO: 21), DYS438-oR (SEQ ID NO: 23), DYS439-oR (SEQ ID NO: 25), DYS392-oR (SEQ ID NO: 27), DYS 19-R (SEQ ID NO: 29), DYS391-R (SEQ ID NO: 31),
  • the disclosed methods work on the same principles of any PCR reaction, i.e., that with each amplification cycle, there is an exponential increase in the target DNA.
  • a minimum number of rounds of amplification i.e., cycles
  • the pre-amplification round i.e., the first PCR reaction
  • methods of genotyping or detecting the presence of a target DNA sample in a mixture of DNA samples wherein at least 10 cycles of amplification are performed. It is understood and herein contemplated that additional cycles of amplification in the first reaction will increase the signal of the target DNA relative to the unwanted DNA background.
  • the first PCR reaction comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 80 , 90 or 100 cycles of amplification.
  • the first reaction comprises between 10 and 500 cycles of amplification, more specifically, 10 and 100 cycles of amplification, more specifically, 10 and 50 cycles of amplification, and more specifically 10 and 20 cycles of amplification.
  • one of the several purposes of the first PCR reaction is to increase (i.e., pre-amplify) the target DNA relative to the unwanted background DNA so that the more traditional PCR reactions can be used. Therefore, disclosed herein are methods of genotyping or detecting the presence of a target DNA sample in a mixture of DNA samples, wherein the second PCR reaction is performed using a multiplex PCR kit. Multiplex PCR kits are well known in the art.
  • multiplex PCR kits that can be used in the second PCR reaction of the disclosed methods include but are not limited to the Applied Biosystems Yfiler PCR kit, QIAGEN Argus Y-12 QS kit, Applied Biosystems AmpFISTR kit, Y-PlexTM 5, Y-PlexTM 6, Y-PlexTM 12, or Promega PowerPlexY kit.
  • the disclosed methods contemplate the use of a first PCR reaction to pre- amplify a target DNA sample and then utilize a commercial DNA kit in the subsequent PCR reaction
  • methods of genotyping or detecting the presence of a target DNA sample in a mixture of DNA samples wherein one or more forward primers of the first PCR reaction are 5 ' to the forward primer of the second PCR reaction, wherein the primers in the second PCR reaction and the reverse primer for use in the first PCR reaction are obtained from a commercially available kit.
  • the reverse primer for use in both PCR reactions is the same.
  • RNA samples containing at least one or more reverse primers of the first PCR reaction are 5 ' to the reverse primer of the second PCR reaction, wherein the primers in the second PCR reaction and the forward primer for use in the first PCR reaction are obtained from a commercially available kit.
  • one or more primers can be obtained from a commercially available multiplex PCR kit including but not limited to, for example, the Applied Biosystems Yfiler PCR kit, QIAGEN Argus Y-12 QS kit, Applied Biosystems AmpFISTR kit, Y-PlexTM 5, Y-PlexTM 6, Y-PlexTM 12, or Promega PowerPlexY kit.
  • a commercially available multiplex PCR kit including but not limited to, for example, the Applied Biosystems Yfiler PCR kit, QIAGEN Argus Y-12 QS kit, Applied Biosystems AmpFISTR kit, Y-PlexTM 5, Y-PlexTM 6, Y-PlexTM 12, or Promega PowerPlexY kit.
  • the methods disclosed herein relate to the detection and/or genotyping of a nucleic acid sample for one source in a DNA sample from multiple DNA sources.
  • a number of widely used procedures exist for detecting and determining the abundance of a particular DNA in a sample.
  • the technology of PCR permits amplification and subsequent detection of minute quantities of a target nucleic acid.
  • oligonucleotide primers are annealed to the denatured strands of a target nucleic acid, and primer extension products are formed by the polymerization of deoxynucleoside triphosphates by a polymerase.
  • a typical PCR method involves repetitive cycles of template nucleic acid denaturation, primer annealing and extension of the annealed primers by the action of a thermostable polymerase. The process results in exponential amplification of the target nucleic acid, and thus allows the detection of targets existing in very low concentrations in a sample.
  • QPCR Quantitative PCR
  • microarrays real-time PCT
  • hot start PCR hot start PCR
  • nested PCR allele-specific PCR
  • Touchdown PCR Touchdown PCR.
  • An array is an orderly arrangement of samples, providing a medium for matching known and unknown DNA samples based on base-pairing rules and automating the process of identifying the unknowns.
  • An array experiment can make use of common assay systems such as microplates or standard blotting membranes, and can be created by hand or make use of robotics to deposit the sample.
  • arrays are described as macroarrays or microarrays, the difference being the size of the sample spots.
  • Macroarrays contain sample spot sizes of about 300 microns or larger and can be easily imaged by existing gel and blot scanners.
  • the sample spot sizes in microarray can be 300 microns or less, but typically less than 200 microns in diameter. These arrays usually contain thousands of spots.
  • Microarrays require specialized robotics and/or imaging equipment that generally are not commercially available as a complete system. Terminologies that have been used in the literature to describe this technology include, but not limited to: biochip, DNA chip, DNA microarray, GeneChip® (Affymetrix, Inc which refers to its high density, oligonucleotide-based DNA arrays), and gene array.
  • DNA microarrays or DNA chips are fabricated by high-speed robotics, generally on glass or nylon substrates, for which probes with known identity are used to determine complementary binding, thus allowing massively parallel gene expression and gene discovery studies. An experiment with a single DNA chip can provide information on thousands of genes simultaneously. It is herein contemplated that the disclosed microarrays can be used to monitor gene expression, disease diagnosis, gene discovery, drug discovery (pharmacogenomics), and toxicological research or toxicogenomics.
  • Type I microarrays comprise a probe cDNA (500-5,000 bases long) that is immobilized to a solid surface such as glass using robot spotting and exposed to a set of targets either separately or in a mixture. This method is traditionally referred to as DNA microarray.
  • Type I microarrays localized multiple copies of one or more polynucleotide sequences, preferably copies of a single polynucleotide sequence are immobilized on a plurality of defined regions of the substrate's surface.
  • a polynucleotide refers to a chain of nucleotides ranging from 5 to 10,000 nucleotides. These immobilized copies of a polynucleotide sequence are suitable for use as probes in hybridization experiments.
  • Typical dispensers include a micropipette delivering solution to the substrate with a robotic system to control the position of the micropipette with respect to the substrate. There can be a multiplicity of dispensers so that reagents can be delivered to the reaction regions simultaneously.
  • a microarray is formed by using ink-jet technology based on the piezoelectric effect, whereby a narrow tube containing a liquid of interest, such as oligonucleotide synthesis reagents, is encircled by an adapter.
  • An electric charge sent across the adapter causes the adapter to expand at a different rate than the tube and forces a small drop of liquid onto a substrate.
  • Samples may be any sample containing polynucleotides (polynucleotide targets) of interest and obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
  • DNA or RNA can be isolated from the sample according to any of a number of methods well known to those of skill in the art. In an embodiment, total RNA is isolated using the TRIzol total RNA isolation reagent (Life Technologies, Inc., Rockville, Md.) and RNA is isolated using oligo d(T) column chromatography or glass beads. After hybridization and processing, the hybridization signals obtained should reflect accurately the amounts of control target polynucleotide added to the sample.
  • the plurality of defined regions on the substrate can be arranged in a variety of formats.
  • the regions may be arranged perpendicular or in parallel to the length of the casing.
  • the targets do not have to be directly bound to the substrate, but rather can be bound to the substrate through a linker group.
  • the linker groups may typically vary from about 6 to 50 atoms long. Linker groups include ethylene glycol oligomers, diamines, diacids and the like. Reactive groups on the substrate surface react with one of the terminal portions of the linker to bind the linker to the substrate. The other terminal portion of the linker is then functionalized for binding the probes.
  • Sample polynucleotides may be labeled with one or more labeling moieties to allow for detection of hybridized probe/target polynucleotide complexes.
  • the labeling moieties can include compositions that can be detected by spectroscopic, photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or chemical means.
  • labeling moieties include radioisotopes, such as J P, JJ P, or JJ S, chemiluminescent compounds, labeled binding proteins, heavy metal atoms, spectroscopic markers, such as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags, spin labels, electron transfer donors and acceptors, biotin, and the like.
  • Labeling can be carried out during an amplification reaction, such as polymerase chain reaction and in vitro or in vivo transcription reactions.
  • the labeling moiety can be incorporated after hybridization once a probe-target complex his formed.
  • biotin is first incorporated during an amplification step as described above.
  • Hybridization causes a polynucleotide probe and a complementary target to form a stable duplex through base pairing.
  • Hybridization methods are well known to those skilled in the art
  • Stringent conditions for hybridization can be defined by salt concentration, temperature, and other chemicals and conditions. Varying additional parameters, such as hybridization time, the concentration of detergent (sodium dodecyl sulfate, SDS) or solvent (formamide), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Additional variations on these conditions will be readily apparent to those skilled in the art.
  • the polynucleotide probes are labeled with a fluorescent label and measurement of levels and patterns of complex formation is accomplished by fluorescence microscopy, preferably confocal fluorescence microscopy.
  • An argon ion laser excites the fluorescent label, emissions are directed to a photomultiplier and the amount of emitted light detected and quantitated.
  • the detected signal should be proportional to the amount of probe/target polynucleotide complex at each position of the microarray.
  • the fluorescence microscope can be associated with a computer-driven scanner device to generate a quantitative two-dimensional image of hybridization intensities. The scanned image is examined to determine the abundance/expression level of each hybridized target polynucleotide.
  • polynucleotide targets from two or more different biological samples are labeled with two or more different fluorescent labels with different emission wavelengths. Fluorescent signals are detected separately with different photomultipliers set to detect specific wavelengths. The relative abundance and/or expression levels of the target polynucleotides in two or more samples is obtained.
  • microarray fluorescence intensities can be normalized to take into account variations in hybridization intensities when more than one microarray is used under similar test conditions.
  • individual polynucleotide probe/target complex hybridization intensities are normalized using the intensities derived from internal normalization controls contained on each microarray.
  • Type II microarrays comprise an array of oligonucleotides (20-80-mer oligos) or peptide nucleic acid (PNA) probes that is synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization. The array is exposed to labeled sample DNA, hybridized, and the identity/abundance of complementary sequences are determined.
  • This method "historically” called DNA chips, was developed at Affymetrix, Inc., which sells its photolithographically fabricated products under the GeneChip ® trademark.
  • Type II arrays for gene expression are simple: labeled cDNA or cRNA targets derived from the mRNA of an experimental sample are hybridized to nucleic acid probes attached to the solid support. By monitoring the amount of label associated with each DNA location, it is possible to infer the abundance of each mRNA species represented.
  • hybridization has been used for decades to detect and quantify nucleic acids, the combination of the miniaturization of the technology and the large and growing amounts of sequence information, have enormously expanded the scale at which gene expression can be studied.
  • Microarray manufacturing can begin with a 5 -inch square quartz wafer. Initially the quartz is washed to ensure uniform hydroxylation across its surface. Because quartz is naturally hydroxylated, it provides an excellent substrate for the attachment of chemicals, such as linker molecules, that are later used to position the probes on the arrays.
  • chemicals such as linker molecules
  • the wafer is placed in a bath of silane, which reacts with the hydroxyl groups of the quartz, and forms a matrix of covalently linked molecules.
  • the distance between these silane molecules determines the probes' packing density, allowing arrays to hold over 500,000 probe locations, or features, within a mere 1.28 square centimeters. Each of these features harbors millions of identical DNA molecules.
  • the silane film provides a uniform hydroxyl density to initiate probe assembly.
  • Linker molecules, attached to the silane matrix provide a surface that may be spatially activated by light.
  • Probe synthesis occurs in parallel, resulting in the addition of an A, C, T, or G nucleotide to multiple growing chains simultaneously.
  • photolithographic masks carrying 18 to 20 square micron windows that correspond to the dimensions of individual features, are placed over the coated wafer. The windows are distributed over the mask based on the desired sequence of each probe.
  • ultraviolet light is shone over the mask in the first step of synthesis, the exposed linkers become deprotected and are available for nucleotide coupling.
  • a solution containing a single type of deoxynucleotide with a removable protection group is flushed over the wafer's surface.
  • the nucleotide attaches to the activated linkers, initiating the synthesis process.
  • each position in the sequence of an oligonucleotide can be occupied by 1 of 4 nucleotides, resulting in an apparent need for 25 x 4, or 100, different masks per wafer, the synthesis process can be designed to significantly reduce this requirement.
  • Algorithms that help minimize mask usage calculate how to best coordinate probe growth by adjusting synthesis rates of individual probes and identifying situations when the same mask can be used multiple times.
  • probes are selected from regions shared by multiple splice or polyadenylation variants. In other cases, unique probes that distinguish between variants are favored. Inter-probe distance is also factored into the selection process.
  • a different set of strategies is used to select probes for genotyping arrays that rely on multiple probes to interrogate individual nucleotides in a sequence.
  • the identity of a target base can be deduced using four identical probes that vary only in the target position, each containing one of the four possible bases.
  • the presence of a consensus sequence can be tested using one or two probes representing specific alleles.
  • arrays with many probes can be created to provide redundant information, resulting in unequivocal genotyping.
  • generic probes can be used in some applications to maximize flexibility.
  • Some probe arrays allow the separation and analysis of individual reaction products from complex mixtures, such as those used in some protocols to identify single nucleotide polymorphisms (SNPs).
  • Real-time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production during each PCR cycle (i.e., in real time) as opposed to the endpoint detection.
  • the real-time progress of the reaction can be viewed in some systems.
  • Real-time PCR does not detect the size of the amplicon and thus does not allow the differentiation between DNA and cDNA amplification, however, it is not influenced by non-specific amplification unless SYBR Green is used.
  • Real-time PCR quantitation eliminates post-PCR processing of PCR products. This helps to increase throughput and reduce the chances of carryover contamination.
  • Real-time PCR also offers a wide dynamic range of up to 10 7 - fold.
  • Dynamic range of any assay determines how much target concentration can vary and still be quantified.
  • a wide dynamic range means that a wide range of ratios of target and normaliser can be assayed with equal sensitivity and specificity. It follows that the broader the dynamic range, the more accurate the quantitation.
  • a real-time RT-PCR reaction reduces the time needed for measuring the amount of amplicon by providing for the visualization of the amplicon as the amplification process is progressing.
  • the real-time PCR system is based on the detection and quantitation of a fluorescent reporter. This signal increases in direct proportion to the amount of PCR product in a reaction. By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. A significant increase in fluorescence above the baseline value measured during the 3-15 cycles can indicate the detection of accumulated PCR product.
  • a fixed fluorescence threshold is set significantly above the baseline that can be altered by the operator.
  • the parameter CT threshold cycle is defined as the cycle number at which the fluorescence emission exceeds the fixed threshold.
  • hydrolysis probes include TaqMan probes, molecular beacons and scorpions. They use the fluorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in cDNA samples.
  • TaqMan probes are designed to anneal to an internal region of a PCR product.
  • Molecular beacons also contain fluorescent (FAM, TAMRA, TET, ROX) and quenching dyes (typically DABCYL) at either end but they are designed to adopt a hairpin structure while free in solution to bring the fluorescent dye and the quencher in close proximity for FRET to occur. They have two arms with complementary sequences that form a very stable hybrid or stem. The close proximity of the reporter and the quencher in this hairpin configuration suppresses reporter fluorescence. When the beacon hybridises to the target during the annealing step, the reporter dye is separated from the quencher and the reporter fluoresces (FRET does not occur). Molecular beacons remain intact during PCR and must rebind to target every cycle for fluorescence emission. This will correlate to the amount of PCR product available.
  • All real-time PCR chemistries allow detection of multiple DNA species (multiplexing) by designing each probe/beacon with a spectrally unique fluor/quench pair as long as the platform is suitable for melting curve analysis if SYBR green is used.
  • multiplexing the target(s) and endogenous control can be amplified in single tube.
  • Scorpion probes sequence-specific priming and PCR product detection is achieved using a single oligonucleotide.
  • the Scorpion probe maintains a stem-loop configuration in the unhybridised state.
  • the fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end.
  • the 3' portion of the stem also contains sequence that is complementary to the extension product of the primer. This sequence is linked to the 5' end of a specific primer via a non-amp lifiable monomer.
  • the specific probe sequence is able to bind to its complement within the extended amplicon thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed.
  • SYBR- green I or ethidium bromide a non-sequence specific fluorescent intercalating agent
  • SYBR green is a fiuorogenic minor groove binding dye that exhibits little fluorescence when in solution but emits a strong fluorescent signal upon binding to double-stranded DNA.
  • Disadvantages of SYBR green-based real-time PCR include the requirement for extensive optimisation.
  • non-specific amplifications require follow-up assays (melting point curve or dissociation analysis) for amplicon identification.
  • the threshold cycle or the C T value is the cycle at which a significant increase in ARn is first detected (for definition of ARn, see below).
  • the threshold cycle is when the system begins to detect the increase in the signal associated with an exponential growth of PCR product during the log-linear phase. This phase provides the most useful information about the reaction (certainly more important than the end-point).
  • the slope of the log-linear phase is a reflection of the amplification efficiency.
  • the efficiency of the PCR should be 90 - 100% (-3.6 > slope > -3.1).
  • a number of variables can affect the efficiency of the PCR. These factors include length of the amplicon, secondary structure and primer quality.
  • the qRT-PCR should be further optimised or alternative amplicons designed.
  • the slope to be an indicator of real amplification (rather than signal drift)
  • the important parameter for quantitation is the C T . The higher the initial amount of genomic DNA, the sooner accumulated product is detected in the PCR process, and the lower the C T value.
  • the threshold should be placed above any baseline activity and within the exponential increase phase (which looks linear in the log transformation).
  • C T cycle threshold
  • the methods disclosed herein can be used to detect or genotype RNA rather than DNA.
  • the disclosed methods can also comprise a step of amplifying RNA.
  • specific mRNAs can be detected using Northern blot analysis, nuclease protection assays (NPA), in situ hybridization, or reverse transcription-polymerase chain reaction (RT- PCR), and microarray.
  • each of these techniques can be used to detect specific RNAs and to precisely determine their expression level.
  • Northern analysis is the only method that provides information about transcript size, whereas NPAs are the easiest way to simultaneously examine multiple messages.
  • In situ hybridization is used to localize expression of a particular gene within a tissue or cell type, and RT-PCR is the most sensitive method for detecting and quantitating gene expression.
  • RT-PCR allows for the detection of the RNA transcript of any gene, regardless of the scarcity of the starting material or relative abundance of the specific mRNA.
  • an RNA template is copied into a complementary DNA (cDNA) using a retroviral reverse transcriptase.
  • the cDNA is then amplified exponentially by PCR using a DNA polymerase.
  • the reverse transcription and PCR reactions can occur in the same or difference tubes.
  • RT-PCR is somewhat tolerant of degraded RNA. As long as the RNA is intact within the region spanned by the primers, the target will be amplified.
  • Relative quantitative RT-PCR involves amplifying an internal control simultaneously with the gene of interest.
  • the internal control is used to normalize the samples. Once normalized, direct comparisons of relative abundance of a specific mR A can be made across the samples. It is crucial to choose an internal control with a constant level of expression across all experimental samples (i.e., not affected by experimental treatment).
  • Commonly used internal controls e.g., GAPDH, ⁇ -actin, cyclophilin
  • GAPDH, ⁇ -actin, cyclophilin often vary in expression and, therefore, may not be appropriate internal controls. Additionally, most common internal controls are expressed at much higher levels than the mRNA being studied. For relative RT-PCR results to be meaningful, all products of the PCR reaction must be analyzed in the linear range of amplification. This becomes difficult for transcripts of widely different levels of abundance.
  • RT-PCR is used for absolute quantitation. This technique involves designing, synthesizing, and accurately quantitating a competitor RNA that can be distinguished from the endogenous target by a small difference in size or sequence. Known amounts of the competitor RNA are added to experimental samples and RT-PCR is performed. Signals from the endogenous target are compared with signals from the competitor to determine the amount of target present in the sample.
  • Northern analysis is the easiest method for determining transcript size, and for identifying alternatively spliced transcripts and multigene family members. It can also be used to directly compare the relative abundance of a given message between all the samples on a blot.
  • the Northern blotting procedure is straightforward and provides opportunities to evaluate progress at various points (e.g., intactness of the RNA sample and how efficiently it has transferred to the membrane).
  • RNA samples are first separated by size via electrophoresis in an agarose gel under denaturing conditions. The RNA is then transferred to a membrane, crosslinked and hybridized with a labeled probe.
  • Nonisotopic or high specific activity radiolabeled probes can be used including random-primed, nick-translated, or PCR-generated DNA probes, in vitro transcribed RNA probes, and oligonucleotides. Additionally, sequences with only partial homology (e.g., cDNA from a different species or genomic DNA fragments that might contain an exon) may be used as probes.
  • the Nuclease Protection Assay (including both ribonuclease protection assays and SI nuclease assays) is a sensitive method for the detection and quantitation of specific mRNAs.
  • the basis of the NPA is solution hybridization of an antisense probe
  • NPAs are the method of choice for the simultaneous detection of several RNA species. During solution hybridization and subsequent analysis, individual probe/target interactions are completely independent of one another. Thus, several RNA targets and appropriate controls can be assayed simultaneously (up to twelve have been used in the same reaction), provided that the individual probes are of different lengths. NPAs are also commonly used to precisely map mRNA termini and intron/exon junctions.
  • ISH In situ hybridization
  • ISH is a powerful and versatile tool for the localization of specific mRNAs in cells or tissues. Unlike Northern analysis and nuclease protection assays, ISH does not require the isolation or electrophoretic separation of RNA. Hybridization of the probe takes place within the cell or tissue. Since cellular structure is maintained throughout the procedure, ISH provides information about the location of mRNA within the tissue sample.
  • the procedure begins by fixing samples in neutral-buffered formalin, and embedding the tissue in paraffin. The samples are then sliced into thin sections and mounted onto microscope slides. (Alternatively, tissue can be sectioned frozen and post-fixed in paraformaldehyde.) After a series of washes to dewax and rehydrate the sections, a Proteinase K digestion is performed to increase probe accessibility, and a labeled probe is then hybridized to the sample sections. Radiolabeled probes are visualized with liquid film dried onto the slides, while nonisotopically labeled probes are conveniently detected with colorimetric or fluorescent reagents.
  • hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene.
  • Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
  • the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
  • selective hybridization conditions can be defined as stringent hybridization conditions.
  • stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
  • the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25 °C below the T m (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5 °C to 20 °C below the Tm.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-R A and RNA-R A hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989; Kunkel et al. Methods Enzymol. 1987: 154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids).
  • a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68 °C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68 °C.
  • Stringency of hybridization and washing if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
  • stringency of hybridization and washing if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
  • selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid.
  • the non- limiting primer is in for example, 10 or 100 or 1000 fold excess.
  • This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their k d , or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their !3 ⁇ 4.
  • Another way to define selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation.
  • selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended.
  • Preferred conditions also include those suggested
  • composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein.
  • primers for use with the disclosed methods.
  • the primer design for Y-STRs is very challenging, because of the high homology with loci on other chromosomes, in particular to the X-chromosome.
  • Specific primer pairs were designed that can selectively pre-amplify the regions surrounding the Y-chromosome specific loci (e.g., DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391) in a first round of PCR.
  • primer design One consideration of primer design is that optimal primer pairs should be specific enough to prevent amplification starting from 100 ng of female DNA. Another consideration of primer design is that optimal primer pairs should permit amplification of male DNA in the presence of a 100- to 1000- fold female background.
  • the product of this first enrichment PCR can be then applied and is compatible to many commercial Y-STR multiplex kits such as the QIAGEN Argus Y-12 QS, the Applied Biosystems AmpFlSTR Yfiler or the Promega PowerPlex Y.
  • forward and reverse primers that bind 5' to a Y chromosome short tandem repeat and can amplify regions 5' to a Y-chromosome specific loci.
  • forward and reverse primers the bind 5' to regions surrounding the Y-chromosome specific loci (e.g., DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393 (SEQ ID NO: 36), DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391 (SEQ ID NO: 1)).
  • regions surrounding the Y-chromosome specific loci e.g., DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393 (SEQ ID NO: 36), DYS458,
  • DYS391 (SEQ ID NO: 1) is GGTGATGTAT GGAGACATTT TTGGTCATCA TGACTCTGGG GTGGAGGGTG TGCTTCTGGT ATCTGGTTGC TGCAGCCCTG GGATCCTGCT CAACATCCTA CAGTGCACAA GACACCCCAC CACAGATTAG CATTCATCTT GCCTTAAATG TTAATACTGC TGAGGTCAAG TAACCCTGTC TTAGCATGTA AGATTTTGTC TGTCCATTTA GCTATCTATT TATCCATTCA TTCATTCCTG TATACCTAAC CTATCATCCA TCCTTATCTC TTGTGTATCT ATTCATTCAA TCATACACCC ATATCTGTCT GTCTGTCTAT CTATCTATCT ATCTATCTAT CTATCTATCTAT CTGCCTATCT GCCTAC CTATCCCTCTCT ATGGCAATTG CTTGCAACCA GGGAGATTTT ATTCCCAGGA GATATTTGGC TATGTCTGTCTGGTATCTAT CTAT
  • DYS393 (SEQ ID NO: 36) is AGCATGAGAA CAGACTAATA CATACATATA ATTATTTTGT AACTTTTAAA TATACAAATT TGTAGTTATG TTTTATTTGT CATTCCTAAT GTGGTCTTCT ACTTGTGTCA ATACAGATAG ATAGATAGAT AGATAGATAG ATAGATAGAT AGATAGATAG ATATGTATGT CTTTTCTATG AG AC AT AC CT CATTTTTTGG ACTTGAGTTT TATTTTTTTA AATTATGCAG CTGATATGAC TTTATTTAGT TAGATTATAG GCCATTCTTT TTGTAACATT TCAATTTAAT TGATTTTGCT TTTACTCTCC CTTAATTCTA TCCTTCACTT CCACACACGT TATCTGGCTT GTTTAGTT TTTTTCTAAC TTCCTGAGTT TAGAATTTAG CTCAATTATTTTCTCT TCTCTTCTCT TCTCTCTTCTCT TCTCTCTTCTCT TCTCTCTTCT TC
  • forward primers wherein the forward primer is DYS390-oF (SEQ ID NO: 2), DYS456-oF (SEQ ID NO: 4), H4-oF (SEQ ID NO: 6), DYS448-oF (SEQ ID NO: 8), DYS437-oF (SEQ ID NO: 10), DYS385-oF (SEQ ID NO: 12), DYS635-oF (SEQ ID NO: 14), DYS389-oF (SEQ ID NO: 16), DYS393-oF (SEQ ID NO: 18), DYS458-oF (SEQ ID NO: 20), DYS438-oF (SEQ ID NO: 22), DYS439-oF (SEQ ID NO: 24), DYS392-oF (SEQ ID NO: 26), DYS 19-F (SEQ ID NO: 28), DYS391-F (SEQ ID NO: 30), DYS39
  • reverse primers wherein the reverse primer is DYS390-oR (SEQ ID NO: 3), DYS456-oR (SEQ ID NO: 5), H4-oF (SEQ ID NO: 7), DYS448-oR (SEQ ID NO: 9), DYS437-oR (SEQ ID NO: 11), DYS385-oR (SEQ ID NO: 13), DYS635-oR (SEQ ID NO: 15), DYS389-oR (SEQ ID NO: 17), DYS393-oR (SEQ ID NO: 19), DYS458-oR (SEQ ID NO: 21), DYS438-oR (SEQ ID NO: 23), DYS439-oR (SEQ ID NO: 25), DYS392-oR (SEQ ID NO: 27), DYS 19-R (SEQ ID NO: 29), DYS391-R (SEQ ID NO: 31), DYS391
  • homology and identity mean the same thing as similarity.
  • the use of the word homology is used between two non-natural sequences it is understood that this is not necessarily indicating an evolutionary relationship between these two sequences, but rather is looking at the similarity or relatedness between their nucleic acid sequences.
  • Many of the methods for determining homology between two evolutionarily related molecules are routinely applied to any two or more nucleic acids or proteins for the purpose of measuring sequence similarity regardless of whether they are evolutionarily related or not.
  • variants of genes and proteins herein disclosed typically have at least, about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent homology to the stated sequence or the native sequence.
  • variants of genes and proteins disclosed herein typically have about 70-74, 75-79, 80- 84, 85-89, 90-94, 95-99 percent homology to the stated sequence or the native sequence. In an aspect, variants of genes and proteins disclosed herein typically have about 70-99, 75-95, or 80-90 percent homology to the stated sequence or the native sequence. In an aspect, variants of genes and proteins disclosed herein typically have about 70-80, 80-90, or 90-100 percent homology to the stated sequence or the native sequence.
  • the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
  • Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
  • nucleic acids can be obtained by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity, and be disclosed herein.
  • a sequence recited as having a particular percent homology to another sequence refers to sequences that have the recited homology as calculated by any one or more of the calculation methods described above.
  • a first sequence has 80 percent homology, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent homology to the second sequence using the Zuker calculation method even if the first sequence does not have 80 percent homology to the second sequence as calculated by any of the other calculation methods.
  • a first sequence has 80 percent homology, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent homology to the second sequence using both the Zuker calculation method and the Pearson and Lipman calculation method even if the first sequence does not have 80 percent homology to the second sequence as calculated by the Smith and Waterman calculation method, the Needleman and Wunsch calculation method, the Jaeger calculation methods, or any of the other calculation methods.
  • a first sequence has 80 percent homology, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent homology to the second sequence using each of calculation methods (although, in practice, the different calculation methods will often result in different calculated homology percentages).
  • nucleic acid based there are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acid primers disclosed herein for binding to Y chromosome specific loci or fragments, derivatives, or analogs thereof.
  • the disclosed nucleic acids are made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U.
  • an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantagous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment, a) Nucleotides and related molecules
  • a nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage.
  • the base moiety of a nucleotide can be adenine-9-yl (A), cytosine-l-yl (C), guanine-9-yl (G), uracil- 1-yl (U), and thymin-l-yl (T).
  • the sugar moiety of a nucleotide is a ribose or a deoxyribose.
  • the phosphate moiety of a nucleotide is pentavalent phosphate.
  • An non-limiting example of a nucleotide would be 3'- AMP (3 '-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate).
  • a nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl (.psi.), hypoxanthin-9-yl (I), and 2-aminoadenin-9- yl.
  • a modified base includes but is not limited to 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cyto
  • nucleotide analogs such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
  • 5-methylcytosine can increase the stability of duplex formation.
  • time base modifications can be combined with for example a sugar modification, such as 2'- O-methoxyethyl, to achieve unique properties such as increased duplex stability.
  • Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S- or N-alkenyl; 0-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to C 10 , alkyl or C 2 to C 10 alkenyl and alkynyl.
  • 2' sugar modifications also include but are not limited to -0[(CH 2 ) n 0] m CH 3 , -0(CH 2 ) n OCH 3 , -0(CH 2 ) n NH 2 , -0(CH 2 ) n CH 3 , -0(CH 2 ) n -ONH 2 , and -0(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
  • Ci Ci to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an R A cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • sugars Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH 2 and S. Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Nucleotide analogs can also be modified at the phosphate moiety.
  • Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates.
  • these phosphate or modified phosphate linkage between two nucleotides can be through a 3 '-5' linkage or a 2 '-5' linkage, and the linkage can contain inverted polarity such as 3 '-5' to 5 '-3' or 2 '-5' to 5 '-2'.
  • Various salts, mixed salts and free acid forms are also included.
  • nucleotide analogs need only contain a single modification, but may also contain multiple modifications within one of the moieties or between different moieties.
  • Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA).
  • Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson- Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
  • Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • nucleotide substitute that both the sugar and the phosphate moieties of the nucleotide can be replaced, by for example an amide type linkage (aminoethyl glycine) (PNA).
  • PNA aminoethyl glycine
  • conjugates can be link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance for example, cellular uptake.
  • Conjugates can be chemically linked to the nucleotide or nucleotide analogs.
  • Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid, a thioether
  • a Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute.
  • the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, Nl , and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.
  • a Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA.
  • the Hoogsteen face includes the N7 position and reactive groups (NH 2 or O) at the C6 position of purine nucleotides.
  • sequences related to the primers for performing the methods disclosed herein There are a variety of sequences related to the primers for performing the methods disclosed herein.
  • the sequences for the human analogs of these primers, as well as other anlogs, and alleles of these genes, and splice variants and other types of variants, are available in a variety of protein and gene databases, including Genbank. Those sequences available at the time of filing this application at Genbank are herein incorporated by reference in their entireties as well as for individual subsequences contained therein. Those of skill in the art understand how to resolve sequence discrepancies and differences and to adjust the compositions and methods relating to a particular sequence to other related sequences. Primers and/or probes can be designed for any given sequence given the information disclosed herein and known in the art.
  • compositions including primers and probes, which are capable of interacting with Y chromosome specific loci, as disclosed herein.
  • the primers are used to support DNA amplification reactions.
  • the primers will be capable of being extended in a sequence specific manner.
  • Extension of a primer in a sequence specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer.
  • Extension of the primer in a sequence specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions that amplify the primer in a sequence specific manner are preferred.
  • the primers are used for the DNA amplification reactions, such as PCR or direct sequencing. It is understood that in certain embodiments the primers can also be extended using non-enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner.
  • the disclosed primers hybridize with a Y chromosome specific locus, such as, for example, DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeats.
  • a Y chromosome specific locus such as, for example, DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeats.
  • the disclosed primers hybridize with the complement of the DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or the complement of other Y chromosome short tandem repeats.
  • primer design One consideration of primer design is that optimal primer pairs should be specific enough to prevent amplification starting from 100 ng of female DNA. Another consideration of primer design is that optimal primer pairs should permit amplification of male DNA in the presence of a 100- to 1000- fold female background.
  • the size of the primers or probes for interaction with the Y chromosome specific loci such as DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeats can be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or the simple hybridization of the probe or primer.
  • a primer or probe for a typical Y chromosome specific locus such as, for example, DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeat can be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78
  • a primer or probe for a Y chromosome specific locus such as DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeat
  • Y chromosome short tandem repeat can be less than or equal to 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74
  • the primers and probes are designed such that they are outside primers for Y chromosome specific loci such as DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeats.
  • Y chromosome specific loci such as DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeats.
  • the primers can have a nearest point of interaction with the Y chromosome specific loci such as DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391, or other Y chromosome short tandem repeats that is within 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,
  • kits that are drawn to reagents that can be used in practicing the methods disclosed herein.
  • the kits can include any reagent or combination of reagent discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods.
  • the kits could include primers to perform the amplification reactions discussed in certain embodiments of the methods, as well as the buffers and enzymes required to use the primers as intended.
  • kits for amplifying a Y chromosome short tandem repeat in a DNA sample derived form multiple DNA donor sources comprising at least one primer that binds 5' to a Y chromosome short tandem repeat and can amplify regions 5' to a Y-chromosome specific locus.
  • kits comprising a forward and/or reverse primer that binds 5' to a Y chromosome short tandem repeat and can amplify regions 5' to a Y-chromosome specific loci.
  • kits comprising a forward and/or reverse primer that bind 5' to regions surrounding a Y- chromosome specific locus (e.g., DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393 (SEQ ID NO: 36), DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391 (SEQ ID NO: 1).
  • kits wherein the forward primer is DYS390-oF (SEQ ID NO: 2), DYS456-oF (SEQ ID NO: 4), H4-oF (SEQ ID NO: 6), DYS448-oF (SEQ ID NO: 8), DYS437-oF (SEQ ID NO: 10), DYS385-oF (SEQ ID NO: 12), DYS635-oF (SEQ ID NO: 14), DYS389-oF (SEQ ID NO: 16), DYS393-oF (SEQ ID NO: 18), DYS458-oF (SEQ ID NO: 20), DYS438-oF (SEQ ID NO: 22), DYS439- oF (SEQ ID NO: 24), DYS392-oF (SEQ ID NO: 26), DYS19-F (SEQ ID NO: 28), DYS391-F (SEQ ID NO: 30), DYS391-F (SEQ ID NO: 2
  • kits disclosed herein in addition to comprising a forward primer can comprise a reverse primer. Accordingly, contemplated herein are kits, further comprising a reverse primer that binds 5' to a Y chromosome short tandem repeat and can amplify regions 5' to a Y-chromosome specific loci.
  • kits wherein the reverse primer is DYS390-oR (SEQ ID NO: 3), DYS456-oR (SEQ ID NO: 5), H4-oF (SEQ ID NO: 7), DYS448-oR (SEQ ID NO: 9), DYS437-oR (SEQ ID NO: 11), DYS385-oR (SEQ ID NO: 13), DYS635-oR (SEQ ID NO: 15), DYS389-oR (SEQ ID NO: 17), DYS393-oR (SEQ ID NO: 19), DYS458-oR (SEQ ID NO: 21), DYS438-oR (SEQ ID NO: 23), DYS439-oR (SEQ ID NO: 25), DYS392-oR (SEQ ID NO: 27), DYS19-R (SEQ ID NO: 29), DYS391-R (SEQ ID NO: 31), DYS391-R (SEQ ID NO: 31),
  • kits wherein the reverse primer is DYS390- oR (SEQ ID NO: 3), DYS456-oR (SEQ ID NO: 5), H4-oF (SEQ ID NO: 7), DYS448-oR (SEQ ID NO: 9), DYS437-oR (SEQ ID NO: 11), DYS385-oR (SEQ ID NO: 13), DYS635- oR (SEQ ID NO: 15), DYS389-oR (SEQ ID NO: 17), DYS393-oR (SEQ ID NO: 19), DYS458-oR (SEQ ID NO: 21), DYS438-oR (SEQ ID NO: 23), DYS439-oR (SEQ ID NO: 25), DYS392-oR (SEQ ID NO: 27), DYS19-R (SEQ ID NO: 29), DYS391-R (SEQ ID NO: 31), DYS391-
  • FIG. 3 shows the 2% agarose gel electrophoresis after pre-amplification of these three loci using the two concentrations of primers.
  • the molecular marker was GelPilot lkb Plus ladder. None of these primers generated a positive result at the right size, which was expected in the boxed areas.
  • a second set of primers for loci DYS19, DYS389I, and DYS439 were evaluated.
  • the samples were as follows: Lane 1 (1 ng RxN male genomic DNA), Lane 2 (100 ng female DNA), Lane 3 (50 ng female DNA and 1 ng male DNA), and Lane 4 (NTC).
  • FIG. 4 shows the 2% agarose gel electrophoresis after pre-amplification of these three loci.
  • the molecular marker was GelPilot lkb Plus ladder.
  • the second set of primers for DYS19 and DYS389I generated a positive result at the correct band size, which is in the framed areas.
  • the second set of primers for DYS439 did not generate a specific PCR product.
  • the DNA was amplified using 1 ng male DNA, but gave no amplification using 100 ng female DNA.
  • FIG. 5 which shows a sequence surrounding Y-STR locus DYS391
  • the NCFS primers are bolded in FIG. 5.
  • the forward DYS391F primer is 31021-31081 (e.g., ctattcattcaatcatacaccca) (SEQ ID NO: 32) and the reverse DYS391R primer is 31321 (e.g., gattctttgtggtgggtctg) (SEQ ID NO: 33).
  • the (TCTG) 3 (TCTA) n repeats are in italics and every other TCTA repeat is underlined.
  • FIG. 6, which shows a sequence surrounding the Y-STR locus DYS393 the following apply: Accession ID - GDB is
  • the sequence is found in AC006152 (CoreNucleotide, NCBI); the Y chromosome sequence position is 3191128-2191246; and the start and stop position based on NCFS primer location.
  • NCFS primers are bolded in FIG. 6.
  • the forward DYS393 primer is 21091-21114 (e.g., gtggtcttctacttgtgtcaatac) (SEQ ID NO: 34) and the reverse DYS393 primer is 21209-21188 (e.g., aactcaagtccaaaaaatgagg) (SEQ ID NO: 35).
  • the (AGAT) n repeats are underlined.
  • DYS391 forward primer 2 (for2) and DYS391 reverse primer 1 (revl) were used on the left side of the gel, and DYS391 forward primer 2 (for2) and DYS391 reverse primer 2 (rev2) were used on the right hand side of the gel.
  • the expected amplicon sizes were expected to be about 360 bp and about 400 bp, respectively, depending on the repeats.
  • the GelPilot Plus ladder is also shown in FIG. 7.
  • DYS393 forward primer 5 for 5
  • DYS393 reverse primer 3 rev3
  • the expected amplicon size was about 120 bp to about 200 bp, depending on the repeats.
  • the GelPilot Plus ladder is also shown in FIG. 8.
  • pre-amplification The optimization of pre-amplification to avoid the need for purification prior to the Y-STR analysis was undertaken. Different cycle numbers and different primer concentrations were tested to exhaust the pre-amplification primers during pre- amplification. The approach aimed to avoid those pre-amplification primers that interfered with the Y-STR analysis by producing products with different lengths, which could invalidate or otherwise falsify the result of the fingerprinting. (FIG. 2).
  • the pre- amplification conditions are such that the pre-amplification primers (outer primers) are exhausted after the pre-amplification reaction.
  • purification off the PCR product is not need.
  • QIAGEN Type-It Microsatellite Mastermix was used for all experiments.
  • a homebrew Y-STR analysis singleplex for DYS391 was optimized using fluorescently labeled primers. (Butler and Kayser (2002) Forensic Sci Int. 129(1): 10-24). Thus, the pre-amplification process was optimized prior testing it with a cost-intensive commercially available Y-STR Kits.
  • the reaction was prepared as stated below in Table 1. The Y-STR analysis was performed both with and without pre-amplification. In the case of pre-amplification, the PCR product was diluted according to the theoretical PCR efficiency of 100%.
  • the dilution factors for this experiment are shown in Table 2. Different dilution factors were used according to the cycle numbers, independent from the primer concentration in the pre-amplification.
  • the Y-STR analysis was performed with the following protocol.
  • the initial enzyme activation occurred at 95 °C for 15 min.
  • 34 cycles of 95 °C at 30 sec, 55 °C for 90 sec, and 72 °C for 30 sec. occurred.
  • Final elongation occurred at 68 °C for 20 min.
  • the reactions were run on an ABI 3730 DNA analyzer.
  • FIGS. 9-21 show electropherograms for the analysis of DYS391 without pre- amplification or with 10 or 20 cycles pre-amplification with a pre-amplification primer concentration of 0.1 ⁇ . Using a primer concentration of 0.01 ⁇ resulted in blank electropherograms .
  • FIGS. 9-12 show the analysis of DYS391 after CE.
  • the expected length of the PCR amplicon for DYS391 was about 93 bp to about 121 bp.
  • 0.1 ng of male DNA and 100 ng of female DNA were used without pre-amplification.
  • the reaction using purified male DNA generated a clear signal by about 102 bp.
  • the reaction using purified female DNA generated two peaks, which appeared by about 100 bp and about 300 bp.
  • the NTC showed no signal.
  • 0.1 ng of male DNA and 100 ng of female DNA were used with 10 cycles pre-amplification and a primer concentration of 0.1 ⁇ .
  • the purified male DNA showed a clear signal by about 102 bp.
  • the female DNA showed no signal, even at 300 bp.
  • the reaction using mixed DNA (0.1 ng male DNA and 100 ng female DNA) showed a peak with a lower intensity than using just male DNA.
  • 0.1 ng of male DNA and 100 ng of female DNA were used with 20 cycles pre-amplification and a primer concentration of 0.1 ⁇ .
  • the dilution factor was 1,000,000 fold.
  • FIG. 11 shows that the CE was overloaded and that quantification could not be performed.
  • FIGS. 12-14 show the analysis of DYS391 after CE.
  • the expected length of the PCR amplicon for DYS391 in FIGS. 12-14 was about 93 bp to about 121 bp.
  • 1.0 ng of male DNA and 100 ng of female DNA were used without pre-amplification.
  • 1.0 ng of male DNA and 100 ng of female DNA were used with 10 cycles pre- amplification and a primer concentration of 0.1 ⁇ .
  • 1.0 ng of male DNA and 100 ng of female DNA were used with 20 cycles pre-amplification and a primer concentration of 0.1 ⁇ .
  • FIGS. 15-17 show the analysis of DYS391 after CE.
  • the expected length of the PCR amplicon for DYS391 in FIGS. 15-17 was about 93 bp to about 121 bp.
  • 5.0 ng of male DNA and 100 ng of female DNA were used without pre-amplification.
  • 5.0 ng of male DNA and 100 ng of female DNA were used with 10 cycles pre- amplification and a primer concentration of 0.1 ⁇ .
  • 5.0 ng of male DNA and 100 ng of female DNA were used with 20 cycles pre-amplification and a primer concentration of 0.1 ⁇ .
  • FIG. 18 shows the Y-STR analysis for DYS393 using 1 ng male DNA and 100 ng female DNA using the primers published by Kayser.
  • the expected length of the PCR amplicon for male DNA was between about 109 bp and about 133 bp.
  • the selected primers did not show the high specificity for male DNA.
  • Female DNA was amplified to two different PCR products of about 123 bp and 135 bp. The 8 bp difference in amplicon size was explained by the analysis of the sequence alignment between the sequences of X- and Y-chromosomes. (FIG. 19).
  • DYS393 The alignment of male (top) and female (bottom) DNA sequences of DYS393 was done using ClusalX2. The sequence of the reverse primer for the analysis of DYS393 is shown in the rectangular box. The homologous sequence on the Y chromosome is 8 bp shorter than the corresponding sequence on the X chromosome.
  • FIG. 20 and FIG. 21 show the analysis of DYS393 after CE with 10 cycles pre- amplification and a primer concentration of 0.1 ⁇ (FIG. 20) or 20 cycles of pre- amplification and a primer concentration of 0.1 ⁇ (FIG. 21).
  • 1.0 ng of male DNA and 100 ng of female DNA were used.
  • the expected length of the PCR amplicon for DYS393 was about 109 bp to about 133 bp.
  • primers were designed for the disclosed novel forensic amplification method to pre-amplify specific Y-STR sequences. (See FIG. 1). Specific primer pairs that can selectively pre-amplify in a first round of PCR the regions surrounding the Y-STRs were developed.
  • the Y-STRs were as follows: DYS390, DYS456, Y GATA H4, DYS448, DYS437, DYS385, DYS635, DYS389, DYS393, DYS458, DYS438, DYS439, DYS392, DYS19, and DYS391.
  • Table 3 lists the nested pre-amplification primers for the above -identified Y-STRS.
  • the inside primer pairs represent the Y-STR specific primers (i.e, the primers of the second PCR reaction).
  • the outside primer pairs represent the pre- amplification primers (primers for the first PCR reaction) are located in the region 5 ' of the STR-locus.
  • primers are selected to be located 5' of the respective primers contained in any commercial Y-STR kit for a given Y-STR locus.
  • primers can partially overlap with the Y-STR specific primer for a given Y-STR locus.
  • the forward or reverse primer can be identical to the primer contained in the commercial kit (semi- nested), (ii) can overlap with the primer contained in the commercial kit except the 1 nucleotide at the 3' end, or (iii) can do both.
  • the primers are selected specifically to a given set of Y-STR markers in a given commercial Y-STR kit.
  • the product of this first enrichment PCR can be then applied and is compatible to many commercial Y- STR multiplex kits such as the QIAGEN Argus Y-12 QS, the Applied Biosystems AmpFISTR Yfiler, or the Promega PowerPlex Y.
  • the pre-amplification was performed using the QIAGEN Type-it
  • Microsatellite PCR Kit (Catalog No. 206243) using the standard protocol recommended in the manual with a reduced number of cycles.
  • the protocol was as follows: 95 °C for 15 min., followed by 15 cycles of 95 °C for 30 sec, 60 °C for 90 sec, 72 °C for 30 sec, then 68 °C for 10 min.
  • the reaction products can be stored indefinitely at 8 °C.
  • FIG. 22A shows the results of the reaction without pre-amplification for several Y-STR loci
  • FIG. 22B shows the results of the reaction with pre-amplification for several Y-STR loci.
  • FIG. 23A shows the results of the reaction without pre-amplification for several Y-STR loci
  • FIG. 23B shows the results of the reaction with pre-amplification for several Y-STR loci.
  • the Y-STR analysis obtained without pre-amp shows hardly detectable signals, with allele drop-out in many cases so that only a partial profile was obtained.
  • FIG. 23A shows hardly detectable signals, with allele drop-out in many cases so that only a partial profile was obtained.
  • FIG. 23B shows hardly detectable signals, with allele drop-out in many cases so that only a partial profile was obtained.
  • the Y-STR genotyping is commonly used in the forensic field, e.g., sexual assaults
  • the co-amplification of the female DNA contained in the sample is possible.
  • the co-amplification of female DNA leads to artifacts that can interfere with the genotyping analysis, and possibly invalidate the results.
  • the available amount of male DNA for genotyping decreases (which is often the results of a delay in reporting the sexual assault)
  • low copy number techniques have to be applied. This enhances the probability of artifact appearance.
  • Y-STR Y-chromosome specific loci
  • the use of these specific primers in a pre-amplification method enhanced the sensitivity of a common Y-STR commercial kit, such as the Applied Biosystems Yfiler Kit.
  • the product of this first enrichment PCR was applied in and was compatible to many commercial Y-STR multiplex kits such as the QIAGEN Argus Y-12 QS, the Applied Biosystems AmpFISTR Yfiler, or the Promega PowerPlex Y.

Abstract

L'invention concerne des compositions et des procédés qui permettent d'amplifier un échantillon d'ADN cible dans un mélange d'échantillons d'ADN. Dans un mode de réalisation, des procédés de génotypage d'un premier échantillon d'ADN cible (par ex. un ADN chromosomique Y) dans un échantillon d'ADN provenant de différentes sources consistent à produire de manière séquentielle une première réaction PCR et une deuxième réaction PCR sur l'échantillon, la première et la deuxième réaction PCR étant obtenues avec au moins une amorce avant et au moins une amorce inverse, au moins une amorce dans la première réaction PCR étant 5' relativement à l'amorce correspondante dans la deuxième réaction PCR.
PCT/US2012/058746 2011-10-04 2012-10-04 Procédés et compositions pour détecter un adn cible dans un échantillon mixte d'acides nucléiques WO2013052663A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161543116P 2011-10-04 2011-10-04
US61/543,116 2011-10-04

Publications (1)

Publication Number Publication Date
WO2013052663A1 true WO2013052663A1 (fr) 2013-04-11

Family

ID=48044152

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/058746 WO2013052663A1 (fr) 2011-10-04 2012-10-04 Procédés et compositions pour détecter un adn cible dans un échantillon mixte d'acides nucléiques

Country Status (1)

Country Link
WO (1) WO2013052663A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020119478A1 (en) * 1997-05-30 2002-08-29 Diagen Corporation Methods for detection of nucleic acid sequences in urine
US20080153099A1 (en) * 2006-12-19 2008-06-26 Allen Robert W Quantitation of Human Genomic DNA
US20090117542A1 (en) * 2004-05-17 2009-05-07 The Ohio State University Research Foundation Unique short tandem repeats and methods of their use
WO2010065470A2 (fr) * 2008-12-01 2010-06-10 Consumer Genetics, Inc. Compositions et méthodes pour détecter un adn masculin pendant la détermination du sexe foetal

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020119478A1 (en) * 1997-05-30 2002-08-29 Diagen Corporation Methods for detection of nucleic acid sequences in urine
US20090117542A1 (en) * 2004-05-17 2009-05-07 The Ohio State University Research Foundation Unique short tandem repeats and methods of their use
US20080153099A1 (en) * 2006-12-19 2008-06-26 Allen Robert W Quantitation of Human Genomic DNA
WO2010065470A2 (fr) * 2008-12-01 2010-06-10 Consumer Genetics, Inc. Compositions et méthodes pour détecter un adn masculin pendant la détermination du sexe foetal

Similar Documents

Publication Publication Date Title
US9909179B2 (en) Single-cell nucleic acid analysis
EP3191604B1 (fr) Méthodes et compositions pour la préparation de banques d'acides nucléiques rapides
EP3133167B1 (fr) Procédés se rapportant à des fusions d'alk pour diagnostiquer le cancer
JP4886298B2 (ja) 核酸増幅
US20090081655A1 (en) Multiplex Real-time Quantitative PCR
US20080038727A1 (en) MicroRNA and Messenger RNA Detection on Arrays
CA2957633A1 (fr) Mesures numeriques a partir de sequencage cible
JP2006512094A5 (fr)
EP2812451A2 (fr) Procédés et compositions concernant des fusions de ros1 pour diagnostiquer et traiter le cancer
US20210010060A1 (en) Highly Multiplexed PCR with Bioinformatically Optimized Primers to Prepare Targeted Libraries for Next-Generation Sequencing
US9428812B2 (en) Kit comprising primers for amplifying ALK kinase domain nucleic acids
US20100297622A1 (en) Method for high-throughput gene expression profile analysis
CN116323963A (zh) 选择性捕获靶dna序列
WO2013052663A1 (fr) Procédés et compositions pour détecter un adn cible dans un échantillon mixte d'acides nucléiques
JP6983906B2 (ja) ライブラリーの定量および定性
WO2014026133A1 (fr) Méthodes et compositions associées à alk pour le diagnostic et le traitement de cancers du sein inflammatoires et d'autres cancers humains

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12838238

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12838238

Country of ref document: EP

Kind code of ref document: A1