WO2013039880A1 - Biomarqueurs et cibles thérapeutiques du cancer hépatocellulaire - Google Patents

Biomarqueurs et cibles thérapeutiques du cancer hépatocellulaire Download PDF

Info

Publication number
WO2013039880A1
WO2013039880A1 PCT/US2012/054607 US2012054607W WO2013039880A1 WO 2013039880 A1 WO2013039880 A1 WO 2013039880A1 US 2012054607 W US2012054607 W US 2012054607W WO 2013039880 A1 WO2013039880 A1 WO 2013039880A1
Authority
WO
WIPO (PCT)
Prior art keywords
scd
cancer
hcc
patient
marker
Prior art date
Application number
PCT/US2012/054607
Other languages
English (en)
Inventor
Anuradha S. BUDHU
Xin Wei Wang
Original Assignee
The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, As Represented By The Secretary, Department Of Health And Human Services filed Critical The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Publication of WO2013039880A1 publication Critical patent/WO2013039880A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/303—Liver or Pancreas

Definitions

  • the present invention generally relates to biomarkers, methods and assay kits for the identification, monitoring and treatment of Hepatocellular Cancer (HCC) patients.
  • HCC Hepatocellular Cancer
  • Hepatocellular carcinoma represents an extremely poor prognostic cancer that remains one of the most common and aggressive malignancies worldwide. With current diagnostic methods, HCC patients are often diagnosed with end-stage cancer and have poor survival. HCC is also a very heterogeneous disease, which adds to the difficulty of clinical diagnosis and prognosis. HCC heterogeneity is thought to occur via lineage- specific tumor subtypes.
  • the hepatic stem cell-like HCC subtype (HpSC HCC) retains stem-cell features which are capable of cellular plasticity, dynamic cell motility, and integral interaction with the microenvironment making it a highly aggressive form of this disease.
  • the HpSC HCC is associated with poor outcome and prognosis, and treatment options remain minimal and relatively unsuccessful.
  • the present invention relates to a novel biomarker of HCC, namely Stearoyl Co-A
  • Desaturase (SCD) protein Desaturase (SCD) protein, and methods of treating the cancer, methods of diagnosis of the cancer, methods of determining predisposition to the cancer, methods of monitoring progression/regression of the cancer, methods of assessing efficacy of compositions for treating the cancer, methods of screening compositions for activity in modulating biomarker of the cancer, as well as other methods based on the biomarker.
  • SCD Desaturase
  • the invention provides a method of treating or preventing or ameliorating hepatocellular cancer (HCC) or preventing metastasis of HCC.
  • HCC hepatocellular cancer
  • the HCC is HpSC HCC subtype.
  • the agent may be SPA. In some embodiments, the agent may inhibit the activity or expression or both of Steoryl Co-A Desaturase (SCD) protein. In some embodiments, the agent may be a SCD synthetic inhibitor, a nucleic acid molecule, an antibody or a biologically active fragment thereof, or an aptamer. In some embodiments, the SCD synthetic inhibitor may be CGX0168 or CGX0290. In some embodiments, the nucleic acid molecule may be an anti-sense oligonucleotide, an R Ai construct, a DNA enzyme, or a ribozyme that specifically inhibits the expression of SCD. In some embodiments, the RNAi construct may be a small interfering RNA (siRNA) that is specific for SCD. In some embodiments, the antibody or a biologically active fragment thereof specifically binds to SCD.
  • siRNA small interfering RNA
  • the agent may be administered to the subject in a pharmaceutical composition.
  • the pharmaceutical composition may be a mono-phasic pharmaceutical composition suitable for parenteral or oral administration consisting essentially of a therapeutically-effective amount of the agent, and a pharmaceutically acceptable carrier.
  • the SCD comprises the human SCD-1 isoform.
  • the method of treating or preventing HCC is combined with an anti-cancer therapy.
  • the anticancer therapy may be surgery, radiation therapy and chemotherapy.
  • the invention provides a method of diagnosing hepatocellular cancer (HCC) in a subject.
  • the method comprises analyzing a biological sample from a subject to determine the level of SCD in the sample; and comparing the level of the SCD in the sample to cancer-positive and/or cancer-negative reference levels of the SCD marker to diagnose whether the subject has HCC.
  • HCC hepatocellular cancer
  • the analyzing may be conducted in conjunction with at least one of a skin examination, dermoscopy, lymph node examination, chest x-ray, CT scan of the chest, head, abdomen, or pelvis, magnetic resonance imaging (MRI), evaluation of other biomarkers from the subject, clinical testing to rule out concurrent infection in the subject, clinical testing to rule out the presence of an autoimmune disorder in the subject, and/or a serum lactate dehydrogenase blood test.
  • the HCC is hepatic stem cell (HpSC) HCC subtype.
  • the subject may have pancreatic cancer, cholangiocarcinoma, angiosarcoma, hepatoblastoma, leukemia, or any metastatic cancer, diabetes, a hepatitis B viral infection, hepatitis C viral infection, an alcohol related disease or a fatty acid disease.
  • upregulation of the SCD marker compared to cancer-negative reference levels may be associated with a decrease in patient survival.
  • the biological sample may be a tumor tissue or a body fluid.
  • the body fluid may be blood, cultured whole blood, serum, plasma, cerebrospinal fluid, urine, saliva, cancer tissue, peritoneal fluids, plural fluids, tears, or sweat.
  • the reference level may be determined according to a statistical procedure for risk prediction.
  • the level of SCD may be detected with a reagent that specifically detects the SCD protein.
  • the reagent may be an antibody, an antibody derivative, an antibody fragment, or an aptamer.
  • the level of SCD in the sample may be analyzed with a technique that specifically detects SCD gene expression.
  • the present invention provides a kit for detecting or monitoring HCC in a subject, comprising a means to detect the expression of SCD, including at least one of binding ligands that specifically detect SCD, binding ligands disposed on an assay surface, and antibodies or binding fragments thereof; and a control element.
  • the assay surface may comprise a chip, array, or fluidity card.
  • the control element may be a) information containing a predetermined control level of SCD that has been correlated with good patient outcome; b) information containing a predetermined control level of SCD that has been correlated with poor patient outcome; or c) both a) and b).
  • control element may be a) information containing a predetermined control level of SCD that has been correlated with HpSC HCC subtype; b) information containing a predetermined control level of SCD that has been correlated with MH HCC subtype; or c) both a) and b).
  • the present invention provides a method for predicting the prognosis of a cancer patient.
  • the method comprises obtaining a biological sample from a patient diagnosed with hepatocellular carcinoma; detecting in the biological sample the presence of at least one marker selected from: i) at least one mutation in an SCD-1 nucleic acid molecule that reduces or eliminates a protein function of the encoded SCD-1 protein; ii) the level or presence of SCD-1 protein activity; or iii) the level of SCD-1 gene expression, wherein the presence of at least one marker is indicative of a poor prognosis of the cancer patient.
  • the patient may be a human.
  • the biological sample may be blood, tears, urine, saliva, skin, muscle and lymph tissue.
  • the biological sample may be tumor tissue.
  • the step of detecting may include determining the expression level of SCD- 1 nucleic acid molecules in the sample.
  • the present invention provides a method for predicting the clinical response of a cancer patient to a therapeutic agent that increases the proportion of Saturated Palmitic Acid (SPA) to its unsaturated metabolic products.
  • the method comprises obtaining a biological sample from a human patient diagnosed with hepatocellular carcinoma; detecting in the biological sample the presence of at least one marker selected from i) an increased level or presence of SCD protein activity; or ii) an increased level of SCD gene expression, wherein the presence of the at least one marker is indicative of a cancer patient that will benefit from the therapeutic administration of the agent.
  • SPA Saturated Palmitic Acid
  • the benefit may be a reduction or elimination of cancer cells from the patient, a reduction in the growth of the cancer cells in the patient, a reduction of metastases of the cancer cells in the patient, or a reduction in the rate of metastasis in the cancer patient.
  • the agent may inhibit the activity or expression of Steoryl Co-A Desaturase (SCD) protein.
  • the agent may be a SCD synthetic inhibitor, a nucleic acid molecule, an antibody or a biologically active fragment thereof, or an aptamer.
  • the SCD may be the human SCD-1 isoform.
  • Figure 1 shows the array analysis of SCD gene expression in HpSC or MH tumor or nontumor tissues. Data is presented as ⁇ SD.
  • Figure 2 shows a Kaplan-Meier overall survival analysis curve for high and low risk survival groups with the log rank p value based on SCD gene expression categorized as high or low according to its median expression among tumor specimens.
  • Figure 3 shows a Kaplan-Meier overall survival analysis curve for high and low risk survival groups with the log rank p value based on SCD gene expression categorized as high or low according to its median expression among non-tumor specimens.
  • Figure 4 shows correlation analysis of SCD and palmitoleate or 15-methylpalmitate. The Spearman r value and p value is presented.
  • FIG. 5 shows that treatment of Huh7 or Huhl cells with saturated palmitic acid (SPA) or SCD inhibitor CGX0168 or both reduces Akt activity which can be rescued with addition of mono-unsaturated palmitic acid (MUPA).
  • SPA saturated palmitic acid
  • MUPA mono-unsaturated palmitic acid
  • FIG. 6 shows that treatment of Huh7 cells with saturated palmitic acid (SPA) or SCD inhibitor CGX0168 or both reduces cell migration and invasion which can be rescued with addition of mono-unsaturated palmitic acid (MUPA).
  • SPA saturated palmitic acid
  • MUPA mono-unsaturated palmitic acid
  • Figure 7 shows a model depicting the role of SCD in HCC sternness.
  • Figure 8 shows Kaplan-Meier patient survival analysis curves for high and low risk survival groups indicating that high SCD expression is associated with poor patient outcome.
  • Figure 9 shows Western blots showing that endogenous SCD expression is inhibited by treatment with Metformin or siR A specific to SCD.
  • Figure 10 shows that inhibition of SCD expression by Metformin decreases HCC sternness characteristics such as cell proliferation, migration and invasion.
  • the present inventors have discovered a biological marker whose measurement levels are indicative of hepatocellular carcinoma (HCC), namely the Stearoyl Co-A Desaturase (SCD) protein.
  • HCC hepatocellular carcinoma
  • SCD Stearoyl Co-A Desaturase
  • the biomarker is differentially expressed in biological samples obtained from HCC patients.
  • the levels and activities of the biomarker, along with clinical parameters, can be used as a biological marker indicative of HCC, including early stage (TNM stage I).
  • TNM stage I early stage
  • the invention also relates to the expression levels of the biomarker in patients with cancer that discriminate between patients having a high and low probability of survival.
  • the invention further relates to the methods of treatment or prevention of HCC that involve reducing the expression or activity of the biomarker levels in the HCC patients.
  • the terminology used herein is for describing particular embodiments and is not intended to be limiting.
  • a biological marker is a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacological responses to therapeutic interventions, consistent with NIH Biomarker Definitions Working Group (1998). Markers can also include patterns or ensembles of characteristics indicative of particular biological processes.
  • the biomarker measurement can increase or decrease to indicate a particular biological event or process. In addition, if the biomarker measurement typically changes in the absence of a particular biological process, a constant measurement can indicate occurrence of that process.
  • biomarker or “marker” includes the SCD protein, the full length gene, R A or cDNA encoding the SCD protein, or a fragment thereof.
  • gene expression or “protein expression” includes any information pertaining to the amount of gene transcript or protein present in a sample, as well as information about the rate at which genes or proteins are produced or are accumulating or being degraded (e.g., reporter gene data, data from nuclear runoff experiments, pulse-chase data etc.). Certain kinds of data might be viewed as relating to both gene and protein expression.
  • protein levels in a cell are refiective of the level of protein as well as the level of transcription, and such data is intended to be included by the phrase "gene or protein expression information.”
  • Such information may be given in the form of amounts per cell, amounts relative to a control gene or protein, in unitless measures, etc.; the term “information” is not to be limited to any particular means of representation and is intended to mean any representation that provides relevant information.
  • expression levels refers to a quantity reflected in or derivable from the gene or protein expression data, whether the data is directed to gene transcript accumulation or protein accumulation or protein synthesis rates, etc.
  • Metabolite or "small molecule” means organic and inorganic molecules which are present in a cell.
  • the term does not include large macromolecules, such as large proteins (e.g., proteins with molecular weights over 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000), large nucleic acids (e.g., nucleic acids with molecular weights of over 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000), or large polysaccharides (e.g., polysaccharides with a molecular weights of over 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000).
  • large proteins e.g., proteins with molecular weights over 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000
  • nucleic acids e.g., nucleic acids with molecular weights of over
  • small molecules of the cell are generally found free in solution in the cytoplasm or in other organelles, such as the mitochondria, where they form a pool of intermediates which can be metabolized further or used to generate large molecules, called macromolecules.
  • the term "small molecules” includes signaling molecules and intermediates in the chemical reactions that transform energy derived from food into usable forms. Examples of small molecules include sugars, fatty acids, amino acids, nucleotides, intermediates formed during cellular processes, and other small molecules found within the cell.
  • Marker measurements may be of the absolute values (e.g., the molar concentration of a molecule in a biological sample) or relative values (e.g., the relative concentration of two molecules in a biological sample).
  • the quotient or product of two or more measurements also may be used as a marker. For example, some physicians use the total blood cholesterol as a marker of the risk of developing coronary artery disease, while others use the ratio of total cholesterol to HDL cholesterol.
  • the marker SCD is used for therapeutic, diagnostic, prognostic, drug screening and patient stratification purposes (e.g., to group patients into a number of stages or “subsets” for evaluation), as well as other purposes described herein, including evaluation of the effectiveness of a HCC therapy or drug.
  • SCD Steoryl Co-A destaurase
  • SPA saturated palmitic acid
  • MUPA monounsaturated palmitic acid
  • a number of SCD iso forms have been characterized in numerous species including zebrafish, bovine, goat, mouse, rat and human, and their protein sequences, as well as gene sequences, are available at public databases as follows:
  • Human SCD1 http://www.ncbi.nlm.nih.gOv/nuccore/NM_005063.4
  • Human SCD5 http://www.ncbi.nlm.nih.gOv/nuccore/BC137429.l
  • the SCD protein is a mammalian SCD protein. In some embodiments, the SCD protein is a human SCD protein. In a preferred embodiment, SCD protein is the human SCD-1 isoform.
  • SCD is also used to refer to a nucleic acid encoding a SCD protein or a
  • variants include polypeptides that are at least 90% identical to a known SCD protein sequence, and nucleic acids encoding such variant polypeptides.
  • variants include different post- translational modifications, such as glycosylations, methylations, etc.
  • Particularly preferred variants include any naturally occurring variants, such as allelic differences, mutations that occur in a neoplasia and secreted or processed forms. The terms “variants” and “fragments” are overlapping.
  • the present invention is based on the finding that the expression levels of the SCD protein are highly elevated in HCC, particularly in the hepatic stem cell-like HCC (HpSC HCC) subtype.
  • HpSC-HCC subtype cells are EpCAM + AFP + and display the features of hepatic stem cells
  • MH-HCC (Mature Hepatocyte HCC) subtype cells are EpCAM " AFP " HCC and exhibit the features of mature hepatocytes.
  • HpSC-HCC displays the ability to self-renew and differentiate and is a highly invasive form of HCC.
  • Cancer sternness is defined as those tumor cells with the capacity to self-renew, differentiate, and form tumor sphere in non-attached culture condition; such cells are highly invasive in vitro and initiate aggressive tumors in vivo.
  • the expression levels of the SCD are highly elevated in HCC and are associated with poor patient survival.
  • treatment of Huh7 cells (a stem-like HCC cell line having stem cell features) with SCD inhibitors significantly decreased features of sternness of the Huh7 cells.
  • the marker SCD was identified by comparing the levels measured in tumor samples obtained from HCC patients with the levels measured in non-tumor samples obtained from the same patients. Analysis of the microarray data showed that SCD is significantly elevated in HpSC tumors vs nontumors, and the SCD gene expression is significantly higher in HpSC tumors vs MH tumors (Example 1, Fig. 1). Accordingly, it is believed that the expression levels of SCD are indicative of HCC, particularly of the HpSC HCC subtype.
  • the SCD expression was also highly and significantly correlated with the expression of two metabolic SPA products namely MUPA and 15-methylpalmitate in HCC tissues (Example 3, Fig. 4).
  • presence of the unsaturated metabolic products of SPA also correlated with the presence of HCC, particularly the HpSC HCC subtype, and with poor patient survival.
  • the activity of SCD plays a significant role in HpSC HCC by regulating the balance between saturated and unsaturated forms of palmitic acid.
  • Huh7 and Huhl cell lines are stem-like HCC cell lines composed of a mixture of EpCAM + AFP + HCC cells with stem cell features and the differentiated EpCAM AFP " HCC cells. As explained in Examples 4, 5 and 7, the cells were treated with inhibitors of SCD activity or expression and the effect of the treatment on the stem cell-like characteristics of the cells was measured.
  • Akt is a serine/threonine protein kinase that plays a key role in multiple cellular processes such as cell proliferation, apoptosis, transcription and cell migration and Akt phosphorylation is associated with the development of stem cell like characteristics.
  • SCD-specific inhibitor CGX0168 or CGX0290
  • Treatment of Huh7 cells with SCD-specific inhibitor also reduced cell migration and cell invasion, two features commonly associated with sternness and development of aggressive phenotypes of HCC.
  • Treatment of Huh7 cells with SPA or the combination of SPA with SCD inhibitor significantly decreased cell migration and cell invasion (Fig. 6, Example 5).
  • Treatment of Huh7 and HepG2 cells with the anti-diabetes drug Metformin or SCD specific siRNA inhibited endogenous expression of SCD (Fig. 9) and also reduced cell migration, cell invasion and ability to form cell colonies (Fig, 10, Example 7).
  • the disclosure of the present application establishes the SCD biomarker as a novel indicator of HCC, including the HpSC HCC subtype, and a novel therapeutic target in the treatment or prevention of hepatocellular cancer.
  • the disclosure also shows that shifting the lipid metabolite milieu in the cells to a more saturated status, that is by increasing the levels of SPA as compared to its unsaturated metabolic products, either by direct addition of SPA, or by inhibiting the SCD activity or expression, or both is an effective therapeutic strategy in the treatment or prevention of sternness and aggressive phenotypes of hepatocellular cancer.
  • the present invention includes all compositions and methods relying on correlations between SCD levels and the presence of HCC, early stage HCC, and HCC having stem cell features. Such methods include, without limitation, methods of treating, preventing, ameliorating or preventing metastasis of HCC, methods of diagnosing HCC, and methods for monitoring the progression of HCC.
  • the present invention also includes methods for choosing an effective treatment for HCC in a patient based on the biomarker values.
  • the term "effective” is to be understood broadly to include reducing or alleviating the signs or symptoms of HCC, improving the clinical course of the disease, or reducing any other objective or subjective indicia of the disease. Different drugs, doses and delivery routes may be chosen using the methods of the invention.
  • the SCD biomarker described herein will be measured in combination with other signs, symptoms and clinical tests of cancer, such as skin examination, dermoscopy, lymph node examination, chest x-ray, CT scan of the chest, head, abdomen, or pelvis, magnetic resonance imaging (MRI), and/or serum lactate dehydrogenase blood tests. Measurement of the biomarker of the invention along with any other marker known in the art, including those not specifically listed herein, falls within the scope of the present invention. .
  • a component e.g., a marker
  • a component is referred to as “differentially expressed” in one sample as compared to another sample when the method used for detecting the component provides a different level or activity when applied to the two samples.
  • a component is referred to as “increased” or “upregulated” in the first sample if the method for detecting the component indicates that the level or activity of the component is higher in the first sample than in the second sample (or if the component is detectable in the first sample but not in the second sample).
  • a component is referred to as “decreased” or “downregulated” in the first sample if the method for detecting the component indicates that the level or activity of the component is lower in the first sample than in the second sample (or if the component is detectable in the second sample but not in the first sample).
  • marker is referred to as “increased” (“upregulated”) or “decreased” (“downregulated”) in a sample (or set of samples) obtained from a hepatocellular cancer subject (or a subject who is suspected of having hepatocellular cancer, or is at risk of developing hepatocellular cancer) if the level or activity of the marker is higher or lower, respectively, compared to the level of the marker in a sample (or set of samples) obtained from a non-hepatocellular cancer subject, or a reference value or range.
  • the invention provides a biomarker of hepatocellular cancer.
  • the invention provides a SCD biomarker or fragment thereof.
  • a compound is referred to as "isolated" when it has been separated from at least one component with which it is naturally associated.
  • a metabolite can be considered isolated if it is separated from contaminants including polypeptides, polynucleotides and other metabolites.
  • Isolated molecules can be either prepared synthetically or purified from their natural environment. Standard quantification methodologies known in the art can be employed to obtain and isolate the molecules of the invention.
  • the inventors have discovered a novel biomarker of early stage HCC, HCC outcome, HCC stem-cell subtype, HCC patient prognosis.
  • the biomarker expression signature discriminates cancer tumors from non-tumorous tissue.
  • the invention provides a marker of hepatocellular cancer associated with stem-cell features and thus aggressive forms of HCC, in which the marker is a fragment, precursor, successor, or modified version of SCD.
  • Some variation is inherent in the measurements of the physical and chemical characteristics of the marker.
  • the magnitude of the variation depends to some extent on the reproducibility of the separation means and the specificity and sensitivity of the detection means used to make the measurement.
  • the method and technique used to measure the markers is sensitive and reproducible.
  • the expression of SCD genes is detected by measuring amounts of transcripts of the SCD gene in cells in a biological sample.
  • the expression of the genes may be detected by detecting hybridization of at least a portion of the SCD gene or a transcript thereof, to a nucleic acid molecule comprising a portion of the gene and a transcript thereof in a nucleic acid array.
  • the expression of the gene is detected by detecting the production of proteins encoded by the genes.
  • the expression of SCD is detected by an assay system including a plurality of antibodies, or antigen binding fragments thereof, or aptamers.
  • the plurality of antibodies, or antigen binding fragments thereof, or aptamers consist of antibodies, or antigen binding fragments thereof, or aptamers that selectively bind to SCD differentially expressed in patients with hepatocellular cancer, and that can be detected as protein products using antibodies or aptamers.
  • the plurality of antibodies, or antigen binding fragments thereof, or aptamers comprise antibodies, or antigen binding fragments thereof, or aptamers that selectively bind to SCD proteins or portions thereof (e.g., peptides) encoded by SCD genes.
  • Certain embodiments of the present invention utilize a plurality of biomarkers, including the SCD biomarker identified herein as being differentially expressed in subjects with cancer.
  • the terms "patient,” “cancer subject” and “a subject who has hepatocellular cancer” and “hepatocellular cancer subject” are intended to refer to subjects who have been diagnosed with hepatocellular cancer.
  • the terms "normal,” “normal control” and “a subject who does not have hepatocellular cancer” are intended to refer to a subject who has not been diagnosed with hepatocellular cancer, or who is cancer-free as a result of surgery to remove the diseased tissue.
  • a non-hepatocellular cancer subject may be healthy and have no other disease, or they may have a disease other than hepatocellular cancer.
  • a "subject” is any organism of interest, generally a mammalian subject, such as a mouse, and preferably a human subject.
  • the marker of the invention is useful in methods for diagnosing hepatocellular cancer, determining the extent and/or severity of the disease, monitoring progression of the disease and/or response to therapy.
  • the marker is also useful in methods for treating hepatocellular cancer and for evaluating the efficacy of treatment for the disease.
  • the marker may also be used as pharmaceutical compositions or in kits.
  • the marker may also be used to screen candidate compounds that modulate their expression.
  • the marker may also be used to screen candidate drugs for treatment of hepatocellular cancer. Such screening methods can be performed in human and non-human subjects.
  • Marker may be isolated by any suitable method known in the art. Markers can be purified from natural sources by standard methods known in the art (e.g., chromatography, centrifugation, differential solubility, immunoassay). In one embodiment, markers may be isolated from a biological sample using the methods disclosed herein. In another embodiment, polypeptide markers may be isolated from a sample by contacting the sample with substrate-bound antibodies or aptamers that specifically bind to the markers.
  • the SCD biomarker may be isolated by any suitable method known in the art.
  • SCD biomarker can be purified from natural sources by standard methods known in the art
  • the SCD biomarker may be isolated from a biological sample using the methods disclosed herein.
  • polypeptide marker may be isolated from a sample by contacting the sample with substrate -bound antibodies or aptamers that specifically bind to the marker.
  • the present invention also encompasses molecules which specifically bind the
  • the term “specifically binding,” refers to the interaction between binding pairs (e.g., an antibody and an antigen or aptamer and its target). In some embodiments, the interaction has an affinity constant of at most 10 ⁇ 6 moles/liter, at most 10 ⁇ 7 moles/liter, or at most 10 ⁇ 8 moles/liter. In other embodiments, the phrase “specifically binds” refers to the specific binding of one protein to another (e.g., an antibody, fragment thereof, or binding partner to an antigen), wherein the level of binding, as measured by any standard assay (e.g., an immunoassay), is statistically significantly higher than the background control for the assay.
  • any standard assay e.g., an immunoassay
  • controls when performing an immunoassay, controls typically include a reaction well/tube that contain antibody or antigen binding fragment alone (i.e., in the absence of antigen), wherein an amount of reactivity (e.g., nonspecific binding to the well) by the antibody or antigen binding fragment thereof in the absence of the antigen is considered to be background. Binding can be measured using a variety of methods standard in the art including enzyme immunoassays (e.g., ELISA), immunoblot assays, etc.).
  • enzyme immunoassays e.g., ELISA
  • immunoblot assays etc.
  • the binding molecules include antibodies, aptamers and antibody fragments.
  • antibody refers to an immunoglobulin molecule capable of binding an epitope present on an antigen.
  • the term is intended to encompasses not only intact immunoglobulin molecules such as monoclonal and polyclonal antibodies, but also bi- specific antibodies, humanized antibodies, chimeric antibodies, anti-idiopathic (anti-ID) antibodies, single-chain antibodies, Fab fragments, F(ab') fragments, fusion proteins and any modifications of the foregoing that comprise an antigen recognition site of the required specificity.
  • an aptamer is a non-naturally occurring nucleic acid molecule or peptide having a desirable action on a target, including, but not limited to, binding of the target, catalytically changing the target, reacting with the target in a way which modifies/alters the target or the functional activity of the target, covalently attaching to the target as in a suicide inhibitor, facilitating the reaction between the target and another molecule.
  • the antibodies or aptamers specifically bind to a component that is a fragment, modification, precursor or successor of a SCD biomarker.
  • Another embodiment of the present invention relates to a plurality of aptamers, antibodies, or antigen binding fragments thereof, for the detection of the expression of the SCD biomarker differentially expressed in patients with cancer.
  • the plurality of aptamers, antibodies, or antigen binding fragments thereof consists of antibodies, or antigen binding fragments thereof, that selectively bind to SCD proteins differentially expressed in patients with hepatocellular cancer, and that can be detected using antibodies or aptamers.
  • the plurality of aptamers, antibodies, or antigen binding fragments thereof comprises antibodies, or antigen binding fragments thereof, that selectively bind to proteins or portions thereof (peptides) encoded by SCD gene.
  • antibodies that specifically bind SCD markers of the invention are already known and/or available for purchase from commercial sources.
  • the antibodies of the invention may also be prepared by any suitable means known in the art.
  • antibodies may be prepared by immunizing an animal host with the SCD marker or an immunogenic fragment thereof (conjugated to a carrier, if necessary).
  • Adjuvants e.g., Freund's adjuvant
  • Sera containing polyclonal antibodies with high affinity for the antigenic determinant can then be isolated from the immunized animal and purified.
  • antibody-producing tissue from the immunized host can be harvested and a cellular homogenate prepared from the organ can be fused to cultured cancer cells.
  • Hybrid cells which produce monoclonal antibodies specific for a marker can be selected.
  • the antibodies of the invention can be produced by chemical synthesis or by recombinant expression.
  • a polynucleotide that encodes the antibody can be used to construct an expression vector for the production of the antibody.
  • the antibodies of the present invention can also be generated using various phage display methods known in the art.
  • Antibodies or aptamers that specifically bind SCD can be used, for example, in methods for detecting levels of SCD marker using methods and techniques well-known in the art.
  • the antibodies are conjugated to a detection molecule or moiety (e.g., a dye, and enzyme) and can be used in ELISA or sandwich assays to detect markers of the invention. They can also be used in methods for treating or preventing or ameliorating or preventing metstasis of HCC, as discussed in detail below.
  • antibodies or aptamers against SCD can be used to assay a tissue sample (e.g., a hepatocellular tumor tissue) for SCD marker.
  • the antibodies or aptamers can specifically bind to the marker, if any, present in the tissue sections and allow the localization of the marker in the tissue.
  • antibodies or aptamers labeled with a radioisotope may be used for in vivo imaging or treatment applications.
  • compositions comprising SCD marker, a binding molecule that is specific for SCD marker (e.g., an antibody or an aptamer), an inhibitor of SCD, or other molecule that can increase or decrease the level or activity of SCD.
  • SCD marker e.g., an antibody or an aptamer
  • Such compositions may be pharmaceutical compositions formulated for use as a therapeutic.
  • the invention provides a composition that comprises a component that is a fragment, modification, precursor, or successor of SCD or a molecule that comprises a foregoing component.
  • the invention provides a composition that comprises an antibody or aptamer that specifically binds to a SCD polypeptide or a molecule that comprises a foregoing antibody or aptamer.
  • the present invention also provides methods of detecting the SCD biomarker of the present invention.
  • the practice of the present invention employs, unless otherwise indicated, conventional methods of analytical biochemistry, microbiology, molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. (See, e.g., Sambrook, J. et al. Molecular Cloning: A Laboratory Manual. 3rd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2000; DNA Cloning: A Practical Approach, Vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., Current Edition); Nucleic Acid Hybridization (B.
  • the marker of the invention may be detected by any method known to those of skill in the art, including without limitation LC-MS, GC-MS, immunoassays, hybridization and enzyme assays.
  • the detection may be quantitative or qualitative.
  • a wide variety of conventional techniques are available, including mass spectrometry, chromatographic separations, 2-D gel separations, binding assays (e.g., immunoassays), competitive inhibition assays, and so on.
  • Any effective method in the art for measuring the presence/absence, level or activity of a marker is included in the invention. It is within the ability of one of ordinary skill in the art to determine which method would be most appropriate for measuring a specific marker.
  • an ELISA assay may be best suited for use in a physician's office while a measurement requiring more sophisticated instrumentation may be best suited for use in a clinical laboratory. Regardless of the method selected, it is important that the measurements be reproducible.
  • the marker of the invention can be measured by mass spectrometry, which allows direct measurements of analytes with high sensitivity and reproducibility.
  • mass spectrometric methods are available.
  • many separation technologies may be used in connection with mass spectrometry. For example, a wide selection of separation columns is commercially available.
  • separations may be performed using custom chromatographic surfaces (e.g., a bead on which a marker specific reagent has been immobilized). Molecules retained on the media subsequently may be eluted for analysis by mass spectrometry.
  • the level of the marker may be determined using a standard immunoassay, such as sandwiched ELISA using matched antibody pairs and chemiluminescent detection. Commercially available or custom monoclonal or polyclonal antibodies are typically used. However, the assay can be adapted for use with other reagents that specifically bind to the marker. Standard protocols and data analysis are used to determine the marker concentrations from the assay data.
  • a number of the assays discussed above employ a reagent that specifically binds to the marker.
  • Any molecule that is capable of specifically binding to SCD biomarker is included within the invention.
  • the binding molecules are antibodies or antibody fragments.
  • the binding molecules are non- antibody species, such as aptamers.
  • the binding molecule may be an enzyme for which the marker is a substrate.
  • the binding molecules may recognize any epitope of the targeted marker.
  • the binding molecules may be identified and produced by any method accepted in the art. Methods for identifying and producing antibodies and antibody fragments specific for an analyte are well known. Examples of other methods used to identify the binding molecules include binding assays with random peptide libraries (e.g., phage display) and design methods based on an analysis of the structure of a SCD biomarker.
  • the SCD biomarker of the invention also may be detected or measured using a number of chemical derivatization or reaction techniques known in the art. Reagents for use in such techniques are known in the art, and are commercially available for certain classes of target molecules.
  • chromatographic separation techniques described above also may be coupled to an analytical technique other than mass spectrometry such as fluorescence detection of tagged molecules, NMR, capillary UV, evaporative light scattering or electrochemical detection.
  • the present invention provides a method for determining whether a subject has hepatocellular cancer.
  • the invention provides methods for diagnosing hepatocellular cancer in a subject. These methods comprise obtaining a biological sample from a subject suspected of having hepatocellular cancer, or at risk for developing hepatocellular cancer, detecting the level or activity of one or more biomarkers in the sample, and comparing the result to the level or activity of the marker(s) in a sample obtained from a non-hepatocellular cancer subject, or to a reference range or value.
  • the term "biological sample” includes a sample from any body fluid or tissue (e.g., serum, plasma, blood, cerebrospinal fluid, urine, saliva, hepatocellular cancer tissue).
  • the standard biomarker level or reference range is obtained by measuring the same marker or markers in a set of normal controls. Measurement of the standard biomarker level or reference range need not be made contemporaneously; it may be a historical measurement.
  • the normal control is matched to the patient with respect to some attribute(s) (e.g., age).
  • the patient can be diagnosed as having hepatocellular cancer or as not having hepatocellular cancer.
  • hepatocellular cancer is diagnosed in the patient if the expression level of the biomarker or biomarkers in the patient sample is statistically more similar to the expression level of the biomarker or biomarkers that has been associated with hepatocellular cancer than the expression level of the biomarker or biomarkers that has been associated with the normal controls.
  • hepatocellular cancer may turn out to be a number of related, but distinguishable conditions. Classifications may be made, and these types may be further distinguished into subtypes.
  • HCC heterogeneity may be attributed to lineage-specific tumor subtypes (Lee et al, Nat Med 12, 410-6, 2006; Yamashita et al, Cancer Res, 68, 1451-61 2008; Zaret and Grompe, Science 2008; Yamashita et al, Gastroenterology 2009), some of which retain stem-cell features making them highly aggressive forms of HCC.
  • HCC can develop with the background of hepatitis B viral infection, hepatitis C viral infection, alcohol related disease and fatty liver disease.
  • diabetes is associated with site-specific cancers of the liver, breast, endometrium, bladder, colorectum and pancreas, and increases the risk of all-cancer incidence and mortality.
  • HCC can also develop with the background of diabetes.
  • HCC may be associated with other cancers such as pancreatic cancer, cholangiocarcinoma, angiosarcoma, hepatoblastoma, leukemia, or any metastatic cancer and can develop with the background of such cancers. Any and all of the various forms of hepatocellular cancer are intended to be within the scope of the present invention. Indeed, by providing a method for subsetting patients based on SCD biomarker measurement level, the compositions and methods of the present invention may be used to uncover and define various forms of the disease.
  • the methods of the present invention may be used to make the diagnosis of hepatocellular cancer, independently from other information such as the patient's symptoms or the results of other clinical or paraclinical tests. However, the methods of the present invention may be used in conjunction with such other data points.
  • the method may be used to determine whether a subject is more likely than not to have hepatocellular cancer, or is more likely to have hepatocellular cancer than to have another disease, based on the difference between the measured and standard level or reference range of the SCD biomarker.
  • a patient with a putative diagnosis of hepatocellular cancer may be diagnosed as being "more likely” or “less likely” to have hepatocellular cancer in light of the information provided by a method of the present invention.
  • the biological sample may be of any tissue or fluid, including a serum or tissue sample, but other biological fluids or tissue may be used. Possible biological samples include, but are not limited to, blood, plasma, urine, saliva, and hepatocellular tissue.
  • the level of SCD marker may be compared to the level of another marker or some other component in a different tissue, fluid or biological "compartment.” Thus, a differential comparison may be made of SCD marker in tissue and serum. It is also within the scope of the invention to compare the level of SCD marker with the level of another marker or some other component within the same compartment.
  • the above description is not limited to making an initial diagnosis of hepatocellular cancer, but also is applicable to confirming a provisional diagnosis of hepatocellular cancer or "ruling out” such a diagnosis. Furthermore, an increased or decreased level or activity of the SCD marker in a sample obtained from a subject suspected of having hepatocellular cancer, or at risk for developing hepatocellular cancer, is indicative that the subject has or is at risk for developing hepatocellular cancer.
  • the invention also provides a method for determining a subject's risk of developing hepatocellular cancer, the method comprising obtaining a biological sample from a subject, detecting the level or activity of SCD marker in the sample, and comparing the result to the level or activity of the SCD marker in a sample obtained from a non- hepatocellular cancer subject, or to a reference range or value wherein an increase or decrease of the SCD marker is correlated with the risk of developing hepatocellular cancer.
  • the invention also provides methods for determining the stage or severity of hepatocellular cancer, the method comprising obtaining a biological sample from a subject, detecting the level or activity of SCD marker in the sample, and comparing the result to the level or activity of the SCD marker in a sample obtained from a non- hepatocellular cancer subject, or to a reference range or value wherein an increase or decrease of the SCD marker is correlated with the stage or severity of the disease.
  • the invention also provides methods for monitoring the progression of the disease in a subject who has hepatocellular cancer, the method comprising detecting the level or activity of SCD biomarker in a first biological sample obtained from a subject and comparing the result to the level or activity of the SCD marker in a second sample obtained from the subject at a later time, or to a reference range or value wherein an increase or decrease of the SCD marker is correlated with progression of the disease.
  • Cancer prognosis generally refers to a forecast or prediction of the probable course or outcome of the cancer.
  • cancer prognosis includes the forecast or prediction of any one or more of the following: duration of survival of a patient susceptible to or diagnosed with a cancer, duration of recurrence-free survival, duration of progression free survival of a patient susceptible to or diagnosed with a cancer, response rate in a group of patients susceptible to or diagnosed with a cancer, duration of response in a patient or a group of patients susceptible to or diagnosed with a cancer, and/or likelihood of metastasis in a patient susceptible to or diagnosed with a cancer.
  • cancer prognosis also includes prediction of overall recurrence in tumor tissues, in particular early recurrence, defined as recurrence at or within 24 months post-surgery. This type of early recurrence is associated with metastatic disease rather than de novo tumor formation. SCD expression is not associated with recurrence in nontumor specimens.
  • Measurements can be of (i) a SCD biomarker of the present invention, or a SCD biomarker of the present invention and another factor known to be associated with cancer (e.g., EpCAM, micro-RNA-181 , beta-cateninm YYiAPAl , alpha- fetoprotein (AFP), abdominal ultrasound, helical CT scan and/or triple phase CT scan).
  • the amount of change in a biomarker level may be an indication of the relative likelihood of the presence of cancer.
  • the SCD marker may be detected in any biological sample obtained from the subject, by any suitable method known in the art (e.g., immunoassays, hybridization assay) see supra.
  • the marker is detected in a tumor sample obtained from the patient by surgical procedure(s).
  • the invention also provides methods for monitoring a hepatocellular cancer patient over time to determine whether the disease is progressing.
  • the specific techniques used in implementing this embodiment are similar to those used in the embodiments described above.
  • the method is performed by obtaining a biological sample, such as serum or tissue, from the subject at a certain time (t;); measuring the level of a SCD biomarker in the biological sample; and comparing the measured level with the level measured with respect to a biological sample obtained from the subject at an earlier time (to). Depending upon the difference between the measured levels, it can be seen whether the SCD marker level has increased, decreased, or remained constant over the interval (trto).
  • a further deviation of the SCD marker in the direction indicating hepatocellular cancer, or the measurement of additional increased or decreased hepatocellular cancer markers, would suggest a progression of the disease during the interval.
  • Subsequent sample acquisitions and measurements can be performed as many times as desired over a range of times 3 ⁇ 4 to
  • the ability to monitor a patient by making serial marker level determinations would represent a valuable clinical tool. Rather than the limited "snapshot" provided by a single test, such monitoring would reveal trends in marker levels over time.
  • tracking the marker levels in a patient could be used to predict exacerbations or indicate the clinical course of the disease.
  • the SCD biomarker of the present invention could be further investigated to distinguish between any or all of the known forms of hepatocellular cancer or any later described types or subtypes of the disease.
  • the sensitivity and specificity of any method of the present invention could be further investigated with respect to distinguishing hepatocellular cancer from other diseases or to predict relapse or remission.
  • a chemotherapeutic drug or drug combination can be evaluated or re-evaluated in light of the present invention.
  • the drug(s) can be administered differently to different subject populations, and measurements corresponding to administration can be analyzed to determine if the differences in the SCD biomarker levels before and after drug administration are significant. Results from the different drug regiments can also be compared with each other directly. Alternatively, the assay results may indicate the desirability of one drug regimen over another, or indicate that a specific drug regimen should or should not be administered to a hepatocellular cancer patient.
  • the finding of elevated levels of the SCD marker in a hepatocellular cancer patient is indicative of a poor prognosis for response to treatment with chemotherapeutic agents.
  • the absence of elevated levels of the SCD marker in a hepatocellular cancer patient is indicative of a good prognosis for response to treatment.
  • the SCD marker can be used to assess the efficacy of a therapeutic intervention in a subject.
  • the same approach described above would be used, except a suitable treatment would be started, or an ongoing treatment would be changed, before the second measurement (i.e., after to and before ti).
  • the treatment can be any therapeutic intervention, such as drug administration, dietary restriction or surgery, and can follow any suitable schedule over any time period as appropriate for the intervention.
  • the measurements before and after could then be compared to determine whether or not the treatment had an effect effective.
  • the determination may be confounded by other superimposed processes (e.g., an exacerbation of the disease during the same period).
  • the SCD activity is used as a theragnostic; that is, a specific patient's measured SCD activity can be used to individualize medical treatment for that patient.
  • one embodiment of the invention provides methods for predicting the clinical response of a patient having a tumor or a cancer to an SCD inhibitor.
  • a method of identifying patients that will respond to SCD-inhibiting therapies includes:
  • the presence of elevated SCD activity in the cancer patient's sample indicates that the cancer patient is likely to benefit from a SCD-inhibiting therapy.
  • a reduction in, or loss of, SCD activity in the cancer patient's sample indicates that the cancer patient is unlikely to benefit from a SCD-inhibiting therapy.
  • the cancer patient may have a cancer selected from pancreatic cancer, cholangiocarcinoma, angiosarcoma, hepatoblastoma, leukemia, or any metastatic cancer.
  • the cancer patient has been diagnosed with a hepatocellular cancer, HCC, and particularly the hepatic stem cell-like subtype (HpSC HCC).
  • HCC hepatic stem cell-like subtype
  • Some of the potential benefits the cancer patient may be expected to receive from the SCD inhibiting therapy may include reduction of sternness in the cancer cells in the patient, reduction or elimination of cancer cells from the patient, reduction in the growth of the cancer cells in the patient, reduction of metastases of the cancer cells in the patient, and reduction in the rate of metastasis in the cancer patient.
  • the invention provides a kit for detecting SCD marker of the present invention.
  • the kit may be prepared as an assay system including any one of assay reagents, assay controls, protocols, exemplary assay results, or combinations of these components designed to provide the user with means to evaluate the expression level of the SCD marker of the present invention.
  • the invention provides a kit for diagnosing hepatocellular cancer in a patient including reagents for detecting at least one polypeptide or polynucleotide SCD in a biological sample from a subject.
  • kits of the invention may comprise one or more of the following: an antibody, wherein the antibody specifically binds with SCD marker, a labeled binding partner to the antibody, a solid phase upon which is immobilized the antibody or its binding partner, instructions on how to use the kit, and a label or insert indicating regulatory approval for diagnostic or therapeutic use.
  • the invention further includes microarrays comprising SCD marker, or molecules, such as antibodies, which specifically bind to SCD.
  • standard techniques of microarray technology are utilized to assess expression of the SCD polypeptides and/or identify biological constituents that bind such polypeptides.
  • Protein microarray technology is well known to those of ordinary skill in the art and is based on, but not limited to, obtaining an array of identified peptides or proteins on a fixed substrate, binding target molecules or biological constituents to the peptides, and evaluating such binding.
  • Arrays that bind SCD marker also can be used for diagnostic applications, such as for identifying subjects that have a condition characterized by expression of polypeptide biomarkers, e.g., hepatocellular cancer.
  • the assay system preferably also includes one or more controls.
  • the controls may include: (i) a control sample for detecting sensitivity to a chemotherapeutic agent or agents being evaluated for use in a patient; (ii) a control sample for detecting resistance to the chemotherapeutic(s); (iii) information containing a predetermined control level of SCD marker to be measured with regard to the chemotherapeutic sensitivity or resistance (e.g., a predetermined control level of SCD marker that has been correlated with sensitivity to the chemotherapeutic(s) or resistance to the chemotherapeutic).
  • a means for detecting the expression level of the SCD marker can generally be any type of reagent that can include, but are not limited to, antibodies and antigen binding fragments thereof, peptides, binding partners, aptamers, enzymes, and small molecules. Additional reagents useful for performing an assay using such means for detection can also be included, such as reagents for performing immunohistochemistry or another binding assay.
  • the means for detecting of the assay system of the present invention can be conjugated to a detectable tag or detectable label.
  • a detectable tag can be any suitable tag which allows for detection of the reagents used to detect the SCD marker and includes, but is not limited to, any composition or label detectable by spectroscopic, photochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include: biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DynabeadsTM), fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent
  • radiolabels e.g., H, I, S, C, or P
  • enzymes e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA
  • colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
  • a substrate suitable for immobilization of a means for detecting includes any solid support, such as any solid organic, biopolymer or inorganic support that can form a bond with the means for detecting without significantly affecting the activity and/or ability of the detection means to detect the desired target molecule.
  • exemplary organic solid supports include polymers such as polystyrene, nylon, phenol-formaldehyde resins, and acrylic copolymers (e.g., polyacrylamide).
  • the kit can also include suitable reagents for the detection of the reagent and/or for the labeling of positive or negative controls, wash solutions, dilution buffers and the like.
  • the assay system can also include a set of written instructions for using the system and interpreting the results.
  • the assay system can also include a means for detecting a control marker that is characteristic of the cell type being sampled and can generally be any type of reagent that can be used in a method of detecting the presence of a known marker (at the nucleic acid or protein level) in a sample, such as by a method for detecting the presence of SCD biomarker described previously herein.
  • the means is characterized in that it identifies a specific marker of the cell type being analyzed that positively identifies the cell type. For example, in a hepatocellular tumor assay, it is desirable to screen hepatocellular cancer cells for the level of the SCD biomarker expression and/or biological activity. Therefore, the means for detecting a control marker identifies a marker that is characteristic of a hepatocellular cell, so that the cell is distinguished from other cell types, such as a connective tissue or inflammatory cells. Such a means increases the accuracy and specificity of the assay of the present invention.
  • Such a means for detecting a control marker include, but are not limited to: a probe that hybridizes under stringent hybridization conditions to a nucleic acid molecule encoding a protein marker; PCR primers which amplify such a nucleic acid molecule; an aptamer that specifically binds to a conformationally-distinct site on the target molecule; and/or an antibody, antigen binding fragment thereof, or antigen binding peptide that selectively binds to the control marker in the sample.
  • Nucleic acid and amino acid sequences for many cell markers are known in the art and can be used to produce such reagents for detection.
  • the assay systems and methods of the present invention can be used not only to identify patients that are predicted to survive or be responsive to treatment, but also to identify treatments that can improve the responsiveness of cancer cells which are resistant to treatment, and to develop adjuvant treatments that enhance the response of the treatment and survival.
  • the invention provides therapeutic methods for treating or preventing hepatocellular cancer.
  • the invention further provides methods of treating or preventing or inhibiting the growth and/or metastasis of hepatocellular cancer.
  • the therapeutic methods of the present invention comprise administering a therapeutically effective amount of at least one agent that increases the proportion of SPA as compared to the unsaturated metabolic products of SPA.
  • SPA include MUPA or 15-methylpalmitate.
  • the proportion of SPA may be increased by directly administering
  • SPA (or its chemical and functional analog) to the subject.
  • the proportion of SPA may be increased by administering an agent that is capable of inhibiting the activity or expression of SCD in the subject.
  • Such inhibitory effects can be at the transcriptional level, at the translational level, or at the post-translational level.
  • agent means a chemical or biological molecule such as a simple or complex organic molecule, a peptide, a polypeptide or protein, or a nucleic acid molecule that is able to inhibit the expression or activity of the SCD protein.
  • molecules may be purchased commercially or synthesized using methods known in the art.
  • Suitable organic molecules to be used as agents include any molecules that effectively alter the balance between SPA and its unsaturated metabolic products such as MUPA.
  • examples of such molecules include SPA, as well as any other molecules that are chemical and functional analogs of SPA.
  • Suitable organic molecules to be used as agents further include drugs, synthetic or naturally occurring, that are capable of inhibiting the activity of the SCD enzyme.
  • Many such inhibitors are well known in the art and are encompassed in the present invention. See e.g., Liu G., Stearoyl-CoA desaturase inhibitors: update on patented compounds, Expert Opin. Ther. Patents 19(9): 1169-1191 (2009).
  • Exemplary inhibitors are known in the art and available from diverse pharmaceutical and chemical suppliers (see Liu, G., Stearoyl-CoA desaturase inhibitors: update on patented compounds, Expert Opin. Ther. Patents 19(8):1169-1191 (2009)).
  • the inhibitors are CGX0168 and CGX0290 (available from CompleGene).
  • the agent may be a polypeptide or protein.
  • the protein is an antibody specifically reactive with a SCD protein or polypeptide that is effective for decreasing a biological activity of the SCD protein or polypeptide.
  • immunogens derived from a SCD protein or polypeptide e.g., based on the cDNA sequences
  • anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). Such methods are well known in the art and have also been discussed before in this application.
  • a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the SCD (e.g., SCD protein or polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein).
  • an immunogenic form of the SCD e.g., SCD protein or polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein.
  • Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art.
  • An immunogenic portion of a SCD protein or polypeptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • the subject antibodies are immunospecific for antigenic determinants of a SCD protein or polypeptide of a mammal.
  • anti-SCD antisera can be obtained and, if desired, polyclonal anti-SCD antibodies can be isolated from the serum.
  • polyclonal anti-SCD antibodies can be isolated from the serum.
  • antibody- producing cells lymphocytes
  • myeloma cells can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells.
  • Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a mammalian SCD protein or polypeptide and monoclonal antibodies isolated from a culture comprising such hybridoma cells.
  • an antibody of the invention is a monoclonal antibody, and in certain embodiments the invention makes available methods for generating novel antibodies.
  • a method for generating a monoclonal antibody that binds specifically to a SCD protein or polypeptide may comprise administering to a mouse an amount of an immunogenic composition comprising the SCD protein or polypeptide effective to stimulate a detectable immune response, obtaining antibody- producing cells (e.g., cells from the spleen) from the mouse and fusing the antibody- producing cells with myeloma cells to obtain antibody-producing hybridomas, and testing the antibody-producing hybridomas to identify a hybridoma that produces a monocolonal antibody that binds specifically to the SCD protein or polypeptide.
  • antibody- producing cells e.g., cells from the spleen
  • a hybridoma can be propagated in a cell culture, optionally in culture conditions where the hybridoma-derived cells produce the monoclonal antibody that binds specifically to the SCD protein or polypeptide.
  • the monoclonal antibody may be purified from the cell culture.
  • One characteristic that influences the specificity of an antibody:antigen interaction is the affinity of the antibody for the antigen. Although the desired specificity may be reached with a range of different affinities, generally preferred antibodies will have an affinity (a dissociation constant) of about 10 ⁇ 6 , 10 ⁇ 7 , 10 ⁇ 8 , 10 ⁇ 9 or less.
  • an antibody to be used for certain therapeutic purposes will preferably be able to target a particular cell type. Accordingly, to obtain antibodies of this type, it may be desirable to screen for antibodies that bind to cells that express the antigen of interest (e.g., by fluorescence activated cell sorting). Likewise, if an antibody is to be used for binding an antigen in solution, it may be desirable to test solution binding. A variety of different techniques are available for testing antibody:antigen interactions to identify particularly desirable antibodies.
  • Such techniques include ELISAs, surface plasmon resonance binding assays (e.g., the Biacore binding assay, Bia-core AB, Uppsala, Sweden), sandwich assays (e.g., the paramagnetic bead system of IGEN International, Inc., Gaithersburg, Md.), western blots, immunoprecipitation assays and immunohistochemistry.
  • the agent may be a nucleic acid molecule.
  • the nucleic acid molecule may be RNAi, ribozyme, antisense, DNA enzyme or other nucleic acid-related compositions for manipulating (typically decreasing) SCD expression or activity.
  • RNAi RNA interference
  • RNAi is a process of sequence-specific post-transcriptional gene repression which can occur in eukaryotic cells. In general, this process involves degradation of an mRNA of a particular sequence induced by double-stranded RNA (dsRNA) that is homologous to that sequence. Any selected gene may be repressed by introducing a dsRNA which corresponds to all or a substantial part of the mRNA for that gene.
  • dsRNA double-stranded RNA
  • RNAi may be effected by introduction or expression of relatively short homologous dsRNAs.
  • Two types of small RNA molecules - microRNA (miRNA) and small interfering RNA (siRNA) - are central to RNA interference.
  • the double stranded oligonucleotides used to effect R Ai are preferably less than 30 base pairs in length and, more preferably, comprise about 25, 24, 23, 22, 21, 20, 19, 18 or 17 base pairs of ribonucleic acid.
  • the dsRNA oligonucleotides of the invention may include 3' overhang ends.
  • Exemplary 2-nucleotide 3' overhangs may be composed of ribonucleotide residues of any type and may even be composed of 2'- deoxythymidine resides, which lowers the cost of RNA synthesis and may enhance nuclease resistance of siRNAs in the cell culture medium and within transfected cells (see Elbashi et al. (2001) Nature 411 : 494-8). Longer dsRNAs of 50, 75, 100 or even 500 base pairs or more may also be utilized in certain embodiments of the invention.
  • Exemplary concentrations of dsRNAs for effecting RNAi are about 0.05 nM, 0.1 nM, 0.5 nM, 1.0 nM, 1.5 nM, 25 nM or 100 nM, although other concentrations may be utilized depending upon the nature of the cells treated, the gene target and other factors readily discernable the skilled artisan.
  • Exemplary dsRNAs may be synthesized chemically or produced in vitro or in vivo using appropriate expression vectors.
  • Exemplary synthetic RNAs include 21 nucleotide RNAs chemically synthesized using methods known in the art (e.g. Expedite RNA phophoramidites and thymidine phosphoramidite (Proligo, Germany).
  • Synthetic oligonucleotides are preferably deprotected and gel-purified using methods known in the art (see e.g. Elbashir et al. (2001) Genes Dev. 15: 188-200). Longer RNAs may be transcribed from promoters, such as T7 RNA polymerase promoters, known in the art. A single RNA target, placed in both possible orientations downstream of an in vitro promoter, will transcribe both strands of the target to create a dsRNA oligonucleotide of the desired target sequence.
  • RNA species will be designed to include a portion of nucleic acid sequence represented in a SCD gene, such as, for example, a nucleic acid that hybridizes, under stringent and/or physiological conditions, to SCD gene and a complement thereof.
  • the specific sequence utilized in design of the oligonucleotides may be any contiguous sequence of nucleotides contained within the expressed gene message of the target. Programs and algorithms, known in the art, may be used to select appropriate target sequences. In addition, optimal sequences may be selected utilizing programs designed to predict the secondary structure of a specified single stranded nucleic acid sequence and allowing selection of those sequences likely to occur in exposed single stranded regions of a folded mRNA. Methods and compositions for designing appropriate oligonucleotides may be found, for example, in U.S. Pat. No. 6,251,588, the contents of which are incorporated herein by reference.
  • RNA messenger RNA
  • mRNA messenger RNA
  • Secondary structure elements in RNA are formed largely by Watson-Crick type interactions between different regions of the same RNA molecule.
  • Important secondary structural elements include intramolecular double stranded regions, hairpin loops, bulges in duplex RNA and internal loops.
  • Tertiary structural elements are formed when secondary structural elements come in contact with each other or with single stranded regions to produce a more complex three dimensional structure.
  • RNA duplex structures A number of researchers have measured the binding energies of a large number of RNA duplex structures and have derived a set of rules which can be used to predict the secondary structure of RNA (see e.g. Jaeger et al. (1989) Proc. Natl. Acad. Sci. USA 86:7706 (1989); and Turner et al. (1988) Annu. Rev. Biophys. Biophys. Chem. 17: 167).
  • the rules are useful in identification of RNA structural elements and, in particular, for identifying single stranded RNA regions which may represent preferred segments of the mRNA to target for silencing RNAi, ribozyme or antisense technologies. Accordingly, preferred segments of the mRNA target can be identified for design of the RNAi mediating dsRNA oligonucleotides as well as for design of appropriate ribozyme and hammerhead ribozyme compositions of the invention.
  • the dsRNA oligonucleotides may be introduced into the cell by transfection with an heterologous target gene using carrier compositions such as liposomes, which are known in the art ⁇ e.g. Lipofectamine 2000 (Life Technologies) as described by the manufacturer for adherent cell lines.
  • Transfection of dsRNA oligonucleotides for targeting endogenous genes may be carried out using Oligofectamine (Life Technologies). Transfection efficiency may be checked using fluorescence microscopy for mammalian cell lines after co-transfection of hGFP-encoding pAD3 (Kehlenback et al. (1998) J Cell Biol 141 : 863-74).
  • RNAi may be assessed by any of a number of assays following introduction of the dsRNAs. These include Western blot analysis using antibodies which recognize the SCD gene product following sufficient time for turnover of the endogenous pool after new protein synthesis is repressed, reverse transcriptase polymerase chain reaction and Northern blot analysis to determine the level of existing SCD target mRNA. Further compositions, methods and applications of RNAi technology are provided in U.S. patent application Nos. 6,278,039, 5,723,750 and 5,244,805, which are incorporated herein by reference.
  • Ribozyme molecules designed to catalytically cleave SCD mRNA transcripts can also be used to prevent translation of subject SCD mRNAs and/or expression of SCD (see, e.g., PCT International Publication WO90/11364, published Oct. 4, 1990; Sarver et al. (1990) Science 247: 1222-1225 and U.S. Pat. No. 5,093,246). Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. (For a review, see Rossi (1994) Current Biology 4: 469-471).
  • the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage event.
  • the composition of ribozyme molecules preferably includes one or more sequences complementary to a SCD mRNA, and the well known catalytic sequence responsible for mRNA cleavage or a functionally equivalent sequence (see, e.g., U.S. Pat. No. 5,093,246, which is incorporated herein by reference in its entirety).
  • hammerhead ribozymes can also be used to destroy target mRNAs.
  • Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA.
  • the target mRNA has the following sequence of two bases: 5'-UG-3'.
  • the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach ((1988) Nature 334:585-591; and see PCT Appln. No. WO89/05852, the contents of which are incorporated herein by reference).
  • RNA polymerase HI-mediated expression of tRNA fusion ribozymes are well known in the art (see Kawasaki et al.
  • ribozyme cleavage sites within a given target cDNA sequence.
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the target mRNA— to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
  • the use of any cleavage recognition site located in the target sequence encoding different portions of the C-terminal amino acid domains of, for example, long and short forms of target would allow the selective targeting of one or the other form of the target, and thus, have a selective effect on one form of the target gene product.
  • Gene targeting ribozymes necessarily contain a hybridizing region complementary to two regions, each of at least 5 and preferably each 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides in length of a SCD mRNA.
  • ribozymes possess highly specific endoribonuclease activity, which autocatalytically cleaves the target sense mRNA.
  • the present invention extends to ribozymes which hybridize to a sense mRNA encoding a SCD gene thereby hybridising to the sense mRNA and cleaving it, such that it is no longer capable of being translated to synthesize a functional polypeptide product.
  • Ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.) and should be delivered to cells which express the target gene in vivo.
  • a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous target messages and inhibit translation. Because ribozymes, unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • a further aspect of the invention relates to the use of the isolated "antisense" nucleic acids to inhibit expression, e.g., by inhibiting transcription and/or translation of a subject SCD nucleic acid.
  • the antisense nucleic acids may bind to the potential drug target by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix. In general, these methods refer to the range of techniques generally employed in the art, and include any methods that rely on specific binding to oligonucleotide sequences.
  • An antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a SCD polypeptide.
  • the antisense construct is an oligonucleotide probe, which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a SCD nucleic acid.
  • oligonucleotide probes are preferably modified oligonucleotides, which are resistant to endogenous nucleases, e.g., exonucleases and/or endonucleases, and are therefore stable in vivo.
  • Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Pat. Nos. 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) BioTechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659- 2668.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to mRNA encoding the SCD polypeptide.
  • the antisense oligonucleotides will bind to the mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required.
  • Absolute complementarity although preferred, is not required.
  • a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid.
  • the longer the hybridizing nucleic acid the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the mRNA should work most efficiently at inhibiting translation.
  • sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well. (Wagner, R. 1994. Nature 372:333). Therefore, oligonucleotides complementary to either the 5' or 3' untranslated, non-coding regions of a gene could be used in an antisense approach to inhibit translation of that mRNA.
  • Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could also be used in accordance with the invention. Whether designed to hybridize to the
  • antisense nucleic acids should be at least six nucleotides in length, and are preferably less that about 100 and more preferably less than about 50, 25, 17 or 10 nucleotides in length.
  • the antisense oligonucleotides can be DNA or R A or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors), or compounds facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al, 1987, Proc.
  • oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization- triggered cleavage agent, etc.
  • the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxytiethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannos
  • the antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • the antisense oligonucleotide can also contain a neutral peptide-like backbone.
  • Such molecules are termed peptide nucleic acid (PNA)-oligomers and are described, e.g., in Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93: 14670 and in Eglom et al. (1993) Nature 365:566.
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • a further aspect of the invention relates to the use of DNA enzymes to inhibit expression of SCD gene.
  • DNA enzymes incorporate some of the mechanistic features of both antisense and ribozyme technologies. DNA enzymes are designed so that they recognize a particular target nucleic acid sequence, much like an antisense oligonucleotide, however much like a ribozyme they are catalytic and specifically cleave the target nucleic acid. There are currently two basic types of DNA enzymes, and both of these were identified by Santoro and Joyce (see, for example, U.S. Pat. No. 6,110,462). The 10-23 DNA enzyme comprises a loop structure which connect two arms.
  • the two arms provide specificity by recognizing the particular target nucleic acid sequence while the loop structure provides catalytic function under physiological conditions.
  • the unique or substantially sequence is a G/C rich of approximately 18 to 22 nucleotides. High G/C content helps insure a stronger interaction between the DNA enzyme and the target sequence.
  • DNA enzymes can be found, for example, in U.S. Pat. No. 6,110,462.
  • methods of delivery of DNA ribozymes in vitro or in vivo include methods of delivery of RNA ribozyme, as outlined in detail above.
  • DNA enzymes can be optionally modified to improve stability and improve resistance to degradation.
  • Antisense RNA and DNA, ribozyme, RNAi constructs of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules, including techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis.
  • RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule.
  • DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • various well-known modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half- life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
  • the agent is an aptamer.
  • aptamers are nucleic acid or peptide molecules that bind to a specific target molecule. Aptamers can inhibit the activity of the target molecule by binding to it. Aptamers can also be used as delivery agents for therapeutic cargo.
  • therapeutically-effective amount of an agent of this invention means an amount effective to inhibit or lessen the formation or progression of heptocellular cancer or to prevent metastasis of the cancer following administration to a subject having the cancer. Such amounts typically comprise from about 0.1 to about 100 mg of the compound per kilogram of body weight of the subject to which the composition is administered. Therapeutically effective amounts can be administered according to any dosing regimen satisfactory to those of ordinary skill in the art.
  • the agent is administered to the subject in a pharmaceutical composition.
  • pharmaceutical compositions containing agents of the invention and a pharmaceutically-acceptable carrier, which are generally accepted in the art for the delivery of biologically active agents to animals, in particular, mammals.
  • pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio.
  • the agent may be administered in the form of a pharmaceutically acceptable salts or prodrugs.
  • the "Pharmaceutically-acceptable salts” refer to derivatives of the disclosed agents or compounds wherein the agent or parent compound is modified by making acid or base salts thereof.
  • pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, or alkali or organic salts of acidic residues such as carboxylic acids.
  • Pharmaceutically-acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
  • Such conventional nontoxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
  • Pharmaceutically acceptable salts are those forms of agents, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • salt forms may be synthesized from the agents which contain a basic or acidic moiety by conventional chemical methods.
  • such salts are, for example, prepared by reacting the free acid or base forms of these agents with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in at page 1418 of Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985.
  • Prodrugs are intended to include any covalently bonded carriers that release an active parent drug or agent of the present invention in vivo when such prodrug is administered to a mammalian subject. Since prodrugs are known to enhance numerous desirable qualities of pharmaceuticals (i.e., solubility, bioavailability, half life, manufacturing, etc.) the agents of the present invention may be delivered in prodrug form. Thus, the present invention is intended to cover prodrugs of the presently claimed compounds, methods of delivering the same, and compositions containing the same. Prodrugs of the present invention are prepared by modifying functional groups present in the agent in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to an active agent.
  • Prodrugs include agents of the present invention wherein an acyl, hydroxy, amino, or sulfhydryl group is bonded to any group that, when the prodrug of the present invention is administered to a mammalian subject, is cleaved to form a free acetyl, hydroxyl, free amino, or free sulfydryl group, respectively.
  • Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohol and amine functional groups in the agents of the present invention.
  • agents having a chiral center may exist in, and may be isolated in, optically active and racemic forms.
  • agent encompasses any racemic, optically-active, regioisomeric or stereoisomeric form, or mixtures thereof, which possess the therapeutically useful properties described herein. It is well known in the art how to prepare optically active forms (for example, by resolution of the racemic form by recrystallization techniques, by synthesis from optically-active starting materials, by chiral synthesis, or by chromatographic separation using a chiral stationary phase).
  • the scope of this invention encompasses not only the various isomers, which may exist but also the various mixtures of isomers, which may be formed.
  • the compound of the present invention contains one or more chiral centers, the compound can be synthesized enantioselectively or a mixture of enantiomers and/or diastereomers can be prepared and separated.
  • the resolution of the compounds of the present invention, their starting materials and/or the intermediates may be carried out by known procedures, e.g., as described in the four volume compendium Optical Resolution Procedures for Chemical Compounds: Optical Resolution Information Center, Manhattan College, Riverdale, N.Y., and in Enantiomers, Racemates and Resolutions, Jean Jacques, Andre Collet and Samuel H. Wilen; John Wiley & Sons, Inc., New York, 1981, which is incorporated in its entirety by this reference.
  • the resolution of the agents is based on the differences in the physical properties of diastereomers by attachment, either chemically or enzymatically, of an enantiomerically pure moiety resulting in forms that are separable by fractional crystallization, distillation or chromatography.
  • agents including the salts and prodrugs of these agents, of the present invention may be purchased commercially or may also be prepared in ways well known to those skilled in the art of organic synthesis. It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule must be compatible with the reagents and reactions proposed. Such restrictions to the substituents, which are compatible with the reaction conditions, will be readily apparent to one skilled in the art and alternate methods must then be used.
  • Pharmaceutically-acceptable carriers are formulated according to a number of factors well within the purview of those of ordinary skill in the art to determine and accommodate. These include, without limitation: the type and nature of the agent; the subject to which the agent-containing composition is to be administered; the intended route of administration of the composition; and, the therapeutic indication being targeted. Pharmaceutically-acceptable carriers include both aqueous and non-aqueous liquid media, as well as a variety of solid and semi-solid dosage forms. Such carriers can include a number of different ingredients and additives in addition to the active agent, such additional ingredients being included in the formulation for a variety of reasons, e.g., stabilization of the active agent, well known to those of ordinary skill in the art. Descriptions of suitable pharmaceutically-acceptable carriers, and factors involved in their selection, are found in a variety of readily available sources, such as Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985.
  • compositions suitable for parenteral administration include various aqueous media such as aqueous dextrose and saline solutions; glycol solutions are also useful carriers, and preferably contain a water soluble salt of the active agent, suitable stabilizing compounds, and if necessary, buffering compunds.
  • Antioxidizing compunds such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or in combination, are suitable stabilizing compunds; also used are citric acid and its salts, and EDTA.
  • parenteral solutions can contain preservatives such as benzalkonium chloride, methyl- or propylparaben, and chlorobutanol.
  • compositions may be administered orally in solid dosage forms, such as capsules, tablets and powders; or in liquid forms such as elixirs, syrups, and/or suspensions.
  • Gelatin capsules can be used to contain the active ingredient and a suitable carrier such as, but not limited to, lactose, starch, magnesium stearate, stearic acid, or cellulose derivatives. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of time.
  • Compressed tablets can be sugar- coated or film-coated to mask any unpleasant taste, or used to protect the active ingredients from the atmosphere, or to allow selective disintegration of the tablet in the gastrointestinal tract.
  • a preferred formulation of the invention is a mono-phasic pharmaceutical composition suitable for parenteral or oral administration for the prevention, treatment or prophylaxis of hepatocellular cancer, consisting essentially of a therapeutically-effective amount of an agent of the invention, and a pharmaceutically acceptable carrier.
  • Another preferred formulation of the invention is a mono-phasic pharmaceutical composition suitable for the prevention, treatment or prophylaxis of hepatocellular cancer, consisting essentially of a therapeutically-effective amount of a prodrug of an agent of the invention, and a pharmaceutically acceptable carrier.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • compositions may also contain adjuvants such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like in the compositions.
  • isotonic agents such as sugars, sodium chloride, and the like in the compositions.
  • prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monosterate and gelatin.
  • the absorption of the agent in order to prolong the effect of a agent, it is desirable to slow the absorption of the agent from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the agent then depends upon its rate of dissolution, which in turn may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered agent is accomplished by dissolving or suspending the agent in an oil vehicle.
  • Injectable depot forms are made by forming microencapsulated matrices of the agent in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of agent to polymer, and the nature of the particular polymer employed, the rate of agent release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the agent in liposomes or microemulsions which are compatible with body tissue. The injectable materials can be sterilized for example, by filtration through a bacterial-retaining filter.
  • the principal active ingredient is mixed with a pharmaceutical excipient to form a solid preformulation composition containing a homogeneous mixture of an agent of the present invention.
  • a solid preformulation composition containing a homogeneous mixture of an agent of the present invention.
  • the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
  • This solid preformulation is then subdivided into unit dosage forms of the type described above containing from, for example, 0.1 to about 500 mg of the therapeutic compounds of the present invention.
  • Formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, powders, granules or as a solution or a suspension in an aqueous or non-aqueous liquid, or an oil-in-water or water-in-oil liquid emulsions, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia), and the like, each containing a predetermined amount of an agent of the present invention as an active ingredient.
  • An agent or agents of the present invention may also be administered as bolus, electuary or paste.
  • the active ingredient is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia;
  • pharmaceutically acceptable carriers such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia;
  • humectants such as glycerol
  • disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate
  • solution retarding agents such as paraffin
  • absorption accelerators such as quaternary ammonium compounds
  • wetting agents such as, for example, cetyl alcohol and glycerol monosterate
  • absorbents such as kaolin and bentonite clay
  • lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof
  • coloring agents such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof.
  • compositions may also comprise buffering agents.
  • Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
  • a tablet may be made by compression or molding optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent.
  • Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets, and other solid dosage forms of the pharmaceutical compositions may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter.
  • compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner.
  • opacifying agents include polymeric substances and waxes.
  • the active ingredient can also be in microencapsulated form.
  • the tablets or pills may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action.
  • the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former.
  • the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release.
  • enteric layers or coatings such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
  • Liquid dosage forms for oral administration of the agents include pharmaceutically-acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.
  • the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • the oral compositions can also include adjuvants such as wetting agents, emuls, emuls, solutions, suspensions, syrups
  • Suspensions in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • Formulations of the pharmaceutical compositions for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds of the invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
  • suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
  • Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
  • Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants.
  • the active ingredient may be mixed under sterile conditions with a pharmaceutically- acceptable carrier, and with any buffers, or propellants which may be required.
  • the ointments, pastes, creams and gels may contain, in addition to an active ingredient, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • Powders and sprays can contain, in addition to an active ingredient, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder or mixtures of these substances.
  • Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
  • Transdermal patches have the added advantage of providing controlled delivery of compounds of the invention to the body.
  • dosage forms can be made by dissolving, dispersing or otherwise incorporating one or more agents in a proper medium, such as an elastomeric matrix material.
  • Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by either providing a rate- controlling membrane or dispersing the compound in a polymer matrix or gel.
  • the composition may take the form of a dry powder, for example, a powder mix of one or more of the agents and a suitable powder base, such as lactose or starch.
  • the powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatin or blister packs from which the powder may be administered with the aid of an inhalator, insufflator or a metered-dose inhaler.
  • compounds of the invention may be administered by means of nose drops or a liquid spray, such as by means of a plastic bottle atomizer or metered-dose inhaler.
  • Typical of atomizers are the Mistometer (Wintrop) and Medihaler
  • Drops such as eye drops or nose drops, may be formulated with an aqueous or nonaqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents.
  • Liquid sprays are conveniently delivered from pressurized packs. Drops can be delivered by means of a simple eye dropper-capped bottle or by means of a plastic bottle adapted to deliver liquid contents dropwise by means of a specially shaped closure.
  • the formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampules and vials, and may be stored in a lyophilized condition requiring only the addition of the sterile liquid carrier, for example water for injection, immediately prior to use.
  • sterile liquid carrier for example water for injection
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above.
  • the dosage formulations provided by this invention may contain the therapeutic compounds of the invention, either alone or in combination with other therapeutically active ingredients, and pharmaceutically acceptable inert excipients.
  • the dosage formulations may contain one or more of antioxidants, chelating agents, diluents, binders, lubricants/glidants, disintegrants, coloring agents and release modifying polymers.
  • Suitable antioxidants may be selected from amongst one or more pharmaceutically acceptable antioxidants known in the art.
  • pharmaceutically acceptable antioxidants include butylated hydroxyanisole (BHA), sodium ascorbate, butylated hydroxytoluene (BHT), sodium sulfite, citric acid, malic acid and ascorbic acid.
  • BHA butylated hydroxyanisole
  • BHT butylated hydroxytoluene
  • the antioxidants may be present in the dosage formulations of the present invention at a concentration between about 0.001% to about 5%, by weight, of the dosage formulation.
  • Suitable diluents such as lactose, sugar, cornstarch, modified cornstarch, mannitol, sorbitol, and/or cellulose derivatives such as wood cellulose and microcrystalline cellulose, typically in an amount within the range of from about 20% to about 80%, by weight.
  • binders examples include methyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinyl pyrrolidone, eudragits, ethyl cellulose, gelatin, gum arabic, polyvinyl alcohol, pullulan, carbomer, pregelatinized starch, agar, tragacanth, sodium alginate, microcrystalline cellulose and the like.
  • suitable disintegrants include sodium starch glycolate, croscarmellose sodium, crospovidone, low substituted hydroxypropyl cellulose, and the like. The concentration may vary from 0.1% to 15%, by weight, of the dosage form.
  • lubricants/glidants examples include colloidal silicon dioxide, stearic acid, magnesium stearate, calcium stearate, talc, hydrogenated castor oil, sucrose esters of fatty acid, microcrystalline wax, yellow beeswax, white beeswax, and the like.
  • concentration may vary from 0.1% to 15%, by weight, of the dosage form.
  • Release modifying polymers may be used to form extended release formulations containing the therapeutic compounds of the invention.
  • the release modifying polymers may be either water-soluble polymers, or water insoluble polymers.
  • water-soluble polymers include polyvinylpyrrolidone, hydroxy propylcellulose, hydroxypropyl methylcellulose, vinyl acetate copolymers, polyethylene oxide, polysaccharides (such as alginate, xanthan gum, etc.), methylcellulose and mixtures thereof.
  • water- insoluble polymers include acrylates such as methacrylates, acrylic acid copolymers; cellulose derivatives such as ethylcellulose or cellulose acetate; polyethylene, and high molecular weight polyvinyl alcohols.
  • the therapeutic methods of the present invention may be combined with other anti-cancer therapies.
  • anti-cancer therapies include traditional cancer treatments such as surgery, radiation therapy and chemotherapy, as well as other new treatments.
  • Such other anti-cancer therapies will be expected to act in an additive or synergistic manner with the disclosed SCD-targeted therapeutics. This may result in better control of the cancer as well as reducing the need for high dosages and reducing any dose related harmful side effects.
  • doxrubincin; and sorafinib have been shown to have anti-cancer activities.
  • Another embodiment of the invention relates to the use of any of the compositions of the invention in the preparation of a medicament for the inhibition of the growth or metastasis of hepatocellular cancer in a subject.
  • Example 1 This Example shows that the SCD-1 levels are elevated in HCC stem cells.
  • Hepatic tissues were obtained with informed consent from patients who underwent radical resection between 2002 and 2003 at the Liver Cancer Institute and Zhongshan Hospital (Fudan University, Shanghai, China). The study was approved by the Institutional Review Board of the Liver Cancer Institute and NIH. Gene expression profiles were conducted in primary HCC and corresponding non-cancerous hepatic fresh frozen tissues from 247 Chinese HCC patients. Among them, thirty were defined as hepatic stem cell (HpSC) HCC tissue specimens (15 tumor and 15 paired nontumor) and thirty were defined as mature hepatocyte (MH) HCC specimens (15 tumor and 15 paired nontumor).
  • HpSC hepatic stem cell
  • MH mature hepatocyte
  • RNA array analysis of SCD gene expression in HpSC or MH tumor or nontumor tissues was performed. RNA isolation was done using the methods previously known (Sreekumar, A. et al. Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression. Nature 457, 910-914 (2009); Akavia,U.D. et al. An integrated approach to uncover drivers of cancer. Cell 143, 1005-1017 (2010)). Probes for stem or mature hepatocyte SCD genes were purchased from ABI and qRT-PCR assays were performed on an ABI-Prism 770 Sequence Detector System (Applied Biosystems).
  • Figure 1 shows the results of the analysis. Data is presented as the mean SD, and the statistical significance is calculated from the Student's t-test. As shown in Fig. 1, SCD expression is elevated in HpSC tumors vs. non- tumors. Additionally, SCD gene expression is significantly higher in HpSC tumors vs. MH tumors.
  • Example 2 This Example shows that the SCD-1 levels are associated with patient survival.
  • SCD-1 levels were measured in 247 cases by transcriptomics (i.e. microarray,
  • Survival Risk Prediction analysis was performed to compare patient survival based on prediction results.
  • a Kaplan-Meier overall survival analysis curve was constructed for high and low risk survival groups with the log rank p value based on SCD gene expression categorized as high or low according to its median expression among tumor or nontumor specimens.
  • PrismGraph 5.0 software was used to generate Kaplan Meier plots with the log rank p-value shown. The statistical p-value was generated by the Cox-Mantel log-rank test.
  • the Survival Risk Prediction analysis was performed using BRB Array Tools, software V4.1.0.
  • Example 3 This Example shows that the SCD expression is correlated with the expression of SPA products.
  • SCD expression values or metabolite expression values were determined in 60 patient samples representing patients with either the HpSC or MH subtype (i.e. good vs poor survival) by transcriptomics or metabolomics.
  • the correlation of these values (SCD vs SPA products) were correlated in tumor tissues using statistical software in GraphPad Prism. The data is presented with the correlation coefficient (Spearman r value) and a statistical p-value (Fig. 4).
  • Example 4 shows that inhibition of SCD and/or addition of saturated palmitic acid (SPA) reduces the activation of Akt in stem- like HCC cells.
  • SPA saturated palmitic acid
  • Huh7 and Huhl cells stem-like HCC cell lines composed of a mixture of EpCAM+ AFP+ HCC cells with stem cell features and differentiated EpCAM- AFP- HCC cells, were treated with DMSO, MUPA (purchased from Cayman Chemical) at a cone, of ⁇ , SPA (purchased from Cayman Chemical) at a cone, of ⁇ , CGX0168 (a specific inhibitor of SCD-specific inhibitor a generous gift from CompleGen) at a cone, of ⁇ , SPA and CGX0168, MUPA and CGX0168, or TCN at a cone, of 5 ⁇ (Tribicine, a known allosteric inhibitor of Akt phosphorylation, purchased from Cayman Chemical) for 3 days. Cells were harvested and lysates were probed for expression of p473-Akt or pan-Akt.
  • Results are shown in Fig. 5.
  • the left panel shows Western blots in which the phosphorylated form of Akt was detected by using an antibody specific to the S473 phosphorylation site of Akt (purchased from Cell Signaling). Quantitation of the Western blots are shown in the right panel. Data is presented as the mean ⁇ SD of triplicate experiments and the statistical significance is calculated with an un-paired Student's t-test.
  • Treatment of Huh7 or Huhl cells with either SPA or CGX0168 reduced the phosphorylation status of Akt at serine 473 (Fig. 5, lane 3 and 4 respectively). A more pronounced effect was observed when SPA and CGX0168 were combined (Fig. 5, lane 6). However, this reduction in activity of Akt was alleviated in the presence of MUPA (Fig. 5, lane 5).
  • Example 5 This example shows that inhibiting SCD and altering the balance of SPA to
  • MUPA reduces the characteristics of sternness of HpSC HCC cells.
  • Huh7 cells were treated with DMSO, MUPA, SPA (Calbiochem), CGX0168,
  • MUPA and CGX0168 or SPA and CGX0168 in boyden chambers.
  • Cells were incubated for 22 hrs and those migrating and invading were quantified. The results are shown in Fig. 6.
  • Upper panels show the representative images obtained after each treatment.
  • the lower panels show the quantification data presented as the % values seen in the control.
  • SCD inhibitor reduced cell invasion even further.
  • the decrease in cell invasion observed with SCD inhibitor was rescued with the addition of MUPA. This suggests that elevating the levels of SPA and/or inhibiting the activity of SCD can reduce the stem like properties of HCC cells.
  • Example 6 This example shows that SCD expression is associated with poor patient survival and recurrence.
  • Fig. 8 The Kaplan-Meier overall survival curves shown in Fig. 8 demonstrate that SCD-1 expression is significantly associated with patient survival in the LCI and LEC cohorts.
  • Fig. 8 A and B show Kaplan-Meier overall survival analysis curves for high and low risk survival groups with the log rank p value based on SCD gene expression categorized as high or low according to its median expression among tumor specimens, in the LCI cohort (Fig. 8A) and LEC cohort (Fig. 8B).
  • Fig. 8C and 8D show Kaplan-Meier disease-free survival analysis curves for high and low risk survival groups in the LCI cohort (Fig. 8C) and LEC cohort (Fig. 8D).
  • Fig. 8E and 8F show Kaplan- Meier analysis curves for early recurrence (recurrence at or before 24 months post- surgery) for high and low risk survival groups in the LCI cohort (Fig. 8E) or LEC cohort (Fig. 8F).
  • Fig. 8G shows Kaplan- Meier curves showing overall survival of the LCI cohort subgrouped by the SCD predictor and AFP. Disc refers to discordant risk assessments.
  • Example 7 This example shows that inhibition of SCD reduces HCC cell migration, cell invasion and the capcity to form cell colonies.
  • FIG. 9A shows endogenous SCD expression in Huhl, Huh7, HepG2, Hep3B, MHCC97 or SK-Hepl cells. Based on this information, two cell lines with measurable endogenous SCD expression, Huh7 and HepG2, were chosen for further experiments.
  • Both cell lines were treated with the anti-diabetic drug Metformin (0-20mM) for 48hr to inhibit endogenous SCD-1 expression.
  • Cells were harvested and lysates were probed for SCD, AMPK-P, AMPK or actin.
  • AMPK is a known target of Metformin and serves as a positive control for Metformin activity.
  • Fig. 9B treatment with Metformin inhibited SCD expression in both cells lines, HepG2 (left panel) and Huh7 (right panel).
  • Huh7or HepG2 cells were also treated with 0-20 pmol siR A specific to SCD for 48 hours or 72 hours.
  • the siRNA (purchased from Qiagen, Valencia, CA) specifically targeted the SCD mRNA sequence AGGGCAGACAATAGTATAGAA (SEQ ID NO: l). Cells were harvested and lysates were probed for SCD and actin. Treatment with SCD siRNA effectively reduced SCD-1 expression. See Fig. 9C, treatment with 48 hr (top panel) or 72hr (bottom panel).
  • HCC cells Huh7 or HepG2 cells were treated with lOOuM MUPA for 3 days or Metformin (lOmM) for 2 days or in combination. Cells were incubated for 22 hrs in boyden chambers and those migrating and invading were quantified. Results are shown in Fig. 10A. Representative images are shown on the left with corresponding quantitation on the right. Data is presented as the mean ⁇ SD of triplicate experiments. Addition of Metformin reduced cell migration and invasion. Treatment with MUPA alone increased cell migration and invasion, which was reduced when cells were additionally treated with Metformin.
  • Huh7 cells were treated with lOOuM MUPA for 3 days or Metformin (lOmM) for 2 days or in combination. After 14 days, the number of cell colonies was quantified. Results are shown in Fig. 10B. Representative images are shown on the bottom with corresponding quantitation on the top. Data is presented as the mean ⁇ SD of triplicate experiments. Treatment with Metformin effectively reduced the number of colonies.
  • Fig. IOC shows a model depicting the role of SCD and it's downstream metabolites in HCC. As shown, conversion of SPA to MUPA by SCD leads to poor HCC outcome. However, this can be prevented by inhibition of SCD expression by treatment with Metformin or siRNA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Cette invention concerne un biomarqueur du cancer hépatocellulaire (HCC), en particulier, du sous-type HpSC du HCC ayant la nature des cellules souches, et des méthodes d'utilisation dudit biomarqueur, comprenant des méthodes pour traiter ou prévenir le cancer, pour diagnostiquer le cancer, des méthodes pour déterminer la prédisposition au cancer, des méthodes pour surveiller l'évolution/la régression du cancer, des méthodes pour évaluer l'efficacité des compositions destinées à traiter le cancer, ainsi que d'autres méthodes basées sur l'utilisation de ce biomarqueur du cancer.
PCT/US2012/054607 2011-09-12 2012-09-11 Biomarqueurs et cibles thérapeutiques du cancer hépatocellulaire WO2013039880A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161533392P 2011-09-12 2011-09-12
US61/533,392 2011-09-12

Publications (1)

Publication Number Publication Date
WO2013039880A1 true WO2013039880A1 (fr) 2013-03-21

Family

ID=46881174

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/054607 WO2013039880A1 (fr) 2011-09-12 2012-09-11 Biomarqueurs et cibles thérapeutiques du cancer hépatocellulaire

Country Status (1)

Country Link
WO (1) WO2013039880A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024112438A1 (fr) * 2022-11-21 2024-05-30 The Regents Of The University Of California Alpha fétoprotéine liée à un acide gras polyinsaturé favorisant la suppression de l'immunité par modification du métabolisme des cellules dendritiques humaines

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988009810A1 (fr) 1987-06-11 1988-12-15 Synthetic Genetics Nouveaux conjugues d'acide nucleique amphiphile
WO1989005852A1 (fr) 1987-12-15 1989-06-29 Macphillamy Cummins & Gibson Ribozymes
WO1989010134A1 (fr) 1988-04-25 1989-11-02 The Regents Of The University Of California Peptides chimeriques d'administration de neuropeptides a travers la barriere vasculaire du cerveau
WO1990011364A1 (fr) 1989-03-24 1990-10-04 University Patents, Inc. Procede et endoribonucleases de restriction de ribozymes d'arn
US5093246A (en) 1986-12-03 1992-03-03 University Patents, Inc. Rna ribozyme polymerases, dephosphorylases, restriction endoribo-nucleases and methods
US5176996A (en) 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
US5244805A (en) 1989-05-17 1993-09-14 University Of Georgia Research Foundation, Inc. Baculovirus expression vectors
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5723750A (en) 1995-01-12 1998-03-03 Vanderbilt University Transgenic plants expressing disassembly deficient viral coat proteins
US6110462A (en) 1999-03-03 2000-08-29 The Scripps Research Institute Enzymatic DNA molecules that contain modified nucleotides
US6251588B1 (en) 1998-02-10 2001-06-26 Agilent Technologies, Inc. Method for evaluating oligonucleotide probe sequences
US6278039B1 (en) 1997-05-28 2001-08-21 Axys Pharmaceuticals, Inc. C. elegans deletion mutants
US20080032957A1 (en) * 2006-08-04 2008-02-07 Zheng Xu Cytotropic heterogeneous molecular lipids (CHML), method of preparation, and methods of treating patients with multiple cancers
WO2010035052A1 (fr) * 2008-09-25 2010-04-01 Glenmark Pharmaceuticals, S.A. Inhibiteurs de la stéaroyl-coa désaturase 1 sélective de tissu et analyse de criblage à base de cellule pour leur identification
WO2010083311A2 (fr) * 2009-01-14 2010-07-22 Vanas Oncology Compositions et procédés d'utilisation
WO2011030312A1 (fr) * 2009-09-10 2011-03-17 Institut National De La Sante Et De La Recherche Medicale (Inserm) Nouveaux inhibiteurs de stearoyl-coa-desaturase-1 et leurs utilisations

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5093246A (en) 1986-12-03 1992-03-03 University Patents, Inc. Rna ribozyme polymerases, dephosphorylases, restriction endoribo-nucleases and methods
WO1988009810A1 (fr) 1987-06-11 1988-12-15 Synthetic Genetics Nouveaux conjugues d'acide nucleique amphiphile
WO1989005852A1 (fr) 1987-12-15 1989-06-29 Macphillamy Cummins & Gibson Ribozymes
WO1989010134A1 (fr) 1988-04-25 1989-11-02 The Regents Of The University Of California Peptides chimeriques d'administration de neuropeptides a travers la barriere vasculaire du cerveau
US5176996A (en) 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
WO1990011364A1 (fr) 1989-03-24 1990-10-04 University Patents, Inc. Procede et endoribonucleases de restriction de ribozymes d'arn
US5244805A (en) 1989-05-17 1993-09-14 University Of Georgia Research Foundation, Inc. Baculovirus expression vectors
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5723750A (en) 1995-01-12 1998-03-03 Vanderbilt University Transgenic plants expressing disassembly deficient viral coat proteins
US6278039B1 (en) 1997-05-28 2001-08-21 Axys Pharmaceuticals, Inc. C. elegans deletion mutants
US6251588B1 (en) 1998-02-10 2001-06-26 Agilent Technologies, Inc. Method for evaluating oligonucleotide probe sequences
US6110462A (en) 1999-03-03 2000-08-29 The Scripps Research Institute Enzymatic DNA molecules that contain modified nucleotides
US20080032957A1 (en) * 2006-08-04 2008-02-07 Zheng Xu Cytotropic heterogeneous molecular lipids (CHML), method of preparation, and methods of treating patients with multiple cancers
WO2010035052A1 (fr) * 2008-09-25 2010-04-01 Glenmark Pharmaceuticals, S.A. Inhibiteurs de la stéaroyl-coa désaturase 1 sélective de tissu et analyse de criblage à base de cellule pour leur identification
WO2010083311A2 (fr) * 2009-01-14 2010-07-22 Vanas Oncology Compositions et procédés d'utilisation
WO2011030312A1 (fr) * 2009-09-10 2011-03-17 Institut National De La Sante Et De La Recherche Medicale (Inserm) Nouveaux inhibiteurs de stearoyl-coa-desaturase-1 et leurs utilisations

Non-Patent Citations (48)

* Cited by examiner, † Cited by third party
Title
"Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR PRESS
"CRC Handbook of Parvoviruses", vol. I, II
"DNA Cloning: A Practical Approach", vol. I, II
"Fundamental Virology", vol. I, II
"Nucleic Acid Hybridization"
"Oligonucleotide Synthesis"
"Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY
"Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY, pages: 1418
"Transcription and Translation"
AKAVIA,U.D. ET AL.: "An integrated approach to uncover drivers of cancer", CELL, vol. 143, 2010, pages 1005 - 1017
COLE ET AL.: "Monoclonal Antibodies and Cancer Therapy", 1985, ALAN R. LISS, INC., pages: 77 - 96
EGLOM, NATURE, vol. 365, 1993, pages 566
ELBASHI ET AL., NATURE, vol. 411, 2001, pages 494 - 8
ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 - 200
FCYTCR; GAUDRON: "Methods in Molecular Biology", vol. 74, HUMANA PRESS INC., article "Expressing Ribozymes in Plants"
HASELOFF; GERLACH, NATURE, vol. 334, 1988, pages 585 - 591
JAEGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 7706
JEAN JACQUES; ANDRE COLLET; SAMUEL H. WILEN: "Enantiomers, Racemates and Resolutions", 1981, JOHN WILEY & SONS, INC.
KAWASAKI ET AL., NATURE, vol. 393, 1998, pages 284 - 9
KCHLCNBACK ET AL., J CELL BIOL, vol. 141, 1998, pages 863 - 74
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497
KOSEKI ET AL., J VIROL, vol. 73, 1999, pages 1868 - 77
KOZBAR ET AL., IMMUNOLOGY TODAY, vol. 4, 1983, pages 72
KROL ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 958 - 976
KUWABARA ET AL., MOL. CELL, vol. 2, 1998, pages 617 - 27
KUWABARA ET AL., NATURE BIOTECHNOL., vol. 16, 1998, pages 961 - 5
KUWABARA ET AL., PROC NATL ACAD SCI USA, vol. 96, 1999, pages 1886 - 91
LCMAITRC ET AL., PROC. NATL. ACAD. SCI., vol. 84, 1987, pages 648 - 652
LCTSINGCR, PROC. NATL. ACAD. SCI. U.S.A., vol. 86, 1989, pages 6553 - 6556
LEE ET AL., NAT MED, vol. 12, 2006, pages 410 - 6
LIU G.: "Stearoyl-CoA desaturase inhibitors: update on patented compounds", EXPERT OPIN. THER. PATENTS, vol. 19, no. 9, 2009, pages 1169 - 1191, XP002626573, DOI: doi:10.1517/13543770903061311
LIU, G.: "Stearoyl-CoA desaturase inhibitors: update on patented compounds", EXPERT OPIN. THER. PATENTS, vol. 19, no. 8, 2009, pages 1169 - 1191, XP002626573, DOI: doi:10.1517/13543770903061311
PERRIMAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 6175 - 79
PERRY-O'KEEFE ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 93, 1996, pages 14670
ROSSI, CURRENT BIOLOGY, vol. 4, 1994, pages 469 - 471
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2000, COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK, J. ET AL.: "Molecular Cloning: A Laboratory Manual", 2000, COLD SPRING HARBOR LABORATORY PRESS
SARVER ET AL., SCIENCE, vol. 247, 1990, pages 1222 - 1225
SREEKUMAR, A. ET AL.: "Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression", NATURE, vol. 457, 2009, pages 910 - 914, XP002590536, DOI: doi:10.1038/NATURE07762
STEIN, CANCER RCS, vol. 48, 1988, pages 2659 - 2668
TANABE ET AL., NATURE, vol. 406, 2000, pages 473 - 4
TURNER ET AL., ANNU. REV. BIOPHYS. BIOPHYS. CHEM., vol. 17, 1988, pages 167
VAN DCR KROL, BIOTCCHNIQUCS, vol. 6, 1988, pages 958 - 976
WAGNER, R., NATURE, vol. 372, 1994, pages 333
YAMASHITA ET AL., CANCER RES, vol. 68, 2008, pages 1451 - 61
YAMASHITA ET AL., GASTROENTEROLOGY, 2009
ZARET; GROMPE, SCIENCE, 2008
ZON, PHARM. RES., vol. 5, 1988, pages 539 - 549

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024112438A1 (fr) * 2022-11-21 2024-05-30 The Regents Of The University Of California Alpha fétoprotéine liée à un acide gras polyinsaturé favorisant la suppression de l'immunité par modification du métabolisme des cellules dendritiques humaines

Similar Documents

Publication Publication Date Title
US20170058360A1 (en) Methods for Prediction of Clinical Response to Radiation Therapy in Cancer Patients
JP6105012B2 (ja) 前立腺癌マーカーとしてのホスホジエステラーゼ４ｄ７
RU2596394C2 (ru) Маркеры для рака эндометрия
US20060134688A1 (en) Genes overexpressed in prostate disorders as diagnostic and therapeutic targets
EP2430190B1 (fr) Phosphodiestérase 4D7 en tant que marqueur du cancer
JP2017505428A (ja) 診断及び治療の方法
JP2009535642A (ja) 非アルコール性脂肪性肝炎（ｎａｓｈ）を診断及び予測する方法
JP2016514136A (ja) グリシン、ミトコンドリア１炭素代謝、及びがん
EP2361315B1 (fr) Cxcl4l1 en tant que biomarqueur du cancer du pancréas
EP3375887A1 (fr) Procédés pour déterminer la résistance à une thérapie anticancéreuse et composition utilisée à cet effet
EP3390669B1 (fr) Biomarqueurs de la leucémie lymphoïde chronique et leur utilisation
WO2013039880A1 (fr) Biomarqueurs et cibles thérapeutiques du cancer hépatocellulaire
CN111910005B (zh) Cdk4/6抑制剂敏感性相关基因及其应用
CN112462072B (zh) 一种tmub1蛋白在制备肿瘤免疫抑制分子检测剂中的应用
EP2295977A1 (fr) Nouveaux marqueurs de tumeur
JP2014095643A (ja) 炎症性疾患治療薬のスクリーニング方法、並びに炎症性疾患の治療及び検査
CA2992377A1 (fr) Methode de cancerotherapie individualisee
WO2010030980A2 (fr) Akt et clusterine utilisés comme biomarqueurs de sensibilité à un traitement chimiothérapeutique
US20230288399A1 (en) Method for screening colorectal cancer metastasis inhibitor
EP4295844A2 (fr) Composition pharmaceutique destinée à l'inhibition de métastases cancéreuses
Pu et al. Tumor Cells Talk to Normal Cells Through Exosomes to Rebuild the Tumor Microenvironment
KR20180092135A (ko) 대장암 및 직장암의 예방, 진단 또는 치료를 위한 ｖｌｄｌｒ의 용도
EP2473853A1 (fr) Nouveaux marqueurs tumoraux sélectionnés parmi un groupe d'éléments de la voie de régulation des ampc
KR20100129552A (ko) 간세포암의 진단 및 예후결정용 조성물
KR20240088113A (ko) 긴 비번역 rna linc01446을 이용한 간암 진단 또는 치료 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12761860

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12761860

Country of ref document: EP

Kind code of ref document: A1