WO2013028611A1 - Isolement de facteurs qui s'associent directement ou indirectement à des arn non codants - Google Patents

Isolement de facteurs qui s'associent directement ou indirectement à des arn non codants Download PDF

Info

Publication number
WO2013028611A1
WO2013028611A1 PCT/US2012/051565 US2012051565W WO2013028611A1 WO 2013028611 A1 WO2013028611 A1 WO 2013028611A1 US 2012051565 W US2012051565 W US 2012051565W WO 2013028611 A1 WO2013028611 A1 WO 2013028611A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
nucleic acid
sequence
target nucleic
acid sequence
Prior art date
Application number
PCT/US2012/051565
Other languages
English (en)
Inventor
Robert Kingston
Matthew Simon
Jason Allen WEST
Original Assignee
The General Hospital Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The General Hospital Corporation filed Critical The General Hospital Corporation
Priority to EP12825262.4A priority Critical patent/EP2744902B1/fr
Priority to US14/239,369 priority patent/US10273529B2/en
Publication of WO2013028611A1 publication Critical patent/WO2013028611A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the invention relates to assays for factors that associate with nucleic acid sequences, particularly genomic DNA, RNA and chromatin.
  • nucleic acid sequences particularly genomic DNA, RNA and chromatin.
  • novel chromatin associated factors identified by the assay are provided.
  • Epigenetics concerns the transmission of information from a cell or multicellular organism to its descendants without that information being encoded in the nucleotide sequence of genes. Epigenetic mechanisms can operate through chemical modification of the DNA or through post translational modifications to proteins and polypeptides associated with the DNA. RNAs, including long non-coding RNAs have also been implicated in epigenetic regulation.
  • nucleic acid sequences are critical to information storage and regulation of cell state; this is particularly evident in the regulation of chromatin structure and function.
  • DNA is associated with protein and ribonucleic acid (RNA) complexes that assist in regulating gene expression, packaging of the DNA and controlling replication.
  • RNA ribonucleic acid
  • the myriad of factors that are associated with the genome contribute to what is termed chromatin: the nuclear material present in the nucleus of most eukaryotic cells.
  • the level of packaging (or condensation) of the genomic DNA can vary between a lower packaged state such as during replication of the DNA (S Phase) to a more condensed state such as during cell division (M phase) where the genome is packaged into chromosomes.
  • Highly expressed genes also tend to exist in a state of low packaging (so called Vietnamese state), whereas silenced genes exist in a state of high packaging (so called heterochromatic state).
  • the relative state of condensation, maintenance of this state and the transition between heterochromatin and euchromatin is believed to be mediated largely by a plurality of specialist proteins, RNAs and polypeptide complexes.
  • the roX non-coding RNAs found in flies act with a protein complex to open chromatin and increase transcription on the male X chromosome.
  • the mammalian Xist non-coding RNA coats one of the female X chromosomes and causes it to condense into heterochromatin.
  • the most 'open' or euchromatic form of chromatin comprises short sections of the genomic DNA wound around an octet of histone proteins,that together form a nucleosome.
  • the nucleosomes are arrayed in series to form a beads-on-a- string formation. Interactions between adjacent nucleosomes allow the formation of more highly ordered chromatin structures. It is these interactions that can be mediated by enzymes that catalyse post-translational modifications of histones, or structural proteins that physically interact with and assist in anchoring the histones together.
  • ChIP Protocols for performing ChIP are disclosed in Nelson et al. (Nature Protocols (2006) 1:179 - 185) and Crane-Robinson et al. (Meth. Enzym. (1999) 304:533-547). Furthermore, while ChIP is useful for probing protein regulatory factors across the genome, there are no analogous techniques to determine the binding sites of RNA factors.
  • a significant drawback with ChIP based techniques is that for a given sequence, at least one specific protein associated with that sequence must be known already.
  • a method of isolating protein factors that associate directly or indirectly with a specified target nucleic acid sequence In effect, there is a need for a method of chromatin associated protein or polypeptide isolation that is nucleic acid sequence driven rather than antigen driven.
  • a lack of immunoprecipitation does not necessarily reflect an absence of the tested factor, so there is always a risk of false negative results with this technique.
  • the present invention overcomes the deficiencies in the art by providing a novel method for isolating factors that associate directly or indirectly with a given target nucleic acid sequence.
  • the method of the invention overcomes the aforementioned problems (1) with regard to isolating novel chromatin binding RNAs and polypeptides and (2) with analyzing the factors associated with a regulatory RNA including its DNA binding sites.
  • aspects of the invention relate to a method for identifying one or more factors associated with a target nucleic acid sequence, wherein the one or more factors comprise at least one ribonucleic acid (RNA) sequence that is associated with the target nucleic acid sequence.
  • RNA ribonucleic acid
  • the method comprises the steps of obtaining a sample that comprises the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence; contacting the sample with one or more capture probes, wherein the capture probes comprise a nucleic acid sequence and at least one affinity label, and wherein the capture probes specifically hybridise with the at least one RNA sequence, under conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence; isolating the hybridization complex by immobilising the hybridization complex via a molecule that interacts with the affinity label; and analyzing the constituents of the isolated hybridization complex so as to identify the one or more factors associated with the target nucleic acid sequence.
  • the target nucleic acid sequence is comprised within genomic DNA.
  • the target nucleic acid sequence is comprised within chromatin.
  • the target nucleic acid sequence is comprised within a gene.
  • the target nucleic acid sequence is comprised within a regulatory sequence.
  • the regulatory sequence is within a promoter.
  • the regulatory sequence is within a coding region.
  • the regulatory sequence is within a non-coding region.
  • the one or more factors comprise at least one non-coding RNA (ncRNA).
  • the one or more factors comprise at least one messenger RNA (mRNA).
  • mRNA messenger RNA
  • the one or more factors comprise at least one polypeptide.
  • the at least one ribonucleic acid (RNA) sequence that is associated with the target nucleic acid sequence is a ncRNA.
  • the at least one ribonucleic acid (RNA) sequence that is associated with the target nucleic acid sequence is an mRNA.
  • the one or more capture probes comprise DNA.
  • the one or more capture probes comprise at least one modified nucleotide analogue.
  • the affinity label is selected from the group consisting of: biotin or an analogue thereof; digoxigenin; fluorescein;
  • the biotin analogue is desthiobiotin.
  • the probe-target hybrid is immobilized through a molecule that binds to the at least one affinity label and which molecule is attached to a solid substrate.
  • the solid substrate comprises a microbead.
  • the microbead is capable of being magnetically separated from a solution.
  • the one or more factors associated with the target nucleic acid sequence are exposed to conditions that result in crosslinking of the one or more factors prior to the step of exposing the sample to the capture probe, and wherein the crosslinking is reversed prior to the step of analyzing the constituents of the isolated hybridization complex so as to identify the one or more factors associated with the target nucleic acid sequence.
  • the conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence comprise high ionic strength and high concentration of a denaturant compound.
  • the denaturant compound is urea.
  • the method comprises an additional pre-treatment step prior to the obtaining step in which the at least one ribonucleic acid (RNA) sequence that is associated with the target nucleic acid sequence is mapped in order to identify regions of the RNA that are accessible to hybridization with a capture probe.
  • RNA ribonucleic acid
  • the mapping of the RNA sequence comprises exposing the RNA sequence to RNase H in the presence of one or more complementary DNA oligonucleotides, determining the location of any RNase H cleavage sites that result from hybridization of the RNA to the one or more complementary DNA oligonucleotides, and identifying the cleavage sites as regions of the RNA that are accessible to hybridization with a capture probe.
  • mapping of the RNA sequence comprises determining whether the target RNA sequence co-purifies with chromatin when analysed in the form of a sheered chromatin extract.
  • the co-purification is an anti- histone RNA-immunoprecipitation.
  • the co-purification is from a DNA affinity epitope.
  • the sample is from a cell.
  • the cell is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the mammalian cell is a human cell.
  • the sample is obtained from human tissue.
  • RNA sequence that is capable of associating with the at least one genomic locus
  • the method comprises the steps of obtaining a sample that comprises the region of chromatin and the one or more factors associated with the region of chromatin; contacting the sample with one or more capture probes, wherein the capture probes comprise a nucleic acid sequence and at least one affinity label, wherein the affinity label is conjugated to the one or more capture probes via a spacer group, and wherein the capture probes specifically hybridise with the at least one RNA sequence, under conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration of a denaturant compound; isolating the hybridization complex by immobilising the hybridization complex via a molecule that interacts with the affinity label; and analyzing the constituents of the isolated hybridization complex so as to identify the one or more factors associated with the
  • the region of chromatin comprises one or more of the group consisting of: a telomere; a centromere; euchromatin; heterochromatin; a gene; a repeat sequence; a heterologously inserted sequence; and an integrated viral genome.
  • the at least one RNA is a non-coding RNA (ncRNA).
  • the one or more factors comprise at least one polypeptide.
  • RNA sequence that is capable of associating with the at least one genomic locus
  • the method comprises the steps of obtaining a sample that comprises the region of chromatin and the one or more factors associated with the region of chromatin; contacting the sample with one or more capture probes that specifically hybridise with the at least one RNA sequence, wherein the capture probes comprise a nucleic acid sequence and wherein the capture probes are immobilized on a solid substrate, under conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration of a denaturant compound; and analyzing the constituents of the isolated hybridization complex so as to identify the one or more factors associated with the target nucleic acid sequence.
  • the solid substrate comprises a microbead.
  • Another aspect of the invention relates to a method for identifying one or more factors associated with a region of chromatin that comprises at least one genomic locus, wherein the one or more factors comprise at least one non-coding ribonucleic acid (ncRNA) sequence that is capable of associating with the at least one genomic locus.
  • ncRNA non-coding ribonucleic acid
  • the method comprises the steps of mapping the at least one ncRNA sequence in order to identify regions of the ncRNA that are accessible to hybridization; synthesizing one or more capture probes, wherein the capture probes comprise a nucleic acid sequence and at least one affinity label, wherein the affinity label is conjugated to the one or more capture probes via a spacer group, and wherein the capture probes are able to hybridize with the at least one ncRNA sequence in a region defined as accessible to hybridization by the mapping step; obtaining a sample that comprises the region of chromatin and the one or more factors associated with the region of chromatin; contacting the sample with one or more capture probes, under conditions that allow the one or more capture probes to hybridise with the at least one ncRNA sequence so as to form a hybridization complex between the capture probe, the at least one ncRNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration
  • the mapping step comprises exposing the ncRNA sequence to RNase H in the presence of one or more complementary DNA oligonucleotides, determining the location of any RNase H cleavage sites that result from hybridization of the ncRNA to the one or more complementary DNA oligonucleotides, and identifying the cleavage sites as regions of the ncRNA that are accessible to
  • Another aspect of the invention relates to an assay for identifying one or more factors associated with a target nucleic acid sequence, wherein the one or more factors comprise at least one RNA sequence that is associated with the target nucleic acid sequence.
  • the assay comprises (i) one or more capture probes, wherein the capture probes comprise a nucleic acid sequence and at least one affinity label, and wherein the nucleic acid sequence of the capture probes is complementary to and will specifically hybridize with at least a part of the at least one RNA sequence; (ii) a hybridization buffer solution for providing conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration of a denaturant; and (iii) a label comprising set of instructions on how to perform the assay.
  • the affinity label is conjugated to the one or more capture probes via a spacer group.
  • the assay further comprises (iv) a solid substrate that comprises a molecule that is capable of binding to the at least one affinity label and which molecule is attached to the solid substrate.
  • the solid substrate comprises a microbead.
  • the microbead comprises magnetic particles so that it is capable of being magnetically separated from a solution.
  • the assay further comprises a solution of RNase H.
  • Another aspect of the invention relates to an assay for identifying one or more factors associated with a target nucleic acid sequence, wherein the one or more factors comprise at least one RNA sequence that is associated with the target nucleic acid sequence.
  • the assay comprises (i) one or more capture probes, wherein the capture probes comprise a nucleic acid sequence and wherein the capture probes are immobilized on a solid substrate, and wherein the nucleic acid sequence of the capture probes is complementary to and will specifically hybridize with at least a part of the at least one RNA sequence; (ii) a capture probes, wherein the capture probes comprise a nucleic acid sequence and wherein the capture probes are immobilized on a solid substrate, and wherein the nucleic acid sequence of the capture probes is complementary to and will specifically hybridize with at least a part of the at least one RNA sequence; (ii) a
  • hybridization buffer solution for providing conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration of a denaturant; and (iii) a label comprising set of instructions on how to perform the assay.
  • the solid substrate comprises a microbead.
  • the microbead comprises magnetic particles so that it is capable of being magnetically separated from a solution.
  • the assay further comprises a solution of RNase H.
  • RNA sequence a non-coding RNA sequence
  • a method for identifying one or more genomic DNA target nucleic acids of a non-coding RNA sequence comprising a) treating a chromatin extract comprising the ncRNA, to thereby reversibly cross-link the ncRNA present in the extract to an associated genomic DNA target nucleic acid(s) present in the extract; b)contacting the extract from step a) with one or more capture probes specific to the ncRNA under conditions that allow the capture probes to specifically hybridize with the ncRNA to thereby form a hybridization complex comprised of the capture probe(s), the ncRNA and the associated genomic DNA target nucleic acid(s); c) isolating the hybridization complex by immobilizing the one or more capture probes in the context of the hybrization complex; and d) analyzing DNA in the hybrization complex to thereby identify the genomic DNA target nucleic acid(s).
  • ncRNA non-coding RNA sequence
  • analyzing the hybridization complex comprises a)treating the hybridization complex to uncross-link the ncRNA and associated genomic DNA target nucleic acid(s); and b) sequencing the genomic DNA target nucleic(s) acid present in the hybrization complex.
  • the method further comprises amplifying the genomic DNA target nucleic acid present in the hybridization complex prior to sequencing.
  • RNA sequence a non-coding RNA sequence
  • a method for identifying one or more factors associated with a non-coding RNA sequence comprising, a)treating a genomic DNA extract comprising the ncRNA, to thereby reversibly cross-link the ncRNA present in the extract to one or more associated genomic DNA target nucleic acids present in the extract, b) contacting the extract from step a) with one or more capture probes specific to the ncRNA under conditions that allow the capture probes to specifically hybridize with the ncRNA to thereby form a hybridization complex comprised of the capture probe(s), the ncRNA and the associated genomic DNA target nucleic acid(s); c)isolating the hybridization complex by immobilizing the one or more capture probes in the context of the hybrization complex; and d) analyzing the hybridization complex for the presence of associated proteins or RNAs, to thereby identify factors associated with the ncRNA.
  • the analyzing step d) comprises performing western blot analysis of proteins present in the hybridization complex to thereby analyze the hybridization complex for the presence of associated proteins.
  • analyzing step d) comprises performing PCR on RNA present in the hybridization complex to thereby analyze the hybridization complex for the presence of RNAs.
  • analyzing step d) further comprises performing sequencing of the RNA present in the hybridization complex.
  • the capture probes are DNA oligonucleotides.
  • capture probes comprise an affinity label and the hybridization complex is immobilized by binding of the affinity label to a specific binding partner.
  • the affinity label is biotin.
  • RNAse H sensitivity a method for determining one or more oligonucleotide sequences for use in a capture probe for a specific ncRNA, for use in Capture Hybridization Analysis of RNA Targets (CHART), comprising: a) preparing a reversibly cross-linked chromatin extract;b) providing candidate oligonucleotides; c) separately combining each of the candidate oligonucleotides of step b) to the reversibly cross-linked chromatin extract, the presence of RNase H, under conditions suitable for RNA hydrolysis of RNA-DNA hybrids, to thereby produce a chromatin-oligonucleotide mixture; d) performing RT-qPCR on the chromatin-oligonucleotide mixture to detect RNAse H sensitivity; and e) identifying a candidate oligonucleotide as a sequence for use as a capture probe for CHART when RNAse H sensitivity in step d
  • the reversibly cross-linked chromatin extract of step a) is prepared by formaldehyde cross-linking.
  • the candidate oligonucleotides are between 15 and 25 nucleotides in length.
  • the candidate oligonucleotides are 20 nucleotides in length
  • the RT-qPCR is performed with a primer set that amplifies a region of the target cDNA that includes the oligo probe, a control primer set for an unrelated RNA, and a control primer set designed to hybridize to a region representative of the ncRNA that is not RNAse H sensitive.
  • kits comprising one or more capture probes optimized for use in Capture Hybridization Analysis of RNA Targets (CHART) for a specific ncRNA.
  • CHART Capture Hybridization Analysis of RNA Targets
  • the capture probes are optimized for a specific stage of development within a cell.
  • the capture probes are optimized for a specific cell type.
  • Figure 1 shows a graphical representation of the PICh (Proteomics of Intact Chromatin) procedure.
  • Figure 2 shows (A) a schematic overview of the CHART procedure of one embodiment of the invention; (B-C) the regions of normalized, mapped sequencing reads from roX2 and control CHART data (S2 cells) compared with MSL3-TAP ChIP (MSL3-TAP Clone 8 cells); (D) a graph showing distribution of sequencing reads for CESs compared to non-CESs.
  • Figure 3 shows (A) RNaseH mapping roX2 ncRNA was assayed with three primer sets by RT-qPCR, triangles ( ⁇ ) demarcate C-oligo sites, SL refers to a previously identified stem loop structure. Regions of high sensitivity were found to be sensitive only within appropriate primer sets. (B) Yields or roX2 RNA and control RNAs assayed by RT- qPCR (input normalized, SOM). (C) Yields relative to input of DNA from the indicated genomic loci for two negative loci, and two roX2 target loci.
  • Figure 4 shows an autoradiograph of an analysis of RNase H activity using synthetic nucleotides analyzed by native PAGE. A fluorescently labeled RNA-DNA duplex was incubated with RNase H under the various buffer conditions as labeled above the gel. As controls, the ssDNA, and lane without RNase H and two dsDNA controls are also shown.
  • Figure 5 shows results similar to the experiment in Figure 3A but repreated in triplicate for several oligonucleiotides.
  • Figure 6 shows (A) an analysis of RNA enriched by CHART using either capture oligos targeting roX2 (roX2 CHART) or a control CHART using a scambled sequence (Cntrl CHART).
  • the RNA enrichment was measured by RT-qPCR with primers against roX2 (two sets, A and B) and three other RNAs (Rpll7, CG14438 and Act5C); and
  • Figure 7 shows an autoradiograph of a Western blot analysis of proteins co- purifying by CHART.
  • Upper panel the first three lanes represent the equivalent amount of a 2%, 0.4% or 0.08% yield, respectively.
  • the enriched material was run along with a 1:5 dilution for either roX2 CHART or a control CHART experiment.
  • the TAP-tag was visualized using a peroxidase » anti-peroxidase complex (PaP).
  • Lower panel is the same blot overexposed to visualize weaker bands.
  • Figure 8 shows a graphical analysis of the enrichment of DNA loci by CHART.
  • Enriched material from either roX2 or control CHART was analyzed by qPCR using primers for either unrelated genes (pka-Cl and Act87E) the roX2 endogenous locus (roX2), a known chromatin entry site (CES-5C2), the 5' and 3' ends of a gene known to be dosage
  • CG13316 compensated (CG13316) and a gene on an autosome (CG15570) that is known to escape dosage compensation.
  • Figure 9 shows a graphical analysis of DNA enrichment from NEAT1 or MALAT1 CHART experiments, compared with a no pull down control (None). qPCR primers specific for three different loci, including one unrelated loci (KCNQlotl) were used for analysis of the enriched DNA.
  • FIG. 10 shows a schematic of CHART, a hybridization-based strategy that uses complementary oligonucleotides to purify the RNA together with its targets from reversibly cross-linked extracts.
  • the cartoon here shows the scenario where the RNA is bound in direct contact with the DNA together with proteins, but other configurations are also possible (see the text).
  • CHART-enriched material can be analyzed in various ways; the two examples depicted here are (Left) sequencing the DNA to determine genomic loci where the RNA is bound and (Right) analyzing the protein content by Western blot analysis.
  • Figure 11A - Figure 11C show results from experiments that indicate CHART allows specific enrichment of roX2 along with its associated targets.
  • Figure 11A shows enrichment of RNAs by roX2 CHART (using C-oligos listed in Table 3) as measured by RT- qPCR.
  • Figure 11B shows enrichment of DNA loci by roX2 CHART.
  • CES-5C2 is a regulatory site enriched by roX2 CHART. The enrichment values are labeled for comparison of CES-5C2 by roX2 CHART with sense-oligo CHART and also with roX2 CHART at a control site, Pka.
  • RNase-positive lanes represent CHART enrichment from extracts pretreated with RNase to eliminate RNA-mediated signal. Error bars represent +SEM for three qPCR experiments. Primers are listed in Table 4. Figure 11C shows specific enrichment of a tagged MSL subunit, MSL3-TAP, by roX2 CHART. DSPl antisera (64) is used as a negative control because of its sensitivity.
  • Figure 12A - Figure 12C show results from experiments that indicate NEAT1 CHART, but not MALAT1 CHART, specifically enriches NEAT1 RNA along with its protein and DNA targets.
  • Figure 3 A shows enrichment of the indicated RNAs from HeLa chromatin extracts by either N, NEAT1 CHART; M, MALAT1 CHART; or O, a mock (no C-oligo) control as measured by RT-qPCR.
  • Figure 12B shows results similar to Figure 12A, but enrichment of associated DNA loci as determined by qPCR. Error bars represent +SEM for three independent CHART experiments.
  • Figure 12C shows specific enrichment of two paraspeckle proteins, p54/nrb and PSPC1, by NEAT1 CHART from MCF7 extract. Histone H3 was chosen as a negative control because it is a highly sensitive antiserum and NEAT1 is not expected to be predominantly chromatin bound.
  • Figure 13A - Figure 13D shows results from experiments that indicate roX2 CHART-seq reveals robust enrichment of roX2 on chrX and precise localization to sites of MSL binding.
  • Figure 13A top four rows, mapped sequencing reads from roX2 and sense- oligo CHART data (performed from S2 cells expressing MSL3-TAP) (55) compared to MSL3-TAP ChIP data from MSL3-TAP Clone 8 (41). Both mapped read numbers and normalized read numbers are listed. Note the RNase-H-eluted roX2 CHART has higher peaks signals at roX2 binding sites and required a different scale than the other three sequencing tracks.
  • ChlP-chip data for the indicated histone modifications are shown (S2 cells, ModENCODE) (65).
  • Figure 13B shows finer-scale examples and comparisons of roX2 CHART data, with normalized read depth, except Far Right where normalized for peak height.
  • Figure 13C shows a correlation between the roX2 CHART signal and MSL3-TAP ChIP signal (41) by plotting the conservative enrichment magnitudes (relative to
  • FIG. 13D shows a motif identified from the top roX2 CHART peaks, depicted here as a motif logo in comparison with a nearly identical motif previously determined from MSL3- TAP ChlP-chip data (41).
  • Figure 14 A - Figure 14E shows the development of C-oligos for CHART.
  • Figure 14A shows analysis of RNase-H activity using synthetic nucleotides analyzed by native PAGE.
  • a Cy5-fluorescently labeled DNA oligonucleotide was hybridized to either a complementary RNA (lanes 2-7) or DNA (lanes 8 and 9) or run without hybridization as a control (lane 1). These oligonucleotides were incubated with RNase H (5U) under the indicated buffer conditions.
  • Buffer B is 50 mM Hepes pH 7.5, 75 mM KC1, 3 mM MgC12, 0.1 mM EGTA, 20 u mL SUPERasIN, 5 mM DTT, 7.5% glycerol to which the indicated detergents were added.
  • RNase-H sensitivity represents the ratio of cleaved to uncleaved RNA (e.g., a value of 9 corresponds to 90% cleavage). Note that the sites of high sensitivity are only observed with the appropriate primer sets. The targets of the C-oligos based on this mapping are indicated with gray arrowheads.
  • Figure 14C shows the same as Figure 14B but repeated in three independent experiments for each oligo shown. Error bars represent +SEM.
  • Figure 14D shows the design of C-oligos used inbiotin-eluted CHART and
  • Figure 14E shows the design of C-oligos used for RNase-H-eluted CHART.
  • Figure 15 shows data from experiments that indicate the C-oligos used in roX2 CHART each independently enrich roX2 binding sites and act synergistically.
  • roX2 CHART was performed either with the standard mixture of three C-oligo nucleotides (white) or with the individual C-oligos (red, yellow, and blue).
  • a mixture of three sense oligos corresponding to each of the roX2 C-oligo cocktail was used (gray). The results are plotted on a loglO scale relative to input.
  • the individual C-oligos each have yields greater than threefold lower (40-, 37-, and 56-fold lower, respectively) than the combined cocktail, demonstrating that the C-oligos act synergistically.
  • the two negative- control loci Pka and Act5C amplified but did not achieve 0.001% yield (corresponding to a qPCR CT value of >35 with input CT values of approximately 20 for all four loci). Error bars represent +SEM of three qPCR replicates.
  • Figure 16A - Figure 16C shows experimental design and results.
  • Figure 16A shows the location of oligonucleotides.
  • peaks of RNase-H sensitivity were used to design C-oligos to a mammalian IncRNA.
  • RNase-H mapping of a region of NEAT1 (980-1240 nt of NR_028272.1) and
  • FIG. 16B shows NEAT1 CHART, but not MALAT1 CHART, enriches NEAT1 RNA in MCF7 cells, similar to analysis depicted in Figure 12A demonstrating enrichment of specific RNAs by RT-qPCR with different CHART
  • FIG. 16C shows NEAT1 CHART, but not MALAT1 CHART, enriches the NEAT1 endogenous locus in MCF7 cells, similar to analysis depicted in Figure 12B demonstrating enrichment of specific DNA loci by qPCR with different CHART experiments as in Figure 16B.
  • Figure 17A - Figue 17F shows data from experiments.
  • Figure 17A shows that whereas the top roX2 CHART peaks are found on chrX, some of the lower- significance peaks from biotin-eluted roX2 CHART-seq correspond to sites that are caused by direct binding of the C-oligos to DNA.
  • Comparison of normalized sequencing reads across a region of chr2L demonstrating several roX2 CHART peaks (marked by asterisks) that correspond to peaks also observed in the sense control, suggesting they are caused by direct binding of the C-oligos to DNA and are not roX2 binding sites.
  • FIG. 17B shows peaks from biotin-eluted roX2 CHART data were ordered by the enrichment magnitude relative to the senseoligo control and plotted for their cumulative fraction found on the chrX.
  • the red dashed line shows the cutoff at 173 peaks where 100% of peaks are found on chrX.
  • Figure 17C shows the analysis of DNA enrichment by RNase-H-eluted roX2 CHART based on qPCR and similar to Figure 11B.
  • Results are plotted on a loglO scale. Error bars are +SEM from three qPCR replicates. A genome- wide correlation of biotin-eluted and RNase-H-eluted CHARTread density (200-bp bandwidth) was deduced and plotted on a log 10 scale (not shown). chrX peaks were plotted along side with autosomal peaks and analyzed. A correlation for all data was also deduced. The correlation between two RNase- H-eluted CHARTreplicates were similarly deduced. Figure 17D Similar to Figure 17B, peaks from RNase-H-eluted roX2 CHART data were ordered by the enrichment magnitude relative to the input and plotted for their cumulative fraction found on the chrX. The red dashed line shows the cutoff at 214 peaks where 100% of peaks are found on chrX.
  • Figure 18 shows data from experiments.
  • Figure 18A indicates the top sites of roX2 CHART enrichment are all sites of MSL enrichment. Similar to the analysis in Figure 13F, roX2 CHART sites were ordered by significance. The plot shows the cumulative fraction of the top peaks that have at least twofold enrichment of MSL3-TAP ChIP
  • Figure 18B is a box plot comparing the distribution of read densities for each dataset for either the top MSL3-enriched sites (blue, based on ref. 1; red, 1,000 non-MSL3 enriched sites chosen at random).
  • Figure 18C shows average roX2 CHART data (the line with the highest peak represents the biotin-eluted) and sense-oligo CHART data (the flatter line) aligned around sites of MSL3 enrichment (top 625 peaks used based on Figure 17B).
  • Figure 19A - Figure 19D is a schematic and collection of bar graphs and photographs of data generated from the application of CHART to the Xist RNA in mammalian cells.
  • Figure 19 A is a schematic overview of the CHART procedures as applied in Example 3.
  • Figure 19B shows a bar graph of data from experiments showing RNA enrichment.
  • Figure 19C shows a bar graph of data from experiments showing DNA enrichment.
  • polypeptide refers to a polymer of amino acid residues joined by peptide bonds, whether produced naturally or in vitro by synthetic means.
  • Polypeptides of less than approximately 12 amino acid residues in length are typically referred to as a "peptide".
  • polypeptide denotes the product of a naturally occurring polypeptide, precursor form or proprotein. Polypeptides also undergo maturation or post-translational modification processes that may include, but are not limited to: glycosylation, proteolytic cleavage, lipidization, signal peptide cleavage, propeptide cleavage, phosphorylation, ubiquitylation, sumoylation, acetylation, methylation and such like.
  • a “protein” is a macromolecule comprising one or more polypeptide chains.
  • a "polypeptide complex” as used herein, is intended to describe proteins and polypeptides that assemble together to form a unitary association of factors.
  • the members of a polypeptide complex may interact with each other via non-covalent or covalent bonds.
  • members of a polypeptide complex will cooperate to enable binding either to DNA or to polypeptides and proteins already associated with or bound to DNA (i.e. chromatin).
  • Chromatin associated polypeptide complexes may comprise a plurality of proteins and/or polypeptides which each serve to interact with other polypeptides that may be permanently associated with the complex or which may associate transiently, dependent upon cellular conditions and position within the cell cycle.
  • polypeptide complexes may vary in their constituent members at different stages of development, in response to varying physiological conditions or as a factor of the cell cycle.
  • polypeptide complexes with known chromatin remodelling activities include Polycomb group gene silencing complexes as well as Trithorax group gene activating complexes.
  • isolated when applied to a nucleic acid or polypeptide sequence is a sequence that has been removed from its natural organism of origin. Typically, an isolated polypeptide or polynucleotide / nucleic acid molecule has been removed from the
  • an isolated polypeptide or polynucleotide is not necessarily 100% pure, but may be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% pure.
  • a purified, isolated polypeptide or polynucleotide is advantageously at least 80% pure, and may be at least 90%, at least 95% or at least 98% pure (e.g. 99% pure).
  • the term "isolated" when applied to a polypeptide is intended to include the same polypeptide in alternative physical forms whether it is in the native form, denatured form, dimeric/multimeric, glycosylated, crystallised, or in derivatised forms.
  • nucleic acid molecules / polynucleotides / oligonucleotides e.g. nucleic acid probes, RNAi molecules etc.
  • polypeptides / peptides e.g. antibodies or fragments thereof
  • Chromatin is the compacted structure of genomic DNA present in the nucleus of most eukaryotic cells. It comprises DNA and a plurality of DNA-binding proteins as well as certain RNAs. The term 'chromatin' derives from the readiness of this cellular material to hold stain with certain chemical dyes (chromaticity). Chromatin is primarily comprised of DNA associated with histone proteins that together form a basic nucleosomal structure. The nucleosome comprises an octet of histone proteins around which is wound a stretch of double stranded DNA 146 bp in length.
  • Histones H2A, H2B, H3 and H4 are part of the nucleosome while histone HI can act to link adjacent nucleosomes together into a higher order structure. Assembly into higher order structures allows for greater packing, or condensation of the DNA.
  • Chromatin is often referred to as occurring in two main states, euchromatin and heterochromatin, corresponding to uncondensed actively transcribed DNA and condensed DNA respectively.
  • Many further polypeptides, RNAs and protein complexes interact with the nucleosome and the histones in order to mediate transition between the euchromatic and heterochromatic states. The identity and functional activity of many of these crucially important chromatin associated proteins and complexes is presently unknown.
  • An affinity label refers to a moiety that specifically binds another moiety and can be used to isolate or purify the affinity label, and compositions to which it is bound, from a complex mixture.
  • An affinity label is a member of a specific binding pair (e.g, biotin:avidin, antibody: antigen).
  • affinity labels such as digoxigenin, dinitrophenol or fluorescein, as well as antigenic peptide 'tags' such as polyhistidine, FLAG, HA and Myc tags, is envisioned.
  • Epigenetics concerns the transmission of information from a cell or multicellular organism to its descendants without that information being encoded in the nucleotide sequence of genes.
  • Epigenetic controls are typically established via chemical modification of the DNA or chromatin structure. Gene expression can be moderated, in some cases, via the covalent attachment of chemical groups to polypeptides that are associated with or that can bind to DNA.
  • methylation, sumoylation, phosphorylation, ubiquitylation and/or acetylation of histones can lead to activation or silencing of gene expression in the region of the genome where these epigenetic modifications have occurred.
  • Epigenetic modifications can occur at different times in the normal development of an organism, and also during transformation of normal cells into cancerous cells. Such modifications often result in the silencing or activation of certain genes.
  • cancer it is well documented that the majority of tumour cells display abnormal DNA epigenetic imprints (Feinberg AP &
  • Neoplasm is used herein to denote a tissue or a cell located within a neoplasm or with properties associated with a neoplasm.
  • Neoplasms typically possess characteristics that differentiate them from normal tissue and normal cells. Among such characteristics are included, but not limited to: a degree of anaplasia, changes in cell morphology, irregularity of shape, reduced cell adhesiveness, the ability to metastasise, increased levels of angiogenesis, increased cell invasiveness, reduced levels of cellular apoptosis and generally increased cell malignancy. Terms pertaining to and often
  • cancer synonymous with “cancer” include sarcoma, carcinoma, tumour, epithelioma, leukaemia, lymphoma, polyp, transformation, neoplasm and the like.
  • An embodiment of the present invention resides in the development of a method for identifying proteins, polypeptides, RNA and protein complexes that are associated with a particular target chromatin site, gene or stretch of nucleic acid, such as DNA.
  • the method utilises a high specificity nucleic acid probe optionally labelled with an affinity tag that allows for isolation of probe-target hybridised sequences.
  • a protein of interest is localized to a specific genomic region, the standard approach has been to combine immuno-staining and DNA fluorescent in situ hybridization (immuno-FISH) on fixed nuclei.
  • immuno-FISH DNA fluorescent in situ hybridization
  • the method of the invention also demonstrates considerable advantage over immuno-precipitation based techniques, such as ChIP, which rely on the presence of a known protein antibody target that is already bound to the DNA. Also, if the antibody is quantitatively precipitating a crosslinked antigen, which is rare, ChIP does not permit purification of a single loci but a mixture of loci that contain the protein of interest.
  • the method of the invention also allows for changes in chromatin/ DNA associated protein complexes to be monitored under different cellular conditions as well.
  • the PICh proteomics of intact chromatin
  • the PICh proteomics of intact chromatin
  • the PICh allows for targeting of specific sequences in genomic DNA and thereby isolating any associated chromatin factors (described in co-pending patent application US-12/674,163; and published as Dejardin and guitarist. Purification of proteins associated with specific genomic Loci. Cell (2009) vol. 136 (1) pp. 175-86, the contents of each of which are herein incorporated by reference in their entirety).
  • cells are fixed, the chromatin solubilized, a specific probe is hybridized to the chromatin, the hybridized chromatin is then captured on magnetic beads, the hybrids are eluted and the proteins identified.
  • LNA Locked Nucleic Acid
  • Suitable spacers include long chain aliphatic groups, or spacers can be synthesised from methoxyoxalamido and succinimido precursors such as those described in Morocho, A. M. et al (Methods Mol Biol (2005) 288, 225-240).
  • desthiobiotin a biotin analog with weaker affinity for avidin, permitting a competitive gentle elution using biotin.
  • the PICh process uses a genomic sequence driven approach to isolation of associated factors. As a result, PICh requires a highly specific probe design that can penetrate the complex structure of chromatin.
  • RNAs non-coding RNAs
  • ncRNAs non-coding RNAs
  • ncRNAs non-coding RNAs
  • RIP RNA immunoprecipitation
  • Chromatation do not have well-established analogous procedures for RNAs. Therefore, a broadly applicable affinity purification technique that allows the identification of factors that interact with the endogenous RNA (analogous to coIP) and the determination of the genomic localization (analogous to ChIP) or interacting RNAs (RIP) would provide important insight into the regulation of chromatin.
  • ncRNAs non-coding RNAs
  • mRNAs protein-coding RNAs
  • Many non-translated RNAs have now been characterized, and several long transcripts, ranging from 0.5 to over 100 kb, have been shown to regulate gene expression by modifying chromatin structure.
  • ncRNAs Functions uncovered at a few well characterized loci demonstrate a wide diversity of mechanisms by which ncRNAs can regulate chromatin over a single promoter, a gene cluster, or an entire chromosome, in order to activate or silence genes in cis or in trans.
  • One important role so far recognized for ncRNAs is their participation in the epigenetic regulation of genes. Indeed, it is becoming increasingly apparent that many epigenetic mechanisms of gene expression are controlled by ncRNAs.
  • CHART Capture Hybridization Analysis of RNA Targets
  • ncRNAs endogenous RNAs
  • CHART involves identifying complementary oligonucleotides to the RNA that are then used to purify these RNAs from crosslinked extracts. The enrichment has proven sufficient to demonstrate co-purification of associated proteins and other polypeptide and RNA factors.
  • CHART allows the identification of the genomic loci where RNAs are bound to chromatin. This technique is generally applicable; CHART is capable of enriching different RNAs from different organisms. Therefore the present inventors believe this protocol will provide the technology required to raise the understanding of ncRNA to the same level as that for the protein factors that regulate chromatin.
  • the CHART enriched material (typically isolated in the form of a hybrization complex, can be analysed to identify its components.
  • Such components may include, without limitation, specific target nucleic acids (e.g., genomic DNA), proteins, and RNAs.
  • the CHART method is set out in Fig 2A and comprises the following general process:
  • capture probes comprise a nucleic acid sequence and at least one affinity label, and wherein the capture probes specifically hybridise with at least one RNA factor that is associated with the target nucleic acid sequence;
  • association of the polypeptide, protein or RNA factors with the target nucleic acid sequence can be covalent (e.g., as achieved by crosslinking, as described herein).
  • Contacting step b) can be under the conditions of step c) (e.g., performed concurrently with step c).
  • Conditions of step c) can be achieved using the appropriate aqueous buffer components and conditions.
  • no SDS is added or used in the aqueous assay.
  • the conditions comprise high ionic strength.
  • the conditions comprise high concentrations of denaturant.
  • high salt concentration is achieved using one or more of sodium chloride, sodium acetate, tetra-alkylammonium salts, lithium chloride, ammonium acetate, and cesium chloride.
  • the salt concentration is greater than or equal to about 100 mM. In one embodiment, the salt concentration is in the range of about 100 mM to no more than about 1.5 M. In one embodiment, the salt concentration is greater than or equal to about 250 mM. In one embodiment, the salt concentration is no greater than about 1M. In one embodiment, the salt concentration is in the range of about 250 mM to no more than about 1M. In one embodiment, the salt concentration is about 800 mM.
  • high denaturant concentration is achieved using one or more of urea, formamide, dimethylsuofoxide, guanidine hydrochloride, and dimethylformamide.
  • the denaturant is present at a final reaction concentration of no less than around 0.5 M. In one embodiment, the final concentration is less than or equal to about 5M. In one embodiment, the final concentration falls within the range of from about 0.5 M to about 5M. In one embodiment, the final concentration is greater than or equal to about 1M. In one embodiment, the final concentration is less than or equal to about 3 M. In one embodiment, the final concentration falls within the range of about 1M to about 3M. In one embodiment, the final concentration is about 2M.
  • An alternative embodiment of the invention provides for capture probes that are already immobilized on a solid substrate.
  • the CHART procedure is summarised as follows:
  • capture probes comprise a nucleic acid sequence and are immobilized on a solid support, and wherein the capture probes specifically hybridise with at least one RNA factor that is associated with the target nucleic acid sequence;
  • the capture probes may be designed by a number of methods, one of which involves RNase H mapping of a specified ncRNA and is described in more detail below. However, it will be understood by the skilled artisan that alternative methods for designing hybridization capture probes may be based on known chemical mapping techniques or bioinformatics analysis of known or projected secondary structure of a specified RNA sequence. However, it should be noted that the CHART process is not limited to use of highly specific PICh probes because, unlike PICh, the CHART capture probes are directed towards hybridization with exposed nucleic acid sequences and not with the genomic DNA.
  • the capture probes utilised in CHART may be characterised by the presence of one or more affinity labels that are spaced apart from the probe oligonucleotide sequence by an intervening group - termed a spacer group.
  • the spacers may be suitably equivalent to those extra-long groups used in PICh probes and described in detail in US patent application serial No. 12/674,163, incorporated herein by reference.
  • spacers of at least 20 atoms in length, typically around 30 atoms in length are suitably used.
  • the capture probe may also be immobilized prior to the
  • Immobilization of the capture probe can be achieved via covalent chemical linkage or affinity interaction (e.g. avidin-biotin interaction), by an affinity label present in the capture probe, as conventionally known in the art.
  • the immobilized capture probe may be bound/linked to a variety of suitable substrates including beads, such as microbeads (e.g. polystyrene or other polymer beads, including magnetic microbeads) or to a solid surface (e.g. including a polymer or glass surface).
  • Analysis of the constituents of the hybridization complex may occur by one or more of the techniques described previously with regards to PICh.
  • the hybridization complex may comprise hybridized DNA-RNA, it is also possible to elute components of the complex for more detailed analysis by way of enzymatic treatment with RNase H.
  • the present invention further resides in the provision of a subset of polypeptides and nucleic acids that are newly identified as possessing chromatin association activity, and thus which potentially act as novel epigenetic factors.
  • the invention facilitates the identification of further epigenetic factors and, importantly, the identification of novel epigenetic activity in known polypeptides.
  • the present invention provides a method by which polypeptides and components of protein complexes associated with chromatin at specified sites in the genome can be characterised. It should be noted that the method of the invention is not limited to those polypeptides that are solely DNA binding, but includes associated polypeptides such as those with histone binding activity, for example.
  • the capture probe may be labelled with one or more suitable affinity tags/labels. Affinity tags may include immuno- tags or haptens.
  • one or more of the nucleotides contained within the probe sequence may be biotinylated (either with biotin or a suitable analogue thereof - e.g.
  • affinity labels may include digoxigenin, dinitrophenol or fluorescein, as well as antigenic peptide 'tags' such as polyhistidine, FLAG, HA and Myc tags.
  • probes will typically comprise only a single type of affinity label.
  • targets of low concentration such as single copy sequences in the genome of an organism, optionally the oligonucleotide probes of the invention may comprise more than one type of tag. The inclusion of more than one affinity tag in the probes of the invention can significantly increase the sensitivity of the process for targets present at low concentration.
  • the chromatin Prior to the hybridization step, the chromatin can be partially enzymatically digested in order to increase the resolution and to facilitate the next step of the method, which involves 'pull-down' of the probe-target sequence hybrid.
  • the chromatin can be fragmented by physical methods such as ultrasonication, or by a combination of physical and enzymatic approaches.
  • a binding moiety that engages the affinity tag and enables the hybridised sequences to be isolated.
  • isolation of the hybridised sequences can be effected in vitro by exposing the hybridised sequences to microbeads coated with streptavidin. In this way the hybridised sequences will bind to the beads and can be precipitated out of solution via a straightforward microcentrifugation step.
  • the microbeads may comprise a magnetic component allowing for immobilisation of the beads via exposure to a magnetic field (see Figure 2A).
  • Alternative isolation strategies include the immobilisation of the probes on a solid substrate such as a microarray support or a dipstick. In this way the 'pull down' is facilitated by localisation to a specific area on a surface, which can then be suitably adapted so as to be suitable for use in later surface-enhanced laser desorption ionization time-of-flight mass spectrometry (SELDI-TOF-MS) analysis of the associated polypeptides.
  • SELDI-TOF-MS later surface-enhanced laser desorption ionization time-of-flight mass spectrometry
  • the purified, or 'pulled-down' hybridised sequences comprise affinity labelled probe hybridised to the target nucleic acid sequence, including ncRNAs, together with any associated chromatin polypeptides, proteins and polypeptide complexes that are bound to the target sequence.
  • affinity labelled probe hybridised to the target nucleic acid sequence, including ncRNAs, together with any associated chromatin polypeptides, proteins and polypeptide complexes that are bound to the target sequence.
  • These associated chromatin polypeptides, proteins and polypeptide complexes can be isolated from the pulled-down material by standard protein precipitation steps and, if required, separated via electrophoretic (e.g. SDS-PAGE) or chromatographic techniques (e.g. HPLC).
  • chromatin associated proteins, polypeptides and nucleic acids can be analysed to determine their identity such as via high throughput identification protocols suitably including the mass spectrometry based technique of peptide mass fingerprinting (PMF).
  • PMF mass spectrometry based technique of peptide mass fingerprinting
  • qualitative changes in the composition of known chromatin associating complexes can be monitored using antibody array technologies that are directed to constituent members of the complexes of interest.
  • the method of the invention is not limited to a specific type of non-coding RNA (nc-RNA) and can be directed a virtually any nucleic acid target which comprises an exposed region in order to identify an associated protein, polypeptide or nucleic acid profile.
  • nc-RNA non-coding RNA
  • the method can be employed at different times in development, in the cell cycle or following exposure of the cell to external stimuli.
  • the method of the invention can allow for detailed profiling of the change in factors associated with a specific target sequence to be monitored.
  • the method of the invention allows for the identification of novel DNA and chromatin associated proteins, polypeptide and nucleic acid factors, many of which may be known but hitherto not considered as having epigenetic, DNA binding or chromatin-associating activities.
  • the present invention provides information on the relative levels of abundance of factors bound to a given sequence in distinct cell types.
  • Identification of the protein and polypeptide factors found to be associated with the specified target sequence can be achieved through a number of routes. Typically the proteins and polypeptides are separated from the probe-target sequence hybrid by
  • proteins/polypeptides are then suitably purified broadly according to molecular weight.
  • the separated proteins can be analysed by several methods to determine identity including western blotting.
  • mass spectrometry based techniques for protein identification are appropriately utilised.
  • protein samples can be derived from SDS-PAGE and then optionally subjected to further chemical modification, such as reduction of disulfide bridges carboxymethylation of cysteine amino acid residues.
  • the proteins/polypeptides are then cleaved into several fragments using a suitable proteolytic enzyme, such as trypsin.
  • the proteolysis step is typically carried out overnight and the resulting cleaved peptides are then extracted with acetonitrile and dried under vacuum. The peptides are then dissolved in a small volume of distilled water and are ready for mass spectrometric analysis. Mass spectrometry can be performed on an aliquot of the purified peptide cleavage fragments via MALDI-TOF mass spectrometry.
  • the output from the MALDI-TOF is then typically analysed in silico, using bioinformatics analytical techniques, and used to query online protein databases such as GenBank or SwissProt in order to identify and provide sequence information for the novel factor (for example, see Griffin et al. (1995) Rapid Commun. Mass Spectrom. 9(15):1546-51; and Courchesne & Patterson (1999) Methods Mol. Biol. 112:487-511).
  • PMF peptide mass fingerprinting
  • PMF identification is optimised where there are several peptide fragments obtained from a given protein the mass of which is accurately known.
  • MALDI-TOF mass spectrometry provides a particularly accurate means to determine the mass of each of these peptide fragments.
  • Proteomic approaches can be used to determine the nature of protein complexes that are composed from the peptides and proteins identified via mass spectrometry (for example see Gingras et al. Nat Rev Mol Cell Biol. (2007)
  • modulator it is meant a molecule (e.g. a chemical substance / entity) that effects a change in the activity of a target molecule (e.g. a gene, enzyme etc.).
  • the change in activity is relative to the normal or baseline level of activity in the absence of the modulator, but otherwise under similar conditions, and it may represent an increase or a decrease in the normal / baseline activity.
  • the modulator may be any molecule as described herein, for example a small molecule drug, an antibody or a nucleic acid.
  • the target is a novel chromatin associated factor that has been identified according to screening method of the invention.
  • the modulation of chromatin-associated factor may be assessed by any means known to the person skilled in the art; for example, by identifying a change in the expression of genes regulated by the chromatin associated factor.
  • the present invention also relates to methods and compositions for the treatment of diseases associated with modified expression of one or more of the novel chromatin associated factors identified according to the method of the present invention.
  • Reagents for the inhibition of expression and/or biological activity of a specified chromatin associated factor include, but are not limited to, antisense nucleic acid molecules, siRNA (or shRNA), ribozymes, small molecules, and antibodies or the antigen binding portions thereof.
  • siRNA or shRNA
  • ribozymes small molecules
  • small molecules and antibodies or the antigen binding portions thereof.
  • the reagents for inhibition of the chromatin associated factor may affect expression and/or biological activity indirectly; for example, by acting on a factor that affects gene expression or that modifies or inhibits the biological activity of the novel chromatin associated factor.
  • the reagent for use as an inhibitor of one of the novel chromatin associated factors identified herein acts directly on the chromatin associated factor, to affect gene expression at the mRNA level (e.g. transcription or mRNA stability), or the protein level (e.g. translation or biological activity).
  • Antisense nucleic acid sequences can be designed that are complementary to and will hybridise with a given mRNA in-vivo. Antisense nucleic acid sequences may be in the form of single stranded DNA or RNA molecules that hybridise to all or a part of the sequence of mRNA for the specified chromatin associated factor. Typically, an antisense molecule is at least 12 nucleotides in length and at least 90%, 93%, 95%, 98%, 99% or 100%
  • Antisense oligonucleotides can be of any reasonable length, such as 12, 15, 18, 20, 30, 40, 50, 100, 200 or more nucleotides, having the advantageous above-mentioned complementarity to its corresponding target nucleotide sequence.
  • An antisense oligonucleotide may contain modified nucleotides (or nucleotide derivatives), for example, nucleotides that resemble the natural nucleotides, A, C, G, T and U, but which are chemically modified. Chemical modifications can be beneficial, for example, in: providing improved resistance to degradation by endogenous exo- and/or endonucleases, to increase the half-life of an oligonucleotide in vivo; enhancing the delivery of an oligonucleotide to a target cell or membrane; or increasing the bioavailability of an oligonucleotide.
  • an antisense molecule contains a mixture of modified and natural nucleotides, and in particular, the 5' most and/or the 3' most nucleotides (e.g. the two outermost nucleotides at each end of the strand) may be modified to increase the half-life of the antisense molecule in vivo.
  • the backbone of an antisense molecule may be chemically modified, e.g. to increase resistance to degradation by nucleases.
  • a typical backbone modification is the change of one or more phosphodiester bonds to a phosphorothioate bonds.
  • An antisense molecule may suitably also comprise a 5' cap structure and/or a poly- A 3' tail, which act to increase the half-life of the antisense molecule in the presence of nucleases.
  • Antisense oligonucleotides can be used to inhibit expression of one or more chromatin associated factors identified according to the method of the present invention in target tissues and cells in vivo. Alternatively, such molecules may be used in an ex vivo treatment, or in an in vitro diagnostic test.
  • antisense molecules for use in therapy may be administered to a patient directly at the site of a tumour (for example, by injection into the cell mass of the tumour), or they can be transcribed from a vector that is transfected into the tumour cells.
  • Transfection of tumour cells with gene therapy vectors can be achieved, for example, using suitable liposomal delivery systems or viral vectors (Hughes, 2004, Surg. Oncol., 85(1): 28- 35).
  • RNA interference is typically initiated by long double- stranded RNA molecules, which are processed by the Dicer enzyme into 21 to 23 nucleotides long dsRNAs having two -nucleotide overhangs at the 5' and 3' ends.
  • the resultant short dsRNA molecules are known as small interfering RNAs (siRNAs).
  • siRNAs small interfering RNAs
  • RISC RNA-induced silencing complex
  • siRNAs short (e.g. 19 to 23 bp) dsRNA molecules
  • siRNAs can initiate RNAi, and that such molecules allow for the selective inactivation of gene function in vivo, for example, as described in Elbashir et al. (2001, Nature, 411: 494-498).
  • this technique provides a means for the effective and specific targeting and degradation of mRNA encoding a chromatin associated factor in cells in vivo.
  • the invention provides siRNA molecules and their use to specifically reduce or eliminate the expression in cells of one or more chromatin associated factors identified by the methods of the present invention.
  • an siRNA or shRNA molecule for in vivo use advantageously contains one or more chemically modified nucleotides and/or one or more modified backbone linkages.
  • compositions of the invention are formulated to conform to regulatory standards and can be administered orally, intravenously, topically, or via other standard routes.
  • the pharmaceutical preparations may be in the form of tablets, pills, lotions, gels, liquids, powders, suppositories, suspensions, liposomes, microparticles or other suitable formulations known in the art.
  • the invention encompasses the use of molecules that can regulate or modulate activity or expression of the novel chromatin associated factors of the invention for treating disease.
  • diseases associated with aberrant activity or expression of chromatin-associated factors will include: cancer, premature aging, inflammatory disease, autoimmune disease, virally induced diseases and infections and infertility.
  • Novel chromatin associated factors (polypeptides, nucleic acids or fragments thereof) identified by the methods of the invention can be recombinantly expressed individually or in combination to create transgenic cell lines and purified factors for use in drug screening.
  • Cell lines over-expressing the chromatin associated factors or fragments thereof can be used, for example, in high-throughput screening methodologies against libraries of compounds (e.g. "small molecules"), antibodies or other biological agents.
  • screening assays may suitably be either cell-based assays, in which defined phenotypic changes are identified (analogous to calcium signalling in GPCR FLIPR screening), or can serve as the source of high levels of purified proteins for use in affinity-based screens such as radioligand binding and fluorescence polarisation.
  • the information derived from the method of the present invention allows for the accurate identification of a chromatin activity for many factors in the cell.
  • the present invention allows for a more focussed approach to drug discovery and target selection.
  • the identification of the proteins and nucleic acids that interact with genomic regions of interest is also critical to the understanding of genome biology.
  • the methods of the present invention significantly advance the characterization of chromosomes and epigentics as a whole.
  • the methods of the present invention have the ability to identify factors that would be difficult to uncover using genetics because they either play vital roles elsewhere or are redundant (e.g. orphan receptors).
  • the present invention relates to the herein described compositions, methods, and respective component(s) thereof, as essential to the invention, yet open to the inclusion of unspecified elements, essential or not ("comprising).
  • other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the invention ("consisting essentially of). This applies equally to steps within a described method as well as compositions and components therein.
  • the inventions, compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method ("consisting of).
  • the present invention may be as defined in any one of the following numbered paragraphs.
  • RNA sequence RNA sequence that is associated with the target nucleic acid sequence
  • capture probes comprise a nucleic acid sequence and at least one affinity label, and wherein the capture probes specifically hybridise with the at least one RNA sequence;
  • ncRNA non-coding RNA
  • the one or more factors comprise at least one messenger RNA (mRNA).
  • RNA sequence that is associated with the target nucleic acid sequence is a ncRNA.
  • RNA sequence that is associated with the target nucleic acid sequence is an mRNA.
  • the affinity label is selected from the group consisting of: biotin or an analogue thereof; digoxigenin; fluorescein; dinitrophenol; and an immunotag.
  • biotin analogue is desthiobiotin.
  • the probe-target hybrid is immobilized through a molecule that binds to the at least one affinity label and which molecule is attached to a solid substrate.
  • the solid substrate comprises a microbead.
  • the microbead is capable of being magnetically separated from a solution.
  • the method of paragraph 1 wherein the one or more factors associated with the target nucleic acid sequence are exposed to conditions that result in crosslinking of the one or more factors prior to the step (c) of exposing the sample to the capture probe, and wherein the crosslinking is reversed prior to the step (e) of analyzing the constituents of the isolated hybridization complex so as to identify the one or more factors associated with the target nucleic acid sequence.
  • the conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence in part (c) comprise high ionic strength and high concentration of a denaturant compound.
  • the denaturant compound is urea.
  • the method comprises an additional pre- treatment step prior to step (a) in which the at least one ribonucleic acid (RNA) sequence that is associated with the target nucleic acid sequence is mapped in order to identify regions of the RNA that are accessible to hybridization with a capture probe.
  • the mapping of the RNA sequence comprises exposing the RNA sequence to RNase H in the presence of one or more
  • mapping of the RNA sequence comprises determining whether the target RNA sequence co-purifies with chromatin when analysed in the form of a sheered chromatin extract.
  • a method for identifying one or more factors associated with a region of chromatin that comprises at least one genomic locus, wherein the one or more factors comprise at least one ribonucleic acid (RNA) sequence that is capable of associating with the at least one genomic locus comprising the steps of:
  • the capture probes comprise a nucleic acid sequence and at least one affinity label, wherein the affinity label is conjugated to the one or more capture probes via a spacer group, and wherein the capture probes specifically hybridise with the at least one RNA sequence;
  • the region of chromatin comprises one or more of the group consisting of: a telomere; a centromere; euchromatin; heterochromatin; a gene; a repeat sequence; a heterologously inserted sequence; and an integrated viral genome.
  • the at least one RNA is a non-coding RNA (ncRNA).
  • ncRNA non-coding RNA
  • a method for identifying one or more factors associated with a region of chromatin that comprises at least one genomic locus, wherein the one or more factors comprise at least one ribonucleic acid (RNA) sequence that is capable of associating with the at least one genomic locus comprising the steps of:
  • the capture probes comprise a nucleic acid sequence and wherein the capture probes are immobilized on a solid substrate;
  • step (b) synthesizing one or more capture probes, wherein the capture probes comprise a nucleic acid sequence and at least one affinity label, wherein the affinity label is conjugated to the one or more capture probes via a spacer group, and wherein the capture probes are able to hybridize with the at least one ncRNA sequence in a region defined as accessible to hybridization by step (a);
  • step (a) comprises exposing the ncRNA sequence to RNase H in the presence of one or more complementary DNA
  • oligonucleotides determining the location of any RNase H cleavage sites that result from hybridization of the ncRNA to the one or more complementary DNA
  • capture probes comprise a nucleic acid sequence and at least one affinity label, and wherein the nucleic acid sequence of the capture probes is complementary to and will specifically hybridize with at least a part of the at least one RNA sequence;
  • a hybridization buffer solution for providing conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration of a denaturant;
  • a label comprising set of instructions on how to perform the assay.
  • the assay of paragraph 42 wherein the affinity label is conjugated to the one or more capture probes via a spacer group.
  • the assay of paragraph 42 further comprising: (iv) a solid substrate that comprises a molecule that is capable of binding to the at least one affinity label and which molecule is attached to the solid substrate.
  • microbead comprises magnetic particles so that it is capable of being magnetically separated from a solution.
  • capture probes comprise a nucleic acid sequence and wherein the capture probes are immobilized on a solid substrate, and wherein the nucleic acid sequence of the capture probes is complementary to and will specifically hybridize with at least a part of the at least one RNA sequence;
  • a hybridization buffer solution for providing conditions that allow the one or more capture probes to hybridise with the at least one RNA sequence so as to form a hybridization complex between the capture probe, the at least one RNA, the target nucleic acid sequence and the one or more factors associated with the target nucleic acid sequence, wherein the conditions comprise high ionic strength and the presence of high concentration of a denaturant;
  • microbead comprises magnetic particles so that it is capable of being magnetically separated from a solution.
  • a method for identifying one or more genomic DNA target nucleic acids of a non- coding RNA sequence comprising, a) treating a chromatin extract comprising the ncRNA, to thereby reversibly crosslink the ncRNA present in the extract to an associated genomic DNA target nucleic acid(s) present in the extract; b) contacting the extract from step a) with one or more capture probes specific to the ncRNA under conditions that allow the capture probes to specifically hybridize with the ncRNA to thereby form a hybridization complex comprised of the capture probe(s), the ncRNA and the associated genomic DNA target nucleic acid(s); c) isolating the hybridization complex by immobilizing the one or more capture probes in the context of the hybrization complex; and d) analyzing DNA in the hybrization complex to thereby identify the genomic DNA target nucleic acid(s).
  • ncRNA non- coding RNA sequence
  • analyzing the hybridization complex comprises: a) treating the hybridization complex to uncross-link the ncRNA and associated genomic DNA target nucleic acid(s); and b) sequencing the genomic DNA target nucleic(s) acid present in the hybrization complex.
  • a method for identifying one or more factors associated with a non-coding RNA sequence comprising, a) treating a genomic DNA extract comprising the ncRNA, to thereby reversibly crosslink the ncRNA present in the extract to one or more associated genomic DNA target nucleic acids present in the extract; b) contacting the extract from step a) with one or more capture probes specific to the ncRNA under conditions that allow the capture probes to specifically hybridize with the ncRNA to thereby form a hybridization complex comprised of the capture probe(s), the ncRNA and the associated genomic DNA target nucleic acid(s); c) isolating the hybridization complex by immobilizing the one or more capture probes in the context of the hybrization complex; and d) analyzing the hybridization complex for the presence of associated proteins or RNAs, to thereby identify factors associated with the ncRNA.
  • ncRNA non-coding RNA sequence
  • analyzing step d) comprises performing western blot analysis of proteins present in the hybridization complex to thereby analyze the hybridization complex for the presence of associated proteins.
  • analyzing step d) comprises performing PCR on RNA present in the hybridization complex to thereby analyze the hybridization complex for the presence of RNAs.
  • analyzing step d) further comprises performing sequencing of the RNA present in the hybridization complex.
  • a method for determining one or more oligonucleotide sequences for use in a capture probe for a specific ncRNA, for use in Capture Hybridization Analysis of RNA Targets comprising: a) preparing a reversibly cross-linked chromatin extract; b) providing candidate oligonucleotides; c) separately combining each of the candidate oligonucleotides of step b) to the reversibly cross-linked chromatin extract, the presence of RNase H, under conditions suitable for RNA hydrolysis of RNA-DNA hybrids, to thereby produce a chromatin-oligonucleotide mixture; d) performing RT-qPCR on the chromatin-oligonucleotide mixture to detect RNAse H sensitivity; and e) identifying a candidate oligonucleotide as a sequence for use as a capture probe for CHART when RNAse H sensitivity in step d) is detected.
  • a kit comprising one or more capture probes optimized for use in Capture Hybridization Analysis of RNA Targets (CHART) for a specific ncRNA.
  • CHART Capture Hybridization Analysis of RNA Targets
  • ncRNAs ncRNAs
  • mRNAs mRNAs
  • Drosophila MSL complex selectively identifies active genes on the male X chromosome. Genes & Development (2006) vol. 20 (7) pp. 848-57) were grown in shaker flasks in serum- free CCM3 medium (Hyclone). HeLa cells were grown in suspension under standard conditions using DMEM supplemented with 10% Calf Serum.
  • glycerol buffer 25% glycerol, 10 mM HEPES pH 7.5, 100 mM KOAc, 1 mM EDTA, 0.1 mM EGTA, 0.5 mM spermidine, 0.15 mM spermine, 1 mM DTT, 10 units/mL SUPERasIN, IX Roche complete EDTA-free protease inhibitor cocktail
  • GB 25% glycerol, 10 mM HEPES pH 7.5, 100 mM KOAc, 1 mM EDTA, 0.1 mM EGTA, 0.5 mM spermidine, 0.15 mM spermine, 1 mM DTT, 10 units/mL SUPERasIN, IX Roche complete EDTA-free protease inhibitor cocktail
  • nuclei were either processed directly without further crosslinking, or crosslinked further.
  • the pellet was crossliked further as follows.
  • the enriched nuclei were rinsed twice with nuclei rinse buffer (NRB, 50 mM HEPES pH 7.5, 75 mM NaCl, 10 units/mL SUPERasIN). This pellet was then resuspended in NRB (40 mL) and of concentrated formaldehyde added (10 mL of 16% w/v, MeOH free). This mixture was incubated with rotation at room temperature for 30 min.
  • the enriched nuclei were rinsed two times with NRB, and once with either wash buffer with 100 mM NaCl (WB100, 100 mM NaCl, 50 mM HEPES pH 7.5, 0.1% SDS, 0.05% N-lauroylsarcosine) or sonication buffer (for RNase H mapping, 50 mM Tris 8.2, 75 mM KC1, 0.5% N- lauroylsarcosine, 0.1 % sodium deoxycholate, 1 mM DTT, 10 units/mL SUPERasIN, IX Roche complete EDTA-free protease inhibitor cocktail).
  • WB100 100 mM NaCl
  • 50 mM HEPES pH 7.5 0.1% SDS
  • 0.05% N-lauroylsarcosine sonication buffer
  • sonication buffer for RNase H mapping, 50 mM Tris 8.2, 75 mM KC1, 0.5% N- lauroylsarcosine, 0.1 % sodium
  • the pellet was resuspended to 3 mL total volume in the same buffer and the chromatin solubilized using a Misonix 3000 sonicator (microtip, 10 min treatment, 15 sec on, 45 seconds off, power level between 4-7 to maintain 35-45 W power) on ice. After sheering, the extract was cleared by centriguation (16,100g, 10 min, rt). The extract was either used immediately for CHART or flash frozen and stored at - 80°C. For nuclei that were used without further crosslinking, instead of sonication, the nuclei were solublized using a Covaris instrument (30 min., 10% duty cycle, intensity of 5).
  • RNase H mapping Crosslinked chromatin extract was thawed on ice and supplemented with SUPERasIN (1 unit L), MgC12 (3 mM), DTT (10 mM) and RNase H (0.5 units/ ⁇ , NEB). The extract was dived into 10 ⁇ ⁇ reactions in strips of PCR tubes, and to each tube a different oligonucleotide was added (1 of 100 ⁇ ). The reactions were allowed to proceed for 30 min at 37 °C in a PCR block. Then DNase (1 ⁇ L ⁇ RQ, Promega) and CaCl 2 (0.1 ⁇ ⁇ of 60 mM) were added.
  • RNA from the reactions were purified using PureLink RNA purification kit (Invitrogen) according to the manufacturer's directions including an on-column DNase treatment step.
  • the RNA (7 ⁇ L ⁇ from 30 ⁇ ⁇ eluant) was reverse-transcribed using VILO (Invitrogen) and analyzed by qPCR on an ABI 7500 instrument.
  • the RNase H sensitivity was determined according to the formula:
  • RatlO (EfflCienCytarget RNA) B /(Efficiency CO ntroi R A) B
  • Pre-rinsed streptavidin-coated magnetic beads 150 ⁇ , MyOne Dynabeads CI, Invitrogen, cat 650.02 were resuspended in ddH20 (100 ⁇ ) and urea buffer (50 ⁇ ) and combined with the hybridized extract. This mixture was allowed to incubate on a roller at room temperature overnight.
  • the bead mixture was transferred to a fresh tube and captured with a magnet, rinsed 5 times with WB250 (250 mM NaCl, 50 mM HEPES pH 7.5, 0.1% SDS, 0.05% N-lauroylsarcosine) and eluted with 200 ⁇ , of biotin elution buffer (50 ⁇ , of 50 mM biotin diluted in 150 ⁇ , WB250) for lh at room temperature with shaking.
  • WB250 250 mM NaCl, 50 mM HEPES pH 7.5, 0.1% SDS, 0.05% N-lauroylsarcosine
  • an RNase H mapping protocol was developed wherein accessible sites in the target ncRNA are assayed by their sensitivity to cleavage by RNase H in the presence of candidate complementary oligonucleotides. Since RNase H only cleaves DNA-RNA hybrids, the target RNA is only cleaved in the presence of DNA oligonucleotides capable of hybridizing to the target RNA. This strategy has been used to map sites of ncRNAs available for hybridization in native extracts. Since CHART is performed on formaldehyde crosslinked chromatin extracts, the RNase H mapping protocol needed to be adapted to identify sites available for hybridization in crosslinked extracts.
  • nt ncRNA is an important regulator of dosage compensation in Drosophila and has been shown to function through a protein-nucleic acid complex referred to as the MSL complex.
  • This ncRNA was chosen because it is abundant, has known protein binding partners and expected sites of interaction with the X-chromosome in a well established cell culture system (Gelbart and Kuroda. Drosophila dosage compensation: a complex voyage to the X
  • oligonucleotides in the presence of RNase H the cleavage of the roX2 target RNA was measured by RT-qPCR ( Figure 3A).
  • Rnase H sensitivity was measured across the roX2 RNA. The cleavage was assayed both by primers that span the site of cleavage and ones that do not. Peaks of sensitivity were only observed using primers spanning the expected sites.
  • cleavage was clearly site specific; the sensitivity was observed between the appropriate primer pairs, but not using primers that covered other regions of the RNA.
  • the peaks in the RNase H sensitivity were used to design capture oligonucleotides complementary to roX2 RNA (see Table 1). The design of these oligonucleotides was initially based on the LNA-bearing ones used in PICh.
  • probes comprising one or more modified nucleotides may be more suited in order to obtain improved hybridization or yield.
  • Table 1 Capture oligonucleotides used in this Example. All sequences are listed 5' to 3'. L indicates the spacer C18 residue. DSB stands for desthiobiotin--TEG.
  • R2 AS1 CAT CGA AAG GGT AAA TTG GTG TTA LLL L- DSB SEQ ID NO: 5
  • R2 AS2 TTG AAT TGT CTT ACG GAC AGT GAG ALL LL -DSB SEQ ID NO 6
  • R2 AS 3 TCT CCG AAG CAA AAT CAA GCA AGA GLL LL -DSB SEQ ID NO 7
  • urea denaturant
  • urea denaturant
  • the reaction conditions may be varied between the above mentioned parameters depending on the nature of the target sequence (e.g. the relative abundance of target in the sample material).
  • the CHART enriched material was assayed by qPCR in a manner analogous to a ChIP experiment for a protein to look for enrichment of specific loci of the genome, especially known sites of MSL protein function.
  • roX2 was found to be enriched both at its own locus as well as at a well-characterized chromatin entry site (CES-5C2) as shown in Figure 8. This enrichment was specific since other loci (pka-Cl and Act87E) and genes known to escape dosage compensation (CG15570) were not substantially enriched by roX2 CHART.
  • roX2 binding sites (e.g.,Peak-5Al, Figs 2B& 6D) including chromatin entry sites (CESs). e.g.,CES-5C2, Fig4B-E), which are thought to be the initial points of assembly of the complex before it spreads into flanking chromatin to regulate active genes.
  • CESs chromatin entry sites
  • Fig4B-E chromatin entry sites
  • the roX2 CHART results demonstrate that the roX2 binding pattern is very similar to that of the protein components of the MSL complex, demonstrating that the CHART experiment can be used to study RNAs in a directly analogous way to a ChIP experiment.
  • RNAs were targeted from HeLa extracts (i.e. human cells), NEATl and MALATl. These two ncRNAs neighbor each other in the genome, yet localize to distinct nuclear bodies. MALATl localizes to nuclear speckles whereas NEATl localizes to nuclear paraspeckles. While little is known about their interaction with chromatin and their expected interacting loci, all expressed RNAs are likely to be found at their site of transcription.
  • This protocol provides a systematic means of developing probe oligonucleotides that can function for RNAs in a manner similar to how antibodies have been used for proteins. While previously developed and now well-established technologies have used oligonucleotides to perform northern blots (in experiments analogous to western blots for proteins), and in situ hybridization (analogous to IF for proteins), other experiments that can currently be performed with protein targets such as co-IP, RIP and ChIP have not been generally available for RNAs. As demonstrated here, CHART provides the necessary technology to bridge this gap. CHART was demonstrated capable of enriching roX2 RNA along with its associated proteins and nucleic acids. As one exemplary application, CHART was used to create a genome wide map of the chromatin loci where roX2 ncRNA binds.
  • CHART is not restricted to roX2 in flies; two mammalian RNAs have also been enriched with their associated factors using CHART.
  • CHART can already be used to discover new interactions.
  • This technology could be useful also for mRNA analysis too, specifically for looking at localized mRNAs, the machinery that transports mRNAs and any other RNAs that are bound in the same complexes.
  • proteomic techniques such as SILAC (stable isotope labeling by/with amino acids in cell culture), CHART can be extended to discover new protein factors that interact with a given target RNA.
  • CHART can facilitate the understanding of the role of RNAs, including ncRNAs, in cellular biology.
  • IncRNAs that influence chromatin include the roX ncRNAs in flies and Xist in mammals, both having well-established roles in dosage compensation (8, 9); Kcnqlotl and Air ncRNAs, which are expressed from genomically imprinted loci and affect chromatin silencing (10-13); Evf2, HSR1, and other ncRNAs that positively regulate transcription (14-16); IncRNAs that target the dihydrofolate reductase promoter and the rDNA promoters through triplex formation (17, 18); and the human HOT AIR and HOTTIP IncRNAs, which regulate polycomb-repressed and trithorax- activated chromatin, respectively (19, 20).
  • RNA can interact with a chromatin locus, including direct interactions with the DNA (through canonical Watson- Crick base pairing or nonconical structures such as triple helices) or indirect interactions mediated through a nascent RNA or protein (28).
  • IncRNAs Determining the direct functions of IncRNAs requires knowledge of where they act. This requirement motivates the development of technology to generate genomic binding profiles of IncRNAs in chromatin that is analogous to chromatin immunoprecipitation (ChIP) for proteins. Ideally, this technology would (i) provide enrichments and resolution similar to ChIP, (ii) use cross-linking conditions that are reversible and allow for analysis of RNA, DNA, and protein from the same enriched sample, and (iii) provide adequate controls to distinguish RNA targets from the background signal. Although there are several techniques that localize RNAs on chromatin, none fulfill all these criteria.
  • FISH fluorescence in situ hybridization
  • a related biochemical approach which relies on indirect biotinylation of biomolecules near the target RNA
  • FISH fluorescence in situ hybridization
  • 31 a related biochemical approach
  • nucleic-acid probes to retrieve IncRNAs from cross-linked extracts has been shown (32), but it is unclear if the signal was RNA-mediated or rather due to direct interactions of the long capture oligos with complementary regions found in nearby DNA. Either way, the efficiency and specificity of these technologies have not allowed the precision required for high-resolution genome- wide profiling.
  • CHART capture hybridization analysis of RNA targets
  • CHART capture hybridization analysis of RNA targets
  • a hybridization-based purification strategy that can be used to map the genomic binding sites for endogenous RNAs.
  • CHART is used to purify IncRNAs and their associated protein and DNA targets and to determine the genome- wide localization of roX2 RNA in chromatin.
  • the work began by identifying regions of the target RNA available for hybridization to short, complementary oligonucleotides. Affinity- tagged versions of these oligonucleotides were then designed to retrieve the target RNA along with its associated factors from reversibly cross-linked chromatin extracts under optimized CHART conditions.
  • CHART By isolating and purifying the CHART-enriched DNA fragments, analogous to ChIP, CHART allows the identification of the genomic binding sites of endogenous RNAs ( Figure 1). These data definitively demonstrate that a IncRNA, roX2, localizes to the same sites across the genome as the chromatin-modifying protein complex with which it is proposed to act. Together, these data demonstrate the utility of CHART as a tool in the study of RNAs.
  • a cocktail of three approximately 25-mer DNA -based C-oligos was found to provide a low background signal and high specific yields of roX2 in a buffer with high ionic strength and high concentrations of denaturants (Figure 11 A).
  • Approximately half of roX2 RNA input could be retrieved from the cross-linked chromatin extract. This enrichment was specific; CHART using a scrambled control C-oligo did not enrich roX2, and control RNAs were not enriched by roX2 CHART. It was concluded that DNA-based C-oligos hybridizing to RNase-H- sensitive locations on a target RNA can specifically enrich the RNAs from a cross-linked chromatin extract.
  • RNA-mediated enrichment of the regulatory site was substantial (> 100-fold over a control locus and > 1000-fold over the sense-oligo control), and the yields (approximately 1-2%) were similar to those retrieved by ChlP.
  • roX2 CHART successfully enriched roX2-associated targets, whether these same conditions are general for enrichment of other RNAs was tested, including longer mammalian IncRNAs.
  • CHART was applied to endogenous NEATl (3.8 kb), a IncRNA found in human cells, and compared the enrichment to another human IncRNA, MALATl (> 6.5 kb) in two different cell lines (42-48).
  • MALATl > 6.5 kb
  • these IncRNAs are both retained in the nucleus, undergo similar processing, and are encoded next to each other in the genome, they have distinct localizations in the nucleus, NEATl localizing to paraspeckles and MALATl to nuclear speckles (49, 50).
  • NEATl assembles co transcriptionally with paraspeckle proteins
  • NEATl CHART fluorescence-imaging experiments suggest that NEATl is retained at its endogenous locus (51). Both NEATl and MALATl CHART demonstrated specific enrichment of their own endogenous genomic loci but not the other's ( Figure 12B and Figure 16C). Pretreatment of the extract with RNase abrogates the CHART signal ( Figure 12B and Figure 16C), demonstrating that CHART enrichment is RNA-mediated. In addition to retrieving the endogenous NEATl locus, we expected NEATl CHART to enrich paraspeckle proteins. Indeed, robust and specific RNA-dependent enrichment of both PSPC1 and p54/nrb (Figure 3C), two proteins found in paraspeckles that interact with NEATl (43, 46, 47) was found. Thus, the analysis of the DNA and proteins enriched by NEATl CHART demonstrates that the conditions developed for roX2 CHART also work for a longer endogenous IncRNA from human cells, supporting the generality of CHART.
  • roX2 CHART-enriched DNA was sequenced to generate a genome- wide binding profile for roX2.
  • roX2 is known to localize to the X chromosome (chrX) (52-54), where it acts together with the MSL complex (including protein subunits MSL1, MSL2, MSL3, MLE, and MOF) (9).
  • the MSL complex affects dosage compensation, at least in part, by regulating acetylation of histone H4 lysine 16 (H4K16) in the bodies of active genes (55- 60) and influencing transcriptional elongation (61). Therefore strong enrichment of the roX2 CHART-seq signal on chrX was expected, and roX2 was further investigated by examining its distribution in comparison with ChIP results for proteins and modifications associated with dosage compensation.
  • CHART signals on chrX is consistent with the role of roX2 in dosage compensation.
  • the MSL complex is thought to find its binding sites through at least two different mechanisms. Genetic and molecular experiments have revealed a set of 150-300 high- occupancy sites containing a GA-rich sequence motif (41, 62). These sites may act as chromatin entry sites for initial, sequence-specific recognition, followed by spreading to sites on the chrX located in active genes (9). This second class of sites is thought to be recognized through general marks of active transcription, such as H3K36me3, because active autosomal genes can acquire MSL binding when inserted on X (63). Genome- wide CHART of roX2 allowed us to test whether roX2 RNA has the same preference for chromatin entry sites as the MSL complex.
  • CHART-seq could have proven significantly worse than ChlP-seq because CHART requires a higher degree of cross-linking.
  • any loss of resolution observed for CHART-seq is minor as can be seen by comparing MSL3-TAP (where TAP is a tandem affinity purification epitope tag) ChlP-seq signals to roX2 CHART-seq signals ( Figure 13A and B). Therefore CHART appears similar to ChIP in enrichment and resolution.
  • ChIP and CHART provide information about the localization of the factor to chromatin loci but do not reveal the molecular basis of the interaction; CHART- enriched targets could either be directly bound to the RNA or bound through other factors such as bridging proteins or RNAs. No evidence that roX2 binding sites are enriched for sequences with Watson-Crick complementarily to roX2 was found (Table 2), which suggests that the interactions between roX2 and these loci are indirect, very short, or based on non- Watson-Crick interactions.
  • CHART-enriched material can be used to examine either candidate genomic loci or genome- wide binding profiles. Both were applied to roX2 and roX2 was found localized to dosage-compensated regions on chrX, as expected. Comparison of the high-resolution map from roX2 CHART with published data for the MSL complex achieved by using ChIP revealed that roX2 binds at the same sites in chromatin as the MSL complex. Because many IncRNAs are thought to act together with chromatin-modifying machinery, this comparison allowed validation of the previously untested inference that a IncRNA can act at the same sites on chromatin across the genome as its associated chromatin-modifying complex.
  • CHART was used successfully for a longer mammalian ncRNA from two different cell lines ( Figure 12 and Figure 16). Few IncRNAs are known to bind to specific genomic sites, but RNAs can be retained near their endogenous loci, serving as a positive control for CHART enrichment without previous knowledge of trans-acting sites. It was found that CHART analysis of endogenous loci can be complicated by the direct DNA binding of the C-oligos, but using RNase-pretreated extract allows this artifactual signal to be distinguished from the desired RNA-mediated CHART signal. Analysis of the RNAs examined here shows that CHART may be successfully applied to RNAs of different lengths and origin.
  • oligonucleotides as affinity reagents will always raise the potential of direct or indirect off- target hybridization. From analysis of the autosomal biotin-eluted roX2 CHART peaks, particular caution was found to be required when interpreting sharp peaks ( ⁇ 600 bp) and peaks that contain motifs with homology to the target RNA; this pattern is indicative of likely artifacts and therefore requires further experimentation. In the case of roX2 CHART, the CHART-identified binding sites were not found to have homology to the RNA, which demonstrates that these potential artifacts were avoided.
  • CHART can also be used to examine other RNA associated factors; we have demonstrated this point by analyzing CHART-enriched material by Western blot for protein targets ( Figures 11C and 12C).
  • CHART involves reversible cross -linking
  • the enriched material can be used for the reciprocal of an RNA-IP; instead of pulling down protein and looking for RNA, CHART allows enrichment of the RNA and examination of which proteins copurify by Western blot. Therefore, although this work focused on the use of CHART to examine DNA targets, CHART-enriched material can also be analyzed for other factors, and the extension of CHART to proteomic analyses is also expected to uncover RNA-associated proteins.
  • CHART a technique that allows determination of RNA targets.
  • CHART was successfully applied to IncRNAs of different lengths from two different organisms. CHART was able to be extended to robust genome- wide analysis and from this analysis the previously untested inference that a IncRNA can act across the genome at the same sites as an associated chromatin-modifying complex was addressed.
  • extract 250 ⁇ , 8 x 10 7 cell equivalent
  • hybridization conditions (20 mM Hepes pH 7.5, 817 mM NaCl, 1.9 M urea, 0.4% SDS, 5.7 mM EDTA, 0.3 mM EGTA, 0.03% sodium deoxycholate, 5x Denhardt's solution) and precleared with ultralink-streptavidin resin (Pierce).
  • C-oligos 800 nM each R2.1-3) were added and hybridized (55 °C for 20 min; 37 °C for 10 min; 45 °C for 60 min; 37 °C for 30 min).
  • streptavidin beads [(MyOne CI;
  • Invitrogen overnight, room temperature (RT)], rinsed five times with WB250 (250 mM NaCl, 10 mM Hepes pH 7.5, 2 mM EDTA, 1 mM EGTA, 0.2% SDS, 0.1% N- lauroylsarcosine), and eluted with 12.5 mM biotin in WB250 for 1 h at RT.
  • WB250 250 mM NaCl, 10 mM Hepes pH 7.5, 2 mM EDTA, 1 mM EGTA, 0.2% SDS, 0.1% N- lauroylsarcosine
  • RNase- pretreated extract RNase (Roche, DNase-free, 1 was added to the initial extract and allowed to incubate for 10 min at RT prior to adjusting to hybridization conditions.
  • RNase- H-eluted CHART was performed similarly, except we omitted the prebinding to ultralink- streptavidin resin and used higher concentrations C-oligos (1.3 ⁇ each).
  • the final rinse was with RNase-H rinse buffer (50 mM Hepes pH 7.5, 75 mM NaCl, 3 mM MgC12, 0.125% N-lauroylsarcosine, 0.025% sodium deoxycholate, 20 u/mL
  • Cells (approximately 10 10 cells) were harvested by centrifugation (500 x g, 15 min, 4 °C), rinsed once with PBS, resuspended to 200 mL with PBS, and cross-linked [1% formaldehyde, 10 min, room temperature (RT)], rinsed three times with PBS, and stored at -80 °C or carried forward directly to prepare nuclei. Nuclei were enriched essentially as described ( Dennis JH, et al. (2007) Genome Res 17:928-939).
  • sucrose buffer 0.3 M sucrose, 1% Triton X- 100, 10 mM Hepes pH 7.5, 100 mM KOAc, 0.1 mM EGTA, 0.5 mM spermidine, 0.15 mM spermine, lx Roche protease inhibitor tablet, 1 mM DTT, 10 u/mL SUPERasIN
  • glycerol buffer 25% glycerol, 10 mM Hepes pH 7.5, 100 mM KOAc, 1 mM EDTA, 0.1 mM EGTA, 0.5 mM spermidine, 0.15 mM spermine, lx Roche protease inhibitor tablet, 1 mM DTT, 10 u/mL SUPERasIN
  • glycerol buffer 25% glycerol, 10 mM Hepes pH 7.5, 100 mM KOAc, 1 mM EDTA, 0.1 mM EGTA, 0.5 mM spermidine
  • the crosslinked nuclei were collected by centrifugation (1;000 x g, 15 min, 4 °C). This protocol was also used to prepare cross-linked nuclei from HeLa cells, except by using tenfold fewer cells for the same volumes (i.e., preparing 10 nuclei).
  • Chromatin Extract for RNase-H Mapping Chromatin Extract for RNase-H Mapping. Chromatin extract for RNase-H mapping was prepared by rinsing nuclei with shearing buffer (50 mM Hepes pH 7.5, 75 mM NaCl, 0.1 mM EGTA, 0.5% N-lauroylsarcosine, 0.1% sodium deoxycholate, 20 u/mL SUPERasIN, 5 mM DTT) and resuspending into 4 mL buffer/10 9 nuclei for S2 cells or 4 mL buffer/10 HeLa nuclei.
  • shearing buffer 50 mM Hepes pH 7.5, 75 mM NaCl, 0.1 mM EGTA, 0.5% N-lauroylsarcosine, 0.1% sodium deoxycholate, 20 u/mL SUPERasIN, 5 mM DTT
  • This material was sheered using a Covaris S2 instrument (30-min program, 10% duty cycle, intensity of 5, 4 °C) and then cleared by centrifugation (16; 100 x g, 10 min, RT). The cleared extract was divided into aliquots, flash frozen with N2, and stored at -80 °C or used directly for RNase-H mapping reactions.
  • Capture Oligonucleotides Peaks from RNase-H mapping were identified and used to design 24-25 nt C-oligos using BLAST to avoid complementarity to other RNA sequences. The resulting C-oligos were synthesized on an Expidite DNA synthesizer with 3'- desthiobiotin (DSB-TEG) and four oligoethyleneglycol spacers. The oligonucleotides were synthesized 4,4'-dimethoxytrityl-on for purification using PolyPak II cartridges (Glen Research). C-oligos used for RNase-H-eluted capture hybridization analysis of RNA targets (CHART) were 3'-modified by a single oligoethyleneglycol spacer and biotin-TEG.
  • CHART RNase-H-eluted capture hybridization analysis of RNA targets
  • DNA fragments were isolated, further sheared (Lieberman- Aiden E, et al. (2009) Science 326:289-293), sequenced (Illumina GAIIx or HiSeq) and mapped to the Drosophila genome (dm3, Bowtie aligner, Langmead et al., (2009) Genome Biol 10:R25), recording positions of uniquely mappable reads.
  • the enrichment of the biotin- CHART signal was determined relative to the sense-oligo controls and the RNase-H-eluted CHARTsignal was determined relative to input.
  • Nl.YELLOW.F GGGGCGGATCGGTGTTGCTT (SEQ ID NO: 22)
  • GAPDH.F AAGGTGAAGGTCGGAGTCAA (SEQ ID NO: 46)
  • GAPDH.R GGAAGATGGTGATGGGATTT (SEQ ID NO: 47)
  • Clark MB et al.(2011) PLoS Biol 9:el000625.
  • the two X-chromosomes are not identical; one is coated by the Xist RNA and inactivated (referred to as the Xi) and one is not coated by Xist and is active (referred to as the Xa).
  • the Xist RNA is important for this process (reviewed in Lee et al. PMC2725936). While it is clear that the Xist RNA plays a role in X-chromosome inactivation and this role is connected to the localization of Xist on the X-chromosome, molecular characterization of the
  • Capture oligonucleotides were designed using RNase H mapping that target regions of the Xist RNA within 5 kb of the 5'-end of the RNA. This region had been previously demonstrated to be important for Xist RNA localization. Using these caputre oligonucleotides and conditions that were developed for roX2 CHART described above, Xist- associated DNA was enriched and analyzed.
  • XI.1 CGC CAT TTT ATA GAC TTC TGA GCA GL-BIO (SEQ ID NO: 52)
  • XI.2 CCC TTA AAG CCA CGG GGG ACC GCG CL-BIO (SEQ ID NO: 53)
  • XI.3 CTC GGT CTC TCG AAT CGG ATC CGA CL-BIO (SEQ ID NO: 54)
  • Example 4 The following describes various examples of the herein described methodology to map the location of these RNAs on the genome, a key step in understanding the function of these RNAs.
  • RNA of interest here Drosophila roX2 is used as an example
  • the targets of the RNA can be determined by examining the proteins and DNA that are enriched under these conditions. This analysis can be extended genome-wide by subjecting the enriched DNA to deep sequencing.
  • This unit describes CHART (Capture Hybridization Analysis of RNA Targets), an experiment used to analyze RNA targets that is analogous to chromatin immunoprecipitation (ChIP, Unit 21.19) for proteins. Similar to a ChIP experiment, the factor of interest is enriched from crosslinked chromatin extracts. Whereas ChIP employs antibodies that recognize an accessible region on the protein of interest, CHART employs capture oligonculeotides are designed to specifically hybridize to the RNA of interest. Using these capture oligonucleotides, the RNA is enriched together with its targets. Similar to a ChIP experiment, the CHART-enriched DNA can be analyzed to determine where the RNA was bound in the genome.
  • RNAs non-coding RNAs
  • BASIC PROTOCOL 1 describes the isolation of nuclei from Drosophila S2 cells but can also be applied to mammalian cell lines.
  • BASIC PROTOCOL 2 describes using these nuclei to map the accessible regions of the RNA for the design of capture oligonucleotides.
  • BASIC PROTOCOL 3 describes the use of these capture
  • BASIC PROTOCOL 4 describes the analysis of CHART-enriched DNA and proteins.
  • CHART enrichment is performed using reversibly cross-linked (e.g.,
  • formaldehyde crosslinked formaldehyde crosslinked chromatin extracts.
  • Formaldehyde serves to covalently connect the RNA to its biological targets at the time of crosslinking while the cells are still intact.
  • PBS Phosphate Buffered Saline
  • CHART experiments require similar quantities of starting material as ChIP experiments. Whether using insect cells such as the S2 cells described here, or mammalian cells, it is convenient to grow enough material to generate several cell pellets of 10 cells/aliquot for mammalian cell lines, or 10 9 cells/aliquot of insect cell lines. The minimum material
  • This pellet of enriched nuclei can either be carried directly into the RNase H mapping protocol (BASIC PROTOCOL 2), or further crosslinked and used for CHART enrichment (BASIC PROTOCOL 3).
  • the objective in this protocol is to design capture oligonucleotides that can hybridize specifically to the desired RNA, in this case roX2.
  • RNA in this case roX2.
  • This protocol provides an example of a method for identifying the regions that are accessible for hybridization and designing capture oligonucleotides that target these regions.
  • a chromatin extract is made from the nuclei generated in BASIC PROTOCOL 1. Then candidate 20-mer synthetic DNA oligonucleotides are mixed one-at-a-time with this chromatin extract in the presence of an enzyme, RNase H, that hydrolyzes RNA at the sites of RNA-DNA hybrids. Oligonucleotides that hybridize to accessible sites in the RNA produce RNA-DNA hybrids and lead to enzymatic cleavage of the RNA. The degree of this RNase H sensitivity can be determined using RT-qPCR. Oligonucleotide sequences that lead to high RNase H sensitivity are used to design biotinylated capture oligonucleotides for CHART enrichment (BASIC PROTOCOL 3).
  • Proteinase K (20 mg/mL, Ambion, AM2548)
  • Step 9 8. Separate the cleared extract into aliquots of 250 ⁇ ⁇ and continue to Step 9 immediately or flash freeze (N 2 ) and store at -80°C.
  • MgCl 2 (1 M stock) e.g., 1.1 ⁇ .
  • DTT (1M stock) e.g., 3.6 ⁇ .
  • RNase H e.g., 36 ⁇ .
  • RNA For a relatively short (-600 nt) RNA such as roX2, the majority of the RNA was tiled. However, for longer RNAs comprehensive tiling would be very resourse intensive, and instead candidate regions are chosen based on the following criteria when information is available: (1) regions near conserved elements within the target RNA, (2) regions near known sites of protein interactions and (3) regions that have low repeat density.
  • the tiled nucleotides are 20-mers that are complementary to the target RNA and overlap each other by 10 nt (e.g., Oligo 1 targets nucleotides 1-20; Oligo 2 targets nucleotides 10-30; Oligo 3 targets nucleotides 20-40; etc.)
  • Oligo 1 targets nucleotides 1-20
  • Oligo 2 targets nucleotides 10-30
  • Oligo 3 targets nucleotides 20-40; etc.
  • the DNA oligonucleotides used do not need to be purified beyond standard desalting.
  • Step 14 is prior to crosslink reversal (Step 17), and therefore a second DNase treatment is included to remove DNA that was protected by crosslinking.
  • This step is for quality control to ensure the RNA was not lost during handling.
  • the yield is between -100-200 ng/ ⁇ .
  • RNA e.g., Act-5C transcript
  • oligonucleotides can be ordered commercially (e.g., http://www.idtdna.com). Using 3 " -modified oligonucleotides (as opposed to 5 '-modified oligonucleotides) is preferable because the modifications will block the capture oligonucleotides from unwanted participation in downstream library preparation steps.
  • the capture oligonucleotides from BASIC PROTOCOL 2 can be used to enrich the target RNA from crosslinked chromatin extracts.
  • the chromatin extract is made using nuclei that are crosslinked to a greater extent than traditional ChIP protocols. Therefore the first part of this protocol is formaldehyde treatment of the nuclei.
  • the chromatin is then sheered into smaller fragments, and the capture oligonucleotides are added under hybridization conditions. These conditions are optimized to maintain high solubility of the chromatin extract, and balance high yields of the desired RNA with the necessary stringency to avoid hybridization-induced artifacts. After capturing and rinsing the desired RNA with its targets, the bound material is eluted enzymatically.
  • Protocol 1 Thaw a pellet of nuclei from BASIC PROTOCOL 1 on ice.
  • a good controls for CHART experiments is to perform the experiment using the sense oligo control, in which the sequence of the oligonucleotides are of the wrong strand to hybridize to the target RNA.
  • Other possible controls include using scrambled oligo controls, or using oligos directed against an unrelated RNA.
  • Using a sense oligo control has the advantage that any artifactual signal caused by direct interactions between the capture oligos and the DNA will also be detected in the sense oligo control and can therefore be subtracted bioinformatically.
  • centrifuge does not heat the samples. Therefore a temperature controlled centrifuge should be used.
  • the supernatant from a no-oligo control makes for a good control since it takes into account any composition changes during handling of the samples.
  • RNase H is highly active (i.e., relatively new).
  • the enzyme can lose activity upon handling; if the enzyme is insufficiently active, preventing elution and thereby dramatically reducing the CHART yields.
  • the material resulting from CHART enrichment (BASIC PROTOCOL 3) is a crosslinked mixture of biomolecules consisting of the RNA of interest and its interacting partners, including its DNA and protein targets. Depending on the purpose of the experiment, the eluted material may be used for analysis of the enriched DNA, RNA or proteins.
  • This protocol describes the handling of CHART enriched material to prepare it for standard analyses such as quantitative PCR or western blot analysis. This protocol also describes how to prepare the DNA for analysis by deep sequencing.
  • Proteinase K (20 mg/mL, Ambion, AM2548)
  • MicroTube (6 x 16mm) AFA Fiber with Snap-Cap round bottom glass tube (Covaris, cat.
  • Step 2 Purify 25 iL the CHART enriched, crosslink reversed RNA (Step 2) and input sample as a control using a standard purification kit (e.g., PureLink, Invitrogen). Include an on-column DNase digestion step.
  • a standard purification kit e.g., PureLink, Invitrogen.
  • This step reverses the crosslinks. Make sure to use a heated lid to avoid drying the samples.
  • Sample loading buffer e.g., Pierce Non-Reducing Sample Buffer
  • standard conditions e.g., UNIT 10.8
  • the input samples should be diluted in a buffer of similar salt to ensure that the lanes of the gel run evenly during PAGE analysis.
  • the diluted libraries in triplicate using primers that will amplify known or expected binding sites (e.g., the endogenous roX2 locus and CES-5C2), and negative controls (e.g., Pka and Act-5C). Include a library constructed from the input. Note that the C T values for the input with different primers should be very similar to each other (within 1-2 C T values). Normalize the signal to input and to one of the negative control (e.g., Act-5C, which was used because amplification of the PKA was undetected for all three replicates in the roX2 CHART enriched samples):
  • CHART enriched library has undetectable levels of one of the negative controls.
  • a conservative estimate of the enrichment can be made by entering C T values of 40 in cases where no amplification is observed after 45 cycles.
  • N-Lauroylsarcosine 0.125%
  • Sodium deoxycholate (4 ⁇ ,, 10%)
  • 40 u SUPERasIN (2 ⁇ , of 20 u/ ⁇ .)
  • 10 niM DTT (20 of 1 M DTT)
  • RNAs non-coding RNAs
  • chromatin non-coding RNAs
  • One important goal is to determine the targets of these RNAs, including where they directly act in the genome.
  • hybridization based approaches to map the targets of RNAs (Carter et al., 2002; Chu et al., 2011 ; Mariner et al., 2008; Simon et al., 2011).
  • the advantage to the CHART protocol described here is the minimization of hybridization-induced artifacts by (1) targeting accessible regions of the RNA, and (2) avoiding extensive denaturation of the DNA.
  • the conditions described here allow the isolation of both protein and DNA targets of an RNA, and can be extended to genome-wide mapping of the binding sites of a IncRNA (Simon et al., 2011).
  • the CHART reaction conditions have been carefully optimized to provide high yields of the desired RNA with its targets.
  • Important parameters include the concentration of the extract, the level of crosslinking, the ionic strength and the concentration of urea. Using concentrated extracts improve CHART yield. Lower levels of crosslinking (as those used in ChIP) lead to low yields of DNA.
  • the high ionic strength of the CHART conditions produces high yields, but higher ionic strength leads to precipitation of the chromatin.
  • the high concentration of urea in the hybridization conditions maintains chromatin solubility and to provide the necessary stringency. The resolution of the experiment is determined by the shear size of the input chromatin.
  • target RNA yields ranged from 5-50%.
  • the corresponding DNA yields ranged from 0.1-2% which is also similar to the yields of tightly bound proteins.
  • the enrichment values determined by comparing enriched loci with control loci were similar to ChIP, ranging up to thousands of fold. As the yields and enrichment were similar to ChIP, successful CHART experiments require a similar scale (10 7 -108
  • the capture oligonucleotides were designed within approximately two days of work: one day for extract preparation and one day for RNase H mapping and oligonucleotide design. Once the capture oligonucleotides were obtained, CHART enrichment were performed in three partial days of work: one day for extract preparation and initiation of the hybridization reactions, one day for the addition of the beads and one day for washing the beads, elution, crosslink reversal and DNA analysis.
  • Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock. Mol Cell 29, 499-509.

Abstract

L'invention concerne des procédés et des essais permettant d'isoler des facteurs comprenant des polypeptides, des acides ribonucléiques (ARN) et des complexes polypeptidiques qui sont associés à une séquence d'acide nucléique cible. La séquence d'acide nucléique cible peut être comprise dans la chromatine. Ces procédés peuvent être mis en œuvre pour identifier et caractériser des facteurs comprenant des ARN non codants (ARNnc) qui s'associent à des locus génomiques spécifiés.
PCT/US2012/051565 2011-08-19 2012-08-20 Isolement de facteurs qui s'associent directement ou indirectement à des arn non codants WO2013028611A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP12825262.4A EP2744902B1 (fr) 2011-08-19 2012-08-20 Isolement de facteurs qui s'associent directement ou indirectement à des arn non codants
US14/239,369 US10273529B2 (en) 2011-08-19 2012-08-20 Isolation of factors that associate directly or indirectly with non-coding RNAS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161525559P 2011-08-19 2011-08-19
US61/525,559 2011-08-19

Publications (1)

Publication Number Publication Date
WO2013028611A1 true WO2013028611A1 (fr) 2013-02-28

Family

ID=47746799

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/051565 WO2013028611A1 (fr) 2011-08-19 2012-08-20 Isolement de facteurs qui s'associent directement ou indirectement à des arn non codants

Country Status (3)

Country Link
US (1) US10273529B2 (fr)
EP (1) EP2744902B1 (fr)
WO (1) WO2013028611A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10984891B2 (en) * 2016-08-05 2021-04-20 The Regents Of The University Of California Methods for global RNA-chromatin interactome discovery

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008024499A2 (fr) * 2006-08-25 2008-02-28 Duke University PROCÉDÉS D'IDENTIFICATION IN VIVO DE CIBLES D'ARNm ENDOGÈNE DE MICRO ARN
WO2010093860A2 (fr) 2009-02-13 2010-08-19 The General Hospital Corporation Isolement de facteurs s'associant directement ou indirectement à la chromatine
JP2011147412A (ja) * 2010-01-25 2011-08-04 Tosoh Corp 捕捉法を用いたｒｎａの測定方法

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000060115A2 (fr) * 1999-04-02 2000-10-12 City Of Hope Methode d'identification de sites de liaison accessibles dans l'arn
US20030175709A1 (en) * 2001-12-20 2003-09-18 Murphy George L. Method and system for depleting rRNA populations
AU2008290376B2 (en) 2007-08-20 2014-05-08 The General Hospital Corporation Isolation of protein factors that associate directly or indirectly with nucleic acids
US8951804B2 (en) * 2010-11-04 2015-02-10 Agilent Technologies, Inc. Isolation of RNA-protein complexes using cross-linking reagents and oligonucleotides
US8748354B2 (en) * 2011-08-09 2014-06-10 The Board Of Trustees Of The Leland Stanford Junior University RNA interactome analysis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008024499A2 (fr) * 2006-08-25 2008-02-28 Duke University PROCÉDÉS D'IDENTIFICATION IN VIVO DE CIBLES D'ARNm ENDOGÈNE DE MICRO ARN
WO2010093860A2 (fr) 2009-02-13 2010-08-19 The General Hospital Corporation Isolement de facteurs s'associant directement ou indirectement à la chromatine
JP2011147412A (ja) * 2010-01-25 2011-08-04 Tosoh Corp 捕捉法を用いたｒｎａの測定方法

Non-Patent Citations (102)

* Cited by examiner, † Cited by third party
Title
ALEKSEYENKO AA ET AL., CELL, vol. 134, 2008, pages 599 - 609
ALEKSEYENKO AA ET AL., GENES DEV, vol. 20, 2006, pages 848 - 857
ALEKSEYENKO ET AL., GENES DEV, vol. 20, 2006, pages 848 - 857
ALEKSEYENKO ET AL.: "A sequence motif within chromatin entry sites directs MSL establishment on the Drosophila X chromosome", CELL, vol. 134, no. 4, 2008, pages 599 - 609
ALEKSEYENKO ET AL.: "High-resolution ChIP-chip analysis reveals that the Drosophila MSL complex selectively identifies active genes on the male X chromosome", GENES & DEVELOPMENT, vol. 20, no. 7, 2006, pages 848 - 57
BAILEY ET AL., NUCLEIC ACIDS RES, vol. 34, 2006, pages W369 - 373
BIRNEY E ET AL., NATURE, vol. 447, 2007, pages 799 - 816
CAIRNS ET AL., BIOINFORMATICS, vol. 27, 2011, pages 713
CARTER D ET AL., NAT GENET, vol. 32, 2002, pages 623 - 626
CARTER, D.; CHAKALOVA, L.; OSBORNE, C. S.; DAI, Y. F.; FRASER, P.: "Long-range chromatin regulatory interactions in vivo", NAT GENET, vol. 32, 2002, pages 623 - 626
CHEN LL; CARMICHAEL GG, MOL CELL, vol. 35, 2009, pages 467 - 478
CHU C ET AL., MOL CELL, vol. 44, 2011, pages 667 - 648
CHU, C.; QU, K.; ZHONG, F. L.; ARTANDI, S. E.; CHANG, H. Y.: "Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions", MOL CELL, vol. 44, 2011, pages 667 - 678
CLARK MB ET AL., PLOS BIOL, vol. 9, 2011, pages EI000625
CLEMSON CM ET AL., MOL CELL, vol. 33, 2009, pages 717 - 726
COURCHESNE; PATTERSON, METHODS MOL. BIOL., vol. 112, 1999, pages 487 - 511
CRANE-ROBINSON ET AL., METH. ENZYM., vol. 304, 1999, pages 533 - 547
DARNELL RB: "Interdiscip Rev RNA, HITS-CLIP: Panoramic views of protein-RNA regulation in living cells", vol. 1, 2010, WILEY, pages: 266 - 286
DEJARDIN J; KINGSTON RE, CELL, vol. 136, 2009, pages 175 - 186
DEJARDIN; KINGSTON: "Purification of proteins associated with specific genomic Loci.", CELL, vol. 136, no. 1, 2009, pages 175 - 86
DENNIS JH ET AL., GENOME RES, vol. 17, 2007, pages 928 - 939
ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498
FEINBERG AP; VOGELSTEIN B, NATURE, vol. 1, no. 5895, 1983, pages 89 - 92
FENG J ET AL., GENES DEV, vol. 20, 2006, pages 1470 - 1484
FOX AH; LAMOND AI, COLD SPRING HARB PERSPECT BIOL, vol. 2, 2010, pages A000687
FRANKE A; BAKER BS, MOL CELL, vol. 4, 1999, pages 117 - 122
GELBART ME ET AL., NAT STRUCT MOL BIOL, vol. 16, 2009, pages 825 - 832
GELBART ME; KURODA MI, DEVELOPMENT, vol. 136, 2009, pages 1399 - 1410
GELBART; KURODA: "Drosophila dosage compensation: a complex voyage to the X chromosome", DEVELOPMENT, vol. 136, no. 9, 2009, pages 1399 - 410
GILBERT C; SVEJSTRUP JQ: "Curr Protoc Mol Biol", 2006, article "Chapter 27: Unit 27 24"
GILFILLAN GD ET AL., GENES DEV, vol. 20, 2006, pages 858 - 870
GINGRAS ET AL., NAT REV MOL CELL BIOL., vol. 8, no. 8, August 2007 (2007-08-01), pages 645 - 54
GORCHAKOV AA ET AL., GENES DEV, vol. 23, 2009, pages 2266 - 2271
GRIFFIN ET AL., RAPID COMMUN. MASS SPECTROM., vol. 9, no. 15, 1995, pages 1546 - 51
GUTTMAN M ET AL., NATURE, vol. 458, 2009, pages 223 - 227
HILFIKER A ET AL., EMBO J, vol. 16, 1997, pages 2054 - 2060
HIRSCH JD ET AL., ANAL BIOCHEM, vol. 308, 2002, pages 343 - 357
HUGHES, SURG. ONCOL., vol. 85, no. 1, 2004, pages 28 - 35
HUNG T ET AL.: "Long noncoding RNA in genome regulation: prospects and mechanisms", RNA BIOL., vol. 7, no. 5, September 2010 (2010-09-01), pages 582 - 585, XP055037562 *
HUTCHINSON JN ET AL., BMC GENOMICS, vol. 8, 2007, pages 39
JACOB F; MONOD J, J MOL BIOL, vol. 3, 1961, pages 318 - 356
KELLEY RL ET AL., CELL, vol. 98, 1999, pages 513 - 522
KHARCHENKO ET AL., NAT BIOTECHNOL, vol. 26, 2008, pages 1351 - 1359
KHARCHENKO PV ET AL., NATURE, vol. 471, 2011, pages 480 - 485
KIND J ET AL., CELL, vol. 133, 2008, pages 813 - 828
KOZIOL MJ; RINN JL, CURR OPIN GENET DEV, vol. 20, 2010, pages 142 - 148
KOZIOL, M. J.; RINN, J. L.: "RNA traffic control of chromatin complexes.", CURR OPIN GENET DEV, vol. 20, 2010, pages 142 - 148
KURRECK, J.: "Antisense technologies - Improvement through novel chemical modifications", EUR. J. BIOCHEM., vol. 270, 2003, pages 1628 - 1644
LANGMEAD ET AL., GENOME BIOL, vol. 10, 2009, pages R25
LANGMEAD ET AL., GENOME BIOL., vol. 10, 2009, pages R25
LARSCHAN E ET AL., NATURE, vol. 471, 2011, pages 115 - 118
LEE JT, GENES DEV, vol. 23, 2009, pages 1831 - 1842
LEVSKY JM; SINGER RH, J CELL SCI, vol. 116, 2003, pages 2833 - 2838
LIEBERMAN-AIDEN E ET AL., SCIENCE, vol. 326, 2009, pages 289 - 293
LIEBERMAN-AIDEN ET AL., SCIENCE, vol. 326, 2009, pages 289
LINGNER J ET AL., GENES, vol. 8, 1994, pages 1984 - 1998
LINGNER J; CECH TR, PROC NATL ACAD SCI USA, vol. 93, 1996, pages 10712 - 10717
MAO YS ET AL., NAT CELL BIOL, vol. 13, 2010, pages 95 - 101
MARINER PD ET AL., MOL CELL, vol. 29, 2008, pages 499 - 509
MARINER, P. D.; WALTERS, R. D.; ESPINOZA, C. A.; DRULLINGER, L. F.; WAGNER, S. D.; KUGEL, J. F.; GOODRICH, J. A.: "Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock.", MOL CELL, vol. 29, 2008, pages 499 - 509
MARTIANOV I ET AL., NATURE, vol. 445, 2007, pages 666 - 670
MELLER VH ET AL., CURR BIOL, vol. 10, 2000, pages 136 - 143
MERCER TR ET AL., PROC NATL ACAD SCI USA, vol. 105, 2008, pages 716 - 721
MOHAMMAD F ET AL., MOL CELL BIOL, vol. 28, 2008, pages 3713 - 3728
MOROCHO, A. M. ET AL., METHODS MOL BIOL, vol. 288, 2005, pages 225 - 240
MOSRIN-HUAMAN C ET AL., DEV GENET, vol. 23, 1998, pages 324 - 334
MOSRIN-HUAMAN ET AL., DEV GENET, vol. 23, 1998, pages 324 - 334
MURAKAMI K ET AL., J HUM GENET, vol. 52, 2007, pages 926 - 933
NAGANO T ET AL., SCIENCE, vol. 322, 2008, pages 1717 - 1720
NAGANO T; FRASER P, CELL, vol. 145, 2011, pages 178 - 181
NELSON ET AL., NATURE PROTOCOLS, vol. 1, 2006, pages 179 - 185
OROM UA ET AL., CELL, vol. 143, 2010, pages 46 - 58
PANDEY RR ET AL., MOL CELL, vol. 32, 2008, pages 232 - 246
PAPPIN ET AL., CURR BIOL., vol. 3, no. 6, 1 June 1993 (1993-06-01), pages 327 - 32
PARK SW ET AL., GENETICS, vol. 177, 2007, pages 1429 - 1437
PONTING CP; OLIVER PL; REIK W, CELL, vol. 136, 2009, pages 629 - 641
PRASANTH KV ET AL., GENES DEV, vol. 21, 2007, pages 11 - 42
RINKE J, NUCLEIC ACIDS RES, vol. 12, 1984, pages 4111 - 4126
RINN JL ET AL., CELL, vol. 129, 2007, pages 1311 - 1323
RYDER U ET AL., NUCLEIC ACIDS RES, vol. 18, 1990, pages 7373 - 7379
SAHA S ET AL., BRAIN RES, vol. 1148, 2007, pages 38 - 42
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, CSHL PRESS
SASAKI YT ET AL., PROC NATL ACAD SCI USA, vol. 106, 2009, pages 2525 - 2530
SCHMITZ KM ET AL., GENES DEV, vol. 24, 2010, pages 2264 - 2269
See also references of EP2744902A4 *
SHAMOVSKY I. ET AL., NATURE, vol. 440, 2006, pages 556 - 560
SIMON, M. D.; WANG, C. I.; KHARCHENKO, P. V.; WEST, J. A.; CHAPMAN, B. A.; ALEKSEYENKO, A. A.; BOROWSKY, M. L.; KURODA, M. I.; KIN: "The genomic binding sites of a noncoding RNA.", PROC NATL ACAD SCI USA, vol. 108, 2011, pages 20497 - 20502
SMITH ER ET AL., J BIOL CHEM, vol. 276, 2001, pages 31483 - 31486
SPECTOR DL ET AL., COLD SPRING HARB PERSPECT BIOL, vol. 3, 2011, pages A000646
STEIN H; HAUSEN P, SCIENCE, vol. 166, 1969, pages 393 - 395
STRAUB T ET AL., PLOS GENET, vol. 4, 2008, pages E1000302
SUNWOO H ET AL., GENOME RES, vol. 19, 2009, pages 347 - 359
TAFT RJ ET AL., J PATHOL, vol. 220, 2010, pages 126 - 139
TSAI MC ET AL., SCIENCE, vol. 329, 2010, pages 689 - 693
ULE J ET AL., METHODS, vol. 37, 2005, pages 376 - 386
ULE J ET AL., SCIENCE, vol. 302, 2003, pages 1212 - 1215
VAN BAKEL H ET AL., PLOS BIOL, vol. 8, 2010, pages EI000371
VESTER, B.; WENGEL, J., BIOCHEMISTRY, vol. 43, 2004, pages 13233 - 13241
WANG KC ET AL., NATURE, vol. 472, 2011, pages 120 - 124
WASSARMAN DA; STEITZ JA, MOL CELL BIOL, vol. 11, 1991, pages 3432 - 3445
WILUSZ JE ET AL., CELL, vol. 135, 2008, pages 919 - 932
ZHANG ET AL., GENOME BIOL., vol. 9, 2008, pages R137

Also Published As

Publication number Publication date
US10273529B2 (en) 2019-04-30
EP2744902A4 (fr) 2015-03-11
EP2744902B1 (fr) 2018-06-06
EP2744902A1 (fr) 2014-06-25
US20150056615A1 (en) 2015-02-26

Similar Documents

Publication Publication Date Title
US20120040857A1 (en) Isolation of factors that associate directly or indirectly with chromatin
McHugh et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3
JP2022065157A (ja) 核酸エンコーディングを使用した巨大分子解析
Simon Capture hybridization analysis of RNA targets (CHART)
EP3083957B1 (fr) Production de bibliothèques chimiques codées
DK2191016T3 (en) INSULATION OF PROTEIN FACTORS BINDING DIRECT OR INDIRECT WITH NUCLEIC ACIDS
WO2013078470A2 (fr) Isolation multiplex d'acides nucléiques associés à des protéines
JP2002520074A (ja) シス作用性核酸エレメントおよび使用法
CN107109698B (zh) Rna stitch测序：用于直接映射细胞中rna:rna相互作用的测定
CN111979229A (zh) 用于rna-染色质相互作用分析的组合物及其用途
US20130011833A1 (en) Method for identifying nucleic acids bound to an analyte
Jia et al. TMT-based quantitative proteomic analysis of cumulus cells derived from vitrified porcine immature oocytes following in vitro maturation
WO2021000889A1 (fr) Procédé à base de marquage chimique pour le séquençage, l'enrichissement et la mesure de nucléosides modifiés
US10273529B2 (en) Isolation of factors that associate directly or indirectly with non-coding RNAS
JP7313696B2 (ja) 増強されたＲＮＡインタラクトーム捕捉（ｅＲＩＣ）
Wippich et al. Transcript specific mRNP capture from Drosophila egg-chambers for proteomic analysis
WO2023086847A1 (fr) Procédés de codage de macromolécules dans des cellules individuelles
US11441175B2 (en) Methods and kits for depleting undesired nucleic acids
WO2022071436A1 (fr) Procédé de mesure d'arn capable de détecter des processus biologiques et physiologiques
WO2011156376A1 (fr) Analyse in vivo de transcriptome
Nguyen Development of high-throughput technologies to map RNA structures and interactions
Zong Discovery and analysis of long noncoding RNAs in gene expression control and cell cycle progression
EP2783001A2 (fr) Isolation multiplex d'acides nucléiques associés à des protéines
Coley Detection of argonaute (Ago) protein associated miRNA by combining anti-ago antibody recognition with real-time PCR
WO2015181397A1 (fr) Procédé de séquençage et d'identification d'arns

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12825262

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14239369

Country of ref document: US