WO2013025853A1 - Neuregulin antibodies and uses thereof - Google Patents
Neuregulin antibodies and uses thereof Download PDFInfo
- Publication number
- WO2013025853A1 WO2013025853A1 PCT/US2012/051033 US2012051033W WO2013025853A1 WO 2013025853 A1 WO2013025853 A1 WO 2013025853A1 US 2012051033 W US2012051033 W US 2012051033W WO 2013025853 A1 WO2013025853 A1 WO 2013025853A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- seq
- amino acid
- acid sequence
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CC(C)*1*=*CC1 Chemical compound CC(C)*1*=*CC1 0.000 description 5
- SHOMMGQAMRXRRK-UHFFFAOYSA-N C1C2CCCC1C2 Chemical compound C1C2CCCC1C2 SHOMMGQAMRXRRK-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/22—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6845—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a cytokine, e.g. growth factors, VEGF, TNF, a lymphokine or an interferon
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0331—Animal model for proliferative diseases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the invention provides neuregulin antibodies and methods for using the antibodies in treating diseases or disorders, such as cancer.
- NSCLC non-small cell lung cancer
- CSCs Cancer stem cells
- TRICs tumor reinitiating cells
- EGFR Epidermal growth factor receptor
- NRG1 Neuregulin 1
- Heregulinl is a ligand for the HER3 and HER4 receptors
- NRG1, NRG2, NRG3, and NRG4 There are four known members of the neuregulin family, NRG1, NRG2, NRG3, and NRG4 (Falls 2003; Hirsch and Wu 2007).
- the NRG1 transcript undergoes extensive alternative splicing resulting in at least 15 different isoforms. All active isoforms share an EGF-like domain that is necessary and sufficient for activity (Holmes 1992, Yarden 1991).
- NRG1 autocrine signaling has been shown to regulate lung epithelial cell proliferation and to play a role in human lung development (Patel et al., 2000), and has been implicated in insensitivity of NSCLC to EGFR inhibitors (Zhou et al., 2006).
- the invention provides anti-neuregulinl (anti-NRGl) antibodies and methods of using the same.
- One aspect of the invention provides for an isolated anti-NRGl antibody that binds to neuregulinl a and neuregulinl ⁇ .
- the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ and the EGF domain of neuregulinl a.
- the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ with an affinity that is greater than the affinity to which it binds to EGF domain of neuregulinl a.
- the anti-NRGl antibody binds to the EGF domain neuregulinl ⁇ with an affinity that is greater than 20-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1000-fold the affinity to which it binds to EGF domain of neuregulinl a.
- the anti-NRGl antibody binds to the EGF domain of neuregulin ⁇ with a kD of 10 nM or less and binds to the EGF domain of neuregulinl a with a kD of 10 nM or less. In specific embodiments, the anti-NRGl antibody binds to the EGF domain of neuregulin ⁇ with a kD of 10 nM or less, 1 nM or less, lxlO "1 nM or less, lxlO "2 nM or less, or lxlO "3 nM or less.
- the affinity of the anti-NRGl antibody in one embodiment is measured by a surface plasmon resonance assay.
- One aspect of the invention provides for an isolated anti-NRGl antibody that binds to an epitope of neuregulinip, wherein the epitope of neuregulini p comprises the amino acid sequence of amino acids 1-37 of SEQ ID NO: 4 or the amino acid sequence of amino acids 38-64 of SEQ ID NO: 4.
- the epitope of neuregulinip comprises the amino acid sequence of SEQ ID NO: 4.
- the anti-NRGl antibody further binds to an epitope of neuregulinla, wherein the epitope of neuregulinla comprises the amino acid sequence of amino acids 1-36 of SEQ ID NO: 3 or the amino acid sequence of amino acids 37-58 of SEQ ID NO: 3.
- the epitope of neuregulinla comprises the amino acid sequence of SEQ ID NO: 3.
- the anti-NRGl antibody is a monoclonal antibody. In certain embodiments, the anti-NRGl antibody is a human, humanized, or chimeric antibody. In certain embodiments, the anti-NRGl antibody is an antibody fragment that binds to neuregulinla and neuregulini p.
- Another aspect of the invention provides for an isolated anti-NRGl antibody which comprises (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 5, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7.
- an isolated anti-NRGl antibody which comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16, (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- the anti-NRGl further comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16, (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- Another aspect of the invention provides for an isolated anti-NRGl antibody which comprises (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 76, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43.
- Another aspect of the invention provides for an isolated anti-NRGl antibody which comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31, (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- the anti-NRGl antibody further comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31, (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- an isolated anti-NRGl antibody which comprises (a) a VH sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 21 ; (b) a VL sequence having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 26; or (c) a VH sequence as in (a) and a VL sequence as in (b).
- the anti- NRGl antibody comprises aVH sequence of SEQ ID NO: 21.
- the anti-NRGl antibody comprises a VL sequence of SEQ ID NO: 26.
- the anti-NRGl antibody comprises a VH sequence of SEQ ID NO: 21 and a VL sequence of SEQ ID NO: 26.
- One aspect of the invention provides for an isolated anti-NRGl antibody comprising a VH sequence of SEQ ID NO: 53 and a VL sequence of SEQ ID NO: 63.
- Another aspect of the invention provides for an isolated nucleic acid encoding an anti-NRGl antibody. Another aspect of the invention provides for a host cell comprising a nucleic acid encoding an anti-NRGl antibody.
- Another aspect of the invention provides for a method of producing an anti-NRGl antibody comprising culturing such a host cell so that the antibody is produced.
- Another aspect of the invention provides for an immunoconjugate comprising an anti-NRGl antibody and a cytotoxic agent.
- Another aspect of the invention provides for a pharmaceutical formulation comprising an anti-
- the pharmaceutical formulation further comprises an additional therapeutic agent, such as, gemcitabine, paclitaxel, or cisplatin, or a combination of paclitaxal and cisplatin.
- an additional therapeutic agent such as, gemcitabine, paclitaxel, or cisplatin, or a combination of paclitaxal and cisplatin.
- Another aspect of the invention provides for an anti-NRGl antibody for use as a medicament. Another aspect of the invention provides for an anti-NRGl antibody for use in treating cancer.
- the medicament is for treatment of cancer, such as non-small cell lung cancer, breast cancer, ovarian cancer, head and neck cancer, cervical cancer, bladder cancer , oesophageal cancer, prostate cancer, and colorectal cancer .
- cancer such as non-small cell lung cancer, breast cancer, ovarian cancer, head and neck cancer, cervical cancer, bladder cancer , oesophageal cancer, prostate cancer, and colorectal cancer .
- Another aspect of the invention provides for a method of treating an individual having cancer comprising administering to the individual an effective amount of an anti-NRGl antibody.
- the cancer to be treated is, for example, non-small cell lung cancer, breast cancer, ovarian cancer, head and neck cancer, cervical cancer, bladder cancer, oesophageal cancer, prostate cancer, and colorectal cancer.
- the method further comprises an additional therapeutic agent to the individual, such as gemcitabine, paclitaxal, carboplatin, and cisplatin or a combination or two or all three of paclitaxal, carboplatin, and cisplatin.
- Another aspect of the invention provides for a method of increasing time to tumor recurrence in a cancer patient comprising administering to the patient an effective amount an anti-NRGl antibody.
- the method further comprises administering a therapeutic agent to the patient.
- the therapeutic agent is a chemotherapeutic agent or a second antibody.
- the chemotherapeutic agent is, for example, gemcitabine, paclitaxal, carboplatin, and cisplatin or a combination or two or all three of paclitaxal, carboplatin, and cisplatin.
- the second antibody binds to EGFR, HER2, HER3, or HER4, or binds to two or more of these targets.
- the cancer to be treated is non-small cell lung cancer, breast cancer, ovarian cancer, head and neck cancer, cervical cancer, bladder cancer , oesophageal cancer, prostate cancer, and/or colorectal cancer .
- the increase in time to tumor recurrence is at least 1.25 fold greater than the time to recurrence in the absence of the antibody. In one embodiment, the increase in time to tumor recurrence is at least 1.50 fold greater than the time to recurrence in the absence of the antibody.
- FIG. 1A Graph showing tumor growth curves for mice with established Calu3-shNRGl xenograft tumors administered vehicle (sucrose) or dox (2gm/L) in their drinking water ad libitum. Tumor volume was measured twice a week for the duration of the study. Data presented as Linear Mixed Effect (LME) model generated fit of tumor volume graphed as cubic splines with auto- determined knots.
- LME Linear Mixed Effect
- Figure IB Graph showing tumor growth curves for mice with established Calu3-shNRGl xenograft tumors treated with chemo+sucrose or chemo+dox. Data presented as LME model generated fit of tumor volume graphed as cubic splines with auto-determined knots.
- Figure 3B Graph showing the daily fold change in tumor burden by treatment regimen with 95% confidence intervals.
- Figure 4 A Graph showing NRG1 mRNA enrichment in residual tumor cells from the Kras- LSL-G12D mouse NSCLC model, data is shown from one microarray probe and as validated by qPCR on independent samples.
- Figure 4B Graph showing expression of NRG1 in vehicle treated and residual chemo-treated Calu3 tumor cells as assessed by qPCR.
- Figure 4C Graph showing expression of NRG1 in vehicle treated and residual chemo-treated H441 tumor cells as assessed by qPCR.
- Figure 4D Graph showing expression of NRG1 in vehicle treated and residual gemcitabine- and vinorelbine-treated Calu3 and H441 tumor cells as assessed by qPCR.
- Figure 6 Graph showing the inhibition of 1251-NRGpi binding to HER3-Fc by anti-NRGl antibodies.
- Figure 7 Graph showing the inhibition of 125I-NRGP 1 binding to HER3-Fc by affinity matured anti-NRGl antibody variants.
- Figure 8 Binding affinities of 538.24 affinity matured variant anti-NRGl IgGs for NRG1 ⁇ as measured in a BIAcoreTM assay.
- Figure 9 Binding affinities of 538.24 affinity matured variant anti-NRGl IgGs for NRGla as measured in a BIAcoreTM assay.
- Figure 10 Binding affinities of 538.24.71 anti-NRGl antibody for NRG 1 ⁇ and NRGla as measured in a BIAcoreTM assay.
- Figure 13 Table showing the ability of affinity matured variants of the 526.09 anti-NGRl antibody to block NRG1 a and NRG1 ⁇ binding to an anti-HER3 antibody in a KIRA assay.
- Figure 14 Graph showing results of BV test of 526.90 affinity matured variants.
- Figure 15 Binding affinities of 538.90.28 anti-NRGl antibody for NRG ⁇ and NRGla as measured in a BIAcoreTM assay.
- Figure 16 Graph showing the ability of anti-NRGl antibodies 526.90.28 and 538.24.71 to block NRGl a induced HER3 activiation as determined using KIRA.
- Figure 17 Graph showing the ability of anti-NRGl antibodies 526.90.28 and 538.24.71 to block NRG1 ⁇ induced HER3 activiation as determined using KIRA.
- FIG. 1 Western Blot showing ability of anti-NRGl antibodies to inhibit NRG1 autocrine signaling in both human and mouse cells.
- Figure 19 Graph showing the effect of anti-NRGl antibodies +/- chemotherapy on HNSCC tumor growth in a mouse model system.
- Figure 20 Tumor Growth curves showing the effect of anti-NRGl antibodies +/- chemotherapy on lung cancer tumor growth in a mouse model system and a Kaplan-Meier curve showing progression free survival in the model system.
- Figure 21 Tumor Growth curves showing the effect of anti-NRGl antibodies +/- chemotherapy on NSCLC LKPH2 tumor growth in a mouse model system and a Kaplan-Meier curve showing progression free survival in the model system.
- Figure 22 Tumor Growth curves showing the effect of anti-NRGl antibodies +/- chemotherapy on NSCLC H596 tumor growth in a mouse model system .
- Figure 23 Tumor Growth curves showing the effect of anti-NRGl antibodies +/- chemotherapy on NSCLC LKPH2 tumor growth in a mouse model system and a Kaplan-Meier curve showing progression free survival in the model system.
- FIG. 24 Tumor Growth curves howing the effect of anti-NRGl antibodies on tumor growth driven by NRG1-HER3 signaling (A) and on growth of tumors driven by NRG1-HER4 signaling (B).
- FIG. 25 Heavy chain variable region amino acid sequences of anti-NRG antibodies (SEQ ID NO: 20).
- Figure 26 Light chain variable region amino acid sequences of anti-NRG antibodies (SEQ ID NOs: 22-27, respectively).
- FIG. 27 Heavy chain variable region amino acid sequences of anti-NRG antibodies (SEQ ID NOs: 52, 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, respectively).
- Figure 28 Light chain variable region amino acid sequences of anti-NRG antibodies (SEQ ID NOs: 53, 55, 57, 59, 61, 53, 53, 65, 67, 69, 71, respectively).
- acceptor human framework for the purposes herein is a framework comprising the amino acid sequence of a light chain variable domain (VL) framework or a heavy chain variable domain (VH) framework derived from a human immunoglobulin framework or a human consensus framework, as defined below.
- An acceptor human framework "derived from” a human immunoglobulin framework or a human consensus framework may comprise the same amino acid sequence thereof, or it may contain amino acid sequence changes. In some embodiments, the number of amino acid changes are 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less.
- the VL acceptor human framework is identical in sequence to the VL human immunoglobulin framework sequence or human consensus framework sequence.
- Binding affinity refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen).
- the affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Specific illustrative and exemplary embodiments for measuring binding affinity are described in the following.
- an “affinity matured” antibody refers to an antibody with one or more alterations in one or more hypervariable regions (HVRs), compared to a parent antibody which does not possess such alterations, such alterations resulting in an improvement in the affinity of the antibody for antigen.
- HVRs hypervariable regions
- anti-NRGl antibody and “an antibody that binds to NRG1” refer to an antibody that is capable of binding a neuregulinl (NRG1) with sufficient affinity such that the antibody is useful as a diagnostic and/or therapeutic agent in targeting a NRG1.
- the extent of binding of an anti-NRGl antibody to an unrelated, non-NRGl protein is less than about 10% of the binding of the antibody to NRG1 as measured, e.g., by a radioimmunoassay (RIA).
- RIA radioimmunoassay
- an antibody that binds to NRG1 has a dissociation constant (Kd) of ⁇ ⁇ ⁇ , ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g. 10 "8 M or less, e.g. from 10 "8 M to 10 "13 M, e.g., from 10 "9 M to 10 "13 M).
- Kd dissociation constant
- an anti-NRGl antibody binds to an epitope of NRG1 that is conserved among NRG1 s from different species.
- antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
- An "antibody fragment” refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab') 2 ; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments.
- an "antibody that binds to the same epitope” as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more.
- An exemplary competition assay is provided herein.
- chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
- cancer refers to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth/proliferation.
- Examples of cancer include, but are not limited to, carcinoma, lymphoma (e.g., Hodgkin's and non-Hodgkin's lymphoma), blastoma, sarcoma, and leukemia.
- cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
- the "class" of an antibody refers to the type of constant domain or constant region possessed by its heavy chain.
- the heavy chain constant domains that correspond to the different classes of
- immunoglobulins are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
- cytotoxic agent refers to a substance that inhibits or prevents a cellular function and/or causes cell death or destruction.
- Cytotoxic agents include, but are not limited to, radioactive isotopes (e.g., At 211 , 1 131 , 1 125 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , P 32 , Pb 212 and radioactive isotopes of Lu); chemotherapeutic agents or drugs (e.g., methotrexate, adriamicin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents); growth inhibitory agents; enzymes and fragments thereof such as nucleolytic enzymes; antibiotics; toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal
- Antibody effector functions refer to those biological activities attributable to the Fc region of an antibody, which vary with the antibody isotype. Examples of antibody effector functions include: Clq binding and complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell- mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g. B cell receptor); and B cell activation.
- an "effective amount" of an agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.
- Fc region herein is used to define a C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region.
- the term includes native sequence Fc regions and variant Fc regions.
- a human IgG heavy chain Fc region extends from Cys226, or from Pro230, to the carboxyl-terminus of the heavy chain.
- the C-terminal lysine (Lys447) of the Fc region may or may not be present.
- numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also called the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.
- FR Framework or "FR” refers to variable domain residues other than hypervariable region (HVR) residues.
- the FR of a variable domain generally consists of four FR domains: FR1, FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.
- full length antibody “intact antibody,” and “whole antibody” are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.
- host cell refers to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells.
- Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
- a “human antibody” is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.
- a "human consensus framework” is a framework which represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH framework sequences. Generally, the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences.
- the subgroup of sequences is a subgroup as in Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91 -3242, Bethesda MD (1991), vols. 1-3.
- the subgroup is subgroup kappa I as in Kabat et al., supra.
- the subgroup is subgroup III as in Kabat et al., supra.
- a “humanized” antibody refers to a chimeric antibody comprising amino acid residues from non-human HVRs and amino acid residues from human FRs.
- a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody, and all or substantially all of the FRs correspond to those of a human antibody.
- a humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody.
- a "humanized form" of an antibody, e.g., a non-human antibody refers to an antibody that has undergone humanization.
- hypervariable region refers to each of the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops ("hypervariable loops").
- native four-chain antibodies comprise six HVRs; three in the VH (HI, H2, H3), and three in the VL (LI, L2, L3).
- HVRs generally comprise amino acid residues from the hypervariable loops and/or from the "complementarity determining regions" (CDRs), the latter being of highest sequence variability and/or involved in antigen recognition.
- CDRs complementarity determining regions
- Exemplary hypervariable loops occur at amino acid residues 26-32 (LI), 50-52 (L2), 91-96 (L3), 26-32 (HI), 53-55 (H2), and 96-101 (H3).
- Exemplary CDRs CDR-L1, CDR-L2, CDR-L3, CDR-Hl, CDR-H2, and CDR-H3) occur at amino acid residues 24-34 of LI, 50-56 of L2, 89-97 of L3, 31-35B of HI, 50-65 of H2, and 95-102 of H3.
- CDRs generally comprise the amino acid residues that form the hypervariable loops.
- CDRs also comprise "specificity determining residues,” or "SDRs,” which are residues that contact antigen. SDRs are contained within regions of the CDRs called abbreviated-CDRs, or a-CDRs.
- Exemplary a-CDRs (a-CDR-Ll, a-CDR-L2, a-CDR-L3, a-CDR-Hl, a- CDR-H2, and a-CDR-H3) occur at amino acid residues 31-34 of LI, 50-55 of L2, 89-96 of L3, 31-35B of HI, 50-58 of H2, and 95-102 of H3.
- HVR residues and other residues in the variable domain are numbered herein according to Kabat et al., supra.
- An "immunoconjugate" is an antibody conjugated to one or more heterologous molecule(s), including but not limited to a cytotoxic agent.
- mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non- human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
- domesticated animals e.g., cows, sheep, cats, dogs, and horses
- primates e.g., humans and non- human primates such as monkeys
- rabbits e.g., mice and rats
- rodents e.g., mice and rats.
- the individual, subject, or patient is a human.
- an “isolated” antibody is one which has been separated from a component of its natural environment.
- an antibody is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC).
- electrophoretic e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis
- chromatographic e.g., ion exchange or reverse phase HPLC
- nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment.
- An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural
- isolated nucleic acid encoding an anti-NRGl antibody refers to one or more nucleic acid molecules encoding antibody heavy and light chains (or fragments thereof), including such nucleic acid molecule(s) in a single vector or separate vectors, and such nucleic acid molecule(s) present at one or more locations in a host cell.
- monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts.
- polyclonal antibody preparations typically include different antibodies directed against different determinants (epitopes)
- each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.
- a “naked antibody” refers to an antibody that is not conjugated to a heterologous moiety (e.g., a cytotoxic moiety) or radiolabel. The naked antibody may be present in a pharmaceutical formulation.
- Native antibodies refer to naturally occurring immunoglobulin molecules with varying structures.
- native IgG antibodies are heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light chains and two identical heavy chains that are disulfide - bonded. From N- to C-terminus, each heavy chain has a variable region (VH), also called a variable heavy domain or a heavy chain variable domain, followed by three constant domains (CHI, CH2, and CH3). Similarly, from N- to C-terminus, each light chain has a variable region (VL), also called a variable light domain or a light chain variable domain, followed by a constant light (CL) domain.
- VH variable region
- VL variable region
- the light chain of an antibody may be assigned to one of two types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino acid sequence of its constant domain.
- package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
- Percent (%) amino acid sequence identity with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
- % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2.
- the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
- the ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, California, or may be compiled from the source code.
- the ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
- pharmaceutical formulation refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
- a “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
- a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
- NRG refers to any native neuregulin (also known as heregulin) from any vertebrate source, including mammals such as primates (e.g. humans) and rodents (e.g., mice and rats), unless otherwise indicated.
- the term encompasses "full-length,” unprocessed NRG as well as any form of NRG that results from processing in the cell.
- the term also encompasses naturally occurring variants of NRG, e.g., splice variants or allelic variants.
- NRG1 Holmes, W.E. et al., Science 256: 1205-1210 (1992)
- NRG2 Caraway, K.L.
- NRG3 Zhang, E. et al., Proc Natl Acad Sci USA 94:9562-9567
- NRG4 Harari, D. et al., Oncogene 18:2681-2689) Due to alternative splicing there are two active isoforms of the NRG1 EGF-like domain that are required for receptor binding, referred to as
- NRG1 alpha NRG1 alpha
- NRGP NRGlbeta
- Sequences of exemplary human NRGls are shown in Genbank Accession No. BK000383 (Falls, D. L., Ex Cell Res, 284: 14-30 (2003) and in US Patent No. 5,367,060.
- NRGla comprises the amino acid sequence of Swiss Prot accession number Q7RTV8 (SEQ ID NO: 1).
- the EGF domain of NRGla comprises the amino acid sequence of amino acids S177-K241 of SEQ ID NO: 1 (SEQ ID NO: 3).
- NRGP comprises the amino acid sequence ofNCBI accession number NP 039250 (SEQ ID NO:2).
- the EGF domain of NRGi p comprises the amino acid sequence of amino acids T176-K246 of SEQ ID NO: 2 (SEQ ID NO: 4).
- treatment refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
- the anti-NRGl antibodies of the invention are used to delay development of a disease, slow the progression of a disease, prevent relapse, or to increase time to tumor recurrence.
- treatment results in a reduction in the number of or complete absence of tumor reinitating cells; a decrease in number of tumor reinitating cells in a solid tumor relative to cells in the tumor that are not tumor reinitating cells; and/or inhibition of the proliferation of tumor reinitating cells.
- treatment with an anti-NRGl antibody results in an increase in time to tumor recurrence of at least 1.25, 1.50, 1.75, 2.0 fold greater than the time to tumor recurrence in the absence of treatment with an anti-NRGl antibody.
- variable region refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
- the variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs).
- FRs conserved framework regions
- HVRs hypervariable regions
- antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).
- vector refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked.
- the term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced.
- Certain vectors are capable of directing the expression of nucleic acids to which they are operative ly linked. Such vectors are referred to herein as "expression vectors.”
- NGF1 Neuregulin signaling, which can occur through either the HER3 (ErbB3) or HER4
- ErbB4 receptor can trigger multiple signaling cascades including the P13K/Akt, PKC, MAPK and the Ras signaling pathways. Junttila, T. T., et al. (2009); Lee-Hoeflich et al., (2008); WO2011103242; US Patent Publication No. 20110229493. Furthermore, inhibition of NRG1 signaling results in the delay or prevention of tumor relapse or recurrence after treatment with a therapeutic agent. Examples 2 - 4 and WO2011103242; US Patent Publication No. 20110229493. Anti-NRGl antibodies that inhibit NRG1 induced signaling are useful in the treatment of cancers associated with NRG1 signaling, including autocrine NRG1 signaling.
- one aspect of the invention provides for antibodies that bind to NRG1 (anti- NRG1 antibodies). These antibodies find use in treating cancer and in preventing resistance and/or recurrence of cancer after treatment with a therapeutic agent.
- the anti-NRGl antibody binds to both neuregulinla and to
- the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ and the EGF domain of neuregulinla. In some embodiments, the anti-NRGl antibody binds to neuregulinl ⁇ with a kD of 10 nM, 1 nM, lxlO "1 nM, lxlO "2 nM, lxlO "3 nM or less and binds to neuregulinla with a kD of 10 nM, 1 nM, lxlO _1 nM, lxlO "2 nM, lxlO "3 nM or less.
- the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ with a kD of 10 nM, 1 nM, lxlO "1 nM, lxlO "2 nM, lxlO "3 nM or less and binds to the EGF domain of neuregulinla with a kD of 10 nM, 1 nM, lxl0 _1 nM, lxlO "2 nM, lxlO "3 nM or less.
- the anti-NRGl antibody binds to neuregulinl ⁇ with a kD of 10 nM, 1 nM, lxlO "1 nM, lxlO "2 nM, lxlO "3 nM or less.
- the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ with a kD of ⁇ ⁇ , 1 nM, lxlO _1 nM, lxlO "2 nM, lxlO "3 nM or less. In some embodiments, the anti-NRGl antibody binds to neuregulinl ⁇ with equal or greater affinity than it binds to neuregulinla. In some embodiments, the anti-NRGl antibody binds neuregulinip with an affinity that is greater than 10-, 20-, 30-, 40-, 50-, 60-. 70- 80- 90- 100-, 125-. 150-.
- the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ with equal or greater affinity than it binds to the EGF domain of neuregulinla . In some embodiments, the anti-NRGl antibody binds to the EGF domain of neuregulinl ⁇ with an affinity that is greater than 10-, 20-, 30-, 40-, 50-, 60-.
- the anti-NRGl antibody binds to neuregulinla with equal or greater affinity than it binds to neuregulinl ⁇ . In some embodiments, the anti-NRGl antibody binds to neuregulinla with an affinity that is greater than 10-, 20-, 30-, 40-, 50-, 60-. 70- 80- 90- 100-, 125-. 150-. 200-, 250-, 300-, 350-, 400-, 450-. 500-, 550-, 600-, 650-. 700-, 750-, 800-, 850-. 900-, 950-, 1000-, 1500-, 2000-fold or greater affinity to which it binds to neuregulinl ⁇ .
- the anti-NRGl antibody binds to the EGF domain of neuregulinla with equal or greater affinity than it binds to the EGF domain of neuregulinl ⁇ . In some embodiments, the anti-NRGl antibody binds to the EGF domain of neuregulinla with an affinity that is greater than 10-, 20-, 30-, 40-, 50-, 60-. 70- 80- 90- 100-, 125-. 150-. 200-, 250-, 300-, 350-, 400-, 450-. 500-, 550-, 600-, 650-. 700-, 750-, 800-, 850-. 900-, 950-, 1000-, 1500-, 2000-fold or greater affinity to which it binds to the EGF domain of neuregulinl ⁇ .
- the anti-NRGl antibody binds to an epitope of neuregulinl ⁇ and to an epitope of neuregulinla. In one embodiment, the epitopes are present in the EGF domain of neuregulinl ⁇ and neuregulinla. In one embodiment, anti-NRGl antibody binds to an epitope of neuregulinl ⁇ that is from, within, or overlapping the amino acid sequence of SEQ ID NO: 4.
- the epitope of neuregulinl ⁇ that is bound by the anti-NRGl antibody is from, within, or overlapping a segment the amino acid sequence of SEQ ID NO: 4, such as, for example, amino 1-37 of SEQ ID NO: 4 or amino acids 38-64 of SEQ ID NO: 4.
- the anti-NRGl antibody binds to an epitope of neuregulinla that is from, within, or overlapping the amino acid sequence of SEQ ID NO: 3.
- the epitope of neuregulinla that is bound by the anti-NRGl antibody is from, within, or overlapping a segment the amino acid sequence of SEQ ID NO: 3, such as, for example, amino 1-36 of SEQ ID NO: 3 or the amino acid sequence of amino acids 37-58 of SEQ ID NO: 3.
- the invention provides for an anti-NRGl antibody that binds to the same epitope as an anti-NRGl antibody provided herein. In another aspect, the invention provides for an anti-NRGl antibody that competes for binding to the same epitope as an anti-NRGl antibody provided herein.
- the invention provides an anti-NRGl antibody comprising an HVR-H1 comprising an amino acid sequence selected from SEQ ID NOs: 5, 28, 34, 37, 39, 41, and 76, an HVR- H2, comprising an amino acid sequence selected from SEQ ID NOs: 6 and 29, and an HVR-H3 comprising an amino acid sequence selected from SEQ ID NOs: 7, 30, 42, 43, 44, 48, and 50.
- the invention provides an anti-NRGl antibody comprising an HVR-L1 comprising aan amino acid sequence selected from SEQ ID NOs: 8, 12, 16, 19, and 31, an HVR-L2, comprising an amino acid sequence selected from SEQ ID NOs: 9, 13, 17, 32, 46, and 49, and an HVR-L3 comprising an amino acid sequence selected from SEQ ID NOs: 10, 11, 14, 15, 18, 20, 33, 35, 36, 38, 40, 45, 47, and 51.
- the invention provides an anti-NRGl antibody comprising an HVR-Hl comprising an amino acid sequence selected from SEQ ID NOs: 5, 28, 34, 37, 39, 41, and 76, an HVR-H2, comprising an amino acid sequence selected from SEQ ID NOs: 6 and 29, and an HVR-H3 comprising an amino acid sequence selected from SEQ ID NOs: 7, 30, 42, 43, 44, 48, and 50, an HVR-L1 comprising an amino acid sequence selected from SEQ ID NOs: 8, 12, 16, 19, and 31, an HVR-L2, comprising an amino acid sequence selected from SEQ ID NOs: 9, 13, 17, 32, 46, and 49, and an HVR- L3 comprising an amino acid sequence selected from SEQ ID NOs: 10, 11, 14, 15, 18, 20, 33, 35, 36, 38, 40, 45, 47, and 51.
- the invention provides an anti-NRGl antibody comprising an HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5, an HVR-H2, comprising the amino acid sequence of SEQ ID NO: 6, and an HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7.
- the invention provides an anti-NRGl antibody comprising an HVR-L1 comprising aan amino acid sequence selected from SEQ ID NOs: 8, 12, 16, and 19, an HVR-L2, comprising an amino acid sequence selected from SEQ ID NOs: 9, 13, and 17, and an HVR-L3 comprising an amino acid sequence selected from SEQ ID NOs: 10, 11, 14, 15, 18, and 20.
- the invention provides an anti-NRGl antibody comprising an an HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5, an HVR-H2, comprising the amino acid sequence of SEQ ID NO: 6, and an HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7, an HVR-L1 comprising aan amino acid sequence selected from SEQ ID NOs: 8, 12, 16, and 19, an HVR-L2, comprising an amino acid sequence selected from SEQ ID NOs: 9, 13, and 17, and an HVR-L3 comprising an amino acid sequence selected from SEQ ID NOs: 10, 11, 14, 15, 18, and 20.
- the invention provides an anti-NRGl antibody comprising an HVR-Hl comprising an amino acid sequence selected from SEQ ID NOs: 28, 34, 37, 39, 41, and 76, an HVR- H2, comprising the amino acid sequence of SEQ ID NO: 6, and an HVR-H3 comprising an amino acid sequence selected from SEQ ID NOs: 30, 42, 43, 44, 48, and 50.
- the invention provides an anti-NRGl antibody comprising an HVR-Ll comprising aan amino acid sequence selected from SEQ ID NOs: 19 and 31, an HVR-L2, comprising an amino acid sequence selected from SEQ ID NOs: 32, 46, and 49, and an HVR-L3 comprising an amino acid sequence selected from SEQ ID NOs: 33, 35, 36, 38, 40, 45, 47, and 51.
- the invention provides an anti-NRGl antibody comprising an HVR-Hl comprising an amino acid sequence selected from SEQ ID NOs: 28, 34, 37, 39, 41, and 76, an HVR-H2, comprising the amino acid sequence of SEQ ID NO: 6, and an HVR-H3 comprising an amino acid sequence selected from SEQ ID NOs: 30, 42, 43, 44, 48, and 50, an HVR-Ll comprising aan amino acid sequence selected from SEQ ID NOs: 19 and 31, an HVR-L2, comprising an amino acid sequence selected from SEQ ID NOs: 32, 46, and 49, and an HVR-L3 comprising an amino acid sequence selected from SEQ ID NOs: 33, 35, 36, 38, 40, 45, 47, and 51.
- the invention provides an anti-NRGl antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17; and (f) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5
- HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6
- HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7
- HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16
- HVR-L2 comprising the amino
- the invention provides an antibody comprising at least one, at least two, or all three VH HVR sequences selected from (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7.
- the antibody comprises (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7.
- the invention provides an antibody comprising at least one, at least two, or all three VL HVR sequences selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17 and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- the antibody comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- an antibody of the invention comprises (a) a VH domain comprising at least one, at least two, or all three VH HVR sequences selected from (i) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5, (ii) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6, and (iii) HVR-H3 comprising an amino acid sequence selected from SEQ ID NO: 7; and (b) a VL domain comprising at least one, at least two, or all three VL HVR sequences selected from (i) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16, (ii) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- the invention provides an antibody comprising (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 5; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17; and (f) HVR-L3 comprising an amino acid sequence selected from SEQ ID NO: 18.
- the invention provides an anti-NRGl antibody comprising at least one, two, three, four, five, or six HVRs selected from (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 76; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31 ; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32; and (f) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- HVR-Hl comprising the amino acid sequence of SEQ ID NO: 76
- HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29
- HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43
- HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31
- HVR-L2
- the invention provides an antibody comprising at least one, at least two, or all three VH HVR sequences selected from (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 76; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43.
- the antibody comprises (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 76; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29; and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43.
- the invention provides an antibody comprising at least one, at least two, or all three VL HVR sequences selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31 ; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32 and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- the antibody comprises (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31 ; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- an antibody of the invention comprises (a) a VH domain comprising at least one, at least two, or all three VH HVR sequences selected from (i) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 76, (ii) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29, and (iii) HVR-H3 comprising an amino acid sequence selected from SEQ ID NO: 43; and (b) a VL domain comprising at least one, at least two, or all three VL HVR sequences selected from (i) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31, (ii) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32, and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- the invention provides an antibody comprising (a) HVR-Hl comprising the amino acid sequence of SEQ ID NO: 76; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43; (d) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31 ; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32; and (f) HVR-L3 comprising an amino acid sequence selected from SEQ ID NO: 33.
- the invention provides an anti-NRGl antibody comprising a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 21. In one aspect, the invention provides an anti-NRGl antibody comprising a light chain variable region (VL) comprising an amino acid sequence selected from SEQ ID NOs: 22, 23, 24, 25, 26, and 27. In one aspect, the invention provides an anti-NRGl antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 21 and a VL comprising an amino acid sequence selected from SEQ ID NOs: 22, 23, 24, 25, 26, and 27.
- the invention provides an anti-NRGl antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence selected from SEQ ID NOs: 52, 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, and 72.
- VH heavy chain variable region
- VL light chain variable region
- the invention provides an anti-NRGl antibody comprising a VH comprising an amino acid sequence selected from SEQ ID NOs: 52, 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, and 72 and a VL comprising an amino acid sequence selected from SEQ ID NOs: 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, and 75.
- an anti-NRGl antibody comprises a VH sequence having at least 90%, 91 >, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 21.
- an anti-NRGl antibody comprises a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid selected from SEQ ID NOs: 22, 23, 24, 25, 26, and 27.
- an anti-NRGl antibody comprises a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 21 and a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid selected from SEQ ID NOs: 22, 23, 24, 25, 26, and 27.
- an anti-NRGl antibody comprises a VH sequence having at least 90%>, 91 >, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 52, 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, and 72.
- an anti-NRGl antibody comprises a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%o, 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, and 75.
- an anti-NRGl antibody comprises a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NOs: 52, 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, and 72 and a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid selected from SEQ ID NOs: 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, and 75.
- an anti-NRGl antibody comprises a VH sequence having at least 90%>, 91 >, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 21.
- a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%), 96%o, 97%), 98%o, or 99%> identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-NRGl antibody comprising that sequence retains the ability to bind to NRG1 a and NRG1 ⁇ .
- the anti-NRGl antibody comprises the VH sequence in SEQ ID NO: 21, including post-translational modifications of that sequence.
- the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 5, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7.
- an anti-NRGl antibody comprising a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 26.
- VL light chain variable domain
- a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-NRGl antibody comprising that sequence retains the ability to bind to NRGla and NRG1 ⁇ .
- the anti-NRGl antibody comprises the VL sequence in SEQ ID NO: 26, including post-translational modifications of that sequence.
- the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 16; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17; and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 18.
- an anti-NRGl antibody comprising a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above.
- the antibody comprises the VH and VL sequences in SEQ ID NO: 21 and SEQ ID NO: 26, respectively, including post-translational modifications of those sequences.
- an anti-NRGl antibody comprises a VH sequence having at least 90%>, 91 >, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 63.
- a VH sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%o, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-NRGl antibody comprising that sequence retains the ability to bind to NRG1 a and NRG1 ⁇ .
- the anti-NRGl antibody comprises the VH sequence in SEQ ID NO: 63, including post-translational modifications of that sequence.
- the VH comprises one, two or three HVRs selected from: (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 76, (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29, and (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43.
- an anti-NRGl antibody comprising a light chain variable domain (VL) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 53 .
- VL light chain variable domain
- a VL sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-NRGl antibody comprising that sequence retains the ability to bind to NRGla and NRG1 ⁇ .
- the anti-NRGl antibody comprises the VL sequence in SEQ ID NO: 53, including post-translational modifications of that sequence.
- the VL comprises one, two or three HVRs selected from (a) HVR-L1 comprising the amino acid sequence of SEQ ID NO: 31 ; (b) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32 and (c) HVR-L3 comprising the amino acid sequence of SEQ ID NO: 33.
- an anti-NRGl antibody comprising a VH as in any of the embodiments provided above, and a VL as in any of the embodiments provided above.
- the antibody comprises the VH and VL sequences in SEQ ID NO: 63 and SEQ ID NO: 53, respectively, including post-translational modifications of those sequences.
- an anti-NRGl antibody comprises a heavy chain sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 72.
- the anti-NRGl antibody comprises the heavy chain sequence in SEQ ID NO: 72, including post-translational modifications of that sequence.
- an anti-NRGl antibody comprising a light chain having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 73 .
- a light chain sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-NRGl antibody comprising that sequence retains the ability to bind to NRGla and NRG1 ⁇ .
- the anti-NRGl antibody comprises the light chain sequence in SEQ ID NO: 73, including post-translational modifications of that sequence.
- an anti-NRGl antibody comprising a heavy chain as in any of the embodiments provided above, and a light chain in any of the embodiments provided above.
- the antibody comprises the heavy chain and light chain sequences in SEQ ID NO: 72 and SEQ ID NO: 73, respectively, including post-translational modifications of those sequences.
- an anti-NRGl antibody comprises a heavy chain sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 74.
- the anti-NRGl antibody comprises the heavy chain sequence in SEQ ID NO: 74, including post-translational modifications of that sequence.
- an anti-NRGl antibody comprising a light chain having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 75 .
- a light chain sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-NRGl antibody comprising that sequence retains the ability to bind to NRGla and NRG1 ⁇ .
- the anti-NRGl antibody comprises the light chain sequence in SEQ ID NO: 75, including post-translational modifications of that sequence.
- an anti-NRGl antibody comprising a heavy chain as in any of the embodiments provided above, and a light chain in any of the embodiments provided above.
- the antibody comprises the heavy chain and light chain sequences in SEQ ID NO: 74 and SEQ ID NO: 75, respectively, including post-translational modifications of those sequences.
- the invention provides an antibody that binds to the same epitope or epitopes as an anti-NRGl antibody provided herein.
- an antibody is provided that binds to the same epitope as an anti-NRGl antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 5; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 6; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 7; (d) HVR-Ll comprising the amino acid sequence of SEQ ID NO: 16; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 17; and (f) HVR-L3 comprising an amino acid sequence selected from SEQ ID NO: 18.
- an antibody that binds to the same epitope or epitopes as an anti-NRGl antibody comprising (a) HVR-H1 comprising the amino acid sequence of SEQ ID NO: 76; (b) HVR-H2 comprising the amino acid sequence of SEQ ID NO: 29; (c) HVR-H3 comprising the amino acid sequence of SEQ ID NO: 43; (d) HVR-Ll comprising the amino acid sequence of SEQ ID NO: 31 ; (e) HVR-L2 comprising the amino acid sequence of SEQ ID NO: 32; and (f) HVR-L3 comprising an amino acid sequence selected from SEQ ID NO: 33.
- an antibody that binds to the same epitope or epitopes as an anti-NRGl antibody comprising the VH sequence of SEQ ID NO: 21 and the VL sequence of SEQ ID NO: 26. In one embodiment, an antibody is provided that binds to the same epitope or epitopes as an anti-NRGl antibody comprising the VH sequence of SEQ ID NO: 63 and the VL sequence of SEQ ID NO: 53.
- an antibody that competes for binding to the same epitope or epitopes as an anti-NRGl antibody as described herein.
- the anti-NRGl antibody binds to an epitope of neuregulinl ⁇ and to an epitope of neuregulinl a. In one embodiment, the epitopes are present in the EGF domain of neuregulinl ⁇ and neuregulinl a. In one embodiment, anti-NRGl antibody binds to an epitope of neuregulinl ⁇ that is from, within, or overlapping the amino acid sequence of SEQ ID NO: 4.
- the epitope of neuregulinl ⁇ that is bound by the anti-NRGl antibody is from, within, or overlapping a segment the amino acid sequence of SEQ ID NO: 4, such as, for example, amino 1-37 of SEQ ID NO: 4 or amino acids 38-64 of SEQ ID NO: 4.
- the anti-NRGl antibody binds to an epitope of neuregulinl a that is from, within, or overlapping the amino acid sequence of SEQ ID NO: 3.
- the epitope of neuregulinl a that is bound by the anti-NRGl antibody is from, within, or overlapping a segment the amino acid sequence of SEQ ID NO: 3, such as, for example, amino 1-36 of SEQ ID NO: 3 or the amino acid sequence of amino acids 37-58 of SEQ ID NO: 3.
- an anti-NRGl antibody is a monoclonal antibody, including a chimeric, humanized or human antibody.
- an anti-NRGl antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab') 2 fragment.
- the antibody is a full length antibody, e.g., an intact IgGl antibody or other antibody class or isotype as defined herein.
- an anti-NRGl antibody may incorporate any of the features, singly or in combination, as described in Sections 1-7 below: 1) Antibody Affinity
- an antibody provided herein has a dissociation constant (Kd) of ⁇ ⁇ ⁇ , ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM (e.g. 10 "8 M or less, e.g. from 10 "8 M to 10 "13 M, e.g., from 10 "9 M to 10 "13 M).
- Kd dissociation constant
- Kd is measured by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay.
- Solution binding affinity of Fabs for antigen is measured by equilibrating Fab with a minimal concentration of ( 125 I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti-Fab antibody-coated plate (see, e.g., Chen et al., J. Mol. Biol. 293:865-881(1999)).
- MICROTITER ® multi-well plates (Thermo Scientific) are coated overnight with 5 ⁇ g/ml of a capturing anti-Fab antibody (Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and subsequently blocked with 2% (w/v) bovine serum albumin in PBS for two to five hours at room temperature (approximately 23°C).
- a capturing anti-Fab antibody Cappel Labs
- bovine serum albumin in PBS for two to five hours at room temperature (approximately 23°C).
- Kd is measured using surface plasmon resonance assays using a BIACORE ® -2000 or a BIACORE ® -3000 (BIAcore, Inc., Piscataway, NJ) at 25°C with immobilized antigen CM5 chips at -10 response units (RU).
- CM5 carboxymethylated dextran biosensor chips
- EDC N-ethyl-N'- (3-dimethylaminopropyl)- carbodiimide hydrochloride
- NHS N-hydroxysuccinimide
- Antigen is diluted with 10 mM sodium acetate, pH 4.8, to 5 ⁇ g/ml (-0.2 ⁇ ) before injection at a flow rate of 5 ⁇ /minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, 1 M ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% polysorbate 20 (TWEEN-20TM) surfactant (PBST) at 25°C at a flow rate of approximately 25 ⁇ /min.
- TWEEN-20TM polysorbate 20
- association rates (k on ) and dissociation rates (k 0 ff) are calculated using a simple one-to- one Langmuir binding model (BIACORE ® Evaluation Software version 3.2) by simultaneously fitting the association and dissociation sensorgrams.
- the equilibrium dissociation constant (Kd) is calculated as the ratio k 0 ff/k on See, e.g., Chen et al., J. Mol. Biol. 293:865-881 (1999).
- an antibody provided herein is an antibody fragment.
- Antibody fragments include, but are not limited to, Fab, Fab', Fab'-SH, F(ab') 2 , Fv, and scFv fragments, and other fragments described below.
- Fab fragment antigen
- Fab' fragment antigen binding domain
- Fab'-SH fragment antigen binding domain antigen binding domain antigen binding domain antigen binding domain antigen binding domain antigen binding domains
- Fv fragment antigen binding domain antigen binding
- scFv fragments see, e.g., Pluckthun, in The Pharmacology of Monoclonal Antibodies , vol. 113, Rosenburg and Moore eds., (Springer- Verlag, New York), pp. 269- 315 (1994); see also WO 93/16185; and U.S.
- Patent Nos. 5,571,894 and 5,587,458 For discussion of Fab and F(ab') 2 fragments comprising salvage receptor binding epitope residues and having increased in vivo half-life, see U.S. Patent No. 5,869,046.
- Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, for example, EP 404,097; WO 1993/01161 ; Hudson et al., Nat. Med. 9: 129-134 (2003); and Hollinger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al., Nat. Med. 9: 129-134 (2003).
- Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody.
- a single-domain antibody is a human single-domain antibody (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516 Bl).
- Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells (e.g. E. coli or phage), as described herein.
- recombinant host cells e.g. E. coli or phage
- an antibody provided herein is a chimeric antibody.
- Certain chimeric antibodies are described, e.g., in U.S. Patent No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81 :6851-6855 (1984)).
- a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region.
- a chimeric antibody is a "class switched" antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
- a chimeric antibody is a humanized antibody.
- a non-human antibody is humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody.
- a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody, and FRs (or portions thereof) are derived from human antibody sequences.
- HVRs e.g., CDRs, (or portions thereof) are derived from a non-human antibody
- FRs or portions thereof
- a humanized antibody optionally will also comprise at least a portion of a human constant region.
- some FR residues in a humanized antibody are substituted with corresponding residues from a non- human antibody (e.g., the antibody from which the HVR residues are derived), e.g., to restore or improve antibody specificity or affinity.
- a non- human antibody e.g., the antibody from which the HVR residues are derived
- Human framework regions that may be used for humanization include but are not limited to: framework regions selected using the "best- fit" method (see, e.g., Sims et al. J. Immunol. 151 :2296 (1993)); framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions (see, e.g., Carter et al. Proc. Natl. Acad. Sci. USA, 89:4285 (1992); and Presta et al. J. Immunol, 151 :2623 (1993)); human mature (somatically mutated) framework regions or human germline framework regions (see, e.g., Almagro and Fransson, Front. Biosci.
- an antibody provided herein is a human antibody.
- Human antibodies can be produced using various techniques known in the art. Human antibodies are described generally in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20:450-459 (2008).
- Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge.
- Such animals typically contain all or a portion of the human immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal's chromosomes. In such transgenic mice, the endogenous immunoglobulin loci have generally been inactivated.
- Human antibodies can also be made by hybridoma-based methods. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described. (See, e.g., Kozbor J. Immunol, 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al., J. Immunol., 147: 86 (1991).) Human antibodies generated via human B-cell hybridoma technology are also described in Li et al, Proc. Nail Acad. Set USA, 103:3557-3562 (2006).
- Human antibodies may also be generated by isolating Fv clone variable domain sequences selected from human-derived phage display libraries. Such variable domain sequences may then be combined with a desired human constant domain. Techniques for selecting human antibodies from antibody libraries are described below.
- Antibodies of the invention may be isolated by screening combinatorial libraries for antibodies with the desired activity or activities. For example, a variety of methods are known in the art for generating phage display libraries and screening such libraries for antibodies possessing the desired binding characteristics. Such methods are reviewed, e.g., in Hoogenboom et al. in Methods in
- naive libraries can be cloned (e.g., from human) to provide a single source of antibodies to a wide range of non-self and also self antigens without any immunization as described by Griffiths et al., EMBO J, 12: 725-734 (1993).
- naive libraries can also be made synthetically by cloning unrearranged V-gene segments from stem cells, and using PCR primers containing random sequence to encode the highly variable CDR3 regions and to accomplish rearrangement in vitro, as described by Hoogenboom and Winter, J. Mol. Biol, 227: 381-388 (1992).
- Patent publications describing human antibody phage libraries include, for example: US Patent No. 5,750,373, and US Patent Publication Nos. 2005/0079574, 2005/0119455, 2005/0266000, 2007/0117126, 2007/0160598, 2007/0237764, 2007/0292936, and 2009/0002360.
- Antibodies or antibody fragments isolated from human antibody libraries are considered human antibodies or human antibody fragments herein.
- an antibody provided herein is a multispecific antibody, e.g. a bispecific antibody.
- Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites.
- one of the binding specificities is for NRG1 and the other is for any other antigen.
- bispecific antibodies may bind to two different epitopes of NRG1.
- Bispecific antibodies may also be used to localize cytotoxic agents to cells which express NRG1.
- Bispecific antibodies can be prepared as full length antibodies or antibody fragments.
- Multispecific antibodies include, but are not limited to, recombinant co- expression of two immunoglobulin heavy chain-light chain pairs having different specificities (see Milstein and Cuello, Nature 305: 537 (1983)), WO 93/08829, and Traunecker et al., EMBO J. 10: 3655 (1991)), and "knob-in-hole” engineering (see, e.g., U.S. Patent No. 5,731,168). Multi-specific antibodies may also be made by engineering electrostatic steering effects for making antibody Fc- heterodimeric molecules (WO 2009/089004A1); cross-linking two or more antibodies or fragments
- the antibody or fragment herein also includes a "Dual Acting FAb” or “DAF” comprising an antigen binding site that binds to NRGl as well as another, different antigen (see, US 2008/0069820, for example).
- a “Dual Acting FAb” or “DAF” comprising an antigen binding site that binds to NRGl as well as another, different antigen (see, US 2008/0069820, for example).
- amino acid sequence variants of the antibodies provided herein are contemplated. For example, it may be desirable to improve the binding affinity and/or other biological properties of the antibody.
- Amino acid sequence variants of an antibody may be prepared by introducing appropriate modifications into the nucleotide sequence encoding the antibody, or by peptide synthesis. Such modifications include, for example, deletions from, and/or insertions into and/or substitutions of residues within the amino acid sequences of the antibody. Any combination of deletion, insertion, and substitution can be made to arrive at the final construct, provided that the final construct possesses the desired characteristics, e.g., antigen-binding.
- antibody variants having one or more amino acid substitutions are provided.
- Sites of interest for substitutional mutagenesis include the HVRs and FRs.
- Conservative substitutions are shown in Table 1 under the heading of "conservative substitutions.” More substantial changes are provided in Table 1 under the heading of "exemplary substitutions,” and as further described below in reference to amino acid side chain classes.
- Amino acid substitutions may be introduced into an antibody of interest and the products screened for a desired activity, e.g., retained/improved antigen binding, decreased immunogenicity, or improved ADCC or CDC.
- Amino acids may be grouped according to common side-chain properties:
- Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
- substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g. a humanized or human antibody).
- a parent antibody e.g. a humanized or human antibody
- the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parent antibody and/or will have substantially retained certain biological properties of the parent antibody.
- An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display-based affinity maturation techniques such as those described herein. Briefly, one or more HVR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g. binding affinity).
- Alterations may be made in HVRs, e.g., to improve antibody affinity. Such alterations may be made in HVR "hotspots," i.e., residues encoded by codons that undergo mutation at high frequency during the somatic maturation process (see, e.g., Chowdhury, Methods Mol. Biol. 207: 179-196 (2008)), and/or SDRs (a-CDRs), with the resulting variant VH or VL being tested for binding affinity.
- HVR "hotspots” i.e., residues encoded by codons that undergo mutation at high frequency during the somatic maturation process (see, e.g., Chowdhury, Methods Mol. Biol. 207: 179-196 (2008)), and/or SDRs (a-CDRs), with the resulting variant VH or VL being tested for binding affinity.
- Affinity maturation by constructing and reselecting from secondary libraries has been described, e.g., in Hoogenboo
- affinity maturation diversity is introduced into the variable genes chosen for maturation by any of a variety of methods (e.g., error- prone PCR, chain shuffling, or oligonucleoti de-directed mutagenesis).
- a secondary library is then created. The library is then screened to identify any antibody variants with the desired affinity.
- HVR-directed approaches in which several HVR residues (e.g., 4-6 residues at a time) are randomized.
- HVR residues involved in antigen binding may be specifically identified, e.g., using alanine scanning mutagenesis or modeling.
- CDR-H3 and CDR-L3 in particular are often targeted.
- substitutions, insertions, or deletions may occur within one or more
- HVRs so long as such alterations do not substantially reduce the ability of the antibody to bind antigen.
- conservative alterations e.g., conservative substitutions as provided herein
- HVRs Such alterations may be outside of HVR "hotspots" or SDRs.
- each HVR either is unaltered, or contains no more than one, two or three amino acid substitutions.
- a useful method for identification of residues or regions of an antibody that may be targeted for mutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells (1989) Science, 244: 1081-1085.
- a residue or group of target residues e.g., charged residues such as arg, asp, his, lys, and glu
- a neutral or negatively charged amino acid e.g., alanine or polyalanine
- Further substitutions may be introduced at the amino acid locations demonstrating functional sensitivity to the initial substitutions.
- a crystal structure of an antigen-antibody complex to identify contact points between the antibody and antigen. Such contact residues and neighboring residues may be targeted or eliminated as candidates for substitution.
- Variants may be screened to determine whether they contain the desired properties.
- Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as
- intrasequence insertions of single or multiple amino acid residues.
- terminal insertions include an antibody with an N-terminal methionyl residue.
- Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme (e.g. for ADEPT) or a polypeptide which increases the serum half-life of the antibody.
- an antibody provided herein is altered to increase or decrease the extent to which the antibody is glycosylated. Addition or deletion of glycosylation sites to an antibody may be conveniently accomplished by altering the amino acid sequence such that one or more glycosylation sites is created or removed. Where the antibody comprises an Fc region, the carbohydrate attached thereto may be altered. Native antibodies produced by mammalian cells typically comprise a branched, biantennary oligosaccharide that is generally attached by an N-linkage to Asn297 of the CH2 domain of the Fc region. See, e.g., Wright et al. TIBTECH 15:26-32 (1997).
- the oligosaccharide may include various carbohydrates, e.g., mannose, N-acetyl glucosamine (GlcNAc), galactose, and sialic acid, as well as a fucose attached to a GlcNAc in the "stem" of the biantennary oligosaccharide structure.
- modifications of the oligosaccharide in an antibody of the invention may be made in order to create antibody variants with certain improved properties.
- antibody variants having a carbohydrate structure that lacks fucose attached (directly or indirectly) to an Fc region.
- the amount of fucose in such antibody may be from 1% to 80%, from 1% to 65%, from 5% to 65% or from 20% to 40%.
- the amount of fucose is determined by calculating the average amount of fucose within the sugar chain at Asn297, relative to the sum of all glycostructures attached to Asn 297 (e. g. complex, hybrid and high mannose structures) as measured by MALDI-TOF mass spectrometry, as described in
- Asn297 refers to the asparagine residue located at about position 297 in the Fc region (Eu numbering of Fc region residues); however, Asn297 may also be located about ⁇ 3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300, due to minor sequence variations in antibodies. Such fucosylation variants may have improved ADCC function. See, e.g., US Patent Publication Nos. US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd).
- Examples of cell lines capable of producing defucosylated antibodies include Led 3 CHO cells deficient in protein fucosylation (Ripka et al. Arch. Biochem. Biophys.
- knockout cell lines such as alpha- 1 ,6-fucosyltransferase gene, FUT8, knockout CHO cells (see, e.g., Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004); Kanda, Y. et al., Biotechnol. Bioeng., 94(4):680-688 (2006); and
- Antibodies variants are further provided with bisected oligosaccharides, e.g., in which a biantennary oligosaccharide attached to the Fc region of the antibody is bisected by GlcNAc. Such antibody variants may have reduced fucosylation and/or improved ADCC function. Examples of such antibody variants are described, e.g., in WO 2003/011878 (Jean-Mairet et al.); US Patent No.
- Antibody variants with at least one galactose residue in the oligosaccharide attached to the Fc region are also provided. Such antibody variants may have improved CDC function. Such antibody variants are described, e.g., in WO 1997/30087 (Patel et al.); WO 1998/58964 (Raju, S.); and WO 1999/22764 (Raju, S.).
- one or more amino acid modifications may be introduced into the Fc region of an antibody provided herein, thereby generating an Fc region variant.
- the Fc region variant may comprise a human Fc region sequence (e.g., a human IgGl, IgG2, IgG3 or IgG4 Fc region) comprising an amino acid modification (e.g. a substitution) at one or more amino acid positions.
- the invention contemplates an antibody variant that possesses some but not all effector functions, which make it a desirable candidate for applications in which the half life of the antibody in vivo is important yet certain effector functions (such as complement and ADCC) are unnecessary or deleterious.
- In vitro and/or in vivo cytotoxicity assays can be conducted to confirm the reduction/depletion of CDC and/or ADCC activities.
- Fc receptor (FcR) binding assays can be conducted to ensure that the antibody lacks FcyR binding (hence likely lacking ADCC activity), but retains FcRn binding ability.
- NK cells express FcyRIII only, whereas monocytes express FcyRI, FcyRII and FcyRIII.
- FcR expression on hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991).
- Non-limiting examples of in vitro assays to assess ADCC activity of a molecule of interest is described in U.S. Patent No. 5,500,362 (see, e.g. Hellstrom, I. et al. Proc. Natl Acad. Sci. USA 83:7059-7063 (1986)) and Hellstrom, I et al., Proc. Natl Acad. Sci. USA 82: 1499-1502 (1985); 5,821,337 (see
- non-radioactive assays methods may be employed (see, for example, ACTITM non-radioactive cytotoxicity assay for flow cytometry (CellTechnology, Inc. Mountain View, CA; and CytoTox 96 ® non-radioactive cytotoxicity assay (Promega, Madison, WI).
- Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and Natural Killer (NK) cells.
- PBMC peripheral blood mononuclear cells
- NK Natural Killer
- ADCC activity of the molecule of interest may be assessed in vivo, e.g., in a animal model such as that disclosed in Clynes et al.
- CI q binding assays may also be carried out to confirm that the antibody is unable to bind Clq and hence lacks CDC activity. See, e.g., Clq and C3c binding ELISA in WO 2006/029879 and WO 2005/100402.
- a CDC assay may be performed (see, for example, Gazzano-Santoro et al., J. Immunol.
- FcRn binding and in vivo clearance/half life determinations can also be performed using methods known in the art (see, e.g., Petkova, S.B. et al., Int'l. Immunol. 18(12): 1759-1769 (2006)).
- Antibodies with reduced effector function include those with substitution of one or more of Fc region residues 238, 265, 269, 270, 297, 327 and 329 (U.S. Patent No. 6,737,056).
- Such Fc mutants include Fc mutants with substitutions at two or more of amino acid positions 265, 269, 270, 297 and 327, including the so-called "DANA" Fc mutant with substitution of residues 265 and 297 to alanine (US Patent No. 7,332,581).
- an antibody variant comprises an Fc region with one or more amino acid substitutions which improve ADCC, e.g., substitutions at positions 298, 333, and/or 334 of the Fc region (EU numbering of residues).
- alterations are made in the Fc region that result in altered ⁇ i.e., either improved or diminished) Clq binding and/or Complement Dependent Cytotoxicity (CDC), e.g., as described in US Patent No. 6,194,551, WO 99/51642, and Idusogie et al. J. Immunol. 164: 4178-4184 (2000).
- CDC Complement Dependent Cytotoxicity
- Antibodies with increased half lives and improved binding to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgGs to the fetus are described in US2005/0014934A1 (Hinton et al.). Those antibodies comprise an Fc region with one or more substitutions therein which improve binding of the Fc region to FcRn.
- Such Fc variants include those with substitutions at one or more of Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, e.g., substitution of Fc region residue 434 (US Patent No. 7,371,826).
- cysteine engineered antibodies e.g., "thioMAbs”
- one or more residues of an antibody are substituted with cysteine residues.
- the substituted residues occur at accessible sites of the antibody.
- reactive thiol groups are thereby positioned at accessible sites of the antibody and may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create an immunoconjugate, as described further herein.
- any one or more of the following residues may be substituted with cysteine: V205 (Kabat numbering) of the light chain; Al 18 (EU numbering) of the heavy chain; and S400 (EU numbering) of the heavy chain Fc region.
- Cysteine engineered antibodies may be generated as described, e.g., in U.S. Patent No. 7,521,541. e. Antibody Derivatives
- an antibody provided herein may be further modified to contain additional nonproteinaceous moieties that are known in the art and readily available.
- the moieties suitable for derivatization of the antibody include but are not limited to water soluble polymers.
- water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-l,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, prolypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., PEG), copolymers
- Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water.
- the polymer may be of any molecular weight, and may be branched or unbranched.
- the number of polymers attached to the antibody may vary, and if more than one polymer are attached, they can be the same or different molecules. In general, the number and/or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody to be improved, whether the antibody derivative will be used in a therapy under defined conditions, etc.
- conjugates of an antibody and nonproteinaceous moiety that may be selectively heated by exposure to radiation are provided.
- the nonproteinaceous moiety is a carbon nanotube (Kam et al., Proc. Natl. Acad. Sci. USA 102: 11600-11605 (2005)).
- the radiation may be of any wavelength, and includes, but is not limited to, wavelengths that do not harm ordinary cells, but which heat the nonproteinaceous moiety to a temperature at which cells proximal to the antibody-nonproteinaceous moiety are killed.
- Antibodies may be produced using recombinant methods and compositions, e.g., as described in U.S. Patent No. 4,816,567.
- isolated nucleic acid encoding an anti-NRGl antibody described herein is provided.
- Such nucleic acid may encode an amino acid sequence comprising the VL and/or an amino acid sequence comprising the VH of the antibody (e.g., the light and/or heavy chains of the antibody).
- one or more vectors e.g., expression vectors
- a host cell comprising such nucleic acid is provided.
- a host cell comprises (e.g., has been transformed with): (1) a vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and an amino acid sequence comprising the VH of the antibody, or (2) a first vector comprising a nucleic acid that encodes an amino acid sequence comprising the VL of the antibody and a second vector comprising a nucleic acid that encodes an amino acid sequence comprising the VH of the antibody.
- the host cell is eukaryotic, e.g. a Chinese Hamster Ovary (CHO) cell or lymphoid cell (e.g., Y0, NSO, Sp20 cell).
- a method of making an anti-NRGl antibody comprises culturing a host cell comprising a nucleic acid encoding the antibody, as provided above, under conditions suitable for expression of the antibody, and optionally recovering the antibody from the host cell (or host cell culture medium).
- nucleic acid encoding an antibody is isolated and inserted into one or more vectors for further cloning and/or expression in a host cell.
- nucleic acid may be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody).
- Suitable host cells for cloning or expression of antibody-encoding vectors include prokaryotic or eukaryotic cells described herein.
- prokaryotic or eukaryotic cells described herein.
- antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed.
- expression of antibody fragments and polypeptides in bacteria see, e.g., U.S. Patent Nos. 5,648,237, 5,789,199, and
- the antibody may be isolated from the bacterial cell paste in a soluble fraction and can be further purified.
- eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors, including fungi and yeast strains whose glycosylation pathways have been "humanized,” resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat. Biotech. 22: 1409-1414 (2004), and Li et al., Nat. Biotech. 24:210-215 (2006).
- Suitable host cells for the expression of glycosylated antibody are also derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for transfection of Spodoptera frugiperda cells.
- Plant cell cultures can also be utilized as hosts. See, e.g., US Patent Nos. 5,959,177,
- Vertebrate cells may also be used as hosts.
- mammalian cell lines that are adapted to grow in suspension may be useful.
- Other examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7); human embryonic kidney line (293 or 293 cells as described, e.g., in Graham et al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK); mouse Sertoli cells (TM4 cells as described, e.g., in Mather, Biol. Reprod.
- monkey kidney cells (CVl); African green monkey kidney cells (VERO-76); human cervical carcinoma cells (HELA); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor (MMT 060562); TRI cells, as described, e.g., in Mather et al., Annals N. Y. Acad. Sci. 383:44-68 (1982); MRC 5 cells; and FS4 cells.
- Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR " CHO cells (Urlaub et al., Proc. Natl. Acad. Sci.
- NRG1 antibodies provided herein may be identified, screened for, or characterized for their physical/chemical properties and/or biological activities by various assays known in the art.
- an antibody of the invention is tested for its antigen binding activity, e.g., by known methods such as ELISA, Western blot, etc.
- assays are provided for identifying anti-NRG antibodies having biological activity.
- Biological activity may include, e.g., inhibition of NRG1 induced receptor tyrosine kinase signaling, inhibition of tumor growth, inhibition of cellular proliferation, etc.
- Anti-NRGl antibodies having such biological activity in vivo and/or in vitro are also provided.
- an anti-NRGl antibody of the invention is tested for such biological activity.
- the ability of an anti-NRGl antibody to inhibit NRG1 induced receptor tyrosine kinase signaling can be measured by determining the level of NRG1 induced phosphorylation of the tyrosine residues of receptor tyrosine kinases in the presence and absence of a potential anti- NRGl antibody. Holmes, et al. 1992. The following is an exemplary assay to determine the phosphorylation state of receptor tyrosine kinases.
- Her2 and Her3 are stimulated with 10 nM NRG following a 60 minute pre-incubation with either the potential anti-NRGl antibody or buffer (control).
- Whole cell lysates are analyzed on a Western blot probed with an anti-phosphotyrosine antibody to determine level of tyrosine phosphorylation.
- the blots may be scanned to quantitate the anti-phosphotyrosine signal.
- Anti-NRGl antibodies would reduce the level of tyrosine phosphorylation as compared to the buffer control.
- the anti-NRGl antibodies inhibits NRG1 induced tyrosine kinase signaling by at least 30%, 40%, 50%, 60% 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% as compared to an untreated control.
- an antibody of the invention is tested for its ability to inhibit cell growth or proliferation in vitro.
- Assays for inhibition of cell growth or proliferation are well known in the art.
- Certain assays for cell proliferation exemplified by the "cell killing” assays described herein, measure cell viability.
- One such assay is the CellTiter-Glo Luminescent Cell Viability Assay, which is commercially available from Promega (Madison, WI). That assay determines the number of viable cells in culture based on quantitation of ATP present, which is an indication of metabolically active cells. See Crouch et al (1993) J. Immunol. Meth. 160:81-88, US Pat. No. 6602677.
- the assay may be conducted in 96- or 384-well format, making it amenable to automated high-throughput screening (HTS). See Cree et al (1995) Anticancer Drugs 6:398-404.
- the assay procedure involves adding a single reagent (CellTiter-Glo ® Reagent) directly to cultured cells. This results in cell lysis and generation of a luminescent signal produced by a luciferase reaction.
- the luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells present in culture. Data can be recorded by luminometer or CCD camera imaging device.
- the luminescence output is expressed as relative light units (RLU).
- MTT colorimetric assay that measures the oxidation of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide to formazan by
- mitochondrial reductase Like the CellTiter-GloTM assay, this assay indicates the number of metabolically active cells present in a cell culture. See, e.g., Mosmann (1983) J. Immunol. Meth. 65:55-63, and Zhang et al. (2005) Cancer Res. 65:3877-3882.
- an anti-NRGl antibody is tested for its ability to induce cell death in vitro.
- Assays for induction of cell death are well known in the art.
- such assays measure, e.g., loss of membrane integrity as indicated by uptake of propidium iodide (PI), trypan blue ⁇ see Moore et al. (1995) Cytotechnology, 17: 1-11), or 7AAD.
- PI propidium iodide
- trypan blue see Moore et al. (1995) Cytotechnology, 17: 1-11
- 7AAD propidium iodide
- cells are cultured in Dulbecco's Modified Eagle Medium (D-MEM):Ham's F-12 (50:50) supplemented with 10% heat-inactivated FBS (Hyclone) and 2 mM L-glutamine.
- the assay is performed in the absence of complement and immune effector cells.
- Cells are seeded at a density of 3 x 10 6 per dish in 100 x 20 mm dishes and allowed to attach overnight.
- the medium is removed and replaced with fresh medium alone or medium containing various concentrations of the antibody or immunoconjugate.
- the cells are incubated for a 3-day time period. Following treatment, monolayers are washed with PBS and detached by trypsinization.
- Cells are then centrifuged at 1200 rpm for 5 minutes at 4 °C, the pellet resuspended in 3 ml cold Ca 2+ binding buffer (10 mM Hepes, pH 7.4, 140 mM NaCl, 2.5 mM CaCl 2 ) and aliquoted into 35 mm strainer-capped 12 x 75 mm tubes (1 ml per tube, 3 tubes per treatment group) for removal of cell clumps. Tubes then receive PI (10 ⁇ g/ml). Samples are analyzed using a FACSCANTM flow cytometer and FACSCONVERTTM CellQuest software (Becton Dickinson).
- Antibodies which induce statistically significant levels of cell death as determined by PI uptake are thus identified.
- an anti-NRGl is tested for its ability to induce apoptosis (programmed cell death) in vitro.
- An exemplary assay for antibodies or immunconjugates that induce apoptosis is an annexin binding assay.
- an exemplary annexin binding assay cells are cultured and seeded in dishes as discussed in the preceding paragraph. The medium is removed and replaced with fresh medium alone or medium containing 0.001 to 10 ⁇ g/ml of the antibody or immunoconjugate. Following a three- day incubation period, monolayers are washed with PBS and detached by trypsinization.
- annexin V-FITC labeled annexin
- Samples are analyzed using a FACSCANTM flow cytometer and FACSCONVERTTM CellQuest software (BD Biosciences). Antibodies that induce statistically significant levels of annexin binding relative to control are thus identified.
- Another exemplary assay for antibodies or immunconjugates that induce apoptosis is a histone DNA ELISA colorimetric assay for detecting internucleosomal degradation of genomic DNA. Such an assay can be performed using, e.g., the Cell Death Detection ELISA kit (Roche, Palo Alto, CA).
- Cells for use in any of the above in vitro assays include cells or cell lines that naturally express NRG1 or that have been engineered to express NRG1. Such cells include tumor cells that overexpress NRG1 relative to normal cells of the same tissue origin. Such cells also include cell lines (including tumor cell lines) that express NRG1 and cell lines that do not normally express NRG1 but have been transfected with nucleic acid encoding NRG1.
- an anti-NRGl antibody is tested for its ability to inhibit cell growth or proliferation in vivo. In certain embodiments, an anti-NRGl antibody is tested for its ability to inhibit tumor growth in vivo.
- In vivo model systems such as xenograft models, can be used for such testing.
- human tumor cells are introduced into a suitably
- the human tumor cells are tumor cells from a human patient. Such xenograft models are commercially available from Oncotest GmbH (Frieberg, Germany). In certain embodiments, the human tumor cells are cells from a human tumor cell line. In certain embodiments, the human tumor cells are introduced into a suitably
- immunocompromised non-human animal by subcutaneous injection or by transplantation into a suitable site, such as a mammary fat pad.
- the anti-NRGl antibody inhibits cellular proliferation by at least 30%, 40%, 50%, 60% 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% as compared to an untreated control. In other embodiments, the anti-NRGl antibody inhibits tumor growth by at least 30%>, 40%>, 50%, 60% 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% as compared to an untreated control.
- the invention also provides immunoconjugates comprising an anti-NRGl antibody herein conjugated to one or more cytotoxic agents, such as chemotherapeutic agents or drugs, growth inhibitory agents, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or radioactive isotopes.
- cytotoxic agents such as chemotherapeutic agents or drugs, growth inhibitory agents, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or radioactive isotopes.
- an immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody is conjugated to one or more drugs, including but not limited to a maytansinoid (see U.S. Patent Nos. 5,208,020, 5,416,064 and European Patent EP 0 425 235 Bl); an auristatin such as monomethylauristatin drug moieties DE and DF (MMAE and MMAF) (see U.S. Patent Nos. 5,635,483 and 5,780,588, and 7,498,298); a dolastatin; a calicheamicin or derivative thereof (see U.S. Patent Nos.
- ADC antibody-drug conjugate
- drugs including but not limited to a maytansinoid (see U.S. Patent Nos. 5,208,020, 5,416,064 and European Patent EP 0 425 235 Bl); an auristatin such as monomethylauristatin drug moieties DE and DF (MMAE and MMAF) (
- an immunoconjugate comprises an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes.
- an enzymatically active toxin or fragment thereof including but not limited to diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (
- an immunoconjugate comprises an antibody as described herein conjugated to a radioactive atom to form a radioconjugate.
- a radioactive atom to form a radioconjugate.
- radioactive isotopes are available for the production of radioconjugates. Examples include At 211 , 1 131 , 1 125 , Y 90 , Re 186 , Re 188 ,
- radioconjugate When used for detection, it may comprise a radioactive atom for scintigraphic studies, for example tc99m or 1123, or a spin label for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, mri), such as iodine-123 again, iodine-131, indium-I l l, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
- NMR nuclear magnetic resonance
- Conjugates of an antibody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4- (N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HQ), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl)
- SPDP N-succinimidyl-3-(2-pyridyldithio) propionate
- SMCC succinimidyl-4- (N-maleimidomethyl) cyclohexane-l-carboxylate
- IT iminothiolane
- a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987).
- Carbon- 14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of
- the linker may be a "cleavable linker" facilitating release of a cytotoxic drug in the cell.
- a cytotoxic drug for example, an acid-labile linker, peptidase-sensitive linker, photolabile linker, dimethyl linker or disulfide -containing linker (Chari et al., Cancer Res. 52: 127-131 (1992); U.S. Patent No. 5,208,020) may be used.
- the immunuoconjugates or ADCs herein expressly contemplate, but are not limited to such conjugates prepared with cross-linker reagents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo- GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, and SVSB
- cross-linker reagents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo- GMBS, sulfo
- anti-NRGl antibodies provided herein are useful for detecting the presence of NRG1 in a biological sample.
- the term "detecting” as used herein encompasses quantitative or qualitative detection.
- a biological sample comprises a cell or tissue, such as lung tissue or breast tissue.
- an anti-NRGl antibody for use in a method of diagnosis or detection is provided.
- a method of detecting the presence of NRG1 in a biological sample comprises contacting the biological sample with an anti -NRG1 antibody as described herein under conditions permissive for binding of the anti -NRG1 antibody to NRG1, and detecting whether a complex is formed between the anti-NRGl antibody and NRG1.
- Such method may be an in vitro or in vivo method.
- an anti-NRGl antibody is used to select subjects eligible for therapy with an anti NRG1 antibody, e.g. where NRG1 is a biomarker for selection of patients.
- a patient is selected for treatment with an anti-NRGl antibody if the patient has a cancer which is or is likely to become resistant to therapy.
- One aspect of the invention provides for an assay which determines if a patient has a cancer which is or is likely to become resistant to therapy.
- the assay comprises assaying tumor cells taken from the patient for NRG1 expression, wherein expression of NRG1 is indicative that the patient has a cancer which is or is likely to become resistant to therapy.
- the patient is selected as one who has a cancer which or is likely to become resistant to therapy if the level of NRG1 expression in the tumor is less than the level of NRG1 expression in the TRICs of the tumor.
- a patient is selected for treatment with an anti-NRGl antibody if the patient has a cancer which is likely to relapse after treatment with a therapeutic agent.
- One aspect of the invention provides for an assay which determines if a patient has a cancer which is likely to relapse after treatment with a therapeutic agent.
- the assay comprises assaying tumor cells taken from the patient for NRGl expression, wherein expression of NRGl is indicative that the patient has a cancer which is likely to relapse after treatment with a therapeutic agent.
- the patient is selected as one who has a cancer which is likely to relapse after treatment with a therapeutic agent if the level of NRGl expression in the tumor is less than the level of NRGl expression in the TRICs of the tumor.
- a diagnostic assay comprises determining the expression of neuregulin in a tumor cell, using, for example, immunohistochemistry, in situ hybridization, or RT-PCR. In other embodiments, a diagnostic assay comprises determining expression levels of neuregulin in a tumor cell using, for example, quantitative RT-PCR. In some embodiments, a diagnostic assay further comprises determining expression levels of neuregulin compared to a control tissue such as, for example, non- cancerous adj acent tissue.
- labeled anti-NRGl antibodies include, but are not limited to, labels or moieties that are detected directly (such as fluorescent, chromophoric, electron- dense, chemiluminescent, and radioactive labels), as well as moieties, such as enzymes or ligands, that are detected indirectly, e.g., through an enzymatic reaction or molecular interaction.
- labels or moieties that are detected directly such as fluorescent, chromophoric, electron- dense, chemiluminescent, and radioactive labels
- moieties such as enzymes or ligands
- radioisotopes P, C, I, H, and I include, but are not limited to, the radioisotopes P, C, I, H, and I, fluorophores such as rare earth chelates or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, luceriferases, e.g., firefly luciferase and bacterial luciferase (U.S. Patent No.
- luciferin 2,3- dihydrophthalazinediones
- horseradish peroxidase HRP
- alkaline phosphatase alkaline phosphatase
- ⁇ -galactosidase glucoamylase
- lysozyme saccharide oxidases
- glucose oxidase galactose oxidase
- glucose-6- phosphate dehydrogenase e.g., glucose-6- phosphate dehydrogenase
- heterocyclic oxidases such as uricase and xanthine oxidase, coupled with an enzyme that employs hydrogen peroxide to oxidize a dye precursor such as HRP, lactoperoxidase, or microperoxidase, biotin/avidin, spin labels, bacteriophage labels, stable free radicals, and the like.
- compositions of an anti-NRGl antibody as described herein are prepared by mixing such antibody having the desired degree of purity with one or more optional pharmaceutically acceptable carriers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
- Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride;
- hexamethonium chloride benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3- pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
- polyvinylpyrrolidone amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as polyethylene glycol (PEG).
- amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine
- monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins chelating agents such as EDTA
- sugars such as sucrose, mannitol, trehalose or sorbitol
- salt-forming counter-ions such as
- Exemplary pharmaceutically acceptable carriers herein further include insterstitial drug dispersion agents such as soluble neutral-active hyaluronidase glycoproteins (sHASEGP), for example, human soluble PH-20 hyaluronidase glycoproteins, such as rHuPH20 (HYLENEX®, Baxter International, Inc.).
- sHASEGP soluble neutral-active hyaluronidase glycoproteins
- rHuPH20 HYLENEX®, Baxter International, Inc.
- Certain exemplary sHASEGPs and methods of use, including rHuPH20 are described in US Patent Publication Nos. 2005/0260186 and
- a sHASEGP is combined with one or more additional
- glycosaminoglycanases such as chondroitinases.
- Exemplary lyophilized antibody formulations are described in US Patent No. 6,267,958.
- Aqueous antibody formulations include those described in US Patent No. 6,171,586 and
- the formulation herein may also contain more than one active ingredient as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
- active ingredient for example, it may be desirable to further provide paclitaxal, carboplatin ,and cisplatin or a combination or two or all three of paclitaxal, carboplatin, and cisplatin.
- Such active ingredients are suitably present in combination in amounts that are effective for the purpose intended.
- Active ingredients may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
- colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody or immunoconjugate, which matrices are in the form of shaped articles, e.g. films, or microcapsules.
- the formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes. G. Therapeutic Methods and Compositions
- anti-NRGl antibodies provided herein may be used in therapeutic methods.
- One aspect of the invention provides for a method of treating cancer.
- One aspect of the invention provides for a method of preventing resistance to treatment with a therapeutic agent in a patient by administering to the patient an anti-NRGl antibody.
- Another aspect of the invention provides for preventing recurrence of cancer after treatment with a therapeutic agent by administering to the patient an anti-NRGl antibody.
- Specific aspects include a method of preventing tumor recurrence or increasing time to tumor recurrence comprising administering to the patient an effective amount of an anti-NRGl antibody.
- the patient has been treated with a therapeutic agent, such as a chemotherapeutic agent or an antigen binding agent, such as an antibody.
- the cancer comprises tumor re-intiating cells.
- the cancer is non-small cell lung cancer.
- the cancer is breast cancer.
- the patient was treated with a chemotherapeutic agent.
- the chemotherapeutic agent is an agent used as a standard of care treatment for cancer.
- the chemotherapeutic agent is gemcitabine, paclitaxal or cisplatin or a combination of paclitaxal and cisplatin.
- the chemotherapeutic agent is gemcitabine, paclitaxal or cisplatin or a combination of paclitaxal and cisplatin.
- the chemotherapeutic agent is gemcitabine, paclitaxal or c
- chemotherapeutic agent is not a tyrosine kinase inhibitor.
- the chemotherapeutic agent is not a tyrosine kinase inhibitor.
- chemotherapeutic agent is a tyrosine kinase inhibitor.
- the chemotherapeutic agent is an inhibitor EGFR, HER2, HER3 and/or HER4.
- Another embodiment comprises additionally administering a chemotherapeutic agent to the patient in combination with an anti-NRGl antibody.
- the patient was treated with an antibody.
- the antibody is an anti-tyrosine kinase antibody.
- the antibody is an EGFR, HER2, HER3 and/or HER4 antibody.
- Another embodiment comprises additionally administering an antibody to the patient in combination with an anti-NRGl antibody.
- the time to tumor recurrence is at least 1.25, 1.50, 1.75, 2.0, 2.5, 5.0,
- Another aspect provides for a method of treating a patient with a resistant cancer comprising administering to a patient an effective amount of an anti-NRGl antibody.
- the cancer comprises tumor re-intiating cells.
- the cancer is non-small cell lung cancer.
- the cancer is breast cancer.
- the cancer is resistant to treatment with chemotherapeutic agents.
- the cancer is resistant to treatment with
- the cancer is resistant to treatment with a tyrosine kinase inhibitor. In one embodiment, the cancer is resistant to treatment with an EGFR, HER2, HER3 and/or HER4 inhibitor.
- Another embodiment comprises additionally administering a chemotherapeutic agent to the patient.
- the chemotherapeutic agent is gemcitabine, paclitaxal, carboplatin, and cisplatin or a combination of two or all three of paclitaxal, carboplatin, and cisplatin.
- the chemotherapeutic agent is an EGFR, HER2, HER3 and/or HER4 inhibitor.
- the cancer is resistant to treatment with a therapeutic antibody. In one embodiment, the cancer is resistant to treatment with an EGFR, HER2, HER3, or HER4 antibody. Another embodiment comprises additionally administering an antibody to the patient. In one embodiment, the antibody is trastuzumab or pertuzumab.
- the cancer comprises tumor re-intiating cells.
- the cancer is non-small cell lung cancer.
- the cancer is breast cancer.
- the cancer is resistant to treatment with chemotherapeutic agents.
- the chemotherapeutic agent is not a tyrosine kinase inhibitor.
- the chemotherapeutic agent is not a tyrosine kinase inhibitor.
- chemotherapeutic agent is a tyrosine kinase inhibitor.
- the chemotherapeutic agent is an inhibitor EGFR, HER2, HER3 and/or HER4.
- Another embodiment comprises additionally administering a chemotherapeutic agent to the patient.
- the chemotherapeutic agent is gemcitabine, paclitaxal, carboplatin, and cisplatin or a combination of two or all three of paclitaxal, carboplatin, and cisplatin.
- the cancer is resistant to treatment with a therapeutic antbody. In one embodiment, the cancer is resistant to treatment with an EGFR, HER2, HER3, or HER4 antibody. Another embodiment comprises additionally administering an antibody to the patient. In one embodiment, the antibody is trastuzumab or pertuzumab.
- an anti-NRGl antibody for use in a method of treatment is provided.
- the invention provides an anti-NRGl antibody for use in a method of treating an individual having cancer comprising administering to the individual an effective amount of an anti- NRGl antibody. In one such embodiment, the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, e.g., as described below. In further embodiments, the invention provides an anti-NRGl antibody for use in treating a patient who has experienced a recurrence of cancer. In certain embodiments, the invention provides an anti-NRGl antibody for use in a method of preventing resistance to treatment with a therapeutic agent in an individual comprising administering to the individual an effective of the anti-NRGl antibody to prevent resistance to the therapeutic agent.
- the invention provides for the use of an anti-NRGl antibody in the manufacture or preparation of a medicament.
- the medicament is for treatment of cancer.
- the medicament is for use in a method of treating cancer comprising administering to an individual having cancer an effective amount of the medicament.
- the method further comprises administering to the individual an effective amount of at least one additional therapeutic agent, e.g., as described below.
- the medicament is for preventing resistance to treatment with a therapeutic agent in patient.
- the medicament is for preventing recurrence of cancer in a patient.
- the invention provides pharmaceutical formulations comprising any anti- NRGl antibody provided herein, e.g., for use in any of the above therapeutic methods.
- a pharmaceutical formulation comprises any of the anti-NRGl antibody provided herein and a pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprises an anti-NRGl antibody provided herein and at least one additional therapeutic agent, e.g., as described below.
- Antibodies of the invention can be used either alone or in combination with other agents in a therapy.
- an antibody of the invention may be co-administered with at least one additional therapeutic agent. Examples of additional therapeutic agents are described below.
- combination therapies noted above encompass combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate
- administration in which case, administration of the antibody of the invention can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent and/or adjuvant.
- Antibodies of the invention can also be used in combination with radiation therapy.
- An antibody of the invention can be administered by any suitable means, including parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration.
- Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Dosing can be by any suitable route, e.g. by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
- Various dosing schedules including but not limited to single or multiple administrations over various time -points, bolus administration, and pulse infusion are contemplated herein.
- Antibodies of the invention would be formulated, dosed, and administered in a fashion consistent with good medical practice. Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners.
- the antibody need not be, but is optionally formulated with one or more agents currently used to prevent or treat the disorder in question. The effective amount of such other agents depends on the amount of antibody present in the formulation, the type of disorder or treatment, and other factors discussed above. These are generally used in the same dosages and with administration routes as described herein, or about from 1 to 99% of the dosages described herein, or in any dosage and by any route that is empirically/clinically determined to be appropriate.
- an antibody of the invention when used alone or in combination with one or more other additional therapeutic agents, will depend on the type of disease to be treated, the type of antibody, the severity and course of the disease, whether the antibody is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody, and the discretion of the attending physician.
- the antibody is suitably administered to the patient at one time or over a series of treatments.
- about 1 ⁇ g/kg to 15 mg/kg (e.g. O. lmg/kg-lOmg/kg) of antibody can be an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
- One typical daily dosage might range from about 1 ⁇ g/kg to 100 mg/kg or more, depending on the factors mentioned above.
- the treatment would generally be sustained until a desired suppression of disease symptoms occurs.
- One exemplary dosage of the antibody would be in the range from about 0.05 mg/kg to about 10 mg/kg.
- one or more doses of about 0.5 mg/kg, 2.0 mg/kg, 4.0 mg/kg or 10 mg/kg (or any combination thereof) may be administered to the patient.
- Such doses may be administered intermittently, e.g. every week or every three weeks (e.g. such that the patient receives from about two to about twenty, or e.g. about six doses of the antibody).
- An initial higher loading dose, followed by one or more lower doses may be administered. The progress of this therapy is easily monitored by conventional techniques and assays.
- an additional therapeutic agent is an agent that inhibits a tyrosine kinase receptor pathway. In one embodiment, the additional therapeutic agent inhibits a HER pathway. In one embodiment the additional therapeutic agent is an inhibitor of EGFR, HER2, HER3, and/or HER4.
- EGFR inhibitor refers to compounds that bind to or otherwise interact directly with EGFR and prevent or reduce its signaling activity, and is alternatively referred to as an "EGFR antagonist.”
- EGFR antagonist examples include antibodies and small molecules that bind to EGFR.
- antibodies which bind to EGFR include MAb 579 (ATCC CRL HB 8506), MAb 455 (ATCC CRL HB8507), MAb 225 (ATCC CRL 8508), MAb 528 (ATCC CRL 8509) (see, US Patent No.
- EMD 55900 Stragliotto et al. Eur. J. Cancer 32A:636-640 (1996)
- EMD7200 (matuzumab) a humanized EGFR antibody directed against EGFR that competes with both EGF and TGF-alpha for EGFR binding (EMD/Merck); human EGFR antibody, HuMax- EGFR (GenMab); fully human antibodies known as El .l, E2.4, E2.5, E6.2, E6.4, E2.11, E6. 3 and E7.6.
- the anti-EGFR antibody may be conjugated with a cytotoxic agent, thus generating an immunoconjugate (see, e.g., EP659,439A2,
- EGFR antagonists include small molecules such as compounds described in US Patent Nos: 5,616,582, 5,457,105, 5,475,001, 5,654,307, 5,679,683, 6,084,095, 6,265,410, 6,455,534, 6,521,620, 6,596,726, 6,713,484, 5,770,599, 6,140,332, 5,866,572, 6,399,602, 6,344,459, 6,602,863, 6,391,874, 6,344,455, 5,760,041, 6,002,008, and 5,747,498, as well as the following PCT publications: W098/14451, WO98/50038, WO99/09016, and WO99/24037.
- EGFR antagonists include OSI-774 (CP-358774, erlotinib, TARCEVA ® Genentech/OSI Pharmaceuticals); PD 183805 (CI 1033, 2-propenamide, N-[4-[(3-chloro-4-fluorophenyl)amino]-7-[3-(4- morpholinyl)propoxy]-6-quinazolinyl]-, dihydrochloride, Pfizer Inc.); ZD1839, gefitinib (IRESSATM) 4-(3'-Chloro-4'-fluoroanilino)-7-methoxy-6-(3-morpholinopropoxy)quinazoline, AstraZeneca); ZM 105180 ((6-amino-4-(3-methylphenyl-amino)-quinazoline, Zeneca); BIBX-1382 (N8-(3-chloro-4- fluoro-phenyl)-N2-(l-methyl-
- HER2 inhibitor refers to compounds that bind to or otherwise interact directly with HER2 and prevent or reduce its signaling activity, and is alternatively referred to as an "HER2 antagonist.”
- examples of such agents include antibodies and small molecules that bind to HER2.
- Particular HER2 antibodies include pertuzumab and trastuzumab.
- HER3 inhibitor refers to compounds that bind to or otherwise interact directly with HER3 and prevent or reduce its signaling activity, and is alternatively referred to as an "HER3 antagonist.” Examples of such agents include antibodies and small molecules that bind to HER3.
- HER4 inhibitor refers to compounds that bind to or otherwise interact directly with HER4 and prevent or reduce its signaling activity, and is alternatively referred to as an "HER4 antagonist.”
- HER4 antagonist examples include antibodies and small molecules that bind to HER4.
- Patent publications related to HER antibodies include: U.S. Pat. No. 5,677,171, U.S. Pat. No. 5,720,937, U.S. Pat. No. 5,720,954, U.S. Pat. No. 5,725,856, U.S. Pat. No. 5,770,195, U.S. Pat. No. 5,772,997, U.S. Pat. No. 6,165,464, U.S. Pat. No. 6,387,371, U.S. Pat. No. 6,399,063,
- an additional therapeutic agent is a chemotherapeutic agent.
- chemotherapeutic agent refers to a chemical compound useful in the treatment of cancer.
- examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide
- CYTOXAN® alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); delta-9- tetrahydrocannabinol (dronabinol, MARINOL®); beta-lapachone; lapachol; colchicines; betulinic acid; a camptothecin (including the synthetic analogue topotecan (HYCAMTIN®), CPT-11
- podophyllotoxin podophyllinic acid; teniposide; cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1- TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as
- calicheamicin especially calicheamicin gammall and calicheamicin omegall (see, e.g., Nicolaou et al., Angew. Chem Intl. Ed. Engl, 33: 183-186 (1994)); CDP323, an oral alpha-4 integrin inhibitor; dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including
- mitobronitol mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C”); thiotepa; taxoid, e.g., paclitaxel (TAXOL®), albumin-engineered nanoparticle formulation of paclitaxel (ABRAXANETM), and docetaxel (TAXOTERE®); chloranbucil; 6-thioguanine; mercaptopurine; methotrexate; platinum agents such as cisplatin, oxaliplatin (e.g., ELOXATIN®), and carboplatin; vincas, which prevent tubulin polymerization from forming microtubules, including vinblastine (VELBAN®), vincristine (ONCOVIN®), vindesine (ELDISINE®, FILDESIN®), and vinorelbine (NAVELBINE®); etoposide (VP- 16); ifosfamide; mitoxantrone;
- troxacitabine a 1,3-dioxolane nucleoside cytosine analog
- antisense oligonucleotides particularly those that inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Raf, H-Ras, and epidermal growth factor receptor (EGF-R); vaccines such as THERATOPE® vaccine and gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rn RH (e.g., ABARELIX®); BAY439006 (sorafenib; Bayer); SU-11248 (sunitinib, S
- celecoxib or etoricoxib proteosome inhibitor
- proteosome inhibitor e.g. PS341
- bortezomib VELCADE®
- CCI-779 tipifarnib (Rl 1577); orafenib, ABT510
- Bcl-2 inhibitor such as oblimersen sodium (GENASENSE®)
- pixantrone EGFR inhibitors (see definition below); tyrosine kinase inhibitors (see definition below); serine-threonine kinase inhibitors such as rapamycin (sirolimus, RAPAMUNE®); farnesyltransferase inhibitors such as lonafarnib (SCH 6636, SARASARTM); and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above such as CHOP, an abbreviation for a combined therapy of cyclophosphamide, doxorubicin, vincris
- Chemotherapeutic agents as defined herein include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer. They may be hormones themselves, including, but not limited to: anti-estrogens with mixed agonist/antagonist profile, including, tamoxifen (NOLVADEX®), 4-hydroxytamoxifen, toremifene (FARESTON®), idoxifene, droloxifene, raloxifene (EVISTA®), trioxifene, keoxifene, and selective estrogen receptor modulators (SERMs) such as SERM3; pure anti-estrogens without agonist properties, such as fulvestrant (FASLODEX®), and EM800 (such agents may block estrogen receptor (ER) dimerization, inhibit DNA binding, increase ER turnover, and/or suppress ER levels); aromatase inhibitors, including steroidal aromatase inhibitors such as forme
- aromatase inhibitors such as anastrazole (ARIMIDEX®), letrozole (FEMARA®) and aminoglutethimide
- other aromatase inhibitors include vorozole (RIVISOR®), megestrol acetate (MEGASE®), fadrozole, and 4(5)-imidazoles; lutenizing hormone -releaseing hormone agonists, including leuprolide (LUPRON® and ELIGARD®), goserelin, buserelin, and tripterelin; sex steroids, including progestines such as megestrol acetate and medroxyprogesterone acetate, estrogens such as diethylstilbestrol and premarin, and androgens/retinoids such as
- fluoxymesterone all transretionic acid and fenretinide; onapristone; anti-progesterones; estrogen receptor down-regulators (ERDs); anti-androgens such as flutamide, nilutamide and bicalutamide; and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above.
- Such combination therapy also includes: (i) lipid kinase inhibitors; (ii) antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in abherant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; (iii) ribozymes such as a VEGF expression inhibitor (e.g., ANGIOZYME® ribozyme) and a HER2 expression inhibitor; (iv) vaccines such as gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; PROLEUKIN® rIL-2; LURTOTECAN® topoisomerase 1 inhibitor; ABARELIX® rrriRH; (v) anti-angiogenic agents such as bevacizumab (A VASTEST®, Genentech); and pharmaceutically acceptable salts, acids or derivatives of any of the above.
- combination therapies noted above encompass combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate
- administration in which case, administration of the anti-NRGl antibody of the invention can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent and/or adjuvant.
- administration of the anti-NRGl antibody of the invention can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent and/or adjuvant.
- an article of manufacture containing materials useful for the treatment, prevention and/or diagnosis of the disorders described above comprises a container and a label or package insert on or associated with the container.
- Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container holds a composition which is by itself or combined with another composition effective for treating, preventing and/or diagnosing the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- At least one active agent in the composition is an antibody of the invention.
- the label or package insert indicates that the composition is used for treating the condition of choice.
- the article of manufacture may comprise (a) a first container with a composition contained therein, wherein the composition comprises an antibody of the invention; and (b) a second container with a composition contained therein, wherein the composition comprises a further cytotoxic or otherwise therapeutic agent.
- the article of manufacture in this embodiment of the invention may further comprise a package insert indicating that the compositions can be used to treat a particular condition.
- the article of manufacture may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate- buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
- BWFI bacteriostatic water for injection
- phosphate- buffered saline such as bac
- NSCLC cell lines Calu3, H441, H1299, H1993, A549 and H596, and KPL4 breast cancer cell line were obtained from American Type Culture Collection (ATCC), Manassas, VA. These cell lines were maintained in RPMI containing 10% FBS, Pen/Strep and L-Glutamine. Calu3 was cultured in ATCC media instead of RPMI. Calu3, H441 and KPL4 cell lines were transduced with TZV-b-actin- eGFP lentivirus. After multiple passages, high GFP expressing cells were sorted and amplified to get -95% GFP positive cells, and these sub-lines were described as Calu3-GFP and H441-GFP and KPL4- GFP.
- Mouse NSCLC cell lines LKPH1 and LKPH2 were derived from two independent tumors from a Kras LSL G12D/+ ; p53 FL/+ ; Z/EG lung tumor-bearing mouse. Cell lines were initially established in DMEM/F12 media containing 5% FBS, Bovine Pituitary Extract, N2 supplement, EGF, FGF, Pen/Strep and L-Glutamine. LKPH1 and LKPH2 were cultured in DMEM high-glucose media containing 10% FBS, Pen/Strep and L-Glutamine.
- shNRGl 5'- GATCCCCCATGGTGAACATAGCGAATTTCAAGAGAA
- shNRG1.2 5'GATCCCCGAGTATATGTGCAAAGTGAT TCAAGAGATCAC TTTG
- shErbB4 5 ' - GATCCCCGATCACAACTGCTGCTTAATTCAAGAGATTAAGCAGCAGTTGT GATCTTTTTTGGAAA-3" (sense) (SEQ ID NO: 81) and
- shErbB3 5'- GATCCCCAAGAGGATGTCAACGGTTATTCAAGAGATAACCGTTGACATCCTCTTTTTTTTG GAAA-3' (sense) (SEQ ID NO: 83) and
- Mouse shNRGl 5"- GATCCCCCATGGTGAACATAGCGAATTTCA AGAGAA
- the complementary double-stranded shRNA oligonucleotides were inserted into a Tet- inducible viral gene transfer vector as described (Hoeflich et al. Cancer Res. 2006).
- the vector system is composed of a shuttle vector and a dsRed expressing viral vector backbone that contains a codon- optimized Tet repressor-internal ribosomal entry site-dsRed cassette to enable Tet-regulated shRNA expression.
- the luciferase shRNA construct was previously described (Hoeflich et al.).
- Inducible-shRNA bearing lentivirus constructs were made based on previously described methods by co-transfecting pHUSH-Lenti-dsRed constructs containing a desired sliRNA with plasmids expressing the vesicular stomatitis vims (VSV-G) envelope glycoprotein and HIV-l packaging proteins (GAG-POL) in HEK293T cells using Lipofectatnme (Invitrogen, Carlsbad, CA). Target cells were transduced with these viruses. After >3 passages, FACS sorting was used to select the top -20% dsRed expressing tumor ceils which were collected, pooled and expanded.
- VSV-G vesicular stomatitis vims
- GAG-POL HIV-l packaging proteins
- H441 cells were serum starved for 18 hours prior to addition of luM recombinant human NRG1 beta-1 extracellular domain (R&D systems) or luM anti-ragweed IgG2A as the control. Ten minutes after addition of NRG1 or ragweed, cells were processed for Western blotting.
- RNA Isolation, cDNA preparation and qPCR RNA was isolated using the Qiagen RNeasy Micro Kit. Complementary DNA was prepared from total RNA using ABI high fidelity kit according to manufacturer's instructions. NRG1 alpha, NRGlbeta, HER3, HER4 expression was determined using ABI gene specific primers/probe by quantitative real time PCR (ABI 7500). Gene expression was normalized using GAPDH or RAB14 house keeping genes.
- Tumor cells (10-20 million) were transplanted into right flank of athymic nude mice. When tumor size reached -200 mm 3 , the mice were divided into different treatment groups. Mice were then treated with either vehicle or chemotherapy (paclitaxel, i.v. + cisplatin, i.p.) for the initial studies.
- the chemotherapy dosing regimen was paclitaxel 20 mg/kg i.v. every other day for 5 doses and cisplatin 5 mg/kg i.p. on days 1 and 7 for the Calu3 model and days 1 and 14 for the H441 model. Regressed tumors and time matched vehicle controls were collected at least 1 week after the last dose of chemo.
- Tumors were dissociated using dispase/collagenase and samples were FACS sorted to collect the GFP positive tumor cells.
- the treatment groups were: sucrose, doxycycline (dox), chemotherapy + sucrose, and chemotherapy+ doxycycline.
- sucrose or doxycycline was started at the same time as the first dose of chemotherapy and continued for the duration of the study.
- 5% sucrose water was provided ad libitum for the vehicle groups and 1 mg/ml doxycyline in 5% sucrose was provided for the doxycycline groups.
- Xenograft Tumor Growth Analysis To appropriately analyze the repeated measurement of tumor volumes from the same animals over time, a mixed-modeling approach was used (Pinheiro et al. 2009). This approach can address both repeated measurements and modest drop-out rate due to
- Cubic regression splines were used to fit a nonlinear profile to the time courses of log2 tumor volume for each treatment group.
- mice were dosed once a week for three weeks with cisplatin (7mg/kg) or phosphate-buffered saline, and bi-weekly with HER4ECD-Fc (25mg/kg) or anti-ragweed IgG2A (25mg/kg) for the duration of the study.
- Serial CT scans were performed at days 14, 45, and 66.
- micro-CT X-ray micro-computed tomography
- the animals were anesthetized with 2% isoflurane in medical air and maintained at constant 37°C temperature by regulated warm airflow.
- the imaging time for each session was approximately 15 minutes (vivaCT 75) or 25 minutes (vivaCT 40) per animal and the estimated radiation dose was approximately 0.2 Gy (vivaCT 75) or 0.1 Gy (vivaCT 40).
- the imaging data were evaluated in the coronal plane using the image analysis software package Analyze (AnalyzeDirect, Inc., Lenexa, KS, USA). Once the largest cross-sectional plane of each tumor was identified, estimates of maximal tumor diameter (di) and the largest perpendicular diameter (d 2 ) were determined.
- siRNA Small interfering RNA oligo (siRNA) pools for HER3 (M-003127-03), HER1 (M-003114-01), HER2, HER4 and non targeting control (D-001206- 14-20) were purchased from Dharmacon Lafayette, CO. siRNAs were introduced into H522 cells by reverse transfection.
- RNAi oligos RNAi oligos
- DharmaFECT# T-2001-02, Dharmacon transfection reagent diluted in OPTI-MEM (Invitrogen) as per manufacturer's recommendation.
- 96h post transfection the effect on cell proliferation was measured by AlamarBlue staining.
- Blotting was carried out using the iBlot dry blotting system (Invitrogen) according to manufacturer's specifications. Nitrocellulose membrane blocking and antibody staining was performed using the Odyssey Western blot anaylsis and infrared imaging system (Li-Cor Biosciences) according to manufacturer's instructions. Blots were visualized on the Odyssey scanner (Li-Cor Biosciences).
- Antibodies The following primary antibodies were used in Western blotting experiments: anti-actin (612656, BD Biosciences), anti-GAPDH (sc-25778, Santa Cruz Biotechnology), anti-EGF receptor (2232, Cell Signaling Technology), anti-Neu (sc-284, Santa Cruz Biotechnology), anti-ErbB3 (sc-285, Santa Cruz Biotechnology), anti-phospho-HER3 (4791, Cell Signaling Technology), anti-ErbB4 (sc- 283, Santa Cruz Biotechnology), anti-phospho-HER4 (4757, Cell Signaling Technology), anti-Akt (4691, Cell Signaling Technology), anti-phospho-Akt (4058, Cell Signaling Technology),
- Stat/phospho-Stat antibody sampler kit 9939/9914, Cell Signaling Technology
- anti-MEK 1/ 2 9126, Cell Signaling Technology
- anti-phospho-MEK 1/ 2 2338, Cell Signaling Technology.
- the following secondary antibodies from Li-Cor Biosciences were used: IRDye 680 conjugated goat anti- mouse IgG, IRDye 800 CW conjugated goat anti-rabbit IgG.
- Binding affinities of anti-NRGl IgGs were measured by Surface Plasmon Resonance (SRP) using a BIAcoreTM-T100 instrument.
- Anti-NRGl human IgGs were captured by mouse anti-human Fc antibody (GE Healthcare, cat# BR-1008-39) coated on CM5 biosensor chips to achieve approximately 1000 response units (RU).
- RU response units
- two-fold serial dilutions (500nM to 0.245nM) of human NRGl-a and NRGl- ⁇ were injected in HBS-T buffer (GE Healthcare, cat#BR-1003-68) at 25°C with a flow rate of 30 ⁇ 1/ ⁇ .
- MCF 7 cells were added to a 96 well culture plate plate (No. 1270, BD Falcon; Franklin Lakes, NJ) at 5, 000 cells/well seeding density in RPMI media with 10% fetal bovine serum (FBS) (Sigma Aldrich Corporation; St. Louis, MO). The plate was cultured at 37°C in 5%> C02 for 3 days. On day 3 MCF 7 cells were switched to serum free media and cells were continuously incubated at 37°C for > 6 hrs prior to the addition of Neuregulin and test materials.
- FBS fetal bovine serum
- test materials (538.24.71 and 526.90.28 antibodies) were serially diluted with non- serum containing RPMI media with 0.5 % BSA , penicillin (100 ⁇ /mL, Gibco Invitrogen; Carlsbad, CA), streptomycin (100 ⁇ g/mL, Gibco Invitrogen), and L glutamine (10 mM, Genentech) to generate a total of ten concentrations.
- Recombinant human Neuregulin 1 -alpha (rhNRGla, R& D system Cat# 296- HR/CF, Minneapolis, MN) was prepared with non-serum containing media (as described above). Each diluted test material was mixed with an equal volume of rhNRGla (0.5 nM final concentration).
- each diluted test material was mixed with an equal volume of rhNRGlb (0.2 nM final concentration).
- the plate containing MCF 7 cells was removed from the incubator. A mixture containing the test material and rhNRGla or rhNRGlb was then added to each well. The cells were incubated for 15 minutes at 37°C with 5% C02. The sample-containing media was decanted, and the plate was lightly tapped on a paper towel. To lyse the cells and solubilize the receptors, diluted cell lysis buffer (Cell Signaling Technologies, cat #9803) with Protease Inhibitor Cocktail Set I, No. 539131, Calbiochem) was added to each well. The plate was incubated at room temperature with agitation for 15 to 60 minutes to complete the lysis. The lysate was either stored in -80°C freezer or used immediately for quantification of phosphorylation using an ELISA.
- Cell Signaling Technologies, cat #9803 Cell Signaling Technologies, cat #9803
- Protease Inhibitor Cocktail Set I No. 539131, Calbiochem
- a maxisorp immunoplate (4-64718, Nunc; Neptune, NJ) was coated overnight with anti erb3 MAb (R+D Systems Duo Set IC Phospho-ErbB3 kit part# 841428, Minneapolis, MN) in PBS. On the following day, the capture MAb was removed and the plate was washed with wash buffer (PBS with 0.05% Tween 20, pH 7.4) and blocked for 1 2 hours with block buffer (0.5% BSA in PBS).
- wash buffer PBS with 0.05% Tween 20, pH 7.4
- the plate was washed with wash buffer, and the cell lysates and controls (R+D Systems Duo Set IC Phospho- ErbB3 kit part# 841430, Minneapolis, MN) were added to the blocked plate and the plate was incubated with agitation at room temperature for 2 hours to allow sufficient binding. After incubation, the plate was washed six times with wash buffer, and anti phospho tyrosine MAb conjugated with horseradish peroxidase (HRP) (R+D Systems Duo Set IC Phospho-ErbB3 kit part# 841403,
- the effects of NRG1 knockdown on primary tumor growth and relapse after chemotherapy was determined by evaluating effects of NRG1 knockdown alone or in combination with chemotherapy.
- Three human NSCLC models that exhibit varying expression patterns of the HER family receptors were used in this study.
- the Calu3 model has high protein levels of all the receptors, H441 shows strong expression of HER2 and HER3 and moderate HER1, and H1299 shows moderate levels HER1, 2 and 3.
- Calu3-shNRGl tumor bearing mice were assigned to four groups; 1) vehicle + sucrose, 2) vehicle + dox, 3) chemotherapy + sucrose, and 4) chemotherapy + dox.
- Chemotherapy consisted of paclitaxel (20mg/kg, i.v. every other day for 5 doses) and cisplatin (5mg/kg, i.p. every 7 days for 2 doses) and 5% sucrose or dox (2g/L) was administered orally in the drinking water ad libitum. Tumor volume was measured twice a week for the duration of the study.
- LME Linear Mixed Effect
- IHC immunohistochemistry
- NRGl a and NRGi p isoforms in tumor cells collected at early and late time points was determined.
- the tumor cells were analyzed for expression of the lentivirally transduced genes. Because the lentivirus used to transduce the cells with the shRNA also includes a dsRed marker gene, the proportion of dsRED positive tumor cells at early and late time points were compared by flow cytometry. In vivo loss of lentiviral gene expression was assessed for tumors at early (5 days) and late time points (>100 days) by FACS analysis examining the proportion of tumor cells (human specific -ESA positive) that express the lentiviral dsRed transgene. Mice in the early time point received sucrose or dox and mice in the late timepoint received chemo+sucrose or chemo+dox.
- Lung tumor bearing LSL-K-ras G12D ;p53 FI + mice were imaged by X-ray micro-computed tomography (micro-CT) at the start of the study (day 0), segregated into three groups of equal starting tumor burdens and treated as follows: 1) PBS + control IgG2A; 2) cisplatin + control IgG2A; and 3) cisplatin + HER4-ECD. Mice underwent longitudinal micro-CT scans to measure changes in tumor burden. Analysis of average tumor burden (Fig. 3 A (graph represents average tumor volume +/- SEM, ragweed, control murine IgG2a antibody)) and tumor growth rate ((Fig.
- LSL-K-rasG12D genetically engineered mouse model (GEMM) of NSCLC (Jackson et al., 2001) crossed to the Z/EG Cre -reporter strain (Novak et al., 2000) was used to characterize TRIC populations.
- Cisplatin treatment of LSL-K-rasGl 2D mice results in a reduction in tumor burden but does not result in prolonged survival, indicating that tumors resume growing after therapy (Oliver et al., 2010).
- two human xenograph models in which tumors regress in response to cisplatin + paclitaxel doublet chemotherapy , but resume growth several weeks after the cessation of treatment were used.
- GFP-expressing sublines of the Calu3 and H441 human NSCLC xenograft models were generated to allow for isolation of tumor cells by fluorescent activated cell sorting (FACS).
- FACS fluorescent activated cell sorting
- the TRICs in the LSL-K-rasG12D mouse model were analyzed. Lungs were collected 1 week after the final dose of cisplatin and GFP positive tumor cells were isolated by FACS. In order to characterize differences in the gene expression profiles of vehicle treated and residual tumor cells,
- the Calu3 tumor model showed a 52.5 fold enrichment for NRG1
- NRG1 protein levels and the activation of the NRG1 receptor, HER3, were also assessed via Western Blot. It was determined that NRG1 protein levels and phospho-Her3 levels were consistently higher in the residual tumor cells than in vehicle treated tumor cells. The activation of HER3 was examined by immunostaining tumors for phospho-HER3. The majority of tumor cells in the residual tumors were p-HER3 positive whereas the vehicle treated tumors showed only scattered clusters of p- HER3 positive cells. Thus, residual tumor cells express NRG1 and show enhanced receptor activation, demonstrating increased NRG1 autocrine signaling.
- HER3 and HER4 knockdown on tumor cell proliferation were evaluated.
- the Calu3 NSCLC model expressed high levels of all the HER family receptors compared to other cell lines.
- Stable dox-inducible shHER3 (Calu3-shHER3) and shHER4 (Calu3-shHER4) Calu3 cell sub-lines were generated, as well as a control cell line carrying a dox-inducible shRNA to Luciferase.
- HER3 and HER4 transcript levels were decreased in Calu3-shHER3 and Calu3-shHER4 respectively in the presence of dox (2 ug/ml) as measured by qPCR, resulting in decreased protein levels, as measured by Western blot.
- dox 2 ug/ml
- the extent of p-AKT down-regulation observed in Calu3-shHER3 in the presence of dox was much greater that seen in Calu3-shHER4, suggesting that HER3 is the predominant receptor mediating NRG1 autocrine signaling in the Calu3 model.
- NRG1 autocrine signaling was assessed in the H522 human NSCLC cell line, which expresses high levels of HER4 but no detectable HER3.
- a H522-shNRGl subline was generated.
- Administration of dox to serum starved H522-shNRGl cells results in decreased levels of phospho-HER4 and phospho-S6.
- No differences were observed in H522-shLuc control cells
- siRNA-mediated knockdown was used to test the requirement for each HER family member in cell proliferation. Only knockdown of HER4 and not the other HER family receptors resulted in decreased cell proliferation.
- NRG1 -a EGF domain (R&D Systems, cat# 296-HR/CF) (SEQ ID NO: 3) and NRGl- ⁇ ECD domain (R&D Systems, cat# 377-HB/CF) (SEQ ID NO: 4) were used as antigens for library sorting.
- Fig. 5 Nunc 96 well Maxisorp immunoplates were coated overnight at 4°C with target antigen (lC ⁇ g/ml) and were blocked for 1 hour at room temperature with phage blocking buffer PBST (phosphate-buffered saline (PBS) and 1% (w/v) bovine serum albumin (BSA) and 0.05% (v/v) tween-20).
- PBST phosphate-buffered saline
- BSA bovine serum albumin
- Antibody phage libraries (Lee et al., J. Mol. Biol 340, 1073-1093, 2004, Liang et al., JMB. 366: 815-829, 2007) were added to antigen plates separately and incubated overnight at room temperature. The following day antigen-coated plates were washed ten times with PBT (PBS with 0.05%) Tween-20), and bound phage were eluted with 50mM HCl and 500mM NaCl for 30 minutes and neutralized with an equal volume of 1 M Tris base (pH7.5). Recovered phages were amplified in E. coli XL-1 Blue cells. During the subsequent selection rounds, incubation of antibody phage with the antigen-coated plates was reduced to 2-3 hours, and the stringency of plate washing was gradually increased.
- the affinities of phage antibodies were ranked using spot competition ELISA.
- the phage supernatant was diluted 1 :5 in ELISA (enzyme linked immunosorbent assay) buffer (PBS with 0.5%> BSA, 0.05%) Tween20) with or without 75nM NRGl-alpha in ⁇ total volume and incubated at least 1 hour at room temperature in an F plate (NUNC).
- 95 ⁇ 1 of mixture with or without target protein was transferred side -by-side to the target protein coated plates (lug/ml NRGl-alpha coated overnight).
- the plate was gently shaken for 15 min to allow the capture of unbound phage to the target protein-coated plate.
- the plate was washed ten times with PBS-0.05%> Tween 20.
- the binding was quantified by adding horseradish peroxidase (HRP)-conjugated anti-M13 antibody in ELISA buffer (1 :5000) and incubated for 30 minutes at room temperature. The plates were washed ten times with PBS-0.05%> Tween 20. Next, ⁇ /well of a 1 : 1 ratio of 3,3',5,5'-tetramethylbenzidine (TMB) Peroxidase substrate and Peroxidase Solution B (H 2 0 2 ) (Kirkegaard-Perry Laboratories (Gaithersburg, MD)) was added to the well and incubated for 5 minutes at room temperature.
- HRP horseradish peroxidase
- ELISA buffer 1 :5000
- TMB 3,3',5,5'-tetramethylbenzidine
- H 2 0 2 Peroxidase Solution B
- the reaction was stopped by adding ⁇ 0.1M phosphoric Acid (H 3 P0 4 ) to each well and allowed to incubate for 5 minutes at room temperature.
- the OD (optical density) of the yellow color in each well was determined using a standard ELISA plate reader at 450 nm. The OD reduction (%) was calculated by the following equation.
- OD 450mn reduction (%) [(OD 450mn of wells with competitor) / (OD 450mn of well with no competitor)]* 100
- Clones that had the OD 450mn reduction (%) lower than 30% for NRGl -a target were picked and reformatted into full length human IgGl by cloning V L and V H regions of individual clones into the LPG3 and LPG4 vector respectively. These clones were subsequently transiently expressed in mammalian CHO cells, and purified with a protein A column.
- the amino acid sequences of the heavy and light chains of the antibodies were determined.
- Selected anti-NRGl antibodies were affinity matured. Amino acid sequences of the parent and affinity matured variants are shown in Fig. 25, Fig. 26, Fig. 27, and Fig. 28.
- Phagemid pW0703 (derived from phagemid pV0350-2b (Lee et al., J. Mol. Biol 340, 1073-
- the mutagenic DNA was synthesized with 70-10-10-10 mixtures of bases favoring the wild type nucleotides (Gallop et al., Journal of ' Medicinal Chemistry 37 : 1233-1251 (1994)).
- residues at positions 91-96 of CDR-L3, 30-33, 35 of CDR-H1, 50, 52, 53-54, and 56 of CDR-H2, 95-98 of CDR-H3 were targeted; and two different combinations of CDR loops, H1/H3/L3, H2/L3, and H3/L3, were selected for randomization.
- phagemids containing 4 stop codons (TAA) in each CDR and displaying monovalent Fab on the surface of Ml 3 bacteriophage were generated individually, and served as the templates for kunkel mutagensis for the construction of affinity maturation libraries. Only soft randomization strategy was used for clones derived from V H V L library, as diversity of CDR- L3 was built into the naive library.
- H2*/L3, H3*, H3*/L2, Ll */L2, Ll */L3, H3/L3*, L2/L3* and H1/L3* were selected for randomization.
- Phage Sorting Strategy to Generate Affinity Improvement For affinity improvement selection, NRG1 -beta or NRG1 -alpha were first biotinylated under limiting reagent condition and reverse phase chromatography to obtained mono-biotinylated-species. Phage libraries were subjected to six rounds of solution sorting with increasing stringency. For the first round of solution sorting, 3 O.D./ml in 1% BSA and 0.05% Tween 20 of phage input were incubated to plates pre -coated with either NRG1 -alpha or NRGl-beta for 3 hours. The wells were washed with PBS-0.05% Tween 20 ten times.
- Bound phage was eluted with 150ul/well 50mM HCl, 500mM KCl for 30 minutes, and subsequently neutralized by 50ul/well of 1M Tris pH8, titered, and propagated for the next round.
- panning of the phage libraries was done in solution phase, where phage library was incubated with 100 nM biotinylated target protein (the concentration is based on parental clone phage IC50 value) in ⁇ buffer containing 1% Superblock (Pierce Biotechnology) and 0.05% Tween20 for 2 hours at room temperature.
- the mixture was further diluted 10X with 1% Superblock, and ⁇ /well was applied to neutravidin-coated wells (10 ⁇ g/ml) for 30 minutes at room temperature with gentle shaking. To determine background binding, control wells containing phage were captured on neutravidin-coated plates. Bound phage was then washed, eluted and propagated as described for first round. Five more rounds of solution sorting were carried out together with increasing selection stringency. The first couple rounds of which is for on-rate selection by decreasing biotinylated target protein concentration from lOOnM to O.
- Colonies were picked from the sixth round of screening. Colonies were grown overnight at 37°C in 150 ⁇ 1 ⁇ 11 of 2YT media with 50 ⁇ g/ml carbenicillin and lx 10 10 /ml M13K07 in 96-well plate (Falcon). From the same plate, a colony of XL-1 infected parental phage was picked as control. 96- well Nunc Maxisorp plates were coated with ⁇ /well of either NRG1 -alpha or NRGl-beta
- 35ul of the phage supernatant was diluted with to 75ul of in ELISA (enzyme linked immunosorbent assay) buffer (PBS with 0.5% BSA, 0.05% Tween20) with or without 5nM NRG1- alpha or NRGl-beta and let incubate for 1 hour at room temperature in an F plate (NUNC). 95 ⁇ 1 of mixture was transferred side by side to the antigen coated plates. The plate was gently shaken for 15 min and was washed ten times with PBS-0.05%> Tween 20. The binding was quantified by adding horseradish peroxidase (HRP)-conjugated anti-M13 antibody in ELISA buffer (1 :2500) and incubated for 30 minutes at room temperature.
- HRP horseradish peroxidase
- the affinity matured variants were tested for their ability to block HRGP binding to HER3-Fc.
- 125I-HRG was generated at Genentech as described previously (Sliwkowski et al JBC 1994). Binding assays were performed in Nunc break-apart strip wells (Thermo-Fisher Scientific, Rochester, NY). Plates were coated at 4°C overnight with 250 ng/well of HER3-ECD-Fc fusion protein in carbonate buffer (pH 9.6). Plates were rinsed twice with wash buffer (PBS/0.05% Tween 20) and blocked with 100 ⁇ PBS including 1% bovine serum albumin (BSA) for 30 minutes.
- BSA bovine serum albumin
- Binding affinities of 538.24 affinity matured variant anti-NRGl IgGs for NRGla and NRGi p were measured by Surface Plasmon Resonance (SRP) using a BIAcoreTM-T100 instrument as described in Example 1.
- SRP Surface Plasmon Resonance
- Fig. 8 The data using 125 nM NRGi p is shown in Fig. 8 and the data using 250 nM NRGla is shown in Fig. 9.
- a competition assay was performed to determine the binding specificity of the 526.09 and 526.02 antibodies. As shown in Fig. 12, 526.90 competes with 538.24.17 for both HRGla and HRG1 ⁇ , indicating that 526.90 binds to both of these HRG1 isoforms.
- Example 7 Several affinity matured variants of the 526.09 antibody were generated as described in Example 7 and analyzed for their ability to block NRG1 a and NRG1 ⁇ binding to an anti-HER3 antibody in KIRA assays as described in detail in Example 1. Briefly, Serum-starved MCF-7 cells were treated with fixed amounts of Neuregulin 1 -alpha or Neuregulin -beta and increasing amounts of test materials (YW538.24.71 and YW526.90.28) for 15min in a C02 incubator. After decanting media, cells were lysed and analyzed in an ELISA previously described (Sadick et al. 1999).
- Her3 phosphorylation was measured using an anti-HER3 as capture MAb (R+D Systems Duo Set IC Phospho-ErbB3 kit part# 841428, Minneapolis, MN) and anti-phosphotyrosine MAb conjugated with horseradish peroxidase (HRP) as detection (R+D Systems Duo Set IC Phospho-ErbB3 kit part# 841403, Minneapolis, MN).
- HRP horseradish peroxidase
- the plates were read at 450 nm with a 620 nm reference on a microplate reader (Thermo Lab Systems; Waltham, MA). The absorbance was graphed and analyzed for inhibition. The combined results of these assays are shown in Fig. 13.
- Binding affinities of the 526.90.28 anti-NRGl antibody for NRGla and NRGi p was measured by Surface Plasmon Resonance (SRP) using a BIAcoreTM-T100 instrument as described in Example 1. The data using 6.25 nM NRGi p and 6.25 nM NRGla is shown in Fig. 15.
- SRP Surface Plasmon Resonance
- NRG1, HB-EGF and BTC are also ligands for the HER4 receptor. Therefore, the ability of YW538.24.71 and YW526.90.28 to inhibit BTC and HB EGF-induced HER4 phosphorylation was analyzed in a cell-based assay. While YW538.24.71 potentially inhibited NRG1-B induced phosphorylation, it had no effect on BTC or HB-EGF induced phosphorylation when measured by Western b lot analysis .
- HNSCC head and neck squamous carcinoma
- Athymic nude mice were inoculated subcutaneously in the right flank with 15 million human lung adenocarcinoma cell line Calu3 cells. When tumors reached a mean of 150-250 mm3 animals were grouped out into treatment groups with equivalent mean starting tumor volumes. Animals were treated as follows:
- Group 1 Vehicle (antibody buffer/carboplatin buffer), i.p. qwk X 2 + Paclitaxel buffer, IV q2d X 5
- Group 2 538.24.71, 25 mg/kg,IP, qwk for study duration + carboplatin buffer, IP qwk X 2 + Paclitaxel buffer, TV q2d X 5
- Paclitaxel buffer IV q2d X 5.
- Group 4 Carboplatin, 60 mg/kg,IP qwk X 2 + Paclitaxel, 20mg/kg, IV q2d X 5 .
- Paclitaxel 20mg/kg, IV q2d X 5.
- Group 6 526.90.28, 25 mg/kg, IP, qwk for study duration + Carboplatin, 60 mg/kg, IP qwk X + Paclitaxel, 20mg/kg, IV q2d X 5.
- Tumor Growth curves are presented as Linear Mixed Effect (LME) model generated fit of tumor volume graphed as cubic splines with auto-determined knots.
- LME Linear Mixed Effect
- a Kaplan-Meier curve showing progression free survival (progression defined as a tumor reaching twice its starting volume) is also presented.
- P values were calculated by Gehan-Breslow-Wilocoxon test.
- Fig. 20 The data show that single agent anti-NRGl treatment significantly inhibits tumor growth. Furthermore, anti-NRGl treatment lengthens the duration of the response to standard of care chemotherapy, delaying tumor regrowth.
- NSCLC non- small cell lung cancer
- Group 1 Vehicle: Anti-ragweed, 20mg/kg, IP qwk for study duration + Carboplatin buffer, IP q4d X 5 + Paclitaxel buffer, IV q4d x 5.
- Group 2 Y538.24.71 : Y538.24.71, 20mg/kg, IP qwk for study duration + Carboplatin buffer, IP q4d X 5 + Paclitaxel buffer, IV q4d X 5.
- Group 3 Chemo + Ragweed: Anti-ragweed, 20mg/kg, IP qwk for study duration + Carboplatin, 60 mg/kg IP q4d X 5 + Paclitaxel 20mg/kg, IV q4d x 5.
- YW538.24.71 also enhanced the response of LKPH2 tumors to gemcitabine treatment, another chemotherapeutic agent commonly used to treat NSCLC (Fig. 23).
- gemcitabine at 100 mg/kg, was administered to the mice every four days for four doses. Tumor Growth curves and Kaplan-Meier curve were generated as in Example 15.
- Total injection volume (per treatment day) will not exceed 30C ⁇ l/mouse.
- mice were grouped out and treated as follows:
- Tumors were measured at least once a week and animals were monitored at least twice a week for the duration of the study. Tumor sites were shaved as necessary to facilitate tumor measurements.
- Tumor Growth curves are presented as Linear Mixed Effect (LME) model generated fit of tumor volume graphed as cubic splines with auto-determined knots. Tumor Growth curves and Kaplan-Meier curve were generated as in Example 15. % TGI is the percentage AUC/Day (on the original mm3 volume scale) reduction compared to control based on the fitted curves for only those days where all treatment groups still have some animals present. Fig. 24.
- LME Linear Mixed Effect
- Cancer cell 2 127-137.
- mutant proteins shows increased sensitivity to the epidermal growth factor receptor tyrosine kinase inhibitor, erlotinib. Cancer research 66, 8163-8171.
- cancer cells through the mammalian target of rapamycin/p70S6Kl pathway. Cancer research 67, 6325-6332.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201280050667.1A CN103890007A (zh) | 2011-08-17 | 2012-08-16 | 神经调节蛋白抗体及其用途 |
| US14/239,229 US20140363438A1 (en) | 2011-08-17 | 2012-08-16 | Neuregulin antibodies and uses thereof |
| RU2014109093/10A RU2014109093A (ru) | 2011-08-17 | 2012-08-16 | Антитела против нейрегулина и их применение |
| BR112014003431A BR112014003431A2 (pt) | 2011-08-17 | 2012-08-16 | anticorpo, ácido nucleico, célula hospedeira, método de produção de um anticorpo, imunoconjugado, formulação farmacêutica, agente farmacêutico, uso do anticorpo, método de tratamento de um indivíduo que tem câncer e método de aumento de tempo para recorrência de tumor |
| EP12751691.2A EP2744824A1 (en) | 2011-08-17 | 2012-08-16 | Neuregulin antibodies and uses thereof |
| CA2842375A CA2842375A1 (en) | 2011-08-17 | 2012-08-16 | Neuregulin antibodies and uses thereof |
| KR1020147006579A KR20140057326A (ko) | 2011-08-17 | 2012-08-16 | 뉴레귤린 항체 및 그의 용도 |
| MX2014001766A MX2014001766A (es) | 2011-08-17 | 2012-08-16 | Anticuerpos de neuregulina y sus usos. |
| JP2014526192A JP2014526891A (ja) | 2011-08-17 | 2012-08-16 | ニューレグリン抗体とその使用 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161524421P | 2011-08-17 | 2011-08-17 | |
| US61/524,421 | 2011-08-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013025853A1 true WO2013025853A1 (en) | 2013-02-21 |
Family
ID=46755132
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/051033 Ceased WO2013025853A1 (en) | 2011-08-17 | 2012-08-16 | Neuregulin antibodies and uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20140363438A1 (https=) |
| EP (1) | EP2744824A1 (https=) |
| JP (1) | JP2014526891A (https=) |
| KR (1) | KR20140057326A (https=) |
| CN (1) | CN103890007A (https=) |
| BR (1) | BR112014003431A2 (https=) |
| CA (1) | CA2842375A1 (https=) |
| MX (1) | MX2014001766A (https=) |
| RU (1) | RU2014109093A (https=) |
| WO (1) | WO2013025853A1 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014123227A1 (ja) * | 2013-02-08 | 2014-08-14 | 株式会社医学生物学研究所 | ヒトnrg1タンパク質に対する抗体 |
| JP2016537965A (ja) * | 2013-10-11 | 2016-12-08 | ジェネンテック, インコーポレイテッド | Nsp4阻害剤及び使用方法 |
| WO2017072150A1 (en) * | 2015-10-27 | 2017-05-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-nrg1 (heregulin) antibodies and uses thereof |
| US9828635B2 (en) | 2011-10-06 | 2017-11-28 | Aveo Pharmaceuticals, Inc. | Predicting tumor response to anti-ERBB3 antibodies |
| US11584793B2 (en) | 2015-06-24 | 2023-02-21 | Hoffmann-La Roche Inc. | Anti-transferrin receptor antibodies with tailored affinity |
| US11603411B2 (en) | 2015-10-02 | 2023-03-14 | Hoffmann-La Roche Inc. | Bispecific anti-human CD20/human transferrin receptor antibodies and methods of use |
| US11787868B2 (en) | 2015-10-02 | 2023-10-17 | Hoffmann-La Roche Inc. | Bispecific anti-human A-beta/human transferrin receptor antibodies and methods of use |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140092346A1 (en) * | 2012-09-28 | 2014-04-03 | Apple Inc. | Borderless Display with Light-Bending Structures |
| US11561226B2 (en) * | 2016-03-14 | 2023-01-24 | Pierce Biotechnology Inc. | Detection and quantification of AKT-mTOR pathway proteins |
| WO2022266413A1 (en) * | 2021-06-17 | 2022-12-22 | Mayo Foundation For Medical Education And Research | Assessing and treating prostate cancer |
Citations (224)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4676980A (en) | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
| WO1987007646A2 (en) | 1986-06-04 | 1987-12-17 | Whitehead Institute For Biomedical Research | Detection of point mutations in neu genes |
| US4737456A (en) | 1985-05-09 | 1988-04-12 | Syntex (U.S.A.) Inc. | Reducing interference in ligand-receptor binding assays |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| WO1989010412A1 (en) | 1988-04-18 | 1989-11-02 | Applied Biotechnology, Inc. | Detection of neu gene expression and products |
| US4943533A (en) | 1984-03-01 | 1990-07-24 | The Regents Of The University Of California | Hybrid cell lines that produce monoclonal antibodies to epidermal growth factor receptor |
| US4968603A (en) | 1986-12-31 | 1990-11-06 | The Regents Of The University Of California | Determination of status in neoplastic disease |
| EP0404097A2 (de) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung |
| WO1991002062A2 (en) | 1989-08-04 | 1991-02-21 | Triton Biosciences, Inc. | C-erbb-2 external domain: gp75 |
| WO1991005264A1 (en) | 1989-09-29 | 1991-04-18 | Oncogenetics Partners | Detection and quantification of neu related proteins in the biological fluids of humans |
| WO1993001161A1 (en) | 1991-07-11 | 1993-01-21 | Pfizer Limited | Process for preparing sertraline intermediates |
| WO1993003741A1 (en) | 1991-08-22 | 1993-03-04 | Becton, Dickinson & Company | Methods and compositions for cancer therapy and for prognosticating responses to cancer therapy |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| WO1993008829A1 (en) | 1991-11-04 | 1993-05-13 | The Regents Of The University Of California | Compositions that mediate killing of hiv-infected cells |
| US5212290A (en) | 1989-09-08 | 1993-05-18 | The Johns Hopkins University | Antibodies specific for type II mutant EGTR |
| WO1993012220A1 (en) | 1991-12-12 | 1993-06-24 | Berlex Laboratories, Inc. | RECOMBINANT AND CHIMERIC ANTIBODIES TO c-erbB-2 |
| WO1993016185A2 (en) | 1992-02-06 | 1993-08-19 | Creative Biomolecules, Inc. | Biosynthetic binding protein for cancer marker |
| WO1993021232A1 (en) | 1992-04-10 | 1993-10-28 | Research Development Foundation | IMMUNOTOXINS DIRECTED AGAINST c-erbB-2 (HER-2/neu) RELATED SURFACE ANTIGENS |
| WO1993021319A1 (en) | 1992-04-08 | 1993-10-28 | Cetus Oncology Corporation | HUMANIZED C-erbB-2 SPECIFIC ANTIBODIES |
| US5288477A (en) | 1991-09-27 | 1994-02-22 | Becton, Dickinson And Company | Method for prognosticating response to cancer therapy |
| WO1994011026A2 (en) | 1992-11-13 | 1994-05-26 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human b lymphocyte restricted differentiation antigen for treatment of b cell lymphoma |
| WO1994022478A1 (en) | 1993-03-30 | 1994-10-13 | The Trustees Of The University Of Pennsylvania | PREVENTION OF TUMORS WITH MONOCLONAL ANTIBODIES AGAINST $i(NEU) |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US5401638A (en) | 1986-06-04 | 1995-03-28 | Oncogene Science, Inc. | Detection and quantification of neu related proteins in the biological fluids of humans |
| EP0659439A2 (en) | 1993-12-24 | 1995-06-28 | MERCK PATENT GmbH | Immunoconjugates |
| US5457105A (en) | 1992-01-20 | 1995-10-10 | Zeneca Limited | Quinazoline derivatives useful for treatment of neoplastic disease |
| US5475001A (en) | 1993-07-19 | 1995-12-12 | Zeneca Limited | Quinazoline derivatives |
| WO1996007321A1 (en) | 1994-09-06 | 1996-03-14 | The Uab Research Foundation | Methods for modulating protein function in cells using intracellular antibody homologues |
| US5500362A (en) | 1987-01-08 | 1996-03-19 | Xoma Corporation | Chimeric antibody with specificity to human B cell surface antigen |
| EP0711565A1 (en) | 1994-11-10 | 1996-05-15 | Eberhard-Karls-Universität Tübingen Universitätsklinikum | Inhibiting growth of leukemic cells by targeting HER-2 protein |
| WO1996016673A1 (en) | 1994-12-02 | 1996-06-06 | Chiron Corporation | Method of promoting an immune response with a bispecific antibody |
| EP0502812B1 (en) | 1991-02-05 | 1996-08-14 | Ciba-Geigy Ag | Recombinant antibodies specific for a growth factor receptor |
| EP0425235B1 (en) | 1989-10-25 | 1996-09-25 | Immunogen Inc | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5571894A (en) | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
| WO1996040789A1 (en) | 1995-06-07 | 1996-12-19 | Medarex, Inc. | THERAPEUTIC COMPOUNDS COMPRISED OF ANTI-Fc RECEPTOR ANTIBODIES |
| WO1996040210A1 (en) | 1995-06-07 | 1996-12-19 | Imclone Systems Incorporated | Antibody and antibody fragments for inhibiting the growth of tumors |
| US5587458A (en) | 1991-10-07 | 1996-12-24 | Aronex Pharmaceuticals, Inc. | Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof |
| WO1997000271A1 (en) | 1995-06-14 | 1997-01-03 | The Regents Of The University Of California | Novel high affinity human antibodies to tumor antigens |
| US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5635483A (en) | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
| WO1997020858A1 (en) | 1995-12-05 | 1997-06-12 | Amgen Inc. | Apoptosis induced by monoclonal antibody anti-her2 |
| US5648237A (en) | 1991-09-19 | 1997-07-15 | Genentech, Inc. | Expression of functional antibody fragments |
| US5654307A (en) | 1994-01-25 | 1997-08-05 | Warner-Lambert Company | Bicyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| WO1997030087A1 (en) | 1996-02-16 | 1997-08-21 | Glaxo Group Limited | Preparation of glycosylated antibodies |
| US5677171A (en) | 1988-01-12 | 1997-10-14 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| WO1997038731A1 (en) | 1996-04-18 | 1997-10-23 | The Regents Of The University Of California | Immunoliposomes that optimize internalization into target cells |
| US5705157A (en) | 1989-07-27 | 1998-01-06 | The Trustees Of The University Of Pennsylvania | Methods of treating cancerous cells with anti-receptor antibodies |
| WO1998002463A1 (en) | 1996-07-11 | 1998-01-22 | Medarex, Inc. | THERAPEUTIC MULTISPECIFIC COMPOUNDS COMPRISED OF ANTI-FCα RECEPTOR ANTIBODIES |
| US5712374A (en) | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5720937A (en) | 1988-01-12 | 1998-02-24 | Genentech, Inc. | In vivo tumor detection assay |
| US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
| WO1998014451A1 (en) | 1996-10-02 | 1998-04-09 | Novartis Ag | Fused pyrazole derivative and process for its preparation |
| US5739116A (en) | 1994-06-03 | 1998-04-14 | American Cyanamid Company | Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents |
| WO1998017797A1 (en) | 1996-10-18 | 1998-04-30 | Genentech, Inc. | ANTI-ErbB2 ANTIBODIES |
| US5747261A (en) | 1986-03-05 | 1998-05-05 | The United States Of America As Represented By The Department Of Health And Human Services | Protein related to but distinct from EGF receptor and antibodies reactive therewith |
| US5747498A (en) | 1996-05-28 | 1998-05-05 | Pfizer Inc. | Alkynyl and azido-substituted 4-anilinoquinazolines |
| WO1998018489A1 (en) | 1996-10-30 | 1998-05-07 | The Uab Research Foundation | Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain intracellular antibodies |
| US5750373A (en) | 1990-12-03 | 1998-05-12 | Genentech, Inc. | Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants |
| US5760041A (en) | 1996-02-05 | 1998-06-02 | American Cyanamid Company | 4-aminoquinazoline EGFR Inhibitors |
| US5770599A (en) | 1995-04-27 | 1998-06-23 | Zeneca Limited | Quinazoline derivatives |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5770710A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methlytrithio group |
| US5770701A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
| US5780588A (en) | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
| US5783404A (en) | 1995-04-13 | 1998-07-21 | Amgen Inc. | Methods and compositions for determining HER-2/neu expression using monoclonal antibodies |
| US5789199A (en) | 1994-11-03 | 1998-08-04 | Genentech, Inc. | Process for bacterial production of polypeptides |
| WO1998033914A1 (en) | 1997-01-31 | 1998-08-06 | University Of Rochester | Chimeric antibody fusion proteins for the recruitment and stimulation of an antitumor immune response |
| US5804396A (en) | 1994-10-12 | 1998-09-08 | Sugen, Inc. | Assay for agents active in proliferative disorders |
| US5821337A (en) | 1991-06-14 | 1998-10-13 | Genentech, Inc. | Immunoglobulin variants |
| WO1998045479A1 (en) | 1997-04-04 | 1998-10-15 | Albany Medical College | Method for assessing prostate cancer |
| US5824311A (en) | 1987-11-30 | 1998-10-20 | Trustees Of The University Of Pennsylvania | Treatment of tumors with monoclonal antibodies against oncogene antigens |
| WO1998050038A1 (en) | 1997-05-06 | 1998-11-12 | American Cyanamid Company | Use of quinazoline compounds for the treatment of polycystic kidney disease |
| WO1998050433A2 (en) | 1997-05-05 | 1998-11-12 | Abgenix, Inc. | Human monoclonal antibodies to epidermal growth factor receptor |
| US5840523A (en) | 1995-03-01 | 1998-11-24 | Genetech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
| US5846749A (en) | 1994-10-12 | 1998-12-08 | The Regents Of The University Of California | Quantitative measurement of tissue protein identified by immunohistochemistry and standardized protein determination |
| WO1998058964A1 (en) | 1997-06-24 | 1998-12-30 | Genentech, Inc. | Methods and compositions for galactosylated glycoproteins |
| US5856089A (en) | 1992-10-09 | 1999-01-05 | Oncor, Inc. | Method for the detection of chromosome structural abnormalities by in situ hybridization to fixed tissue |
| US5866572A (en) | 1996-02-14 | 1999-02-02 | Zeneca Limited | Quinazoline derivatives |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| WO1999009016A1 (en) | 1997-08-01 | 1999-02-25 | American Cyanamid Company | Substituted quinazoline derivatives and their use as tyrosine kinase inhibitors |
| US5891996A (en) | 1972-09-17 | 1999-04-06 | Centro De Inmunologia Molecular | Humanized and chimeric monoclonal antibodies that recognize epidermal growth factor receptor (EGF-R); diagnostic and therapeutic use |
| WO1999022764A1 (en) | 1997-10-31 | 1999-05-14 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
| WO1999024037A1 (en) | 1997-11-06 | 1999-05-20 | American Cyanamid Company | Use of quinazoline derivatives as tyrosine kinase inhibitors for treating colonic polyps |
| WO1999031140A1 (en) | 1997-12-12 | 1999-06-24 | Genentech, Inc. | TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| US5925519A (en) | 1996-06-03 | 1999-07-20 | The Regents Of The University Of California | Genetic alterations associated with prostate cancer |
| WO1999039729A2 (en) * | 1998-02-04 | 1999-08-12 | Genentech, Inc. | Use of heregulin as an epithelial cell growth factor |
| US5939531A (en) | 1991-07-15 | 1999-08-17 | Novartis Corp. | Recombinant antibodies specific for a growth factor receptor |
| US5959177A (en) | 1989-10-27 | 1999-09-28 | The Scripps Research Institute | Transgenic plants expressing assembled secretory antibodies |
| WO1999048527A1 (en) | 1998-03-27 | 1999-09-30 | Genentech, Inc. | Apo-2 ligand-anti-her-2 antibody synergism |
| WO1999051642A1 (en) | 1998-04-02 | 1999-10-14 | Genentech, Inc. | Antibody variants and fragments thereof |
| EP0616812B1 (en) | 1993-03-24 | 1999-11-03 | Berlex Biosciences | Combination with anti-hormonal compounds and binding molecules for the treatment of cancer |
| WO1999055367A1 (en) | 1998-04-24 | 1999-11-04 | The Regents Of The University Of California | INTERNALIZING ErbB2 ANTIBODIES |
| US6002008A (en) | 1997-04-03 | 1999-12-14 | American Cyanamid Company | Substituted 3-cyano quinolines |
| US6015567A (en) | 1989-05-19 | 2000-01-18 | Genentech, Inc. | HER2 extracellular domain |
| US6040498A (en) | 1998-08-11 | 2000-03-21 | North Caroline State University | Genetically engineered duckweed |
| US6054297A (en) | 1991-06-14 | 2000-04-25 | Genentech, Inc. | Humanized antibodies and methods for making them |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6084095A (en) | 1994-01-25 | 2000-07-04 | Warner-Lambert Company | Substituted pyrido[3,2-d]pyrimidines capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6123939A (en) | 1989-08-04 | 2000-09-26 | Berlex Laboratories, Inc. | Anti-neoplastic drugs in cancer therapy |
| WO2000061185A1 (en) | 1999-04-09 | 2000-10-19 | Aventis Pharma S.A | Docetaxel in combination with rhumab her2 for the treatment of cancers |
| WO2000061739A1 (fr) | 1999-04-09 | 2000-10-19 | Kyowa Hakko Kogyo Co., Ltd. | Methode de regulation de l'activite d'une molecule immunologiquement fonctionnelle |
| WO2000061145A1 (en) | 1999-04-09 | 2000-10-19 | Schering Corporation | Methods of inducing cancer cell death and tumor regression |
| US6140332A (en) | 1995-07-06 | 2000-10-31 | Novartis Ag | Pyrrolopyrimidines and processes for the preparation thereof |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO2000069460A1 (en) | 1999-05-14 | 2000-11-23 | Genentech, Inc. | TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| WO2000078347A1 (en) | 1999-06-18 | 2000-12-28 | The Victor Chang Cardiac Research Institute Limited | Cell growth inhibition |
| WO2001000244A2 (en) | 1999-06-25 | 2001-01-04 | Genentech, Inc. | METHODS OF TREATMENT USING ANTI-ErbB ANTIBODY-MAYTANSINOID CONJUGATES |
| WO2001000245A2 (en) | 1999-06-25 | 2001-01-04 | Genentech, Inc. | HUMANIZED ANTI-ErbB2 ANTIBODIES AND TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| WO2001000238A1 (en) | 1999-06-25 | 2001-01-04 | Genentech, Inc. | TREATING PROSTATE CANCER WITH ANTI-ErbB2 ANTIBODIES |
| US6171586B1 (en) | 1997-06-13 | 2001-01-09 | Genentech, Inc. | Antibody formulation |
| WO2001005425A2 (en) | 1999-07-20 | 2001-01-25 | Pharmacia & Upjohn S.P.A. | Combined preparations comprising daunorubicin derivatives and her2 antibodies |
| WO2001009187A2 (en) | 1999-07-29 | 2001-02-08 | Medarex, Inc. | Human monoclonal antibodies to her2/neu |
| US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| WO2001015730A1 (en) | 1999-08-27 | 2001-03-08 | Genentech, Inc. | DOSAGES FOR TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| WO2001020033A1 (en) | 1998-09-14 | 2001-03-22 | The Albany Medical College | Methods for selecting prostate cancer treatments and treating prostate cancer |
| WO2001021192A2 (en) | 1999-09-22 | 2001-03-29 | Corixa Corporation | Methods for diagnosis and therapy of hematological and virus-associated malignancies |
| WO2001029246A1 (fr) | 1999-10-19 | 2001-04-26 | Kyowa Hakko Kogyo Co., Ltd. | Procede de production d'un polypeptide |
| WO2001032155A2 (en) | 1999-11-02 | 2001-05-10 | The University Of Manchester | Use of egfr tyrosine kinase inhibitors for treating breast cancer |
| US6248516B1 (en) | 1988-11-11 | 2001-06-19 | Medical Research Council | Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors |
| WO2001053354A2 (en) | 2000-01-20 | 2001-07-26 | Chiron Corporation | Methods for treating tumors using a fusion protein comprising il-2- polypeptides and p185-specific binding molecules |
| US6267958B1 (en) | 1995-07-27 | 2001-07-31 | Genentech, Inc. | Protein formulation |
| WO2001056604A1 (en) | 2000-02-07 | 2001-08-09 | Uab Research Foundation | Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain secretory antibodies |
| WO2001064246A2 (en) | 2000-02-29 | 2001-09-07 | Janssen Pharmaceutica N.V. | Farnesyl protein transferase inhibitor combinations with an her2 antibody |
| WO2001076586A1 (en) | 2000-04-06 | 2001-10-18 | Astrazeneca Ab | Combination product comprising a non-steroidal antiandrogen and an egfr tyrosine kinase inhibitor |
| WO2001076630A1 (en) | 2000-04-06 | 2001-10-18 | Kyowa Hakko Kogyo Co., Ltd. | Diagnostics and remedies for rheumatoid arthritis |
| WO2001087334A1 (en) | 2000-05-15 | 2001-11-22 | Pharmacia Italia S.P.A. | Aromatase inhibitors and monoclonal anti-her2 antibodies as antitumors agents |
| WO2001087336A1 (en) | 2000-05-15 | 2001-11-22 | Health Research, Inc. | Cancer treatments by using a combination of an antibody against her2 and interleukin -2 |
| WO2001089566A1 (en) | 2000-05-19 | 2001-11-29 | Genentech, Inc. | Gene detection assay for improving the likelihood of an effective response to an erbb antagonist cancer therapy |
| US6333398B1 (en) | 1996-11-27 | 2001-12-25 | Genentech, Inc. | Protein purification |
| US6339142B1 (en) | 1998-05-06 | 2002-01-15 | Genentech, Inc. | Protein purification |
| WO2002005791A2 (en) | 2000-07-18 | 2002-01-24 | Pharmacia Italia Spa | Antitumor combination comprising an aromatase inhibitor and an egfr antagonist or inhibitor |
| US6344459B1 (en) | 1996-04-12 | 2002-02-05 | Warner-Lambert Company | Irreversible inhibitors of tyrosine kinases |
| US6344455B1 (en) | 1998-11-19 | 2002-02-05 | Warner-Lambert Company | N-[4-(3-chloro-4-fluoro-phenylamino)-7-(3-morpholin-4-yl-propoxy)-quinazolin-6-yl]-acrylamide, and irreversible inhibitor of tyrosine kinases |
| WO2002009754A1 (en) | 2000-07-28 | 2002-02-07 | Sumitomo Pharmaceuticals Co., Ltd. | Novel remedies for cancer |
| WO2002011677A2 (en) | 2000-08-09 | 2002-02-14 | Imclone Systems Incorporated | Treatment of hyperproliferative diseases with epidermal growth factor receptor antagonists |
| US6358682B1 (en) | 1998-01-26 | 2002-03-19 | Ventana Medical Systems, Inc. | Method and kit for the prognostication of breast cancer |
| WO2002031140A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions |
| US20020051785A1 (en) | 2000-03-20 | 2002-05-02 | The Regents Of The University Of California And Amgen Inc. | HER -2/neu overexpression abrogates growth inhibitory pathways |
| US6391874B1 (en) | 1996-07-13 | 2002-05-21 | Smithkline Beecham Corporation | Fused heterocyclic compounds as protein tyrosine kinase inhibitors |
| WO2002044413A2 (en) | 2000-12-01 | 2002-06-06 | Response Genetics, Inc. | Method of determining epidermal growth factor receptor and her2-neu gene expression and correlation of levels thereof with survival rates |
| US6403630B1 (en) | 1999-01-27 | 2002-06-11 | Cornell Research Foundation, Inc. | Treating cancers associated with overexpression of HER-2/neu |
| WO2002045653A2 (en) | 2000-12-08 | 2002-06-13 | Uab Research Foundation | Combination radiation therapy and chemotherapy in conjuction with administration of growth factor receptor antibody |
| US20020090662A1 (en) | 2000-08-15 | 2002-07-11 | Peter Ralph | Analytical method |
| US6420548B1 (en) | 1999-10-04 | 2002-07-16 | Medicago Inc. | Method for regulating transcription of foreign genes |
| WO2002055106A2 (en) | 2001-01-09 | 2002-07-18 | Merck Patent Gmbh | Combination therapy using receptor tyrosine kinase inhibitors and angiogenesis inhibitors |
| WO2002070008A1 (en) | 2001-03-02 | 2002-09-12 | Imclone Systems Incorporated | Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist |
| US20020142328A1 (en) | 2000-12-01 | 2002-10-03 | Danenberg Kathleen D. | Method of determining a chemotherapeutic regimen by assaying gene expression in primary tumors |
| WO2002087619A1 (en) | 2001-04-27 | 2002-11-07 | Takeda Chemical Industries, Ltd. | Preventive/therapeutic method for cancer |
| US20020164328A1 (en) | 2000-10-06 | 2002-11-07 | Toyohide Shinkawa | Process for purifying antibody |
| WO2002089842A1 (en) | 2001-05-08 | 2002-11-14 | Merck Patent Gmbh | Combination therapy using anti-egfr antibodies and anti-hormonal agents |
| US20020192211A1 (en) | 1998-03-17 | 2002-12-19 | Hudziak Robert M. | Method of treating tumor cells by inhibiting growth factor receptor function |
| US20020192652A1 (en) | 2001-06-11 | 2002-12-19 | Danenberg Kathleen D. | Method of determining epidermal growth factor receptor and HER2-neu gene expression and correlation of levels thereof with survival rates |
| WO2003006509A2 (en) | 2001-07-10 | 2003-01-23 | Universita Degli Studi Di Napoli Federico Ii | Human mini-antibody cytotoxic for tumor cells which express the erbb2 receptor |
| WO2003011878A2 (en) | 2001-08-03 | 2003-02-13 | Glycart Biotechnology Ag | Antibody glycosylation variants having increased antibody-dependent cellular cytotoxicity |
| WO2003012072A2 (en) | 2001-08-03 | 2003-02-13 | The Trustees Of The University Of Pennsylvania | Monoclonal antibodies to activated erbb family members and methods of use thereof |
| WO2003028638A2 (en) | 2001-09-28 | 2003-04-10 | The Board Of Trustees Of The University Of Arkansas | Treatment of uterine serous papillary cancer |
| US20030086924A1 (en) | 1999-06-25 | 2003-05-08 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| WO2003041736A2 (en) | 2001-11-16 | 2003-05-22 | Pharmacia & Upjohn Company | Method for the treatment of cardiotoxicity induced by antitumor compounds |
| US6573043B1 (en) | 1998-10-07 | 2003-06-03 | Genentech, Inc. | Tissue analysis and kits therefor |
| US20030108545A1 (en) | 1994-02-10 | 2003-06-12 | Patricia Rockwell | Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist |
| US20030115614A1 (en) | 2000-10-06 | 2003-06-19 | Yutaka Kanda | Antibody composition-producing cell |
| US6596726B1 (en) | 1994-01-25 | 2003-07-22 | Warner Lambert Company | Tricyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6602670B2 (en) | 2000-12-01 | 2003-08-05 | Response Genetics, Inc. | Method of determining a chemotherapeutic regimen based on ERCC1 expression |
| US6602684B1 (en) | 1998-04-20 | 2003-08-05 | Glycart Biotechnology Ag | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| US6602677B1 (en) | 1997-09-19 | 2003-08-05 | Promega Corporation | Thermostable luciferases and methods of production |
| US20030157108A1 (en) | 2001-10-25 | 2003-08-21 | Genentech, Inc. | Glycoprotein compositions |
| US20030165840A1 (en) | 2001-03-02 | 2003-09-04 | Kathleen Danenberg | Method of determining dihydropyrimidine dehydrogenase gene expression |
| US20030175845A1 (en) | 2002-03-13 | 2003-09-18 | Kalbag Suresh M. | Use of sulfitolysis in high performance peptide mapping |
| US6630579B2 (en) | 1999-12-29 | 2003-10-07 | Immunogen Inc. | Cytotoxic agents comprising modified doxorubicins and daunorubicins and their therapeutic use |
| US6632979B2 (en) | 2000-03-16 | 2003-10-14 | Genentech, Inc. | Rodent HER2 tumor model |
| WO2003085107A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | Cells with modified genome |
| WO2003085119A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | METHOD OF ENHANCING ACTIVITY OF ANTIBODY COMPOSITION OF BINDING TO FcϜ RECEPTOR IIIa |
| WO2003084570A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | DRUG CONTAINING ANTIBODY COMPOSITION APPROPRIATE FOR PATIENT SUFFERING FROM FcϜRIIIa POLYMORPHISM |
| WO2003087131A2 (en) | 2002-04-10 | 2003-10-23 | Genentech, Inc | Anti-her2 antibody variants |
| WO2003086467A1 (en) | 2002-04-08 | 2003-10-23 | Smithkline Beecham Corporation | Cancer treatment method comprising administering an erb-family inhibitor and a raf and/or ras inhibitor |
| EP1357132A2 (en) | 2002-04-19 | 2003-10-29 | BIOTHER di Contardi Gabriella & C. Società in accomandita semplice | Detection of the her2 receptor by means of biotinylated humanized antibody |
| US20030202973A1 (en) | 2002-04-29 | 2003-10-30 | Dr. George Pieczenik | Treatment of refractory human tumors with epidermal growth factor receptor and HER1 mitogenic ligand (EGFRML) antagonists |
| WO2004008099A2 (en) | 2002-07-15 | 2004-01-22 | Genentech, Inc. | METHODS FOR IDENTIFYING TUMORS THAT ARE RESPONSIVE TO TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| US20040013667A1 (en) | 1999-06-25 | 2004-01-22 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| US6685940B2 (en) | 1995-07-27 | 2004-02-03 | Genentech, Inc. | Protein formulation |
| WO2004024866A2 (en) | 2002-09-11 | 2004-03-25 | Genentech, Inc. | Protein purification |
| US20040093621A1 (en) | 2001-12-25 | 2004-05-13 | Kyowa Hakko Kogyo Co., Ltd | Antibody composition which specifically binds to CD20 |
| US6737056B1 (en) | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US20040110282A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells in which activity of the protein involved in transportation of GDP-fucose is reduced or lost |
| US20040109865A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Antibody composition-containing medicament |
| WO2004048525A2 (en) | 2002-11-21 | 2004-06-10 | Genentech, Inc. | Therapy of non-malignant diseases or disorders with anti-erbb2 antibodies |
| WO2004056312A2 (en) | 2002-12-16 | 2004-07-08 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
| US20040132140A1 (en) | 2002-04-09 | 2004-07-08 | Kyowa Hakko Kogyo Co., Ltd. | Production process for antibody composition |
| US6800738B1 (en) | 1991-06-14 | 2004-10-05 | Genentech, Inc. | Method for making humanized antibodies |
| US20050014934A1 (en) | 2002-10-15 | 2005-01-20 | Hinton Paul R. | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
| US20050079574A1 (en) | 2003-01-16 | 2005-04-14 | Genentech, Inc. | Synthetic antibody phage libraries |
| WO2005035778A1 (ja) | 2003-10-09 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | α1,6-フコシルトランスフェラーゼの機能を抑制するRNAを用いた抗体組成物の製造法 |
| WO2005035586A1 (ja) | 2003-10-08 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | 融合蛋白質組成物 |
| US20050119455A1 (en) | 2002-06-03 | 2005-06-02 | Genentech, Inc. | Synthetic antibody phage libraries |
| US20050123546A1 (en) | 2003-11-05 | 2005-06-09 | Glycart Biotechnology Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
| WO2005053742A1 (ja) | 2003-12-04 | 2005-06-16 | Kyowa Hakko Kogyo Co., Ltd. | 抗体組成物を含有する医薬 |
| WO2005100402A1 (en) | 2004-04-13 | 2005-10-27 | F.Hoffmann-La Roche Ag | Anti-p-selectin antibodies |
| US20050260186A1 (en) | 2003-03-05 | 2005-11-24 | Halozyme, Inc. | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases |
| US20050266000A1 (en) | 2004-04-09 | 2005-12-01 | Genentech, Inc. | Variable domain library and uses |
| US6982321B2 (en) | 1986-03-27 | 2006-01-03 | Medical Research Council | Altered antibodies |
| US20060025576A1 (en) | 2000-04-11 | 2006-02-02 | Genentech, Inc. | Multivalent antibodies and uses therefor |
| WO2006029879A2 (en) | 2004-09-17 | 2006-03-23 | F.Hoffmann-La Roche Ag | Anti-ox40l antibodies |
| WO2006044908A2 (en) | 2004-10-20 | 2006-04-27 | Genentech, Inc. | Antibody formulation in histidine-acetate buffer |
| US7041870B2 (en) | 2000-11-30 | 2006-05-09 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
| US20060104968A1 (en) | 2003-03-05 | 2006-05-18 | Halozyme, Inc. | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminogly ycanases |
| US7087409B2 (en) | 1997-12-05 | 2006-08-08 | The Scripps Research Institute | Humanization of murine antibody |
| US7125978B1 (en) | 1999-10-04 | 2006-10-24 | Medicago Inc. | Promoter for regulating expression of foreign genes |
| US7189826B2 (en) | 1997-11-24 | 2007-03-13 | Institute For Human Genetics And Biochemistry | Monoclonal human natural antibodies |
| US20070061900A1 (en) | 2000-10-31 | 2007-03-15 | Murphy Andrew J | Methods of modifying eukaryotic cells |
| US20070117126A1 (en) | 1999-12-15 | 2007-05-24 | Genentech, Inc. | Shotgun scanning |
| US20070160598A1 (en) | 2005-11-07 | 2007-07-12 | Dennis Mark S | Binding polypeptides with diversified and consensus vh/vl hypervariable sequences |
| US20070237764A1 (en) | 2005-12-02 | 2007-10-11 | Genentech, Inc. | Binding polypeptides with restricted diversity sequences |
| US20070292936A1 (en) | 2006-05-09 | 2007-12-20 | Genentech, Inc. | Binding polypeptides with optimized scaffolds |
| US20080069820A1 (en) | 2006-08-30 | 2008-03-20 | Genentech, Inc. | Multispecific antibodies |
| US7371826B2 (en) | 1999-01-15 | 2008-05-13 | Genentech, Inc. | Polypeptide variants with altered effector function |
| WO2008077546A1 (en) | 2006-12-22 | 2008-07-03 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
| US20090002360A1 (en) | 2007-05-25 | 2009-01-01 | Innolux Display Corp. | Liquid crystal display device and method for driving same |
| US7498298B2 (en) | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US7521541B2 (en) | 2004-09-23 | 2009-04-21 | Genetech Inc. | Cysteine engineered antibodies and conjugates |
| US7527791B2 (en) | 2004-03-31 | 2009-05-05 | Genentech, Inc. | Humanized anti-TGF-beta antibodies |
| WO2009089004A1 (en) | 2008-01-07 | 2009-07-16 | Amgen Inc. | Method for making antibody fc-heterodimeric molecules using electrostatic steering effects |
| US20100255010A1 (en) | 2009-03-20 | 2010-10-07 | Genentech, Inc. | Anti-her antibodies |
| WO2011103242A1 (en) | 2010-02-18 | 2011-08-25 | Genentech, Inc. | Neuregulin antagonists and use thereof in treating cancer |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BRPI0820538B1 (pt) * | 2007-11-16 | 2021-08-17 | Mind-Nrg Sa | Usos de uma isoforma recombinante solúvel de neuregulina-1, e composição farmacêutica ou kit |
-
2012
- 2012-08-16 US US14/239,229 patent/US20140363438A1/en not_active Abandoned
- 2012-08-16 MX MX2014001766A patent/MX2014001766A/es unknown
- 2012-08-16 KR KR1020147006579A patent/KR20140057326A/ko not_active Withdrawn
- 2012-08-16 BR BR112014003431A patent/BR112014003431A2/pt unknown
- 2012-08-16 CA CA2842375A patent/CA2842375A1/en not_active Abandoned
- 2012-08-16 RU RU2014109093/10A patent/RU2014109093A/ru not_active Application Discontinuation
- 2012-08-16 WO PCT/US2012/051033 patent/WO2013025853A1/en not_active Ceased
- 2012-08-16 CN CN201280050667.1A patent/CN103890007A/zh active Pending
- 2012-08-16 JP JP2014526192A patent/JP2014526891A/ja active Pending
- 2012-08-16 EP EP12751691.2A patent/EP2744824A1/en not_active Withdrawn
Patent Citations (308)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5891996A (en) | 1972-09-17 | 1999-04-06 | Centro De Inmunologia Molecular | Humanized and chimeric monoclonal antibodies that recognize epidermal growth factor receptor (EGF-R); diagnostic and therapeutic use |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4943533A (en) | 1984-03-01 | 1990-07-24 | The Regents Of The University Of California | Hybrid cell lines that produce monoclonal antibodies to epidermal growth factor receptor |
| US4737456A (en) | 1985-05-09 | 1988-04-12 | Syntex (U.S.A.) Inc. | Reducing interference in ligand-receptor binding assays |
| US4676980A (en) | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
| US5747261A (en) | 1986-03-05 | 1998-05-05 | The United States Of America As Represented By The Department Of Health And Human Services | Protein related to but distinct from EGF receptor and antibodies reactive therewith |
| US5985553A (en) | 1986-03-05 | 1999-11-16 | The United States Of America As Represented By The Department Of Health And Human Services | erbB-2 gene segments, probes, recombinant DNA and kits for detection |
| US6982321B2 (en) | 1986-03-27 | 2006-01-03 | Medical Research Council | Altered antibodies |
| US5604107A (en) | 1986-06-04 | 1997-02-18 | Oncogene Science, Inc. | Detection of neu p185 in cell lysates |
| US4935341A (en) | 1986-06-04 | 1990-06-19 | Whitehead Institute For Biomedical Research | Detection of point mutations in neu genes |
| WO1987007646A2 (en) | 1986-06-04 | 1987-12-17 | Whitehead Institute For Biomedical Research | Detection of point mutations in neu genes |
| US5401638A (en) | 1986-06-04 | 1995-03-28 | Oncogene Science, Inc. | Detection and quantification of neu related proteins in the biological fluids of humans |
| US4968603A (en) | 1986-12-31 | 1990-11-06 | The Regents Of The University Of California | Determination of status in neoplastic disease |
| US5500362A (en) | 1987-01-08 | 1996-03-19 | Xoma Corporation | Chimeric antibody with specificity to human B cell surface antigen |
| US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5648260A (en) | 1987-03-18 | 1997-07-15 | Scotgen Biopharmaceuticals Incorporated | DNA encoding antibodies with altered effector functions |
| US5770701A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
| US5770710A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methlytrithio group |
| US5824311A (en) | 1987-11-30 | 1998-10-20 | Trustees Of The University Of Pennsylvania | Treatment of tumors with monoclonal antibodies against oncogene antigens |
| US5720954A (en) | 1988-01-12 | 1998-02-24 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| US6165464A (en) | 1988-01-12 | 2000-12-26 | Genetech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| US5720937A (en) | 1988-01-12 | 1998-02-24 | Genentech, Inc. | In vivo tumor detection assay |
| US5770195A (en) | 1988-01-12 | 1998-06-23 | Genentech, Inc. | Monoclonal antibodies directed to the her2 receptor |
| US5772997A (en) | 1988-01-12 | 1998-06-30 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| US5725856A (en) | 1988-01-12 | 1998-03-10 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| US6399063B1 (en) | 1988-01-12 | 2002-06-04 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| US6387371B1 (en) | 1988-01-12 | 2002-05-14 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| US5677171A (en) | 1988-01-12 | 1997-10-14 | Genentech, Inc. | Monoclonal antibodies directed to the HER2 receptor |
| WO1989010412A1 (en) | 1988-04-18 | 1989-11-02 | Applied Biotechnology, Inc. | Detection of neu gene expression and products |
| EP0412116B1 (en) | 1988-04-18 | 1995-11-29 | Oncogene Science, Inc. | Detection of neu gene expression and products |
| US6248516B1 (en) | 1988-11-11 | 2001-06-19 | Medical Research Council | Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors |
| US6333169B1 (en) | 1989-05-19 | 2001-12-25 | Genentech Inc | HER2 extracellular domain |
| US6015567A (en) | 1989-05-19 | 2000-01-18 | Genentech, Inc. | HER2 extracellular domain |
| EP0404097A2 (de) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung |
| US5705157A (en) | 1989-07-27 | 1998-01-06 | The Trustees Of The University Of Pennsylvania | Methods of treating cancerous cells with anti-receptor antibodies |
| EP0444181B1 (en) | 1989-08-04 | 2001-10-31 | Schering Aktiengesellschaft | C-erbb-2 external domain: gp75 |
| EP1006194A2 (en) | 1989-08-04 | 2000-06-07 | Triton Biosciences Inc. | C-erbB-2 external domain: GP75 |
| US6123939A (en) | 1989-08-04 | 2000-09-26 | Berlex Laboratories, Inc. | Anti-neoplastic drugs in cancer therapy |
| WO1991002062A2 (en) | 1989-08-04 | 1991-02-21 | Triton Biosciences, Inc. | C-erbb-2 external domain: gp75 |
| US20020155527A1 (en) | 1989-08-04 | 2002-10-24 | Triton Biosciences, Inc. | C-erbB-2 exrernal domain: gp75 |
| US5212290A (en) | 1989-09-08 | 1993-05-18 | The Johns Hopkins University | Antibodies specific for type II mutant EGTR |
| EP0494135B1 (en) | 1989-09-29 | 1996-04-10 | Oncogene Science, Inc. | Human "neu" related protein p100 and use of the same for detecting preneoplastic or neoplastic cells in a human |
| WO1991005264A1 (en) | 1989-09-29 | 1991-04-18 | Oncogenetics Partners | Detection and quantification of neu related proteins in the biological fluids of humans |
| EP0425235B1 (en) | 1989-10-25 | 1996-09-25 | Immunogen Inc | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5416064A (en) | 1989-10-25 | 1995-05-16 | Immunogen, Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5959177A (en) | 1989-10-27 | 1999-09-28 | The Scripps Research Institute | Transgenic plants expressing assembled secretory antibodies |
| US6417429B1 (en) | 1989-10-27 | 2002-07-09 | The Scripps Research Institute | Transgenic plants expressing assembled secretory antibodies |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5750373A (en) | 1990-12-03 | 1998-05-12 | Genentech, Inc. | Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants |
| US5571894A (en) | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
| EP0502812B1 (en) | 1991-02-05 | 1996-08-14 | Ciba-Geigy Ag | Recombinant antibodies specific for a growth factor receptor |
| US20040236078A1 (en) | 1991-06-14 | 2004-11-25 | Genentech, Inc. | Method for making humanized antibodies |
| US6800738B1 (en) | 1991-06-14 | 2004-10-05 | Genentech, Inc. | Method for making humanized antibodies |
| US6719971B1 (en) | 1991-06-14 | 2004-04-13 | Genentech, Inc. | Method for making humanized antibodies |
| US6054297A (en) | 1991-06-14 | 2000-04-25 | Genentech, Inc. | Humanized antibodies and methods for making them |
| US5821337A (en) | 1991-06-14 | 1998-10-13 | Genentech, Inc. | Immunoglobulin variants |
| US6407213B1 (en) | 1991-06-14 | 2002-06-18 | Genentech, Inc. | Method for making humanized antibodies |
| WO1993001161A1 (en) | 1991-07-11 | 1993-01-21 | Pfizer Limited | Process for preparing sertraline intermediates |
| US5939531A (en) | 1991-07-15 | 1999-08-17 | Novartis Corp. | Recombinant antibodies specific for a growth factor receptor |
| US5514554A (en) | 1991-08-22 | 1996-05-07 | Becton Dickinson And Company | Methods and compositions for cancer therapy and for prognosticating responses to cancer therapy |
| EP0656367A1 (en) | 1991-08-22 | 1995-06-07 | Becton, Dickinson and Company | Method and composition for cancer therapy and for prognosticating responses to cancer theraphy |
| WO1993003741A1 (en) | 1991-08-22 | 1993-03-04 | Becton, Dickinson & Company | Methods and compositions for cancer therapy and for prognosticating responses to cancer therapy |
| EP0554441B1 (en) | 1991-08-22 | 1999-01-27 | Becton, Dickinson and Company | Methods and compositions for cancer therapy and for prognosticating responses to cancer therapy |
| US5648237A (en) | 1991-09-19 | 1997-07-15 | Genentech, Inc. | Expression of functional antibody fragments |
| US5288477A (en) | 1991-09-27 | 1994-02-22 | Becton, Dickinson And Company | Method for prognosticating response to cancer therapy |
| US5587458A (en) | 1991-10-07 | 1996-12-24 | Aronex Pharmaceuticals, Inc. | Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof |
| WO1993008829A1 (en) | 1991-11-04 | 1993-05-13 | The Regents Of The University Of California | Compositions that mediate killing of hiv-infected cells |
| WO1993012220A1 (en) | 1991-12-12 | 1993-06-24 | Berlex Laboratories, Inc. | RECOMBINANT AND CHIMERIC ANTIBODIES TO c-erbB-2 |
| US5616582A (en) | 1992-01-20 | 1997-04-01 | Zeneca Limited | Quinazoline derivatives as anti-proliferative agents |
| US5457105A (en) | 1992-01-20 | 1995-10-10 | Zeneca Limited | Quinazoline derivatives useful for treatment of neoplastic disease |
| US5877305A (en) | 1992-02-06 | 1999-03-02 | Chiron Corporation | DNA encoding biosynthetic binding protein for cancer marker |
| WO1993016185A2 (en) | 1992-02-06 | 1993-08-19 | Creative Biomolecules, Inc. | Biosynthetic binding protein for cancer marker |
| WO1993021319A1 (en) | 1992-04-08 | 1993-10-28 | Cetus Oncology Corporation | HUMANIZED C-erbB-2 SPECIFIC ANTIBODIES |
| WO1993021232A1 (en) | 1992-04-10 | 1993-10-28 | Research Development Foundation | IMMUNOTOXINS DIRECTED AGAINST c-erbB-2 (HER-2/neu) RELATED SURFACE ANTIGENS |
| US5856089A (en) | 1992-10-09 | 1999-01-05 | Oncor, Inc. | Method for the detection of chromosome structural abnormalities by in situ hybridization to fixed tissue |
| WO1994011026A2 (en) | 1992-11-13 | 1994-05-26 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human b lymphocyte restricted differentiation antigen for treatment of b cell lymphoma |
| US5635483A (en) | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
| US5780588A (en) | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
| EP0616812B1 (en) | 1993-03-24 | 1999-11-03 | Berlex Biosciences | Combination with anti-hormonal compounds and binding molecules for the treatment of cancer |
| WO1994022478A1 (en) | 1993-03-30 | 1994-10-13 | The Trustees Of The University Of Pennsylvania | PREVENTION OF TUMORS WITH MONOCLONAL ANTIBODIES AGAINST $i(NEU) |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US5475001A (en) | 1993-07-19 | 1995-12-12 | Zeneca Limited | Quinazoline derivatives |
| EP0659439A2 (en) | 1993-12-24 | 1995-06-28 | MERCK PATENT GmbH | Immunoconjugates |
| US5679683A (en) | 1994-01-25 | 1997-10-21 | Warner-Lambert Company | Tricyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6521620B1 (en) | 1994-01-25 | 2003-02-18 | Warner-Lambert Company | Bicyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6084095A (en) | 1994-01-25 | 2000-07-04 | Warner-Lambert Company | Substituted pyrido[3,2-d]pyrimidines capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US5654307A (en) | 1994-01-25 | 1997-08-05 | Warner-Lambert Company | Bicyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6596726B1 (en) | 1994-01-25 | 2003-07-22 | Warner Lambert Company | Tricyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6455534B2 (en) | 1994-01-25 | 2002-09-24 | Warner-Lambert Company | Bicyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6265410B1 (en) | 1994-01-25 | 2001-07-24 | Warner-Lambert Company | Bicyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US6713484B2 (en) | 1994-01-25 | 2004-03-30 | Warner-Lambert Company | Bicyclic compounds capable of inhibiting tyrosine kinases of the epidermal growth factor receptor family |
| US20030108545A1 (en) | 1994-02-10 | 2003-06-12 | Patricia Rockwell | Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist |
| US20030103973A1 (en) | 1994-02-10 | 2003-06-05 | Patricia Rockwell | Method for reducing tumor growth with VEGF antagonists combined with radiation and chemotherapy |
| US5739116A (en) | 1994-06-03 | 1998-04-14 | American Cyanamid Company | Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents |
| US5767285A (en) | 1994-06-03 | 1998-06-16 | American Cyanamid Company | Linkers useful for the synthesis of conjugates of methyltrithio antitumor agents |
| US5877296A (en) | 1994-06-03 | 1999-03-02 | American Cyanamid Company | Process for preparing conjugates of methyltrithio antitumor agents |
| US5773001A (en) | 1994-06-03 | 1998-06-30 | American Cyanamid Company | Conjugates of methyltrithio antitumor agents and intermediates for their synthesis |
| US5910486A (en) | 1994-09-06 | 1999-06-08 | Uab Research Foundation | Methods for modulating protein function in cells using, intracellular antibody homologues |
| WO1996007321A1 (en) | 1994-09-06 | 1996-03-14 | The Uab Research Foundation | Methods for modulating protein function in cells using intracellular antibody homologues |
| US6028059A (en) | 1994-09-06 | 2000-02-22 | Uab Research Foundation | Methods for modulating protein function in cells using intracellular antibody homologues |
| US5846749A (en) | 1994-10-12 | 1998-12-08 | The Regents Of The University Of California | Quantitative measurement of tissue protein identified by immunohistochemistry and standardized protein determination |
| US5804396A (en) | 1994-10-12 | 1998-09-08 | Sugen, Inc. | Assay for agents active in proliferative disorders |
| US5789199A (en) | 1994-11-03 | 1998-08-04 | Genentech, Inc. | Process for bacterial production of polypeptides |
| US6214388B1 (en) | 1994-11-09 | 2001-04-10 | The Regents Of The University Of California | Immunoliposomes that optimize internalization into target cells |
| EP0711565A1 (en) | 1994-11-10 | 1996-05-15 | Eberhard-Karls-Universität Tübingen Universitätsklinikum | Inhibiting growth of leukemic cells by targeting HER-2 protein |
| WO1996016673A1 (en) | 1994-12-02 | 1996-06-06 | Chiron Corporation | Method of promoting an immune response with a bispecific antibody |
| US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
| US5840523A (en) | 1995-03-01 | 1998-11-24 | Genetech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
| US5783404A (en) | 1995-04-13 | 1998-07-21 | Amgen Inc. | Methods and compositions for determining HER-2/neu expression using monoclonal antibodies |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5770599A (en) | 1995-04-27 | 1998-06-23 | Zeneca Limited | Quinazoline derivatives |
| WO1996040210A1 (en) | 1995-06-07 | 1996-12-19 | Imclone Systems Incorporated | Antibody and antibody fragments for inhibiting the growth of tumors |
| US5712374A (en) | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| WO1996040789A1 (en) | 1995-06-07 | 1996-12-19 | Medarex, Inc. | THERAPEUTIC COMPOUNDS COMPRISED OF ANTI-Fc RECEPTOR ANTIBODIES |
| US6270765B1 (en) | 1995-06-07 | 2001-08-07 | Medarex, Inc. | Therapeutic compounds comprised of anti-Fc receptor antibodies |
| US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5837243A (en) | 1995-06-07 | 1998-11-17 | Medarex, Inc. | Therapeutic compounds comprised of anti-Fc receptor antibodies |
| US6395272B1 (en) | 1995-06-07 | 2002-05-28 | Mederex, Inc. | Therapeutic compounds comprised of anti-Fc receptor antibodies |
| WO1997000271A1 (en) | 1995-06-14 | 1997-01-03 | The Regents Of The University Of California | Novel high affinity human antibodies to tumor antigens |
| US5977322A (en) | 1995-06-14 | 1999-11-02 | The Regents Of The University Of California | High affinity human antibodies to tumor antigens |
| US6512097B1 (en) | 1995-06-14 | 2003-01-28 | The Regents Of The University Of California | High affinity human antibodies to tumor antigens |
| US6140332A (en) | 1995-07-06 | 2000-10-31 | Novartis Ag | Pyrrolopyrimidines and processes for the preparation thereof |
| US6267958B1 (en) | 1995-07-27 | 2001-07-31 | Genentech, Inc. | Protein formulation |
| US6685940B2 (en) | 1995-07-27 | 2004-02-03 | Genentech, Inc. | Protein formulation |
| US6821515B1 (en) | 1995-07-27 | 2004-11-23 | Genentech, Inc. | Protein formulation |
| US5783186A (en) | 1995-12-05 | 1998-07-21 | Amgen Inc. | Antibody-induced apoptosis |
| WO1997020858A1 (en) | 1995-12-05 | 1997-06-12 | Amgen Inc. | Apoptosis induced by monoclonal antibody anti-her2 |
| US6458356B1 (en) | 1995-12-05 | 2002-10-01 | Amgen Inc. | Antibody-induced apoptosis |
| US5760041A (en) | 1996-02-05 | 1998-06-02 | American Cyanamid Company | 4-aminoquinazoline EGFR Inhibitors |
| US6399602B1 (en) | 1996-02-14 | 2002-06-04 | Zeneca Limited | Quinazoline derivatives |
| US5866572A (en) | 1996-02-14 | 1999-02-02 | Zeneca Limited | Quinazoline derivatives |
| WO1997030087A1 (en) | 1996-02-16 | 1997-08-21 | Glaxo Group Limited | Preparation of glycosylated antibodies |
| US6602863B1 (en) | 1996-04-12 | 2003-08-05 | Warner-Lambert Company | Irreversible inhibitors of tyrosine kinases |
| US6344459B1 (en) | 1996-04-12 | 2002-02-05 | Warner-Lambert Company | Irreversible inhibitors of tyrosine kinases |
| WO1997038731A1 (en) | 1996-04-18 | 1997-10-23 | The Regents Of The University Of California | Immunoliposomes that optimize internalization into target cells |
| US5747498A (en) | 1996-05-28 | 1998-05-05 | Pfizer Inc. | Alkynyl and azido-substituted 4-anilinoquinazolines |
| US5925519A (en) | 1996-06-03 | 1999-07-20 | The Regents Of The University Of California | Genetic alterations associated with prostate cancer |
| WO1998002463A1 (en) | 1996-07-11 | 1998-01-22 | Medarex, Inc. | THERAPEUTIC MULTISPECIFIC COMPOUNDS COMPRISED OF ANTI-FCα RECEPTOR ANTIBODIES |
| US5922845A (en) | 1996-07-11 | 1999-07-13 | Medarex, Inc. | Therapeutic multispecific compounds comprised of anti-Fcα receptor antibodies |
| US6391874B1 (en) | 1996-07-13 | 2002-05-21 | Smithkline Beecham Corporation | Fused heterocyclic compounds as protein tyrosine kinase inhibitors |
| WO1998014451A1 (en) | 1996-10-02 | 1998-04-09 | Novartis Ag | Fused pyrazole derivative and process for its preparation |
| WO1998017797A1 (en) | 1996-10-18 | 1998-04-30 | Genentech, Inc. | ANTI-ErbB2 ANTIBODIES |
| WO1998018489A1 (en) | 1996-10-30 | 1998-05-07 | The Uab Research Foundation | Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain intracellular antibodies |
| US6333398B1 (en) | 1996-11-27 | 2001-12-25 | Genentech, Inc. | Protein purification |
| US6797814B2 (en) | 1996-11-27 | 2004-09-28 | Genentech, Inc. | Protein purification |
| WO1998033914A1 (en) | 1997-01-31 | 1998-08-06 | University Of Rochester | Chimeric antibody fusion proteins for the recruitment and stimulation of an antitumor immune response |
| US6002008A (en) | 1997-04-03 | 1999-12-14 | American Cyanamid Company | Substituted 3-cyano quinolines |
| WO1998045479A1 (en) | 1997-04-04 | 1998-10-15 | Albany Medical College | Method for assessing prostate cancer |
| US5994071A (en) | 1997-04-04 | 1999-11-30 | Albany Medical College | Assessment of prostate cancer |
| US20020076695A1 (en) | 1997-04-04 | 2002-06-20 | Jeffrey S. Ross | Methods for treating prostate cancer |
| WO1998050433A2 (en) | 1997-05-05 | 1998-11-12 | Abgenix, Inc. | Human monoclonal antibodies to epidermal growth factor receptor |
| US6235883B1 (en) | 1997-05-05 | 2001-05-22 | Abgenix, Inc. | Human monoclonal antibodies to epidermal growth factor receptor |
| WO1998050038A1 (en) | 1997-05-06 | 1998-11-12 | American Cyanamid Company | Use of quinazoline compounds for the treatment of polycystic kidney disease |
| US6171586B1 (en) | 1997-06-13 | 2001-01-09 | Genentech, Inc. | Antibody formulation |
| WO1998058964A1 (en) | 1997-06-24 | 1998-12-30 | Genentech, Inc. | Methods and compositions for galactosylated glycoproteins |
| WO1999009016A1 (en) | 1997-08-01 | 1999-02-25 | American Cyanamid Company | Substituted quinazoline derivatives and their use as tyrosine kinase inhibitors |
| US6602677B1 (en) | 1997-09-19 | 2003-08-05 | Promega Corporation | Thermostable luciferases and methods of production |
| WO1999022764A1 (en) | 1997-10-31 | 1999-05-14 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
| WO1999024037A1 (en) | 1997-11-06 | 1999-05-20 | American Cyanamid Company | Use of quinazoline derivatives as tyrosine kinase inhibitors for treating colonic polyps |
| US7189826B2 (en) | 1997-11-24 | 2007-03-13 | Institute For Human Genetics And Biochemistry | Monoclonal human natural antibodies |
| US7087409B2 (en) | 1997-12-05 | 2006-08-08 | The Scripps Research Institute | Humanization of murine antibody |
| US20050002928A1 (en) | 1997-12-12 | 2005-01-06 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| US20030147884A1 (en) | 1997-12-12 | 2003-08-07 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| US20030170234A1 (en) | 1997-12-12 | 2003-09-11 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| WO1999031140A1 (en) | 1997-12-12 | 1999-06-24 | Genentech, Inc. | TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| US20030059790A1 (en) | 1998-01-26 | 2003-03-27 | Ventana Medical Systems, Inc. | Method and kit for the prognostication of breast cancer |
| US6358682B1 (en) | 1998-01-26 | 2002-03-19 | Ventana Medical Systems, Inc. | Method and kit for the prognostication of breast cancer |
| WO1999039729A2 (en) * | 1998-02-04 | 1999-08-12 | Genentech, Inc. | Use of heregulin as an epithelial cell growth factor |
| US20020192211A1 (en) | 1998-03-17 | 2002-12-19 | Hudziak Robert M. | Method of treating tumor cells by inhibiting growth factor receptor function |
| US20020141993A1 (en) | 1998-03-27 | 2002-10-03 | Genentech, Inc. | Apo-2 ligand-anti-Her-2 antibody synergism |
| WO1999048527A1 (en) | 1998-03-27 | 1999-09-30 | Genentech, Inc. | Apo-2 ligand-anti-her-2 antibody synergism |
| US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| WO1999051642A1 (en) | 1998-04-02 | 1999-10-14 | Genentech, Inc. | Antibody variants and fragments thereof |
| US6602684B1 (en) | 1998-04-20 | 2003-08-05 | Glycart Biotechnology Ag | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| WO1999055367A1 (en) | 1998-04-24 | 1999-11-04 | The Regents Of The University Of California | INTERNALIZING ErbB2 ANTIBODIES |
| US6339142B1 (en) | 1998-05-06 | 2002-01-15 | Genentech, Inc. | Protein purification |
| US6489447B1 (en) | 1998-05-06 | 2002-12-03 | Genentech, Inc. | Protein purification |
| US6417335B1 (en) | 1998-05-06 | 2002-07-09 | Genentech, Inc. | Protein purification |
| US6040498A (en) | 1998-08-11 | 2000-03-21 | North Caroline State University | Genetically engineered duckweed |
| WO2001020033A1 (en) | 1998-09-14 | 2001-03-22 | The Albany Medical College | Methods for selecting prostate cancer treatments and treating prostate cancer |
| US20030152987A1 (en) | 1998-10-07 | 2003-08-14 | Genentech, Inc. | Tissue analysis and kits therefor |
| US6573043B1 (en) | 1998-10-07 | 2003-06-03 | Genentech, Inc. | Tissue analysis and kits therefor |
| US6344455B1 (en) | 1998-11-19 | 2002-02-05 | Warner-Lambert Company | N-[4-(3-chloro-4-fluoro-phenylamino)-7-(3-morpholin-4-yl-propoxy)-quinazolin-6-yl]-acrylamide, and irreversible inhibitor of tyrosine kinases |
| US7332581B2 (en) | 1999-01-15 | 2008-02-19 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US6737056B1 (en) | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US7371826B2 (en) | 1999-01-15 | 2008-05-13 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US6403630B1 (en) | 1999-01-27 | 2002-06-11 | Cornell Research Foundation, Inc. | Treating cancers associated with overexpression of HER-2/neu |
| WO2000061145A1 (en) | 1999-04-09 | 2000-10-19 | Schering Corporation | Methods of inducing cancer cell death and tumor regression |
| WO2000061185A1 (en) | 1999-04-09 | 2000-10-19 | Aventis Pharma S.A | Docetaxel in combination with rhumab her2 for the treatment of cancers |
| WO2000061739A1 (fr) | 1999-04-09 | 2000-10-19 | Kyowa Hakko Kogyo Co., Ltd. | Methode de regulation de l'activite d'une molecule immunologiquement fonctionnelle |
| US6333348B1 (en) | 1999-04-09 | 2001-12-25 | Aventis Pharma S.A. | Use of docetaxel for treating cancers |
| WO2000069460A1 (en) | 1999-05-14 | 2000-11-23 | Genentech, Inc. | TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| WO2000078347A1 (en) | 1999-06-18 | 2000-12-28 | The Victor Chang Cardiac Research Institute Limited | Cell growth inhibition |
| WO2001000245A2 (en) | 1999-06-25 | 2001-01-04 | Genentech, Inc. | HUMANIZED ANTI-ErbB2 ANTIBODIES AND TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| WO2001000244A2 (en) | 1999-06-25 | 2001-01-04 | Genentech, Inc. | METHODS OF TREATMENT USING ANTI-ErbB ANTIBODY-MAYTANSINOID CONJUGATES |
| US20030086924A1 (en) | 1999-06-25 | 2003-05-08 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| US20040013667A1 (en) | 1999-06-25 | 2004-01-22 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
| WO2001000238A1 (en) | 1999-06-25 | 2001-01-04 | Genentech, Inc. | TREATING PROSTATE CANCER WITH ANTI-ErbB2 ANTIBODIES |
| WO2001005425A2 (en) | 1999-07-20 | 2001-01-25 | Pharmacia & Upjohn S.P.A. | Combined preparations comprising daunorubicin derivatives and her2 antibodies |
| WO2001009187A2 (en) | 1999-07-29 | 2001-02-08 | Medarex, Inc. | Human monoclonal antibodies to her2/neu |
| WO2001015730A1 (en) | 1999-08-27 | 2001-03-08 | Genentech, Inc. | DOSAGES FOR TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| US6627196B1 (en) | 1999-08-27 | 2003-09-30 | Genentech, Inc. | Dosages for treatment with anti-ErbB2 antibodies |
| WO2001021192A2 (en) | 1999-09-22 | 2001-03-29 | Corixa Corporation | Methods for diagnosis and therapy of hematological and virus-associated malignancies |
| US6420548B1 (en) | 1999-10-04 | 2002-07-16 | Medicago Inc. | Method for regulating transcription of foreign genes |
| US7125978B1 (en) | 1999-10-04 | 2006-10-24 | Medicago Inc. | Promoter for regulating expression of foreign genes |
| WO2001029246A1 (fr) | 1999-10-19 | 2001-04-26 | Kyowa Hakko Kogyo Co., Ltd. | Procede de production d'un polypeptide |
| WO2001032155A2 (en) | 1999-11-02 | 2001-05-10 | The University Of Manchester | Use of egfr tyrosine kinase inhibitors for treating breast cancer |
| US20070117126A1 (en) | 1999-12-15 | 2007-05-24 | Genentech, Inc. | Shotgun scanning |
| US6630579B2 (en) | 1999-12-29 | 2003-10-07 | Immunogen Inc. | Cytotoxic agents comprising modified doxorubicins and daunorubicins and their therapeutic use |
| WO2001053354A2 (en) | 2000-01-20 | 2001-07-26 | Chiron Corporation | Methods for treating tumors using a fusion protein comprising il-2- polypeptides and p185-specific binding molecules |
| WO2001056604A1 (en) | 2000-02-07 | 2001-08-09 | Uab Research Foundation | Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain secretory antibodies |
| US20030022918A1 (en) | 2000-02-29 | 2003-01-30 | Horak Ivan David | Farnesyl protein transferase inhibitor combinations with an her2 antibody |
| WO2001064246A2 (en) | 2000-02-29 | 2001-09-07 | Janssen Pharmaceutica N.V. | Farnesyl protein transferase inhibitor combinations with an her2 antibody |
| US6632979B2 (en) | 2000-03-16 | 2003-10-14 | Genentech, Inc. | Rodent HER2 tumor model |
| US6767541B2 (en) | 2000-03-20 | 2004-07-27 | The Regents Of The University Of California | HER-2/neu overexpression abrogates growth inhibitory pathways |
| US20020051785A1 (en) | 2000-03-20 | 2002-05-02 | The Regents Of The University Of California And Amgen Inc. | HER -2/neu overexpression abrogates growth inhibitory pathways |
| WO2001076586A1 (en) | 2000-04-06 | 2001-10-18 | Astrazeneca Ab | Combination product comprising a non-steroidal antiandrogen and an egfr tyrosine kinase inhibitor |
| US20030144252A1 (en) | 2000-04-06 | 2003-07-31 | Furr Barrington John Albert | Combination product comprising a non-steroidal antiandrogen and an egfr tyrosine kinase inhibitor |
| WO2001076630A1 (en) | 2000-04-06 | 2001-10-18 | Kyowa Hakko Kogyo Co., Ltd. | Diagnostics and remedies for rheumatoid arthritis |
| US20030152572A1 (en) | 2000-04-06 | 2003-08-14 | Yoshimi Homma | Diagnostic and therapeutic agents for rheumatoid arthritis |
| US20060025576A1 (en) | 2000-04-11 | 2006-02-02 | Genentech, Inc. | Multivalent antibodies and uses therefor |
| WO2001087336A1 (en) | 2000-05-15 | 2001-11-22 | Health Research, Inc. | Cancer treatments by using a combination of an antibody against her2 and interleukin -2 |
| WO2001087334A1 (en) | 2000-05-15 | 2001-11-22 | Pharmacia Italia S.P.A. | Aromatase inhibitors and monoclonal anti-her2 antibodies as antitumors agents |
| US20020031515A1 (en) | 2000-05-15 | 2002-03-14 | Caligiuri Michael A. | Methods of therapy for cancers characterized by overexpression of the HER2 receptor protein |
| WO2001089566A1 (en) | 2000-05-19 | 2001-11-29 | Genentech, Inc. | Gene detection assay for improving the likelihood of an effective response to an erbb antagonist cancer therapy |
| US20030134344A1 (en) | 2000-05-19 | 2003-07-17 | Genentech, Inc. | Gene detection assay for improving the likelihood of an effective response to an ErbB antagonist cancer therapy |
| US20020064785A1 (en) | 2000-05-19 | 2002-05-30 | Genentech Inc. | Gene detection assay for improving the likelihood of an effective response to an ErbB antagonist cancer therapy |
| WO2002005791A2 (en) | 2000-07-18 | 2002-01-24 | Pharmacia Italia Spa | Antitumor combination comprising an aromatase inhibitor and an egfr antagonist or inhibitor |
| WO2002009754A1 (en) | 2000-07-28 | 2002-02-07 | Sumitomo Pharmaceuticals Co., Ltd. | Novel remedies for cancer |
| US20030157097A1 (en) | 2000-07-28 | 2003-08-21 | Toshihiro Noguchi | Novel remedies for cancer |
| WO2002011677A2 (en) | 2000-08-09 | 2002-02-14 | Imclone Systems Incorporated | Treatment of hyperproliferative diseases with epidermal growth factor receptor antagonists |
| US20020090662A1 (en) | 2000-08-15 | 2002-07-11 | Peter Ralph | Analytical method |
| US20020164328A1 (en) | 2000-10-06 | 2002-11-07 | Toyohide Shinkawa | Process for purifying antibody |
| WO2002031140A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions |
| US20030115614A1 (en) | 2000-10-06 | 2003-06-19 | Yutaka Kanda | Antibody composition-producing cell |
| US20070061900A1 (en) | 2000-10-31 | 2007-03-15 | Murphy Andrew J | Methods of modifying eukaryotic cells |
| US7041870B2 (en) | 2000-11-30 | 2006-05-09 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
| WO2002044413A2 (en) | 2000-12-01 | 2002-06-06 | Response Genetics, Inc. | Method of determining epidermal growth factor receptor and her2-neu gene expression and correlation of levels thereof with survival rates |
| US6602670B2 (en) | 2000-12-01 | 2003-08-05 | Response Genetics, Inc. | Method of determining a chemotherapeutic regimen based on ERCC1 expression |
| US20030211530A1 (en) | 2000-12-01 | 2003-11-13 | Danenberg Kathleen D. | Method of determining epidermal growth factor receptor and HER2-neu gene expression and correlation of levels thereof with survival rates |
| US20020142328A1 (en) | 2000-12-01 | 2002-10-03 | Danenberg Kathleen D. | Method of determining a chemotherapeutic regimen by assaying gene expression in primary tumors |
| WO2002045653A2 (en) | 2000-12-08 | 2002-06-13 | Uab Research Foundation | Combination radiation therapy and chemotherapy in conjuction with administration of growth factor receptor antibody |
| US20020076408A1 (en) | 2000-12-08 | 2002-06-20 | Buchsbaum Donald J. | Combination radiation therapy and chemotherapy in conjunction with administration of growth factor receptor antibody |
| WO2002055106A2 (en) | 2001-01-09 | 2002-07-18 | Merck Patent Gmbh | Combination therapy using receptor tyrosine kinase inhibitors and angiogenesis inhibitors |
| US20030165840A1 (en) | 2001-03-02 | 2003-09-04 | Kathleen Danenberg | Method of determining dihydropyrimidine dehydrogenase gene expression |
| WO2002070008A1 (en) | 2001-03-02 | 2002-09-12 | Imclone Systems Incorporated | Combination methods of inhibiting tumor growth with a vascular endothelial growth factor receptor antagonist |
| WO2002087619A1 (en) | 2001-04-27 | 2002-11-07 | Takeda Chemical Industries, Ltd. | Preventive/therapeutic method for cancer |
| US20040138160A1 (en) | 2001-04-27 | 2004-07-15 | Kenichiro Naito | Preventive/therapeutic method for cancer |
| WO2002089842A1 (en) | 2001-05-08 | 2002-11-14 | Merck Patent Gmbh | Combination therapy using anti-egfr antibodies and anti-hormonal agents |
| US20020192652A1 (en) | 2001-06-11 | 2002-12-19 | Danenberg Kathleen D. | Method of determining epidermal growth factor receptor and HER2-neu gene expression and correlation of levels thereof with survival rates |
| US6582919B2 (en) | 2001-06-11 | 2003-06-24 | Response Genetics, Inc. | Method of determining epidermal growth factor receptor and HER2-neu gene expression and correlation of levels thereof with survival rates |
| WO2003006509A2 (en) | 2001-07-10 | 2003-01-23 | Universita Degli Studi Di Napoli Federico Ii | Human mini-antibody cytotoxic for tumor cells which express the erbb2 receptor |
| WO2003011878A2 (en) | 2001-08-03 | 2003-02-13 | Glycart Biotechnology Ag | Antibody glycosylation variants having increased antibody-dependent cellular cytotoxicity |
| WO2003012072A2 (en) | 2001-08-03 | 2003-02-13 | The Trustees Of The University Of Pennsylvania | Monoclonal antibodies to activated erbb family members and methods of use thereof |
| US20030068318A1 (en) | 2001-09-28 | 2003-04-10 | O'brien Timothy | Treatment of uterine serous papillary cancer |
| WO2003028638A2 (en) | 2001-09-28 | 2003-04-10 | The Board Of Trustees Of The University Of Arkansas | Treatment of uterine serous papillary cancer |
| US20030157108A1 (en) | 2001-10-25 | 2003-08-21 | Genentech, Inc. | Glycoprotein compositions |
| WO2003041736A2 (en) | 2001-11-16 | 2003-05-22 | Pharmacia & Upjohn Company | Method for the treatment of cardiotoxicity induced by antitumor compounds |
| US20040093621A1 (en) | 2001-12-25 | 2004-05-13 | Kyowa Hakko Kogyo Co., Ltd | Antibody composition which specifically binds to CD20 |
| US20030175845A1 (en) | 2002-03-13 | 2003-09-18 | Kalbag Suresh M. | Use of sulfitolysis in high performance peptide mapping |
| WO2003086467A1 (en) | 2002-04-08 | 2003-10-23 | Smithkline Beecham Corporation | Cancer treatment method comprising administering an erb-family inhibitor and a raf and/or ras inhibitor |
| WO2003085107A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | Cells with modified genome |
| WO2003085119A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | METHOD OF ENHANCING ACTIVITY OF ANTIBODY COMPOSITION OF BINDING TO FcϜ RECEPTOR IIIa |
| US20040110282A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells in which activity of the protein involved in transportation of GDP-fucose is reduced or lost |
| WO2003084570A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | DRUG CONTAINING ANTIBODY COMPOSITION APPROPRIATE FOR PATIENT SUFFERING FROM FcϜRIIIa POLYMORPHISM |
| US20040109865A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Antibody composition-containing medicament |
| US20040110704A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells of which genome is modified |
| US20040132140A1 (en) | 2002-04-09 | 2004-07-08 | Kyowa Hakko Kogyo Co., Ltd. | Production process for antibody composition |
| WO2003087131A2 (en) | 2002-04-10 | 2003-10-23 | Genentech, Inc | Anti-her2 antibody variants |
| US20030228663A1 (en) | 2002-04-10 | 2003-12-11 | Lowman Henry B. | Anti-HER2 antibody variants |
| EP1357132A2 (en) | 2002-04-19 | 2003-10-29 | BIOTHER di Contardi Gabriella & C. Società in accomandita semplice | Detection of the her2 receptor by means of biotinylated humanized antibody |
| US20030202973A1 (en) | 2002-04-29 | 2003-10-30 | Dr. George Pieczenik | Treatment of refractory human tumors with epidermal growth factor receptor and HER1 mitogenic ligand (EGFRML) antagonists |
| US20050119455A1 (en) | 2002-06-03 | 2005-06-02 | Genentech, Inc. | Synthetic antibody phage libraries |
| US20040106161A1 (en) | 2002-07-15 | 2004-06-03 | Birgit Bossenmaier | Methods for identifying tumors that are responsive to treatment with anti-ErbB2 antibodies |
| WO2004008099A2 (en) | 2002-07-15 | 2004-01-22 | Genentech, Inc. | METHODS FOR IDENTIFYING TUMORS THAT ARE RESPONSIVE TO TREATMENT WITH ANTI-ErbB2 ANTIBODIES |
| WO2004024866A2 (en) | 2002-09-11 | 2004-03-25 | Genentech, Inc. | Protein purification |
| US20040082047A1 (en) | 2002-09-11 | 2004-04-29 | Emery Jefferson C. | Protein purification |
| US20050014934A1 (en) | 2002-10-15 | 2005-01-20 | Hinton Paul R. | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
| US20040258685A1 (en) | 2002-11-21 | 2004-12-23 | Genentech, Inc. | Therapy of non-malignant diseases or disorders with anti-ErbB2 antibodies |
| WO2004048525A2 (en) | 2002-11-21 | 2004-06-10 | Genentech, Inc. | Therapy of non-malignant diseases or disorders with anti-erbb2 antibodies |
| WO2004056312A2 (en) | 2002-12-16 | 2004-07-08 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
| US20050079574A1 (en) | 2003-01-16 | 2005-04-14 | Genentech, Inc. | Synthetic antibody phage libraries |
| US20060104968A1 (en) | 2003-03-05 | 2006-05-18 | Halozyme, Inc. | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminogly ycanases |
| US20050260186A1 (en) | 2003-03-05 | 2005-11-24 | Halozyme, Inc. | Soluble glycosaminoglycanases and methods of preparing and using soluble glycosaminoglycanases |
| WO2005035586A1 (ja) | 2003-10-08 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | 融合蛋白質組成物 |
| WO2005035778A1 (ja) | 2003-10-09 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | α1,6-フコシルトランスフェラーゼの機能を抑制するRNAを用いた抗体組成物の製造法 |
| US20050123546A1 (en) | 2003-11-05 | 2005-06-09 | Glycart Biotechnology Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
| US7498298B2 (en) | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| WO2005053742A1 (ja) | 2003-12-04 | 2005-06-16 | Kyowa Hakko Kogyo Co., Ltd. | 抗体組成物を含有する医薬 |
| US7527791B2 (en) | 2004-03-31 | 2009-05-05 | Genentech, Inc. | Humanized anti-TGF-beta antibodies |
| US20050266000A1 (en) | 2004-04-09 | 2005-12-01 | Genentech, Inc. | Variable domain library and uses |
| WO2005100402A1 (en) | 2004-04-13 | 2005-10-27 | F.Hoffmann-La Roche Ag | Anti-p-selectin antibodies |
| WO2006029879A2 (en) | 2004-09-17 | 2006-03-23 | F.Hoffmann-La Roche Ag | Anti-ox40l antibodies |
| US7521541B2 (en) | 2004-09-23 | 2009-04-21 | Genetech Inc. | Cysteine engineered antibodies and conjugates |
| WO2006044908A2 (en) | 2004-10-20 | 2006-04-27 | Genentech, Inc. | Antibody formulation in histidine-acetate buffer |
| US20070160598A1 (en) | 2005-11-07 | 2007-07-12 | Dennis Mark S | Binding polypeptides with diversified and consensus vh/vl hypervariable sequences |
| US20070237764A1 (en) | 2005-12-02 | 2007-10-11 | Genentech, Inc. | Binding polypeptides with restricted diversity sequences |
| US20070292936A1 (en) | 2006-05-09 | 2007-12-20 | Genentech, Inc. | Binding polypeptides with optimized scaffolds |
| US20080069820A1 (en) | 2006-08-30 | 2008-03-20 | Genentech, Inc. | Multispecific antibodies |
| WO2008077546A1 (en) | 2006-12-22 | 2008-07-03 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
| US20090002360A1 (en) | 2007-05-25 | 2009-01-01 | Innolux Display Corp. | Liquid crystal display device and method for driving same |
| WO2009089004A1 (en) | 2008-01-07 | 2009-07-16 | Amgen Inc. | Method for making antibody fc-heterodimeric molecules using electrostatic steering effects |
| US20100255010A1 (en) | 2009-03-20 | 2010-10-07 | Genentech, Inc. | Anti-her antibodies |
| WO2011103242A1 (en) | 2010-02-18 | 2011-08-25 | Genentech, Inc. | Neuregulin antagonists and use thereof in treating cancer |
| US20110229493A1 (en) | 2010-02-18 | 2011-09-22 | Erica Jackson | Neuregulin antagonists and use thereof in treating cancer |
Non-Patent Citations (174)
| Title |
|---|
| AGUS, D. B. ET AL.: "Targeting ligand-activated ErbB2 signaling inhibits breast and prostate tumor growth", CANCER CELL, vol. 2, 2002, pages 127 - 137, XP002988666 |
| ALMAGRO, FRANSSON, FRONT. BIOSCI., vol. 13, 2008, pages 1619 - 1633 |
| ALMAGRO; FRANSSON, FRONT. BIOSCI., vol. 13, 2008, pages 1619 - 1633 |
| BACA ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 10678 - 10684 |
| BALDI, P.; LONG, A. D.: "A Bayesian framework for the analysis of nucroarray expression data: regularized t -test and statistical inferences of gene changes", BIOINFORMATICS, vol. 17, 2001, pages 509 - 519, XP002321472, DOI: doi:10.1093/bioinformatics/17.6.509 |
| BAO, S. ET AL.: "Stem cell-like glioma cells promote tumor angiogenesis through vascular endothelial growth factor", CANCER RESEARCH, vol. 66, 2006, pages 7843 - 7848 |
| BASELGA J ET AL: "RECOMBINANT HUMANIZED ANTI-HER2 ANTIBODY (HERCEPTIN TM) ENHANCES THE ANTITUMOR ACTIVITY OF PACLITAXEL AND DOXORUBICIN AGAINST HER2/NEU OVEREXPRESSING HUMAN BREAST CANCER XENOGRAFTS", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 58, no. 13, 1 January 1998 (1998-01-01), pages 2825 - 2831, XP000919190, ISSN: 0008-5472 * |
| BERNSTEIN H G ET AL: "Localization of neuregulin-1alpha (heregulin-alpha) and one of its receptors, ErbB-4 tyrosine kinase, in developing and adult human brain", BRAIN RESEARCH BULLETIN, ELSEVIER SCIENCE LTD, OXFORD, GB, vol. 69, no. 5, 15 May 2006 (2006-05-15), pages 546 - 559, XP024900769, ISSN: 0361-9230, [retrieved on 20060515], DOI: 10.1016/J.BRAINRESBULL.2006.02.017 * |
| BIOCONJ. CHEM., vol. 16, 2005, pages 717 - 721 |
| BOERNER ET AL., J. IMMUNOL., vol. 147, 1991, pages 86 |
| BRENNAN ET AL., SCIENCE, vol. 229, 1985, pages 81 |
| BRENNAN, S. K.; MATSUI, W.: "Cancer stem cells: controversies in multiple myeloma", JOURNAL OF MOLECULAR MEDICINE (BERLIN, GERMANY, vol. 87, 2009, pages 1079 - 1085, XP019750573, DOI: doi:10.1007/s00109-009-0531-7 |
| BREULEUX M: "Role of heregulin in human cancer", CMLS CELLULAR AND MOLECULAR LIFE SCIENCES, BIRKHÄUSER-VERLAG, BA, vol. 64, no. 18, 25 May 2007 (2007-05-25), pages 2358 - 2377, XP019536873, ISSN: 1420-9071, DOI: 10.1007/S00018-007-7120-0 * |
| BRODEUR ET AL.: "Monoclonal Antibody Production Techniques and Applications", 1987, MARCEL DEKKER, INC., pages: 51 - 63 |
| BRUGGEMANN, M. ET AL., J EXP. MED., vol. 166, 1987, pages 1351 - 1361 |
| CARAWAY, K.L. ET AL., NATURE, vol. 387, 1997, pages 512 - 516 |
| CAREY, K. D. ET AL.: "Kinetic analysis of epidermal growth factor receptor somatic mutant proteins shows increased sensitivity to the epidermal growth factor receptor tyrosine kinase inhibitor, erlotinib", CANCER RESEARCH, vol. 66, 2006, pages 8163 - 8171 |
| CARIDAD MALAVÉ ET AL: "Role of glypican-1 in the trophic activity on PC12 cells induced by cultured sciatic nerve conditioned medium: identification of a glypican-1-neuregulin complex", BRAIN RESEARCH, vol. 983, no. 1-2, 1 September 2003 (2003-09-01), pages 74 - 83, XP055042525, ISSN: 0006-8993, DOI: 10.1016/S0006-8993(03)03031-2 * |
| CARTER, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 4285 |
| CHARI ET AL., CANCER RES., vol. 52, 1992, pages 127 - 131 |
| CHARLTON: "Methods in Molecular Biology", vol. 248, 2003, HUMANA PRESS, pages: 245 - 254 |
| CHEN ET AL., J. MOL. BIOL., vol. 293, 1999, pages 865 - 881 |
| CHOTHIA; LESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CHOWDHURY, METHODS MOL. BIOL., vol. 207, 2008, pages 179 - 196 |
| CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628 |
| CLARKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628 |
| CLYNES ET AL., PROC- NAT'L ACAD. SCI. USA, vol. 95, 1998, pages 652 - 656 |
| COSTCLLO, R. T. ET AL.: "Human acute mycloid leukemia CD34+/CD38- progenitor cells have decreased sensitivity to chemotherapy and Fas-induced apoptosis, reduced immunogenicity, and impaired dendritic cell transformation capacities", CANCER RESEARCH, vol. 60, 2000, pages 4403 - 4411 |
| CRAGG, M.S. ET AL., BLOOD, vol. 101, 2003, pages 1045 - 1052 |
| CRAGG, M.S.; M.J. GLENNIE, BLOOD, vol. 103, 2004, pages 2738 - 2743 |
| CREE ET AL., ANTICANCER DRUGS, vol. 6, 1995, pages 398 - 404 |
| CROUCH ET AL., J. IMMUNOL. METH., vol. 160, 1993, pages 81 - 88 |
| CUNNINGHAM; WELLS, SCIENCE, vol. 244, 1989, pages 1081 - 1085 |
| DAHABREH, 1. J. ET AL.: "Somatic EGFR mutation and gene copy gain as predictive biomarkers for response to tyrosine kinase inhibitors in non-small cell lung cancer", CLIN CANCER RES, vol. 16, 2010, pages 291 - 303 |
| DALL'ACQUA ET AL., METHODS, vol. 36, 2005, pages 43 - 60 |
| DAVID E GERBER ET AL: "Cetuximab in combination therapy: from bench to clinic", CANCER AND METASTASIS REVIEWS, KLUWER ACADEMIC PUBLISHERS, DO, vol. 29, no. 1, 8 February 2010 (2010-02-08), pages 171 - 180, XP019787679, ISSN: 1573-7233 * |
| DEAN, M.; FOJO, T.; BATES, S.: "Tumour stem cells and drug resistance", NATURE, vol. 5, 2005, pages 275 - 284, XP002378836, DOI: doi:10.1038/nrc1590 |
| DING, L. ET AL.: "Somatic mutations affect key pathways in lung adenocarcinoma.", NATURE, vol. 455, 2008, pages 1069 - 1075, XP055335353, DOI: doi:10.1038/nature07423 |
| DOEBELE, R. C. ET AL.: "New strategies to overcome limitations of reversible EGFR tyrosine kinase inhibitor therapy in non-small cell lung cancer", LUNG CANCER, vol. 69, 2010, pages 1 - 12, XP027064998, DOI: doi:10.1016/j.lungcan.2009.12.009 |
| DUBOWCHIK ET AL., BIOORG. & MED. CHEM. LETTERS, vol. 12, 2002, pages 1529 - 1532 |
| DUNCAN; WINTER, NATURE, vol. 322, 1988, pages 738 - 40 |
| DYLLA, S. J. ET AL.: "Colorectal cancer stem cells are enriched in xenogeneic tumors following chemotherapy", PLOS ONE 3, 2008, pages E2428 |
| EDWARDS J M ET AL: "Neuregulin 1 growth factors regulate proliferation but not apoptosis of a CNS neuronal progenitor cell line", BRAIN RESEARCH, ELSEVIER, AMSTERDAM, NL, vol. 1108, no. 1, 7 September 2006 (2006-09-07), pages 63 - 75, XP027955183, ISSN: 0006-8993, [retrieved on 20060907] * |
| FALLS, D. L., EX CELL RES, vol. 284, 2003, pages 14 - 30 |
| FELLOUSE, PROC. NATL. ACAD. SCI. USA, vol. 101, no. 34, 2004, pages 12467 - 12472 |
| FLATMAN, J. CHROMATOGR. B, vol. 848, 2007, pages 79 - 87 |
| GALLOP ET AL., JOURNAL OF MEDICINAL CHEMISTRY, vol. 37, 1994, pages 1233 - 1251 |
| GAZZANO-SANTORO ET AL., J. IMMUNOL. METHODS, vol. 202, 1996, pages 163 |
| GCMGROSS, NAT. BIOTECH., vol. 22, 2004, pages 1409 - 1414 |
| GOFFIN, J. ET AL.: "First-line systemic chemotherapy in the treatment of advanced non-small cell lung cancer: a systematic review", J THORAC ONCOL, vol. 5, 2010, pages 260 - 274 |
| GOLLAMUDI, M. ET AL.: "Autocrine activation of ErbB2/ErbB3 receptor complex by NRG-1 in non-small cell lung cancer cell lines.", LUNG CANCER, vol. 43, 2004, pages 135 - 143, XP009092435, DOI: doi:10.1016/j.lungcan.2003.08.027 |
| GRAHAM, J. GEN VIROL., vol. 36, 1977, pages 59 |
| GRAY, D. C. ET AL.: "pHUSH: a single vector system for conditional gene expression", BMC BIOTECHNOL, vol. 7, 2007, pages 61, XP002517237, DOI: doi:10.1186/1472-6750-7-61 |
| GRIFFITHS ET AL., EMBO J, vol. 12, 1993, pages 725 - 734 |
| GRUBCR, J. IMMUNOL., vol. 152, 1994, pages 5368 |
| GUYER ET AL., J. IMMUNOL., vol. 117, 1976, pages 587 |
| HARARI, D. ET AL., ONCOGENE, vol. 18, pages 2681 - 2689 |
| HELLSTROM, I ET AL., PROC. NAT'L ACAD- SCI. USA, vol. 82, 1985, pages 1499 - 1502 |
| HELLSTROM, I., PROC. NAT'L ACAD. SCI. USA, vol. 83, 1986, pages 7059 - 7063 |
| HIJAZI M M ET AL: "HEREGULIN REGULATES THE ACTIN CYTOSKELETON AND PROMOTES INVASIVE PROPERTIES IN BREAST CANCER CELL LINES", INTERNATIONAL JOURNAL OF ONCOLOGY, LYCHNIA, GR, vol. 17, no. 4, 1 October 2000 (2000-10-01), pages 629 - 641, XP008038554, ISSN: 1019-6439 * |
| HINMAN ET AL., CANCER REV., vol. 53, 1993, pages 3336 - 3342 |
| HIRSCH, F. R. ET AL.: "Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib", ANN ONCOL, vol. 18, 2007, pages 752 - 760, XP002547806, DOI: doi:10.1093/ANNONC/MDM003 |
| HIRSCH; WU, EXPERT REVIEWS, vol. 7, 2007, pages 147 - 157 |
| HOEFLICH ET AL., CANCER RES., 2006 |
| HOLLINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448 |
| HOLMCS, W. E. ET AL.: "Identification of hcrcgulin, a specific activator of p 185crbB2", SCIENCE (NEW YORK, NY, vol. 256, 1992, pages 1205 - 1210 |
| HOLMES, W.E. ET AL., SCIENCE, vol. 256, 1992, pages 1205 - 1210 |
| HOMER MJ, ET AL.,: "SEER Cancer Statistics Review", 1975, NATIONAL CANCER INSTITUTE |
| HOOGCNBOOM; WINTCR, MOL. BIOL., vol. 227, 1992, pages 381 - 388 |
| HOOGENBOOM ET AL.: "fethods in Molecular Biology", vol. 178, 2001, HUMAN PRESS, pages: 1 - 37 |
| HOOGENBOOM ET AL.: "Methods in Molecular Biology", vol. 178, 2001, HUMAN PRESS, pages: 1 - 37 |
| HUDSON ET AL., NAT. MED., vol. 9, 2003, pages 129 - 134 |
| IDUSOGIE ET AL., J. IMMUNOL., vol. 164, 2000, pages 4178 - 4184 |
| JACKSON, E. L. ET AL.: "Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras", GENES DEV, vol. 15, 2001, pages 3243 - 3248, XP002584752 |
| JEFFREY ET AL., BIOORGANIC & MED. CHEM. LETTERS, vol. 16, 2006, pages 358 - 362 |
| JOHNS ET AL., J. BIOL. CHEM., vol. 279, no. 29, 2004, pages 30375 - 30384 |
| JOHNSON, B. E.; JANNE, P. A.: "Rationale for a phase II trial of pertuzumab, a HER-2 dimcrization inhibitor, in patients with non-small cell lung cancer", CLIN CANCER RES, vol. 12, 2006, pages 4436S - 4440S |
| JUNTTILA, T. T. ET AL.: "Ligand-independent HER2/HER3/PI3K complex is disrupted by trastuzumab and is effectively inhibited by the PI3K inhibitor GDC-0941", CANCER CELL, vol. 15, 2009, pages 429 - 440, XP002592637, DOI: doi:10.1016/j.ccr.2009.03.020 |
| KABAT ET AL.: "Sequences ofProteins of Immunological Interest, 5th Ed.", 1991, NATIONAL INSTITUTES OF HEALTH |
| KABAT ET AL.: "Sequences ofProteins oflmmunological Interest, 5th Ed.", 1991, NATIONAL INSTITUTES OF HEALTH |
| KAM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 11600 - 11605 |
| KANDA, Y. ET AL., BIOTECHNOL. BIOENG., vol. 94, no. 4, 2006, pages 680 - 688 |
| KASHMIRI ET AL., ULETHODS, vol. 36, 2005, pages 25 - 34 |
| KIM ET AL., J. IMMUNOL., vol. 24, 1994, pages 249 |
| KINDT ET AL.: "Kuby Immunology, 6th ed.,", 2007, W.H. FREEMAN AND CO., pages: 91 |
| KING ET AL., J. MED. CHEM., vol. 45, 2002, pages 4336 - 4343 |
| KLIMKA ET AL., BR. J. CANCER, vol. 83, 2000, pages 252 - 260 |
| KOSAKA, T. ET AL.: "Mutations of the epidermal growth factor receptor gene in lung cancer: biological and clinical implications", CANCER RESEARCH, vol. 64, 2004, pages 8919 - 8923, XP002369912, DOI: doi:10.1158/0008-5472.CAN-04-2818 |
| KOSTELNY, J IMMUNOL., vol. 148, no. 5, 1992, pages 1547 - 1553 |
| KOZBOR, J. IMMUNOL., vol. 133, 1984, pages 3001 |
| KRATZ ET AL., CURRENT MED. CHEM., vol. 13, 2006, pages 477 - 523 |
| KUYAMA, S. ET AL.: "Impact of HER2 gene and protein status on the treatment outcome of cisplatin-based chemoradiotherapy for locally advanced non-small cell lung cancer", J THORAC ONCOL, vol. 3, 2008, pages 477 - 482 |
| LEE ET AL., J. IMMUNOL. METHODS, vol. 284, no. 1-2, 2004, pages 119 - 132 |
| LEE ET AL., J. MOL. BIOL, vol. 340, 2004, pages 1073 - 1093 |
| LEE ET AL., J. MOL. BIOL., vol. 340, no. 5, 2004, pages 1073 - 1093 |
| LEE-HOEFLICH ET AL.: "A central role for HER3 in HER2-amplified breast cancer: implications for targeted therapy", CANCER RCS., vol. 68, 2008, pages 5878 - 5887, XP009145458 |
| LI ET AL., NAT. BIOTECH., vol. 24, 2006, pages 210 - 215 |
| LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 1 03, 2006, pages 3557 - 3562 |
| LI, Q. ET AL.: "Development of an autocrine neuregulin signaling loop with malignant transformation of human breast epithelial cells", CANCER RESEARCH, vol. 64, 2004, pages 7078 - 7085 |
| LIANG ET AL., JMB., vol. 366, 2007, pages 815 - 829 |
| LIU, L. Z. ET AL.: "AKT1 amplification regulates cisplatin resistance in human lung cancer cells through the mammalian target of rapamycin/p70S6K1 pathway", CANCER RESEARCH, vol. 67, 2007, pages 6325 - 6332 |
| LODE ET AL., CANCER REV., vol. 58, 1998, pages 2925 - 2928 |
| LONBERG, CURR. OPIN. IMMUNOL., vol. 20, 2008, pages 450 - 459 |
| LONBERG, NAT. BIOTECH., vol. 23, 2005, pages 11 17 - 1125 |
| LYNCH, T. J. ET AL.: "Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib", N ENGL J MCD, vol. 350, 2004, pages 2129 - 2139, XP002447439, DOI: doi:10.1056/NEJMoa040938 |
| LYNN M R GILMOUR ET AL: "Neuregulin expression, function, and signaling in human ovarian cancer cells.", CLINICAL CANCER RESEARCH, vol. 8, no. 12, 1 December 2002 (2002-12-01), pages 3933 - 3942, XP055042596, ISSN: 1078-0432 * |
| MARCHETTI, A.: "EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment", J CLIN ONCOL, vol. 23, 2005, pages 857 - 865, XP002369910, DOI: doi:10.1200/JCO.2005.08.043 |
| MARKS ET AL., J. MOL. BIOL., vol. 222, 1992, pages 581 - 597 |
| MARKS; BRADBURY: "Methods in Molecular Biology", vol. 248, 2003, HUMAN PRESS, pages: 161 - 175 |
| MATHER ET AL., ANNALS N.Y. ACAD. SCI., vol. 383, 1982, pages 44 - 68 |
| MATHER, BIOL. REPROD., vol. 23, 1980, pages 243 - 251 |
| MATSUI, W. ET AL.: "Characterization of clonogenic multiple myeloma cells", BLOOD, vol. 103, 2004, pages 2332 - 2336 |
| MCCAFFERTY ET AL., NATURE, vol. 348, pages 552 - 554 |
| MILSTEIN; CUELLO, NATURE, vol. 305, 1983, pages 537 |
| MOORE ET AL., CYTOTECHNOLOGY, vol. 17, 1995, pages 1 - 11 |
| MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855 |
| MOSMANN, J. IMMUNOL. METH., vol. 65, 1983, pages 55 - 63 |
| MOUSTAFA, A. E. ET AL.: "Expression of P185erbB-2, PI60erbB-3, P180erbB-4, and heregulin alpha in human normal bronchial epithelial and lung cancer cell lines", ANTICANCER RES, vol. 19, 1999, pages 481 - 486 |
| NAGY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 829 - 834 |
| NI, XIANDAI MIANYIXUE, vol. 26, no. 4, 2006, pages 265 - 268 |
| NICOLAOU ET AL., ANGEW. CHEM INTL. ED. ENGL., vol. 33, 1994, pages 183 - 186 |
| NOVAK, A. ET AL.: "Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision", GENESIS, vol. 28, pages 147 - 155, XP055011683, DOI: doi:10.1002/1526-968X(200011/12)28:3/4<147::AID-GENE90>3.0.CO;2-G |
| OKAZAKI ET AL., J. MOL. BIOL., vol. 336, 2004, pages 1239 - 1249 |
| OLIVER, T. G. ET AL.: "Chronic cisplatin treatment promotes enhanced damage repair and tumor progression in a mouse model of lung cancer", GENES DEV, vol. 24, 2010, pages 837 - 852 |
| OSBOURN, METHODS, vol. 36, 2005, pages 61 - 68 |
| OSOL, A.: "Remington's Pharmaceutical Sciences 16th edition,", 1980 |
| PADLAN, MOL. IMMUNOL., vol. 28, 1991, pages 489 - 498 |
| PAEZ, J. G. ET AL.: "EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy", SCIENCE (NEW YORK, NY, vol. 304, 2004, pages 1497 - 1500, XP002359959, DOI: doi:10.1126/science.1099314 |
| PAO, W. ET AL.: "Acquired resistance of lung adcnocarcinomas to gcfitinib or crlotinib is associated with a second mutation in the EGFR kinase domain", PLOS MED, vol. 2, 2005, pages E73 |
| PATEL, N. V. ET AL.: "Neuregulin-1 and human epidermal growth factor receptors 2 and 3 play a role in human lung development in vitro", AMERICAN J OURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY, vol. 22, 2000, pages 432 - 440 |
| PETKOVA, S.B. ET AL., INT'L. IMMUNOL., vol. 18, no. 12, 2006, pages 1759 - 1769 |
| PHILLIPS, T. M. ET AL.: "The response of CD24(-/low)/CD44+ breast cancer-initiating cells to radiation", JOURNAL OF THE NATIONAL CANCER INSTITUTE, vol. 98, 2006, pages 1777 - 1785, XP055025525, DOI: doi:10.1093/jnci/djj495 |
| PLUCKTHUN: "The Pharmacology of Monoclonal Antibodies", vol. 113, 1994, SPRINGER-VERLAG, pages: 269 - 315 |
| PORTOLANO ET AL., J. IMMUNOL., vol. 150, 1993, pages 880 - 887 |
| PRESTA ET AL., CANCER RES., vol. 57, 1997, pages 4593 - 4599 |
| PRESTA ET AL., I. IMMUNOL., vol. 151, 1993, pages 2623 |
| QUEEN ET AL., PROC. NAT'L ACAD. SCI. USA, vol. 86, 1989, pages 10029 - 10033 |
| RAVETCH; KINET, ANNU. REV. IMMUNOL., vol. 9, 1991, pages 457 - 492 |
| REISSMANN, P. T. ET AL.: "Amplification and overexpression of the cyclin D1 and epidermal growth factor receptor genes in non-small-cell lung cancer. Lung Cancer Study Group", J CANCER RES CLIN ONCOL, vol. 125, 1999, pages 61 - 70 |
| RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 329 |
| RIPKA ET AL., ARCH. BIOCHEM. BIOPHYS., vol. 249, 1986, pages 533 - 545 |
| ROSOK ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 22611 - 22618 |
| SCHAEFER, G. ET AL.: "Gamma-heregulin: a novel heregulin isoform that is an autocrine growth factor for the human breast cancer ccll linc, MDA-MB-175", ONCOGENE, vol. 15, 1997, pages 1385 - 1394 |
| SHENG, Q. ET AL.: "An Activated ErbB3/NRGl Autocrine Loop Supports In Vivo Proliferation in Ovarian Cancer Cells", CANCER CELL, vol. 17, 2010, pages 298 - 310, XP002581702, DOI: doi:10.1016/J.CCR.2009.12.047 |
| SHI, D. ET AL.: "Overexpression of the c-erbB-2/neu-encoded p185 protein in primary lung cancer", MOL CARCINOG, vol. 5, 1992, pages 213 - 218 |
| SHIELDS ET AL., J. BIOL. CHEM., vol. 9, no. 2, 2001, pages 6591 - 6604 |
| SHIGEMATSU, H.; LIN, L. ET AL.: "Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers", JOURNAL OF THE NATIONAL CANCER INSTITUTE, vol. 97, 2005, pages 339 - 346 |
| SIDHU, J. MOL. BIOL., vol. 338, no. 2, 2004, pages 299 - 310 |
| SIMS ET AL., J. IMMUNOL., vol. 151, 1993, pages 2296 |
| SINGH, M., LIMA ET AL.: "Assessing therapeutic responses in Kras mutant cancers using genetically engineered mouse models", NAT BIOTECHNOL, vol. 28, 2010, pages 585 - 593 |
| SINNBERG, T. ET AL.: "Inhibition ofPI3K-AKT-mTOR signaling sensitizes melanoma cells to cisplatin and temozolomide", J INVEST DERMATOL, vol. 129, 2009, pages 1500 - 1515, XP055082401, DOI: doi:10.1038/jid.2008.379 |
| SLIWKOWSKI ET AL., JBC, 1994 |
| SRINIVAS VENKATESWARLU ET AL: "Autocrine heregulin generates growth factor independence and blocks apoptosis in colon cancer cells", ONCOGENE 2002 21, 3 January 2002 (2002-01-03), pages 78 - 86, XP055019437, Retrieved from the Internet <URL:http://www.nature.com/onc/journal/v21/n1/pdf/1205011a.pdf> [retrieved on 20120215], DOI: 10.1038/sj/onc/ * |
| SRINIVASAN ET AL: "Expression of the c-erbB-3/HER-3 and c-erbB-4/HER-4 growth factor receptors and their ligands, neuregulin-1 alpha, neuregulin-1 beta, and betacellulin, in normal endometrium and endometrial cancer.", CLINICAL CANCER RESEARCH, vol. 5, no. 10, 1 October 1999 (1999-10-01), pages 2877 - 2883, XP055042607, ISSN: 1078-0432 * |
| STOREY, J. D.; TIBSHIRANI, R.: "Statistical significance for genomewide studies", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 100, pages 9440 - 9445 |
| STRAGLIOTTO, EUR. ./ CANCER, vol. 32A, 1996, pages 636 - 640 |
| TRAUNECKER ET AL., EAIBO J., vol. 10, 1991, pages 3655 |
| TUTT ET AL., J. IMMUNOL., vol. 147, 1991, pages 60 |
| TZAHAR, E. ET AL.: "ErbB-3 and ErbB-4 function as the respective low and high affinity receptors of all Neu differentiation factor/heregulin isoforms", J BIOL CHEM, vol. 269, 1994, pages 25226 - 25233, XP002004421 |
| URLAUB ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4216 |
| VAN DIJK AND VAN DE WINKEL, CURR. OPIN. PHARMACOL., vol. 5, 2001, pages 368 - 74 |
| VITETTA ET AL., SCIENCE, vol. 238, 1987, pages 1098 |
| VOLLMERS; BRANDLEIN, HISTOLOGY AND HISTOPATHOLOGY, vol. 20, no. 3, 2005, pages 927 - 937 |
| VOLLMERS; BRANDLEIN, METHODS AND FINDINGS IN EXPERIMENTAL AND CLINICAL PHARMACOLOGY, vol. 27, no. 3, 2005, pages 185 - 91 |
| WEINER, D. B. ET AL.: "Expression of the neu gene-encoded protein (PI85neu) in human non-small cell carcinomas of the lung", CANCER RESEARCH, vol. 50, 1990, pages 421 - 425 |
| WINTER ET AL., ANN. REV. IMMUNOL., vol. 12, 1994, pages 433 - 455 |
| WRIGHT ET AL., TIBTECH, vol. 15, 1997, pages 26 - 32 |
| YAMANE-OHNUKI ET AL., BIOTECH. BIOENG., vol. 87, 2004, pages 614 |
| YARDEN, Y.; PELES, E.: "Biochemical analysis of the ligand for the neu oncogenic receptor", BIOCHEMISTRY, vol. 30, 1991, pages 3543 - 3550 |
| YAZAKI; WU: "Methods in Molecular Biology", vol. 248, HUMANA PRESS, pages: 255 - 268 |
| YUSTE, L. ET AL.: "Activation of ErbB2 by overexpression or by transmembrane neuregulin results in differential signaling and sensitivity to herceptin", CANCER RESEARCH, vol. 65, 2005, pages 6801 - 6810, XP055042216, DOI: doi:10.1158/0008-5472.CAN-04-4023 |
| ZHANG ET AL., CANCER RES., vol. 65, 2005, pages 3877 - 3882 |
| ZHANG, E. ET AL., PROC NATL ACAD SCI USA, vol. 94, pages 9562 - 9567 |
| ZHOU, B. B. ET AL.: "Targeting ADAM-mediated ligand cleavage to inhibit HER3 and EGFR pathways in non-small cell lung cancer", CANCER CELL, vol. 10, 2006, pages 39 - 50, XP008093928, DOI: doi:10.1016/j.ccr.2006.05.024 |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9828635B2 (en) | 2011-10-06 | 2017-11-28 | Aveo Pharmaceuticals, Inc. | Predicting tumor response to anti-ERBB3 antibodies |
| US10323087B2 (en) | 2013-02-08 | 2019-06-18 | Medical & Biological Laboratories Co., Ltd. | Antibody against human NRG1 protein |
| US9932396B2 (en) | 2013-02-08 | 2018-04-03 | Medical & Biological Laboratories Co., Ltd. | Antibody against human NRG1 protein |
| WO2014123227A1 (ja) * | 2013-02-08 | 2014-08-14 | 株式会社医学生物学研究所 | ヒトnrg1タンパク質に対する抗体 |
| JP2016537965A (ja) * | 2013-10-11 | 2016-12-08 | ジェネンテック, インコーポレイテッド | Nsp4阻害剤及び使用方法 |
| US10246519B2 (en) | 2013-10-11 | 2019-04-02 | Genentech, Inc. | NSP4 inhibitors and methods of use |
| US11584793B2 (en) | 2015-06-24 | 2023-02-21 | Hoffmann-La Roche Inc. | Anti-transferrin receptor antibodies with tailored affinity |
| US12252533B2 (en) | 2015-06-24 | 2025-03-18 | Hoffmann-La Roche Inc. | Anti-transferrin receptor antibodies with tailored affinity |
| US11603411B2 (en) | 2015-10-02 | 2023-03-14 | Hoffmann-La Roche Inc. | Bispecific anti-human CD20/human transferrin receptor antibodies and methods of use |
| US11787868B2 (en) | 2015-10-02 | 2023-10-17 | Hoffmann-La Roche Inc. | Bispecific anti-human A-beta/human transferrin receptor antibodies and methods of use |
| US12030952B2 (en) | 2015-10-02 | 2024-07-09 | Hoffmann-La Roche Inc. | Bispecific anti-human CD20/human transferrin receptor antibodies and methods of use |
| US12358997B1 (en) | 2015-10-02 | 2025-07-15 | Hoffmann-La Roche Inc. | Bispecific anti-human A-beta/anti-human transferrin receptor antibodies |
| WO2017072150A1 (en) * | 2015-10-27 | 2017-05-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-nrg1 (heregulin) antibodies and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2744824A1 (en) | 2014-06-25 |
| CA2842375A1 (en) | 2013-02-21 |
| KR20140057326A (ko) | 2014-05-12 |
| BR112014003431A2 (pt) | 2017-06-13 |
| CN103890007A (zh) | 2014-06-25 |
| JP2014526891A (ja) | 2014-10-09 |
| US20140363438A1 (en) | 2014-12-11 |
| MX2014001766A (es) | 2014-05-01 |
| RU2014109093A (ru) | 2015-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9556249B2 (en) | Neuregulin antagonists and use thereof in treating cancer | |
| RU2577986C2 (ru) | Антитела против axl и способы их применения | |
| US20140363438A1 (en) | Neuregulin antibodies and uses thereof | |
| TWI658052B (zh) | 抗-rspo抗體及使用方法 | |
| US20210369841A1 (en) | Anti-rspo3 antibodies and methods of use | |
| HK1179997B (en) | Neuregulin antagonists and use thereof in treating cancer | |
| HK1194080A (en) | Neuregulin antibodies and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12751691 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2842375 Country of ref document: CA |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012751691 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012751691 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/001766 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2014526192 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20147006579 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014109093 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14239229 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014003431 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112014003431 Country of ref document: BR |
|
| ENPW | Started to enter national phase and was withdrawn or failed for other reasons |
Ref document number: 112014003431 Country of ref document: BR |