WO2013024243A1 - Inhibitors against endosomal/lysosomal enzymes - Google Patents
Inhibitors against endosomal/lysosomal enzymes Download PDFInfo
- Publication number
- WO2013024243A1 WO2013024243A1 PCT/GB2012/000660 GB2012000660W WO2013024243A1 WO 2013024243 A1 WO2013024243 A1 WO 2013024243A1 GB 2012000660 W GB2012000660 W GB 2012000660W WO 2013024243 A1 WO2013024243 A1 WO 2013024243A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protease inhibitor
- cystatin
- conjugate
- inhibitor according
- pepstatin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/8139—Cysteine protease (E.C. 3.4.22) inhibitors, e.g. cystatin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/66—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/55—Protease inhibitors
- A61K38/57—Protease inhibitors from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
- A61K38/1808—Epidermal growth factor [EGF] urogastrone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/8142—Aspartate protease (E.C. 3.4.23) inhibitors, e.g. HIV protease inhibitors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55516—Proteins; Peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to a multi-functional protease inhibitor, which may be conjugated to various molecules.
- the present invention also relates to uses of the protease inhibitor and conjugates thereof.
- Protease inhibitors have emerged as a powerful drug class 1 . They include the inhibitors of angiotensin converting enzyme, inhibitors of HIV proteases and proteasomal inhibitors such as Bortezomib (Velcade) used to treat multiple myeloma 2 .
- angiotensin converting enzyme inhibitors of HIV proteases
- proteasomal inhibitors such as Bortezomib (Velcade) used to treat multiple myeloma 2 .
- proteases of the endo-lysosomal pathway have frequently been proposed as therapeutic targets as they play important roles in the regulation of a wide variety of biological systems 3 .
- lysosomal cysteine and aspartyl proteases are validated drug targets in several trypanosome species 4 and the upregulation of certain endosomal proteases is associated with increased malignancy 5 .
- Asparagine endopeptidase (AEP or Iegumain) has also been implicated in the progression of malignant melanoma 6 , in the destruction of the therapeutic drug l-asparaginase and in neuroexitotoxity 7 .
- cystatins which are natural cysteine protease inhibitors
- cystatins which are natural cysteine protease inhibitors
- High expression of Cathepsin D (Cat D) in non-Hodgkin's lymphoma has also been associated with increased malignancy 10 and is also associated with poor prognosis in breast cancer 11 .
- a further potential therapeutic application of endosomal protease inhibitors would be immune modulation since several recent studies demonstrate that the proteolytic activity in endosomes of antigen presenting cells may be too high leading to antigen destruction and inefficient presentation to T-cells. Consequently, protease resistant antigens often elicit more robust immune responses 12,13 .
- endosomai proteases belong to 3 distinct families: There are several papain-like cysteine proteases (PLCPs), including cathepsin L,S,B,C and several others 16 . Alongside these there are the aspartyl proteases related to pepsin; cathepsins D and E. Finally, there is an additional cysteine protease termed asparaginyl endopeptidase (AEP) or legumain which is more closely related to the caspases 17 . Each of these 3 classes can be inhibited by distinct and non-overlapping small molecule inhibitors 18 , but in vivo inhibition, or knock-out, of these proteases frequently shows limited or no phenotype most likely due to functional redundancy. We thus postulated that inhibiting all three families of endosomai proteases in an endosome-specific manner would provide a powerful tool for modulating endo/lysosomal function.
- PLCPs papain-like cysteine proteases
- cystatin C a naturally occurring 14 kDa protein
- the cystatins are a family of small proteins, that inhibit PLCPs with sub- nanomolar affinity 19 . They are present in the bloodstream and are believed to play a role in the mopping up of proteases released during physiological and pathological responses.
- cystatin C, as well as several family members inhibit AEP via a distinct binding site with a Ki of 0.20 n 20 ( Figure 1 ).
- cystatin C thus represents an excellent scaffold for the synthesis of a pan-endosomal protease inhibitor.
- Cathepsin D and E the endosomai aspartyl proteases are inhibited with a Ki of 0.1 nM by pepstatin A 21 , an isopeptide first isolated from Actinomyces.
- pepstatin A 21 an isopeptide first isolated from Actinomyces.
- Its major drawback is its virtual insolubility in aqueous media 21 . Nonetheless it is still widely used even in cell based assays because more soluble alternatives are not readily available.
- Several attempts have been made to address this problem such as conjugating pepstatin A to asialoglycoprotein(ASGP) 22 , or to poly(ethylene glycol) 23 , or more recently to directly mannosylate it, or conjugate it to mannosylated bovine serum albumin 24 .
- the present invention is based in part on the provision of a cysteine protease inhibitor/aspartyl protease inhibitor conjugate, which displays multi-functional protease inhibition activity.
- a multi-functional protease inhibitor comprising a cystatin/pepstatin A conjugate.
- the present inventors have observed that it is possible through conjugating pepstatin A (which on its own is very insoluble) to a cystatin, such as cystatin C, to form a highly water-soluble molecule.
- a conjugate displays inhibitory activity against at least two of the following classes of proteases: cysteine proteinases, aspartyl proteinases; and/or asparaginyl endopeptidases (AEP).
- the term multi-functional is understood to mean that the conjugates of the present invention have an inhibitory activity against at least two enzymatically distinct proteases, such as at one cysteine proteinase, and one aspartyl proteinase and/or asparaginyl endopeptidase, with inhibitory constants of smaller than 10 ⁇
- the cystatins have evolved to inhibit multiple cysteine proteases thus while only one protease molecule (and one AEP) can be engaged at any one time, they are broadly suppressive of this class of proteases.
- the present inventors have been able to provide conjugates which are significantly soluble in aqueous solution with solubility greater than 50 nM, but typically greater than 500nM, such as in the order of 1 ⁇ in aqueous buffer in the pH range of 3 - 10, such as 4 - 8, or water itself.
- This may be achieved by incorporation of a peptide moiety between the cystatin molecule and pepstatin A.
- any solubilising peptide may be 2 to 30 amino acids in length and should be sufficiently hydrophilic to solubilise hydrophobic inhibitor components.
- the peptide may also allow for the conjugate to be targeted to desired tissues, cells and the like.
- the peptide itself may conventionally be a targeting peptide known in the art, or the peptide may be capable, through further modification, of incorporating one or more targeting moieties.
- the peptide moiety is >4 amino acid residues long and contains at least 2 amino acids with side chains that possess charges at neutral pH, and/or have hydrophilic and/or polar side chains.
- the peptide may comprise one or more amino acid residues that do not affect the ability of the conjugate to inhibit proteases, for example amino acids that possess negative charges at neutral pH, or those possessing hydroxyl or carboxylic acid side chains.
- Unnatural amino acids for example those that carry azido or alkyne functionality in their side chain may be employed, such as those that can be further modified by additional chemical or enzymatic reactions, for example by copper-catalyzed Huisgen cyclo-addition reactions or using sortase enzymes 26 .
- Reactive side chains on the peptides and/or modified residues may facilitate co-conjugation of the inhibitor to another moiety, such as a targeting protein, thereby facilitating the delivery to specific cell types and tissues (see text and Figure 8, for example, for further details).
- solubilising tag is the FLAG-tag 27 , but other peptides can be used.
- conjugation of cystatin to pepstatin A may be through a cysteine present on the cystatin molecule, or the cystatin may be modified, through mutagenesis techniques known to the skilled addressee, in order to introduce a cysteine moiety which is capable of facilitating conjugation to pepstatin A, optionally via a solubilising peptide. Modification through lysines, or through unnatural amino acids introduced by methods known to the skilled addressee are also possible 28 .
- the skilled addressee is able to determine which residues may be appropriate whilst ensuring that protease inhibitory activity of the cystatin molecule will remain substantially unchanged, by biochemical means, or by comparing sequence analogies to known cystatins, or by determining location of the inhibitory motifs and of the chosen residues in a protein X- ray crystal structure.
- the cystatin is cystatin C and a preferred residue to allow conjugation of pepstatin A is threonine 102, or arginine 77, or Leucine 117, as numbered according to GenBank: CAA36497.1 , which may be replaced with a cysteine residue, which is subsequently capable of reaction, so as to allow conjugation to pepstatin A, preferably via a solubilising peptide.
- Modification of the identified residue may be carried out, through site directed mutagenesis, for example, in order to replace the residue with a more reactive residue, such as a cysteine or azidohomoalanine, which allows conjugation to pepstatin A.
- cystatin family inhibitors can also be used that have different inhibitory profiles for the different proteases. For example binding regions of cystatin C can be mutated so that the inhibition of specific proteases or families is reduced or altered 29 . Further, the latent cystatin, cystatin F can also be used whose PLCP reactivity is only revealed (by dimer to monomer conversion) following uptake into cells 30 .
- the present invention provides a pharmaceutical composition
- a pharmaceutical composition comprising a protease inhibitor conjugate molecule of the present invention, together with a pharmaceutically acceptable carrier therefore.
- the invention provides a conjugate or formulation of the first or second aspect, or physiologically acceptable salt, solvate, ester, amide or other physiologically functional derivative thereof, for use in medicine.
- the invention provides a conjugate of the invention, or physiologically acceptable salt, solvate, ester, amide or other physiologically functional derivative thereof, for the treatment or prophylaxis of a disease, particularly where it is desirable to inhibit proteases which may be associated with a particular disease or where there inhibition may facilitate the treatment of a disease.
- diseases may include cancer, inflammatory disease, autoimmune diseases, parasitic disease e.g Trypanosomiasis and relevant lysosomal storage diseases, such as galactosialidosis, Gaucher's disease 3 , and others.
- the invention provides a method of treatment or prophylaxis of a disease/condition associated with protease expression and/or function said method comprising administering a therapeutically or prophylactically useful amount of a conjugate of the invention, or physiologically acceptable salt, solvate, ester, amide or other physiologically functional derivative thereof, or a pharmaceutical formulation of the present invention, to a subject in need thereof.
- the invention provides use of a conjugate of the invention, or physiologically acceptable salt, solvate, ester, amide or other physiologically functional derivative thereof, in the manufacture of a medicament for use in any treatment or prophylaxis as defined herein.
- the conjugates/inhibitors of the invention may be used to enhance the performance of vaccines specifically by attenuating their known tendency to be unproductively or destructively processed (references 12 & 13).
- the conjugates of the invention may also be administered in conjunction with other agents, such as other therapeutic agents or may be a component of a vaccine and administered in conjunction with immunogenic agents.
- other therapeutic agents include subunit or peptide vaccines with appropriate adjuvants, such as solid phase or emulsion carriers, immune system adjuvants and other agents to improve the vaccine response.
- the conjugate can also be added to live cell vaccines for the aim of improving the efficacy thereof.
- the two or more treatments may be given individually varying dose schedules and/or via different routes.
- Admixtures of the conjugate and vaccine protein optionally also with adjuvant can be co-encapsulated for example in PLGA microspheres, liposomes or other carriers for delivery purposes.
- the inhibitor when administered topically in combination with growth factors, such as, but not limited to EGF, may aid the natural process of wound healing.
- a therapeutic or prophylactic agent with a conjugate of the present invention would be at the discretion of the physician who would select dosages using his common general knowledge and dosing regimens known to a skilled practitioner.
- a conjugate of the invention is administered in combination therapy with one, two, three, four or more, preferably one or two, preferably one other therapeutic/prophylactic agents
- the components can be administered simultaneously or sequentially.
- they can be administered at closely spaced intervals (for example over a period of 5-10 minutes) or at longer intervals (for example 1 , 2, 3, 4 or more hours apart, or even longer period apart where required), the precise dosage regimen being commensurate with the properties of the therapeutic agent(s).
- the patient is typically an animal, e.g. a mammal, especially a human.
- a therapeutically or prophylactically effective amount is meant one capable of achieving the desired response, and will be adjudged, typically, by a medical practitioner.
- the amount required will depend upon one or more of at least the active conjugate(s) concerned, the patient, the condition it is desired to treat or prevent and the formulation of order of from 1 pg to 1 g of conjugate per kg of body weight of the patient being treated.
- Different dosing regiments may likewise be administered, again typically at the discretion of the medical practitioner.
- the low toxicity of the compounds of the invention and their targetability to specific cell types allow for at least daily administration although regimes where the compound(s) is (or are) administered more infrequently, e.g. every other day, weekly or fortnightly, for example, are also embraced by the present invention.
- treatment is meant herein at least an amelioration of a condition suffered by a patient; the treatment need not be curative (i.e. resulting in obviation of the condition).
- Analogously references herein to prevention or prophylaxis herein do not indicate or require complete prevention of a condition; its manifestation may instead be reduced or delayed via prophylaxis or prevention according to the present invention.
- the conjugates or physiologically acceptable salt, solvate, ester or other physiologically acceptable functional derivative thereof described herein may be presented as a pharmaceutical formulation, comprising the conjugate or physiologically acceptable salt, ester or other physiologically functional derivative thereof, together with one or more pharmaceutically acceptable carriers therefor and optionally other therapeutic and/or prophylactic ingredients.
- Any carrier(s) are acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
- physiologically acceptable salts of the conjugates according to the invention include acid addition salts formed with organic carboxylic acids such as acetic, lactic, tartaric, maleic, citric, pyruvic, oxalic, fumaric, oxaloacetic, isethionic, lactobionic and succinic acids; organic sulfonic acids such as methanesulfonic, ethanesulfonic, benzenesulfonic and p-toluenesulfonic acids and inorganic acids such as hydrochloric, sulfuric, phosphoric and sulfamic acids.
- organic carboxylic acids such as acetic, lactic, tartaric, maleic, citric, pyruvic, oxalic, fumaric, oxaloacetic, isethionic, lactobionic and succinic acids
- organic sulfonic acids such as methanesulfonic, ethanesulfonic, benzenesul
- Physiologically functional derivatives of compounds of the present invention are derivatives, which can be converted in the body into the parent conjugate. Such physiologically functional derivatives may also be referred to as "pro-drugs” or “bioprecursors”.
- Physiologically functional derivatives of conjugates of the present invention include hydrolysable esters or amides, particularly esters, in vivo. Determination of suitable physiologically acceptable esters and amides is well within the skills of those skilled in the art.
- solvate is used herein to refer to a complex of solute, such as a compound or salt of the compound, and a solvent. If the solvent is water, the solvate may be termed a hydrate, for example a mono-hydrate, di-hydrate, tri-hydrate etc, depending on the number of water molecules present per molecule of substrate.
- conjugates of the present invention may exist in various stereoisomeric forms and the compounds of the present invention as hereinbefore defined include all stereoisomeric forms and mixtures thereof, including enantiomers and racemic mixtures.
- the present invention includes within its scope the use of any such stereoisomeric form or mixture of stereoisomers.
- the conjugates of the present invention may be prepared using reagents and techniques readily available in the art and/or exemplary methods as described hereinafter.
- compositions include those suitable for oral, topical (including dermal, buccal and sublingual), rectal or parenteral (including subcutaneous, intradermal, intramuscular and intravenous), nasal and pulmonary administration e.g., by inhalation.
- the formulation may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. Methods typically include the step of bringing into association an active conjugate with liquid carriers or finely divided solid carriers or both and then, if necessary, shaping the product into the desired formulation.
- compositions suitable for oral administration wherein the carrier is a solid are most preferably presented as unit dose formulations such as boluses, capsules or tablets each containing a predetermined amount of active compound.
- a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine an active compound in a free-flowing form such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, lubricating agent, surface-active agent or dispersing agent.
- Moulded tablets may be made by moulding an active conjugate with an inert liquid diluent. Tablets may be optionally coated and, if uncoated, may optionally be scored.
- Capsules may be prepared by filling an active conjugate, either alone or in admixture with one or more accessory ingredients, into the capsule shells and then sealing them in the usual manner.
- Cachets are analogous to capsules wherein an active compound together with any accessory ingredient(s) is sealed in a rice paper envelope.
- An active compound may also be formulated as dispersible granules, which may for example be suspended in water before administration, or sprinkled on food. The granules may be packaged, e.g., in a sachet.
- Formulations suitable for oral administration wherein the carrier is a liquid may be presented as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water liquid emulsion.
- Formulations for oral administration include controlled release dosage forms, e.g., tablets wherein an active conjugate is formulated in an appropriate release-controlling matrix, or is coated with a suitable release-controlling film. Such formulations may be particularly convenient for prophylactic use.
- compositions suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories.
- Suitable carriers include cocoa butter and other materials commonly used in the art.
- the suppositories may be conveniently formed by admixture of an active conjugate with the softened or melted carrier(s) followed by chilling and shaping in moulds.
- compositions suitable for parenteral administration include sterile solutions or suspensions of an active conjugate in aqueous or oleaginous vehicles.
- Injectible preparations may be adapted for bolus injection or continuous infusion. Such preparations are conveniently presented in unit dose or multi-dose containers which are sealed after introduction of the formulation until required for use.
- an active conjugate may be in powder form which is constituted with a suitable vehicle, such as sterile, pyrogen-free water, before use.
- An active conjugate may also be formulated as long-acting depot preparations, which may be administered by intramuscular injection or by implantation, e.g., subcutaneously or intramuscularly.
- Depot preparations may include, for example, suitable polymeric or hydrophobic materials, or ion-exchange resins. Such long-acting formulations are particularly convenient for prophylactic use.
- Formulations suitable for pulmonary administration via the buccal cavity are presented such that particles containing an active compound and desirably having a diameter in the range of 0.5 to 7 microns are delivered in the bronchial tree of the recipient.
- such formulations are in the form of finely comminuted powders which may conveniently be presented either in a pierceable capsule, suitably of, for example, gelatin, for use in an inhalation device, or alternatively as a self-propelling formulation comprising an active compound, a suitable liquid or gaseous propellant and optionally other ingredients such as a surfactant and/or a solid diluent.
- suitable liquid propellants include propane and the chlorofluorocarbons
- suitable gaseous propellants include carbon dioxide.
- Self-propelling formulations may also be employed wherein an active conjugate is dispensed in the form of droplets of solution or suspension.
- Such self-propelling formulations are analogous to those known in the art and may be prepared by established procedures. Suitably they are presented in a container provided with either a manually-operable or automatically functioning valve having the desired spray characteristics; advantageously the valve is of a metered type delivering a fixed volume, for example, 25 to 100 microlitres, upon each operation thereof.
- an active compound may be in the form of a solution or suspension for use in an atomizer or nebuliser whereby an accelerated airstream or ultrasonic agitation is employed to produce a fine droplet mist for inhalation.
- Formulations suitable for nasal administration include preparations generally similar to those described above for pulmonary administration. When dispensed such formulations should desirably have a particle diameter in the range 10 to 200 microns to enable retention in the nasal cavity; this may be achieved by, as appropriate, use of a powder of a suitable particle size or choice of an appropriate valve. Other suitable formulations include coarse powders having a particle diameter in the range 20 to 500 microns, for administration by rapid inhalation through the nasal passage from a container held close up to the nose, and nasal drops comprising 0.2 to 5% w/v of an active conjugate in aqueous or oily solution or suspension.
- the pharmaceutical formulations described above may include, an appropriate one or more additional carrier ingredients such as diluents, buffers, flavouring agents, binders, surface active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like, and substances included for the purpose of rendering the formulation isotonic with the blood of the intended recipient.
- additional carrier ingredients such as diluents, buffers, flavouring agents, binders, surface active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like, and substances included for the purpose of rendering the formulation isotonic with the blood of the intended recipient.
- Pharmaceutically acceptable carriers are well known to those skilled in the art and include, but are not limited to, 0.1 M and preferably 0.05 M phosphate buffer or 0.8% saline. Additionally, pharmaceutically acceptable carriers may be aqueous or nonaqueous solutions, suspensions, and emulsions.
- non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
- Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like.
- Formulations suitable for topical formulation may be provided for example as gels, creams or ointments. Such preparations may be applied e.g. to a wound or ulcer either directly spread upon the surface of the wound or ulcer or carried on a suitable support such as a bandage, gauze, mesh or the like which may be applied to and over the area to be treated.
- Liquid or powder formulations may also be provided which can be sprayed or sprinkled directly onto the site to be treated, e.g. a wound or ulcer.
- a carrier such as a bandage, gauze, mesh or the like can be sprayed or sprinkle with the formulation and then applied to the site to be treated.
- Therapeutic formulations for veterinary use may conveniently be in either powder or liquid concentrate form.
- conventional water soluble excipients such as lactose or sucrose, may be incorporated in the powders to improve their physical properties.
- suitable powders of this invention comprise 50 to 100% w/w and preferably 60 to 80% w/w of the active ingredient(s) and 0 to 50% w/w and preferably 20 to 40% w/w of conventional veterinary excipients.
- These powders may either be added to animal feedstuffs, for example by way of an intermediate premix, or diluted in animal drinking water.
- Liquid concentrates of this invention suitably contain the conjugate or a derivative or salt thereof and may optionally include a veterinarily acceptable water-miscible solvent, for example polyethylene glycol, propylene glycol, glycerol, glycerol formal or such a solvent mixed with up to 30% v/v of ethanol.
- a veterinarily acceptable water-miscible solvent for example polyethylene glycol, propylene glycol, glycerol, glycerol formal or such a solvent mixed with up to 30% v/v of ethanol.
- the liquid concentrates may be administered to the drinking water of animals.
- Figure 1a shows a representation of a cystatin-pepstatin conjugate as a potential inhibitor (CPI) of all 3 major endosomal protease families: the papain-like cysteine proteases (PLCP), aspartyl proteases (Cat-D/E) and asparagine endopeptidase;
- CPI potential inhibitor
- Figure 1b identifies three different cystatin mutants which were tested. Mutation sites were picked for solvent accessibility, as well as for their location, with residues which are part of the inhibitory motifs (as highlighted by the dashed circles), excluded. Three mutations where chosen, one on a b-sheet (R77C), one on an a-helix (L117C) and on a non-structured loop region of the protein (T102C).
- Figure 1c shows relative inhibitory rates of the three mutants as determined by serial dilution of the various cystatin C mutants (concentration in mM) in presence of 5 ng of Cathepsin L well.
- Figure 2a shows 4 preferred cystatin-pepstatin conjugates as a potential inhibitor (CPI) of all 3 major endosomal protease families: the papain-like cysteine proteases (PLCP), aspartyl proteases (Cat-D/E) and asparagine endopeptidase.
- CPI potential inhibitor
- Figure 2b shows the mass spectrometric data of conjugates 4, 5, and 6, as well as a Western blot analysis with anti-FLAG 27 antibody of conjugate 7.
- Figures 3 shows the results of inhibition of proteases: 1-3: inhibition of recombinant cath L (PLCP), AEP, and cath D (aspartyl protease) by cystatin C (red), pepstatin (blue) or the CPI (black). 4-6: Inhibition of these same enzymes in the lysates of dendritic cells as measured by turnover of fluorescent substrates. 7: test of residual post-lysis protease activity after feeding of the inhibitors to live dendritic cells. 8: residual protease activity in live immune cells after feeding of the constructs as measured using a quenched fluorophoric casein substrate.
- Figure 4 shows inhibition of degradation of apo-HRP by macrophage lysosomal proteins. PBS, nor pepstatin A warrant protection. Cystatin C appears to protect a fragment only. The CPI protects the unstable antigen back to the level of wild-type HRP.
- FIG. 5a CPI arrests EGF receptor downregulation and sustains signalling.
- A COS7 cells were stimulated with EGF for up to 90 mins following a pre-incubation with or without either CPI or human cystatin C ( ⁇ 0.35mg/ml). The downregulation of the EGF receptor (top panel) was assayed by Western blotting along with levels of phospho-Erk1/2 (p42/44 MAP kinase; middle panel) and Rsk2 to assess total cellular protein loading.
- B Quantitation of data shown in A
- Figure 5b shows the effect of the CPI on the lifetime of the EGF-EGFR complex in cells upon stimulation with EGF. It can be observed by confocal microscopy that the EGFR receptor breakdown is retarded in presence of the inhibitor.
- Figure 6a shows the determination of the loading levels of Ovalbumin and cystatin c on iron oxide adjuvant. Equal amounts of modified iron oxide were analysed by Western blot against cystatin C and Ovalbumin. Three different concentrations of Ovalbumin were loaded together with a fixed amount of cystatin c, pepstatin A or a cystatin-peptstatin inhibitor.
- Figure 6b shows the responses of OT-I (top) and OT-II (bottom) T-cells to dendritic cells incubated with constructs carrying three different amounts of Ovalbumin, as determined in figure 6a with or without protease inhibitor.
- Figure 6c shows the improved antigen presentation on class I MHC (cross- presentation) by co-encapsulation of antigen with CPI.
- PLGA microspheres were titrated in 96-well plates and ovalbumin presentation measured by the addition of murine bone marrow derived dendritic cells (-5 x 10 4 /well) and OTI T cells (-5 x 10 2 /well).
- T cell proliferation was measured by addition of 1 Ci 3H- thymidine. Cells were harvested 16 hours later and 3 H incorporation measured by scintillation counting. Alternatively
- an aliquot of the supernatant was removed after 72 hours and IL-2 production measured by standard ELISA assay.
- Figure 6d shows the Improved antigen presentation on class II MHC by co- capsulation of antigen with CPI. Conditions similar to those in Figure 6c except that OTII (class II MHC restricted) T cells were used instead of OTI.
- OTII class II MHC restricted
- Figure 6e shows the improved presentation of the ovalbumin antigen in vivo by co-encapsulation with CPI.
- C57BL/6 mice were immunised with different varieties of ovalbumin-containing PLGA microspheres and were additionally loaded with CFSE labelled T cells, (see Methods outline).
- CFSE labelled T cells As a positive control ovalbumin was admixed with the strong adjuvant alum. T cell proliferation was subsequently measured by CFSE dilution in the lymph nodes draining the site of injection (sub-cut. base of tail).
- T cells were also stained with anti-CD8 antibodies to distinguish OT1 from OTII cells, (i) Leftmost panels show raw FACS data while centre and right panels show histograms of T cell numbers at different cell doublings for OTI (centre) and OTII (right), (ii) total accumulated T cells by integration of cell doubling data.
- the data reveal a hierarchy of expansion for both OT1 and OTII. As expected Ova/Alum promoted the strongest expansion while Ova/CPI PLGA promoted stronger expansion than Ova PLG.
- Figure 7 Inhibition of cysteine protease activity and aspartyl protease activity in T. brucei cell lysates as determined using substrates specific for either cathepsin B/L/S like activity or cathepsin D/E like activity.
- Figure 8 Shows some constructs that can be used for linking the protease inhibitor to another moiety, for example a targeting group, or a complex with a targeting group.
- Ovalbumin was purchased from Sigma-Aldrich (A5503), or Worthingtons (LS3056; In vitro digest), Cystatin C from Genway (11-511-248839). Bovine serum albumin and Myoglobin (from horse-heart) were purchased from Sigma-Aldrich. antiOOvalbumin was obtained from Polysciences (2344-5) Anti-5His was purchased from Quiagen (34660), antiOCystatin C (mAb1196) and recombinant cathepsins came from R&D systems. Pepstatin A and fluorescent substrates were purchased from Bachem. NBoc-l-Cysteine Methanethiosulfonate was purchased from Toronto Research Chemicals (B646250). Cloning and Expression of Cystatin C - T102C - 6His mutant
- the Cystatin C was amplified as described previously 1 using the following primers: CysCFor (caggattacaattggtaccatggccgggccc) and CysCRev (gcctactcgagcttaatgatgatgatgatgatggtcctgacag) to introduce a C-terminal 6-Histidine tag.
- the amplification product was cloned into a pcDNA-DHFR vector used previously 2 between Xhol and Kpnl restriction sites.
- Threonine 102 was determined to be solvent accessible using the NAccess software 3 based on the crystal structure of human Cystatin C 4 and domain-swapped human Cystatin C 5 . It was also a residue away from the inhibitory motifs of both the papain-like Cathepsins and asparagine endopeptidase 6 .
- DHFR-negative CHO cells were grown in DME -based medium containing 10% dialysed FCS, 5 mM Glutamine and 0.1 mM hypoxanthine and 0.01 mM thymidine.
- the hypoxanthine and thymidine supplement were removed and the cells were cultured at low density in 15 cm dishes (104 cells per dish) in medium containing 20 nM methotrexate (MTX). After 2 days the medium was replaced by medium containing 50 mM MTX.
- the cells were grown at 5% CO2 at 37° C for a further 2 days upon which single colonies had begun to form. These were picked and placed in a 96-well plate (tissue culture treated) in medium containing 100 nM methotrexate.
- the colonies were assessed for Cystatin C expression levels using an anti- Cystatin C antibody MAB1196 (R&D Systems, mouse anti-Human CysC; 1 :3000 dilutions) and the highest producing clones were harvested and transferred to a 24-well dish. Here they were allowed to grow to 80% confluency prior to the addition of medium containing increasing amounts of MTX (up to 2 mM). At the final MTX-concentration one clone (SvKD2-25-A7) was selected for large-scale production of Cystatin C.
- This clone was grown to confluency in 10 225 cm 2 tissue culture flasks in medium containing 2 mM MTX. The cells were incubated at 37 degrees for 2 weeks prior to harvest of the supernatant. The pH of the supernatant (2 L) was adjusted to 8.0 and NaCI was added to a final concentration of 250 mM. The supernatant was filtered through a 0.22 pm filter prior to passing it over 6 mL of NiNTA agarose (Quiagen) at 4° C. The resin was washed with 10 column volumes of 50 mM NaP0 , 300 mM NaCI (pH 8.3) and 5 column volumes of the same buffer containing 5 mM imidazole. The bound protein was eluted by gently shaking the agarose with 2 x 8 mL of 500 mM imidazole containing buffer followed by elution.
- Pepstatin 147 mg, 0.21 mmol was dissolved in DMF (15 mL). N-Hydroxysuccinimide (217 mg, 1.4 mmol) and 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (323 mg, 1.7 mmol) were added and the mixture was stirred at room temperature for 23 hours.
- DTT was added to a solution of Cystatin C-T102C-6His (1 mg/mL in PBS, 2.5 mL) to a final concentration of 20 mM.
- the mixture was gently shaken at room temperature for 15 minutes and buffer exchanged into phosphate buffer (pH 8.5, 100 mM Phosphate, 300 mM NaCI) by Sephadex G-25 resin (GE Healthcare).
- phosphate buffer pH 8.5, 100 mM Phosphate, 300 mM NaCI
- Sephadex G-25 resin GE Healthcare
- To the reduced protein 50 uM 3.5 mL was added a solution of 3 in DMSO (2 mM, 4 x 50 pL) in 4 portions at 1 hour intervals.
- the modified protein was purified by 6His-affinity chromatography, followed by dialysis (PBS, 6000-8000 MWCO, 3 x 4L).
- brucei promastigotes were homogenised in a glass homogeniser in 16 mL of citrate buffer (200 mM, pH 5.5). The cells were lysed by repeated freeze/thaw cycles (6 cycles). The supernatant was cleared by centrifugation at 18,000 g for 30 minutes. The cleared supernatant had a protein concentration of 5 mg/mL. 20 pg of lysate was used as protease source in the same inhibition assays as for the recombinant proteases.
- Lysosomes isolated from bone-marrow derived macrophages using a Percoll density- gradient fractionation 400 ng/pL, 10 pL were resuspended in assay buffer (100 mM Citrate, 2 mM DTT, pH 4.5, 0.5% v/v triton X-100; 590 pL). 50 pL of this diluted lysosomal suspension was plated in triplicates in a 96-well flat-bottomed plate. 10 pL of either cystatin, pepstatin of CPI (3 ⁇ final concentration) was added to each set of three wells with PBS as a control.
- A20 cells (5x10 6 /ml_; 100 pL/well) were plated in a 96-well plate. Inhibitors (28 ⁇ in PBS + 1% DMSO; 50 pL) were added to each wells and the cells were incubated at 37°C, 5% C0 2 for 30 minutes.
- Enzchek (Invitrogen, catalog number E6638, 20 pg/mL in DMEM + 10% FCS) was added and the fluorescence emergence (excitation 485nm; emission 530nm) was measured every hour on a fluorescent plate reader at 37 °C. Rates of fluorescence emergence were plotted for each of the inhibitors.
- Lysosomes isolated from bone-marrow derived macrophages using a Percoll density-gradient fractionation 400 ng/ ⁇ ., 3.6 ⁇ _ were resuspended in assay buffer (50 mM Citrate, pH 4.5, 0.5% Triton X-100; 59 ⁇ ).
- Inhibitor 70 ⁇ ; 12 ⁇ in PBS +5% DMSO was added and the mixture incubated for 15 minutes.
- Protein substrate (1 mg/mL in PBS, 9 ⁇ ) was added to the mixture and the reaction was incubated at 37 °C. At the indicated timepoints 20 ⁇ of the reaction mixture was removed and boiled with LDS-sample buffer and analysed by SDS-PAGE.
- COS7 cells growing in 12-well tissue culture plates were preincubated for 1 hour with or without cystatin C (0.35mg/ml) or CPI (0.32 mg/ml) and then stimulated with 100ng/ml EGF for the times shown.
- the cells were scraped from the well in 50 ⁇ lysis buffer containing 50m Tris, 150mM NaCI, 1mM EGTA, 1mM EDTA, 1% NP40 plus protease inhibitors (Roche, iniprotease tablet). Aliquots were heated in SDS sample buffer and run on a 4 x 12% MOPS % gel (Invitrogen).
- EGF receptor After transfer to Hybond ECL membrane EGF receptor was revealed with a rabbit anti-EGF receptor antibody (Santa Cruz) followed by peroxidase conjugated donkey anti-rabbit (Jackson) and a standard ECL protocol ( illipore). The blot was then stripped and reprobed for phosphor-Erk (p42/44 MAP kinase; Cell signalling) and as as loading control, Rsk2 (Santa Cruz) with appropriate secondary antibodies. The signals were quantitated using ImageJ analysis software.
- IF was performed according to standard protocols.
- fluorescent substrate processing Enzchek, vide infra
- murine A20 B-cell blasts were grown on coverslips and incubated wit enzchek (1 pg/mL final concentration) in presence or absence of protease inhibitors as indicated (20 ⁇ ) for 5 hours under standard growth conditions.
- cells were fixed with 3.7% paraformaldehyde in PBS, Triton X-100 permeabilized (0.1% in PBS), and immunostained against CD63, visualized using an anti-mouse secondary antibody-Alexa 647 conjugate on a Leica SP-2 confocal microscope using a 63x magnification objective.
- HeLa cells were grown on coverslips and serum starved in the absence or presence of CPI (20 ⁇ ; 0.1% PCS in D E -PBS 1:1 ) and stimulated with EGF (100 ng/mL final concentration) for 5 or 90 minutes. Samples were prepared as previously described. All images were collected using a Leica SP-2 confocal microscope equipped with a 63x magnification objective. Post-image processing and data analysis were performed using ImageJ. Image quantification was based on 25-50 cells per condition per experiment and significance was calculated using a standard Student's T-test.
- a vaccine construct was synthesized by conjugating both the model antigen ovalbumin and an inhibitor of all three classes of protease to a solid phase adjuvant. Conjugation of His-tagged proteins to iron oxide nanoparticles
- Talon-modified iron oxide beads were dissolved in 500 pL of 100 m phosphate buffer, 600 mM Nad; pH 8.0 with 0.02% Tween 20.
- Ovalbumin-6His was added (0.3 nmol; 20 pL of a 0.23 mg/mL solution, serially diluted 1:2) was added and the mixture was shaken (1000 rpm) at room temperature for 2 hours. The sample was then split into 2 equal portions. One portion was left shaking. To the other portion was added 0.3 nmol of Cystatin-Pepstatin-conjugate-6His. The solutions were then left shaking for a further 2 hours.
- Iron content of modified particles was determined using a bathophenantroline assay, based on that reported by Perry et al. 31
- the membrane was blocked with 5% w/v skimmed milk powder in PBS with 0.1% Tween 20 for 1 hour at room temperature. After this time a solution of anti-Ovalbumin (Polysciences, 2344-5, 5 mg/mL, 1 :5000 dilution) was added in 5% skimmed milk powder in PBS-Tween 20 and the membrane was gently shaken at 4° C for 17 hours. After this period the gel was washed 3 times with PBS-Tween and incubated with secondary pig-anti-rabbit-horseradish peroxidase conjugate (1:3000 in 5% skimmed milk powder in PBS-Tween 20 at room temperature for 1 hour. The membrane was washed 4 times with PBS-Tween before visualising the presence of HRP with ECL Western Blotting Detection Reagent (GE Healthcare) and exposure to photographic film.
- GE Healthcare ECL Western Blotting Detection Reagent
- the density of the bands was normalised against a standard curve of ovalbumin of known concentrations using Totallab gel analysis software (Nonlinear Dynamics, Newcastle upon Tyne, UK) to approximate the loading of ovalbumin on the particles.
- Cystatin-levels and cystatin-pepstatin levels were determined using the Mouse anti- Human Cystatin C antibody (mouse anti-human Cystatin C, MAB1196, R&D Systems, 1 :3000 dilution) using the above Western blot protocol.
- Dendritic cells are incubated for 48-72 hours with the 3 varieties of PLGA microspheres (CPI only, Ovalbumin only and CPI/ovalbumin) in the presence of T cells able to detect the presentation of peptides derived from processed and presented antigen (OT1 and OTII). T cell activation is then measured by incorporation of 3H-thymidine during a 12-16 hour period.
- mice C57BU6 mice were injected sub-cutaneously with the same PLGA microspheres (1.75mg PLGA containing approx. 5% w/w ovalbumin). The injected volumes additionally contained 1 pg/ml LPS to activate antigen presenting cells at the site of injection. All mice previously (30-60 mins earlier) received 10 6 CFSE labeled OT1 and OTII T cells. After 24-48 hours T cell proliferation in draining lymph nodes was measured by CFSE dilution.
- the present invention provides a molecule which displays tight control over the stoichiometry and localization of the introduced pepstatin; with no more than one pepstatin molecule per cystatin at a site away from the inhibitory domains of cystatin c (see for example figure 1b) this has been achieved through introduction of a free cysteine into the protein backbone of cystatin C by site-directed mutagenesis 25 , as it can be selectively modified in presence of other nucleophilic residues. Issues associated with disulfide scrambling with the two exisiting disulfide bridges in cystatin C were avoided by using a mammalian expression system.
- T102C was found to have the most favourable inhibitory properties.
- a C-terminal 6His-tag was also introduced, for facilitating purification and possible conjugation of the inhibitor to a solid phase carrier.
- methanethiosulfonate chemistry was used to introduce the pepstatin onto the free cysteine of cystatin C 256, 26 , due to its high selectivity for sulfhydryls and its facile introduction into the peptide backbone through a MTS-Boc-Cysteine building block.
- the CPI showed similar IC50 values against representative members of the three classes of endosomal protease even without reduction of the disulfide bond between cystatin C and pepstatin A (figure 3, panel 1-3). Moreover, the CPI was able to inhibit the same 3 classes of protease activity present in dendritic cell lysates (figure 3, panel 4-6).
- One of the potential therapeutic applications of the CPI is as a modulator of antigen processing. It has been reported that unstable antigens can be over-processed in the endo-lysosomal pathway leading to a reduction in antigen presentation 28 and that protease resistant antigens frequently make for better immunogens. The inventors tested whether these unstable antigens could be 'protected' from lysosomal over- degradation by the CPI with the eventual aim of improving antigen presentation of such unstable antigens in vaccine preparations.
- the inventors next assessed the capacity of CPI to inhibit endo/lysosomal proteases in live cells and whether a CPI could successfully modulate the biological functions of this compartmental system.
- One important role of the endocytic pathway is to degrade activated growth factor receptors following their ligand-stimulated endocytosis. For example, following the EGF receptor (EGFr) being ubiquitinated, it is clustered in clathrin coated pits and delivered to the endosome system where it becomes sequestered on the internal vesicles of multivesicular bodies (MVBs) preventing recycling and shutting down its capacity to signal 29 .
- EGF receptor EGF receptor
- MVBs then fuse with lysososomes and the EGF receptor is degraded; The specific lysosomal proteases remain to be fully defined. 11 ' 35 .
- the inventors precincubated the EGFr positive kidney cell line COS-7 in the presence or absence of a CPI or cystatin C (the insolubility of pepstatin A prevented this compound from giving meaningful data in this experiment) and then challenged with EGF. At different times the level of EGFr remaining was monitored by western blotting (figure 5). In control cells downregulation of EGFr was evident after 40 minutes and virtually complete after 90 minutes (Fig 5a). In contrast levels of EGFr were much more persistent in Cos7 cells preincubated with CPI demonstrating a block in receptor degradation as quantified in figure 5b.
- CPI is taken up by cells and can suppress key proteolytic events within the endo/lysosomal system.
- the inventors also tested the protease inhibitor in a model vaccine. First, defined amounts of antigen (Ovalbumin) and inhibitor (figure 6a) were loaded onto a solid- phase carrier not unlike those used in commercial vaccine preparations. Next these vaccine preparates were fed to mouse dendritic cells for 2 hours.
- FIG. 6b After washing, purified OT-I and OT-II T-cells specific for epitopes on Ovalbumin were added and an improved response of the OT-I and OT-II T-cells could be observed (figure 6b).
- Figures 6c and d show that the inclusion of CPI substantially improves presentation of the ovalbumin antigen.. Beads containing CPI alone produced no T cell proliferation (not shown. Moreover, a Ova/CPI PLGA (+LPS) formulation produces more potent antigen presentation than the Ova PLGA (+LPS) formulation in vivo (see Figure 6e).
- pan-endosomal protease inhibitor can improve antigen presentation in relevant immune cells.
- pan protease inhibitor could inhibit the proteolytic activity of pathogenic species, more specifically that of the trypanosomes. It was indeed observed that all three families of protease activities from T. brucei could be powerfully inhibited (figure 7).
- the inventors have presented the construction of a single molecular entity that inhibits all three major families of endo/lysosomal proteases. This broad inhibition has been shown to attenuate destructive processing of labile proteins in vitro and to attenuate proteolytic events within the endo/lysosomal pathway in vivo.
- Cystatin F is a cathepsin C-directed protease inhibitor regulated by proteolysis. EMBO J 2008, 27 (3), 499-508.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- AIDS & HIV (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN1822DEN2014 IN2014DN01822A (https=) | 2011-08-15 | 2012-08-15 | |
| EP12753163.0A EP2744821B1 (en) | 2011-08-15 | 2012-08-15 | Inhibitors against endosomal/lysosomal enzymes |
| CN201280039856.9A CN103814046B (zh) | 2011-08-15 | 2012-08-15 | 针对内体/溶酶体酶的抑制剂 |
| US14/239,354 US9050374B2 (en) | 2011-08-15 | 2012-08-15 | Inhibitors against endosomal/lysosomal enzymes |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1114017.5 | 2011-08-15 | ||
| GBGB1114017.5A GB201114017D0 (en) | 2011-08-15 | 2011-08-15 | Inhibitors against endosomal/ysosomal enzymes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013024243A1 true WO2013024243A1 (en) | 2013-02-21 |
Family
ID=44764498
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2012/000660 Ceased WO2013024243A1 (en) | 2011-08-15 | 2012-08-15 | Inhibitors against endosomal/lysosomal enzymes |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US9050374B2 (https=) |
| EP (1) | EP2744821B1 (https=) |
| CN (1) | CN103814046B (https=) |
| GB (1) | GB201114017D0 (https=) |
| IN (1) | IN2014DN01822A (https=) |
| WO (1) | WO2013024243A1 (https=) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6907188B2 (ja) * | 2015-08-13 | 2021-07-21 | ダイアックス コーポレーション | 接触系活性化の評価のためのプロテアーゼ阻害剤を含む真空採血管 |
| DK3359146T3 (en) | 2016-08-11 | 2019-04-08 | Intrabio Ltd | PHARMACEUTICAL COMPOSITIONS AND USES AGAINST LYSOSOMAL STORAGE DISEASES |
| US10738338B2 (en) | 2016-10-18 | 2020-08-11 | The Research Foundation for the State University | Method and composition for biocatalytic protein-oligonucleotide conjugation and protein-oligonucleotide conjugate |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1066315A1 (en) * | 1998-03-26 | 2001-01-10 | University Of Dundee | Use of inhibitors of mammalian asparaginyl endopeptidase for therapy of autoimmune disease |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7247704B2 (en) * | 2000-12-18 | 2007-07-24 | Arriva Pharmaceuticals, Inc. | Multifunctional protease inhibitors and their use in treatment of disease |
-
2011
- 2011-08-15 GB GBGB1114017.5A patent/GB201114017D0/en not_active Ceased
-
2012
- 2012-08-15 US US14/239,354 patent/US9050374B2/en not_active Expired - Fee Related
- 2012-08-15 EP EP12753163.0A patent/EP2744821B1/en not_active Not-in-force
- 2012-08-15 IN IN1822DEN2014 patent/IN2014DN01822A/en unknown
- 2012-08-15 WO PCT/GB2012/000660 patent/WO2013024243A1/en not_active Ceased
- 2012-08-15 CN CN201280039856.9A patent/CN103814046B/zh not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1066315A1 (en) * | 1998-03-26 | 2001-01-10 | University Of Dundee | Use of inhibitors of mammalian asparaginyl endopeptidase for therapy of autoimmune disease |
Non-Patent Citations (43)
| Title |
|---|
| ABRAHAMSON, M.; AFVAREZ-FERNANDEZ, M.; NATHANSON, C. M., CYSTATINS. BIOCHEM SOC SYMP, 2003, pages 179 - 99 |
| ATVAREZ-FERNANDEZ, M.; BARRETT, A. J.; GERHARTZ, B.; DANDO, P. M.; NI, J.; ABRAHAMSON, M.: "Inhibition of mammalian legumain by some cystatins is due to a novel second reactive site", J. BIOL. CHEM., vol. 274, no. 27, 1999, pages 19195 - 19203, XP002144223, DOI: doi:10.1074/jbc.274.27.19195 |
| AUERSWALD, E. A.; NAGLER, D. K.; ASSFALGMACHLEIDT, L; STUBBS, M. T.; MACHLEIDT, W.; FRITZ, H.: "Hairpin loop mutations of chicken cystatin have different effects on the inhibition of Cathepsin B, Cathepsin L and Papain", FEBS LETT., vol. 361, no. 2-3, 1995, pages 179 - 184 |
| BEDNARSKI, E.; RIBAK, C. E.; LYNCH, G.; SUPPRESSION OF CATHEPSINS B AND L CAUSES A PROLIFERATION OF LYSOSOMES AND THE FORMATION OF, J. NEUROSCI., vol. 17, no. 11, 1997, pages 4006 - 4021 |
| BJORK, I.; BRIEDITIS, I.; RAUBSEGALL, E.; POL, E.; HAKANSSON, K.; ABRAHAMSON, M.: "The importance of the second hairpin loop of cystatin C for proteinase binding, characterization of the interaction of Trp-106 variants of the inhibitor with cysteine proteinases", BIOCHEM., vol. 35, no. 33, 1996, pages 10720 - 10726 |
| BRIGGS, J. J.; HAUGEN, M. H.; JOHANSEN, H. T.; RIKER, A. I.; ABRAHAMSON, M.; FODSTAD, O.; MAELANDSMO, G. M.; SOLBERG, R.: "Cystatin E/M suppresses legumain activity and invasion of human melanoma", BMC CANCER, 2010, pages 10 |
| BRYGIER, J.; VLNCENTELLI, J.; NLJS, M.; GUERMANT, C.; PAUL, C.; BAEYENS-VOLANT, D.; LOOZE, Y.: "Preparation and preliminary characterization of poly(ethylene glycol)-pepstatin conjugate", APP. BIOCHEM. BIOTECH., vol. 47, no. 1, 1994, pages 1 - 10, XP035177145, DOI: doi:10.1007/BF02788670 |
| CHEN, C. S.; CHEN, W. N. U.; ZHOU, M.; ARTTAMANGKUL, S.; HAUGLAND, R. P.: "Probing the cathepsin D using a BODIPY FL-pepstatin A: Applications in fluorescence polarization and microscopy", J. BIOCHEM. BIOPHYS. MET., vol. 42, no. 3, 2000, pages 137 - 151 |
| COLBERT, J. D.; MATTHEWS, S. P.; MILLER, G.; WATTS, C.: "Diverse regulatory roles for lysosomal proteases in the immune response", EUR. J. IMMUNOL., vol. 39, no. 11, 2009, pages 2955 - 2965 |
| COLIN WATTS: "The endosome lysosome pathway and information generation in the immune system", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - PROTEINS & PROTEOMICS, ELSEVIER, NETHERLANDS, vol. 1824, no. 1, 7 July 2011 (2011-07-07), pages 14 - 21, XP028336040, ISSN: 1570-9639, [retrieved on 20110718], DOI: 10.1016/J.BBAPAP.2011.07.006 * |
| DELAMARRE, L.; COUTURE, R.; MELLMAN, I.; TROMBETTA, E. S.: "Enhancing immunogenicity by limiting susceptibility to lysosomal proteolysis", J. EXP. MED., vol. 203, no. 9, 2006, pages 2049 - 2055 |
| DENNEMARKER. J.; LOHMULLER, T.; MÜLLER, S.; AGUILAR, S. V.; TOBIN, D. J.; ETERS, C.; REINHECKEL, T.: "Impaired turnover of autophagolysosomes in cathepsin L deficiency", BIOL. CHEM., vol. 391, no. 8, 2010, pages 913 - 922 |
| DOYLE, P. S.; SAJID, M.; O'BRIEN, T.; DUBOIS, K.; ENGEL, J. C.; MACKEY, Z. B.; REED, S.: "Drugs targeting parasite lysosomes", CURR. PHARM. DESIGN, vol. 14, no. 9, 2008, pages 889 - 900 |
| FREE, P.; HURLEY, C. A.; KAGEYAMA, T.; CHAIN, B. M.; TABOR, A. B.: "Mannose- pepstatin conjugates as targeted inhibitors of antigen processing", ORG. BIOMOL. CHEM., vol. 4, no. 9, 2006, pages 1817 - 1830 |
| FURUNO, K.; MIWA, N.; KATO, K.: "Receptor-mediated introduction of pepstatin- asialofetuin conjugate into lysosomes of rat hepatocytes", J. BIOCHEM, vol. 93, no. 1, 1983, pages 249 - 256 |
| HAMILTON, G.; COLBERT, J. D.; SCHUETTELKOPF, A. W.; WATTS, C.: "Cystatin F is a cathepsin C-directed protease inhibitor regulated by proteolysis", EMBO J, vol. 27, no. 3, 2008, pages 499 - 508 |
| HENSKENS, Y. M.; VEERMAN, E. C.; NIEUW AMERONGEN, A. V.: "Cystatins in health and disease.", BIOL. CHEM., vol. 377, no. 2, 1996, pages 71 - 86, XP009121891 |
| HOPP, T. P.; PRICKETT, K. S.; PRICE, V. L.; LIBBY, R. T.; MARCH, C. J.; PAT CERRETTI, D.; URDAL, D. L.; CONLON, P. J.: "A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification", NAT BIOTECH, vol. 6, no. 10, 1988, pages 1204 - 1210, XP002046115, DOI: doi:10.1038/nbt1088-1204 |
| J. D. COLBERT ET AL: "Internalization of Exogenous Cystatin F Supresses Cysteine Proteases and Induces the Accumulation of Single-chain Cathepsin L by Multiple Mechanisms", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 286, no. 49, 9 December 2011 (2011-12-09), pages 42082 - 42090, XP055041244, ISSN: 0021-9258, DOI: 10.1074/jbc.M111.253914 * |
| KEPPLER, D.: "Towards novel anti-cancer strategies based on cystatin function", CANCER LETTERS, vol. 235, no. 2, 2006, pages 159 - 176, XP026236311, DOI: doi:10.1016/j.canlet.2005.04.001 |
| LEUNG, D.; ABBENANTE, G.; FAIRLIE, D. P.: "Protease inhibitors: Current status and future prospects", J. MED. CHEM., vol. 43, no. 3, 2000, pages 305 - 341, XP002254336, DOI: doi:10.1021/jm990412m |
| LIAUDET-COOPMAN, E.; BEAUJOUIN, M.; DEROCQ, D.; GARCIA, M.; GLONDU-LASSIS, M.; LAURENT-MATHA, V.; PREBOIS, C.; ROCHEFORT, H.; VIGN: "newly discovered functions of a long-standing aspartic protease in cancer and apoptosis", CANCER LETT., vol. 237, no. 2, 2006, pages 167 - 79, XP025021507, DOI: doi:10.1016/j.canlet.2005.06.007 |
| MANOURY, B.; HEWITT, E. W.; MORRICE, N.; DANDO, P. M.; BARRETT, A. J.; WATTS, C.: "An asparaginyl endopeptidase processes a microbial antigen for class II MHC presentation", NATURE, vol. 396, no. 6712, 1998, pages 695 - 699, XP002113050, DOI: doi:10.1038/25379 |
| MATTHEWS, S. P.; WERBER, I.; DEUSSING, J.; PETERS, C.; REINHECKEL, T.; WATTS, C.: "Distinct Protease Requirements for Antigen Presentation In Vitro and In Vivo", J. IMMUNOL., vol. 184, no. 5, 2010, pages 2423 - 2431 |
| MOSS, C. X.; VILLADANGOS, J. A.; WATTS, C.: "Destructive potential of the aspartyl protease cathepsin D in MHC class Il-restricted antigen processing", EUR. J. IMMUNOL., vol. 35, no. 12, 2005, pages 3442 - 3451 |
| NICOTRA, G.; MANFROI, F.; FOLIO, C.; CASTINO, R.; FUSCO, N.; PERACCHIO, C.; KERIM, S.; VALENTE, G.; ISIDORO, C.: "High expression of cathepsin D in non-Hodgkin's lymphomas negatively impacts on clinical outcome", DIS. MARKERS, vol. 28, no. 3, 2010, pages 167 - 83 |
| OTTO HANS-HARTWIG ET AL: "Cysteine Proteases and Their Inhibitors", CHEMICAL REVIEWS, AMERICAN CHEMICAL SOCIETY, US, vol. 97, no. 1, 1 January 1997 (1997-01-01), pages 133 - 171, XP002666640, ISSN: 0009-2665 * |
| OTTO, H.-H.; SCHIRMEISTER, T.: "Cysteine Proteases and Their Inhibitors", CHEM. REV., vol. 97, no. 1, 1997, pages 133 - 172, XP002666640, DOI: doi:10.1021/cr950025u |
| PALERMO, C.; JOYCE, J. A.: "Cysteine cathepsin proteases as pharmacological targets in cancer", TRENDS PHARM. SCI., vol. 29, no. 1, 2008, pages 22 - 28, XP022410626, DOI: doi:10.1016/j.tips.2007.10.011 |
| PAOLA MATARRESE ET AL: "Pepstatin A alters host cell autophagic machinery and leads to a decrease in influenza A virus production", JOURNAL OF CELLULAR PHYSIOLOGY, vol. 226, no. 12, 22 February 2011 (2011-02-22), pages 3368 - 3377, XP055041520, ISSN: 0021-9541, DOI: 10.1002/jcp.22696 * |
| PERRY, R. D.; SANCLEMENTE, C. L.: "Determination of Iron With Bathophenanthroline Following An Improved Procedure for Reduction of Iron(III) Ions", ANALYST, vol. 102, no. 1211, 1977, pages 114 - 119 |
| POPP, M. W.; PLOEGH, H. L.: "Making and breaking peptide bonds: protein engineering using sortase", ANGEW CHEM INT ED ENGL, vol. 50, no. 22, 2011, pages 5024 - 32, XP002686610, DOI: doi:10.1002/ANIE.201008267 |
| RAIBER, E. A.; TULONE, C.; ZHANG, Y.; MARTINEZ-POMARES, L.; STEED, E.; SPONAAS, A. M.; LANGHORNE, J.; NOURSADEGHI, M.; CHAIN, B. M: "Targeted delivery of antigen processing inhibitors to antigen presenting cells via mannose receptors", ACS CHEM. BIOL., vol. 5, no. 5, 2010, pages 461 - 476 |
| REISER, J.; ADAIR, B.; REINHECKEL, T.: "Specialized roles for cysteine cathepsins in health and disease", J. CLIN. INVEST, vol. 120, no. 10, 2010, pages 3421 - 3431, XP055257930, DOI: doi:10.1172/JCI42918 |
| RICHARDSON, P. G.; SONNEVELD, P.; SCHUSTER, M. W.; IRWIN, D.; STADTMAUER, E. A.; FACON, T.; HAROUSSEAU, J. L.; BEN-YEHUDA, D.; LON: "Bortezomib or high-dose dexamethasone for relapsed multiple myeloma", NEW ENGL. J. MED., vol. 352, no. 24, 2005, pages 2487 - 2498 |
| ROZMAN-PUNGERCAR, J.; KOPITAR-JERALA, N.; BOGYO, M.; TURK, D.; VASILJEVA, O.; STEFE, I.; VANDENABEELE, P.; BROMME, D.; PUIZDAR, V.: "Inhibition of papain-like cysteine proteases and legumain by caspase-specific inhibitors: when reaction mechanism is more important than specificity", CELL DEATH DIFFER 0000, vol. 10, no. 8, pages 881 - 888, XP055041481, DOI: doi:10.1038/sj.cdd.4401247 |
| SANDER I. VAN KASTEREN ET AL: "A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function", ACS CHEMICAL BIOLOGY, vol. 6, no. 11, 18 November 2011 (2011-11-18), pages 1198 - 1204, XP055041218, ISSN: 1554-8929, DOI: 10.1021/cb200292c * |
| TURK, B.; TURK, D.; TURK, V.: "Lysosomal cysteine proteases: More than scavengers", BIOCHIM. BIOPHYS. ACT., vol. 1477, no. 1-2, 2000, pages 98 - 111, XP004278888, DOI: doi:10.1016/S0167-4838(99)00263-0 |
| UMEZAWA, H.; AOYAGI, T.; MORISHIMA, H.; MATSUZAKI, M.; HAMADA, M.: "Pepstatin, a new pepsin inhibitor produced by Actinomycetes", J. ANTIBIOT., vol. 23, no. 5, 1970, pages 259 - 262 |
| VAN KASTEREN, S. I.; KRAMER, H. B.; GAMBLIN, D. P.; DAVIS, B. G.: "Site-selective glycosylation of proteins: creating synthetic glycoproteins", NATURE PROTOCOLS, vol. 2, no. 12, 2007, pages 3185 - 3194, XP055036558, DOI: doi:10.1038/nprot.2007.430 |
| WALLIN H ET AL: "Cystatins - Extra- and intracellular cysteine protease inhibitors: High-level secretion and uptake of cystatin C in human neuroblastoma cells", BIOCHIMIE, MASSON, PARIS, FR, vol. 92, no. 11, 1 November 2010 (2010-11-01), pages 1625 - 1634, XP027477796, ISSN: 0300-9084, [retrieved on 20100825], DOI: 10.1016/J.BIOCHI.2010.08.011 * |
| WATTS C ET AL: "Asparaginyl endopeptidase: case history of a class II MHC compartment protease", IMMUNOLOGICAL REVIEWS, BLACKWELL PUBLISHING, MUNKSGAARD, vol. 207, 1 October 2005 (2005-10-01), pages 218 - 228, XP008108558, ISSN: 0105-2896 * |
| ZAIDI, N.; BURSTER, T.; SOMMANDAS, V.; HERRMANN, T.; BOEHM, B. O.; DRIESSEN, C.; VOELTER, W.; KALBACHER, H.: "A novel cell penetrating aspartic protease inhibitor blocks processing and presentation of tetanus toxoid more efficiently than pepstatin A", BIOCHEM. BIOPHYS. RES. COMM., vol. 364, no. 2, 2007, pages 243 - 249, XP022317883, DOI: doi:10.1016/j.bbrc.2007.09.114 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2744821A1 (en) | 2014-06-25 |
| IN2014DN01822A (https=) | 2015-05-15 |
| CN103814046B (zh) | 2017-05-17 |
| GB201114017D0 (en) | 2011-09-28 |
| CN103814046A (zh) | 2014-05-21 |
| EP2744821B1 (en) | 2016-12-07 |
| US9050374B2 (en) | 2015-06-09 |
| US20140308318A1 (en) | 2014-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6249949B2 (ja) | 薬物動態特性の改善されたコンプスタチンアナログ | |
| RU2668560C2 (ru) | Конъюгированная вакцина на основе пептида антигена wt1 | |
| US20200354413A1 (en) | Stabilized peptide-mediated targeted protein degradation | |
| CN107531752B (zh) | 用于炎症和纤维化的肽治疗 | |
| JP2018506509A (ja) | 細胞透過性Bcl−xL阻害剤との抗体薬物コンジュゲート | |
| EP2744821B1 (en) | Inhibitors against endosomal/lysosomal enzymes | |
| JPWO2016047797A1 (ja) | 注射用医薬組成物 | |
| AU2007220307A1 (en) | Cathepsin propeptide and uses thereof | |
| CN115996942A (zh) | 靶向巨噬细胞的肽及其缀合物、组合物和用途 | |
| EP4203957A2 (en) | Inhibitors of sars cov-2 infection and uses thereof | |
| JP2004510703A (ja) | 酵素−分解性プロドラッグ化合物 | |
| WO2004106371A1 (en) | Livin-derived peptides, compositions and uses thereof | |
| KR102017973B1 (ko) | 항-b형 간염 바이러스 x 단백질 폴리펩티드 약제 | |
| JP4914350B2 (ja) | セラリシン(Serralisins)のポリペプチド断片を含む医薬組成物 | |
| KR101167481B1 (ko) | 젖소락토페린 분해물 유래 항균 펩타이드를 포함하는 항균 조성물 | |
| CN108314727A (zh) | 膜型金属蛋白酶抑制蛋白及其用途 | |
| US20210268062A1 (en) | Inflammatory skin disorder treatment | |
| JP7302887B2 (ja) | 抗がんペプチド及びその使用 | |
| KR20230024838A (ko) | 종양 유래 소포를 붕괴시키는 항암 면역치료용 펩타이드 및 이의 용도 | |
| CA3056188A1 (en) | Selective cell death-inducing enzyme system | |
| JP2025503500A (ja) | セストリン-mapk複合体阻害剤 | |
| WO2020000061A1 (en) | Renal treatment | |
| HK1220471B (zh) | Wt1抗原肽缀合物疫苗 | |
| WO2008004130A2 (en) | Peptides for targeting the mitochondrial transition pore complex for therapeutic apoptosis induction and biological applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12753163 Country of ref document: EP Kind code of ref document: A1 |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012753163 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012753163 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14239354 Country of ref document: US |