WO2013013019A2 - Polypeptides lysosomaux, procédés de préparation et d'utilisation - Google Patents

Polypeptides lysosomaux, procédés de préparation et d'utilisation Download PDF

Info

Publication number
WO2013013019A2
WO2013013019A2 PCT/US2012/047356 US2012047356W WO2013013019A2 WO 2013013019 A2 WO2013013019 A2 WO 2013013019A2 US 2012047356 W US2012047356 W US 2012047356W WO 2013013019 A2 WO2013013019 A2 WO 2013013019A2
Authority
WO
WIPO (PCT)
Prior art keywords
composition
lysosomal protein
protein
rna effector
target gene
Prior art date
Application number
PCT/US2012/047356
Other languages
English (en)
Other versions
WO2013013019A3 (fr
Inventor
Anthony Rossomando
Brian Bettencourt
Original Assignee
Alnylam Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals, Inc. filed Critical Alnylam Pharmaceuticals, Inc.
Publication of WO2013013019A2 publication Critical patent/WO2013013019A2/fr
Publication of WO2013013019A3 publication Critical patent/WO2013013019A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/005—Glycopeptides, glycoproteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121—Serpins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121—Serpins
    • C07K14/8125—Alpha-1-antitrypsin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2465—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on alpha-galactose-glycoside bonds, e.g. alpha-galactosidase (3.2.1.22)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01101—Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase (2.4.1.101)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin

Definitions

  • LSDs The lysosomal storage diseases
  • Gaucher' s disease is the most prevalent lysosomal storage disorder. It is caused by a recessive genetic disorder (chromosome 1 q21-q31) resulting in deficiency of glucocerebrosidase, also known as glucosylceramidase, which is a membrane- bound lysosomal enzyme that catalyzes the hydrolysis of the glycosphingolipid
  • glucocerebroside glucosylceramide, GlcCer
  • GlcCer glucose and ceramide.
  • Gaucher' s disease is caused by point mutations in the hGCD (human glucocerebrosidase) gene (GBA), which result in accumulation of GlcCer in the lysosomes of macrophages.
  • GAA human glucocerebrosidase gene
  • the characteristic storage cells called Gaucher cells, are found in liver, spleen and bone marrow.
  • the associated clinical symptoms include severe hepatosplenomegaly, anemia, thrombocytopenia and skeletal deterioration.
  • Fabry disease is an X-linked lysosomal storage disease that is caused by deficient activity of lysosomal enzyme a-glucosidase A (GAA)
  • GAA lysosomal enzyme
  • Patients with classic Fabry disease typically have GAA activity of less than 1% and often demonstrate the full spectrum of symptoms, including severe pain in the extremities (acroparesthesias), hypohidrosis, corneal and lenticular changes, skin lesions (angiokeratoma), renal failure, cardiovascular disease, pulmonary failure, neurological symptoms and stroke.
  • GAA activity including severe pain in the extremities (acroparesthesias), hypohidrosis, corneal and lenticular changes, skin lesions (angiokeratoma), renal failure, cardiovascular disease, pulmonary failure, neurological symptoms and stroke.
  • individuals with residual enzyme activity demonstrate symptoms later in life, and the symptoms are usually limited to one or a few organs.
  • Clinical manifestations in female carriers vary' greatly because of random X-
  • Enzyme replacement therapy has been used successfully to manage symptoms of Gaucher' s disease and other lysosomal storage diseases, such as Pompe disease and Fabry disease. Although enzyme replacement therapy is not a cure, such treatments can effectively manage the disorder when adminis tered on a regular basis.
  • enzyme replacement therapy is not a cure, such treatments can effectively manage the disorder when adminis tered on a regular basis.
  • intravenous recombinant glucocerebrosidase administered to patients decreases liver and spleen size, reduces skeletal abnormalities, and reverses other manifestations.
  • Mature human glucocerebrosidase is a 497 amino acid membrane-associated monomelic glycoprotein of about 67 kDa and has a pH optimum for enzymatic activity of about 5.5.
  • Glucocerebrosidase has five N-glycosylation amino acid consensus sequences (Asn-X-Ser/Thr), four of which are normally glycosylated (Asnl9, Asn59, Asn l46 and Asn270). Recombinantly produced glucocerebrosidase (Cerezyme®) differs from placenta glucocerebrosidase
  • Glycoproteins from either mammalian host cells (such as CHO ceils) or human placenta typically comprise complex N-glycans.
  • Unmodified glucocerebrosidase that comprises complex N-glycans is primarily taken up by hepatocytes (rather than macrophages), and is therefore of limited therapeutic value. Removal of sialic acid on the placental enzyme by treatment with neuraminidase increases targeting to hepatocytes and decreases the amount taken up by non-parenchymal cell (e.g., macrophages).
  • Recombinant a-Galactosidase A for enzyme replacement therapy has been produced in insect (sf9) cells (U.S. Pat. No. 7,0! 1 ,831 ), in human fibroblasts (U.S. Pat. No. 6,395,884), and in plant cells (U.S. Pat. No. 6,846,968).
  • Enzymatically modifying the giycan structure of a therapeutic protein can be costly. Accordingly, there is a need for improved methods for making therapeutic lysosomal proteins that can be delivered to lysosomes efficiently.
  • the invention generally relates to compositions and methods for producing lysosomal proteins that have altered giycan structure, such that the protein can be delivered efficiently into the lysosomes of target cell s (such as macrophages),
  • the lysosomal proteins are produced by modifying the glycosylation pathways in a host cell using an RNA effector molecule, such as an siRNA.
  • Glycan-modified lysosomal proteins produced using the methods described herein have improved properties, including e.g., increased specific uptake by target cells (such as macrophages).
  • the invention also provides methods for producing glycan- modified lysosomal proteins, in particular on a large or commercial scale.
  • the method comprises culturing a host ceil in a large scale cell culture in the presence of an RNA effector that targets a gene that encodes an enzyme or a transporter protein that is involved in a glycosylation pathway.
  • the RNA effector transiently reduces the expression level of the target gene, thereby altering the glycosylation profile of a lysosomal protein.
  • the lysosomal protein is a human lysosomal protein.
  • the host cell is not a human host cell, it may be desirable to also reduce or prevent the expression of the corresponding host lysosomal protein,
  • the invention provides a method for producing a composition comprising an exogenous lysosomal protein, the method comprises: culturing a large scale host cell culture in a medium that comprises an effecti ve amount of an RNA effector molecule; (a) wherein the host cell comprises (i) an exogenous nucleic acid that expresses the exogenous lysosomal protein, and (ii) an endogenous target gene that encodes an oxtholog of the lysosomal protein; (b) wherein the RNA effector is substantially complementary to the endogenous target gene that encodes the oxtholog, and reduces or prevents the expression of the endogenous target gene; and (c) wherem the host cell is cultured for a period of time sufficient for the production of the lysosomal protein,
  • the host cell is a CHO cell, or CHO-derived cell.
  • the exogenous lysosomal protein is a human lysosomal protein
  • the endogenous gene encodes the hamster ortholog of the human lysosomal protein.
  • the invention provides a method for producing a composition comprising an human lysosomal protein, the method comprises: culturing a large scale host cell culture in a medium that comprises an effective amount of an RNA effector molecule; (a) wherein the host cell is a CHO cell or CHO-derived cell, and wherein the host cell comprises (i) an exogenous nucleic acid that expresses the human lysosomal protein, and (ii) an endogenous target gene that encodes the hamster ortholog of the human lysosomal protem; (b) wherein the RNA effector is substantially complementary to the endogenous target gene that encodes the oxtholog, and reduces or prevents the expression of the endogenous target gene; and (c)
  • the exogenous lysosomal protein is human glucocerebrosidase, and the endogenous target gene encodes hamster glucocerebrosidase.
  • the exogenous lysosomal protein is human acid a-glucosidase, and the endogenous target gene encodes hamster acid a-glucosidase.
  • the exogenous lysosomal protein is a human trypsin inhibitor, and the endogenous target gene encodes the corresponding hamster trypsin inhibitor.
  • the exogenous lysosomal protein is a human esterase inhibitor, and the endogenous target gene encodes the corresponding hamster esterase inhibitor.
  • the exogenous lysosomal protein is human a-galactosidase A, and the endogenous target gene encodes hamster a- galactosidase A,
  • the RNA effector can be an siRNA, shRNA, or antisense RNA.
  • the invention provides a glycan-modified lysosomal protein that comprises at least one terminal mannose.
  • lysosomal glycoproteins that have altered glycan structures can be produced on a commercial scale by transiently reducing the expression of target genes that encode enzymes or transporters that are involved in glycosylation pathways. Transient reduction of target genes in commercial scale bioreactors can be accompl ished using RNA effector molecules, such as an siRNA. Lysosomal glycoproteins produced in this way have improved properties.
  • lysosomal proteins produced by mammalian host cells typically comprise complex N-glycans that lack terminal mannose.
  • siRNAs are used to transiently reduce the expression of enzymes or transporters that are in vol ved in the N-giycan biosynthesis in CHO cells.
  • Increased amounts of lysosomal proteins that comprise at least one terminal mannose are produced upon addition of siRN As to the cell culture.
  • the glycan- modified lysosomal proteins show increased specific uptake by target cells (such as
  • the invention provides a method for producing a glycan-modified lysosomal protein by treating a large scale host cell culture with RNA effector molecules that target an enzyme or a transporter that are involved in the biosynthesis of glycans.
  • RNA effector molecules that target an enzyme or a transporter that are involved in the biosynthesis of glycans.
  • MPDUl Mannose-P-dolichol utilization defect 1 protein
  • MGAT mannosyl
  • MGAT mannosyl
  • MGAT 2.-N-acetylglucosaminy [transferase
  • a single species of RNA effector molecule can be used to reduce the expression of a single gene that encodes a protein involved in a desired giycosylation reaction.
  • two or more different species of RNA effector molecules may be used, to reduce expression of one, two or more genes that encode proteins involved in a desired giycosylation reaction(s).
  • MPDUl and MGAT may be targeted individually, or simultaneously. Additional gene(s) may also be targeted.
  • the invention provides a glycan-modified lysosomal protein that comprises at least one terminal mannose.
  • the glycan-modified lysosomal proteins described herein can be formulated into a pharmaceutical formulation that is suitable for in vivo administration.
  • the invention also relates to the use of the lysosomal proteins described herein, or pharmaceutical compositions comprising the lysosomal proteins, in therapy, and to the use of the lysosomal proteins, or pharmaceutical compositions comprising the lysosomal proteins, for the manufacture of a medicament for use in therapy.
  • nucleotide sequence is “fully complementary” to another nucleoti de sequence when there are no mismatched base pairs across the length of the shorter sequence.
  • a nucleotide sequence is "substantially complementary" to another nucleotide sequence when there are no more than 20% of the mismatched base pairs across the length of the shorter sequence (e.g., no more than 5, 4, 3, 2, or 1 mismatched base pair(s) upon hybridization for a duplex up to 30 base pairs). Where two oligonucleotides are designed to form, upon hybridization, one or more single-stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity.
  • a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as "fully comp 1 ementary .”
  • an "exogenous" protein refers to a protein that is not a protein expressed by the host cell's own genomic sequence. Exogenous proteins include a protein that is expressed by exogenously introduced nucleic acid construct, even though a gene that encodes the protein may also be present in the host cell's own genomic sequence.
  • exogenous nucleic acid refers to a nucleic acid that is not naturally found in or produced by a host cell; and an “endogenous" nucleic acid refers to a nucleic acid that is naturally found in or produced by a host cell.
  • glycoform of a protein refers to a protein comprising a particular glycan stnicture or structures. It is recognized that a glycoprotein having more than one glycosylation site can have the same glycan species attached to each glycosylation site, or can have different glycan species attached to different glycosylation sites. In this manner, different patterns of glycan attachment yield different giycoforms of a glycoprotein.
  • isolated a protein refers to the separation of a protein molecule from its original environment found in nature (e.g., from host cells) with respect to its association with other molecules.
  • an "isolated" protein is at least about 50% pure, at least about 55% pure, at least about 60% pure, at least about 65% pure, at least about 70% pure, at least about 75% pure, at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, or at least about 99% pure.
  • a "large scale culture” refers to a culture that is at least about a 10 liter in size, (e.g., a volume of at least about lOL, least about 20L, least about SOL, least about 40L, at least about SOL, least about 60L, least about 70L, least about 80L, least about 90L, at least about !
  • OQL OQL, least about 150L, least about 200L, at least about 250L, least about 300L, least about 400L, at least about 500L, least about 600L, least about 700L, least about 800L, least about 900L, at least about 1000 L, at least about 2000 L, at least about 3000 L, at least about 4000 L, at least about 5000 L, at least about 6000 L, at least about 10,000 L, at least about 15,000 L, at least about 20,000 L, at least about 25,000 L, at least about 30,000 L, at least about 35,000 L, at least about 40,000 L, at least about 45,000 L, at least about 50,000 L, at least about 55,000 L, at least about 60,000 L, at least about 65,000 L, at least about 70,000 L, at least about 75,000 L, at least about 80,000 L, at least about 85,000 L, at least about 90,000 L, at least about 95,000 L, at least about 100,000 L, etc).
  • terminal maimose refers to a mannose at the terminus of a branch of a glycan.
  • a glycan can comprise a chain of residues having se veral different branch points (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.), resulting in a plurality of "branches.”
  • the terminus of each branch comprises a terminal group (e.g., mannose, galactose, N-acetylglucosamine, sialic acid, etc.).
  • a terminal mannose refers to a mannose at the terminus of a single branch.
  • a singl e glycan can comprise a plurality of terminal marmoses at the termini of a plurality of branches.
  • the expression of the target gene in a host cell is "transiently" reduced by an RNA effector molecule when the RNA effector molecule reduces the expression level of the target gene for a defined period of time (e.g., at least about 24 hours, at least about 48 hours, at least about 72 hours, at least about 96 hours, etc), but the reduction in the expression level is not permanent.
  • the RNA effector, or a nucleic acid construct encoding the RNA effector does not integrate into the genome of the host cell.
  • the invention provides glycan-modified lysosomal proteins that comprise at least one terminal mannose.
  • Glycan-modified or "glycan modification” refer to a change in the glycan structure of a glycoprotein produced by a host cell in the presence of an RNA effector molecule that transiently reduces the expression of a target gene (e.g., a gene that encodes an enzyme or a transporter protein that is involved in a glycosyiation pathway), as compared the glycan structure of the glycoprotein produced by the host cell under substantially the same conditions but in the absence of the RNA effector.
  • a target gene e.g., a gene that encodes an enzyme or a transporter protein that is involved in a glycosyiation pathway
  • the invention provides a composition comprising a lysosomal protein, wherein the composition is characterized by: (a) at least about 60% of the lysosomal protein molecules are glycosylated; and (b) at least about 50% of the glycosylated lysosomal protein molecules comprise a glycan that comprises: (i) at least one terminal marmose, and (ii) no more than 5 mannose residues total.
  • At least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the lysosomal protein molecules are glycosylated; and at least about 50%, at least about 55°/», at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, about 96%, at least about 97%, at least about 98%, or at least about 99% of the glycosylated lysosomal protein molecules comprise a glycan that comprises: (i) at least one termmal mannose, and (ii) no more than 5 mannose residues total.
  • terminal-mannose-bearing glycans facilitates the specific uptake of the lysosomal protein to its target cells, such as macrophages, as the Mannose receptor is uniquely found on macrophages, and is not found on monocytes.
  • macrophages bind terminal-mannose-bearing glycoproteins with specificity.
  • the terminal mannose is exposed (i.e., the mannose residue is positioned such that, it is able to bind to a mannose receptor).
  • the mannose residue is positioned such that, it is able to bind to a mannose receptor.
  • mannosidase to remove the mannose, or by comparing the activity of the glycoprotein with a glycoform of the corresponding protein that lacks a terminal mannose.
  • the glycan-modified lysosomal protein is internalized more efficiently by a target cell (e.g., a macrophage) tha that the corresponding unmodified lysosomal protein.
  • a target cell e.g., a macrophage
  • the glycan-modified lyososmal protein may be internalized more efficiently than the corresponding unmodified lysosomal protein by, e.g., at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 50%, about 60%), about 70%), about 80%), or about 90% in a given time period.
  • At least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 fold as much of the glycan-modified lyososmal protein may be internalized, relative to the unmodified lysosomal protein, in a given time period.
  • A. given time period may be, for example, 10 minutes, 1 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 10 hours, 12 hours, 24 hours, 48 hours, 72 hours etc.
  • glycosylated lysosomal protein molecules comprise a glycan that comprises (i) at least one terminal mannose, and (ii) no more than 5 mannose residues total. It has been reported that in case of glucocerebrosidase, larger oiigomannose structures (e.g., Man 9 GlcNAc 2 ) increased the binding of glucocerebrosidase to serum mannose-binding lectin (MBL). See, Van Patten et al., Glycobioiogy vol. 17, 467-478, (2007). MBL.
  • MBL mannose-binding lectin
  • MBL mannosylated liposomes
  • At least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%>, at least about 97%>, at least about 98%, or at least about 99%> of the lysosomal protein molecules are N-glycosylated.
  • At least about 50%, at least about 55%, at least about 60%), at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%), at least about 99%), or 100% of the glycosylated lysosomal protein molecules comprise a glycan that is: Man 2 GlcNAc 2 , an 2 GlcNAc 2 Fuc, Ma3 ⁇ 4GlcNAc 2 , Man 3 GlcNAc 2 puc, Man 4 GlcNAc2, Man 4 Glc Ac2Fuc, Man 5 Glc ' NAc 2 , or Man 5 GicNAc 2 Fuc.
  • the lysosomal protein is a glucocerebrosidase
  • the lysosomal protein is not a glucocerebrosidase.
  • the lysosomal protein is selected from the group consisting of glucosidase, galactocerebrosidase, galactosidase, iduronidase, hexosaminidase, mannosidase, fucosidase, arylsulfatase, V-acetylgalactosamine-6-sulfate sulfatase, acteylgalactosaminidase,
  • thioesterase cathepsin K, siaiidase and lipoprotein lipase.
  • the lysosomal protein is selected from the group consisting of: idursulfase, alglucosidase alfa, galsuliase, agalsidase ⁇ , laronidase, acid a- glucosidase, and a protease inhibitor.
  • the lysosomal protein is selected from the group consisting of idursulfase, alglucosidase alfa. galsuliase, agalsidase ⁇ , and laronidase.
  • Exemplary lysosomal proteins that may be used for treating LSDs are listed in Tables 1-4. Table 1: Examples of LSDs m glycoprotein degradation
  • Metachromatic leukodystrophy arylsulfatase A (cerebroside sulfatase)
  • the lysosomal protein may have 1 , 2, 3, 4, 5 or more consensus sites for - lmked or O-liriked glycosylation, each of which may or may not be glycosylated,
  • human glucocerebrosidase has five N-glycosylation amino acid consensus sequences (Asn-X- Ser/Thr), four of which are normally glycosylated (Asn 19, Asn59, Asnl46 and Asn270).
  • the lysosomal protein may be an enzyme or a transporter protein that has optimal activity, as measured by an activity assay, at a pH ranging from 1-7, such as, a pH ranging from 1-3, 2-5, 3-6, 4-5, 5-6, or 4-6.
  • a pH ranging from 1-7 such as, a pH ranging from 1-3, 2-5, 3-6, 4-5, 5-6, or 4-6.
  • the lysosomal protein has optimal activity at a pH ranging between 3 to 5,
  • the lysosomal protein is glucocerebrosidase.
  • the glucocerebrosidase is a human glucocerebrosidase.
  • the invention provides a composition comprising a glucocerebrosidase wherein (a) at least about 60% of the glucocerebrosidase molecules are glycosylated; (b) the glycosylated molecules comprise at least two glycoforms; (c) each of the glycoforms comprises a glycan that comprises: (i) at least one terminal mannose, (ii) no more than 5 mannose residues total; and (iii) does not comprise a xylose or an a(l ,3)-fucose.
  • At least one glycoform comprises a giycan that comprises: (i) a terminal mannose, and (ii) 2, 4, or 5 mannoses total
  • the composition may comprise a glucocerebrosidase that comprises a N-glycan that is Man 3 GlcNAc 2 , and a glucocerebrosidase that comprises a N-glycan that is Mar GlcNAc?.
  • at least one glycoform does not comprise a giycan that comprises: a terminal mannose and 3 mannoses total.
  • the composition may comprise a glucocerebrosidase that comprises a N-glycan that is Man 4 GlcNAc 2 , and a glucocerebrosidase that comprises a N-glycan that is Man 5 GlcNAc 2 .
  • the giycan is an N-glycan.
  • the giycans are selected from any 2 (or more) of the following: Man 2 GlcNAc 2 , Man 2 Glc Ac 2 Fuc, Man 3 GlcNAc 2 , an 3 GlcNAc 2 Fuc, an 4 GleNAc 2 , Man 4 GlcNAc 2 Puc, Man 5 GlcNAc 2 , or MarisGlcNAc ⁇ Fue,
  • At least about 60%, at least about 65%, at least about 70%), at least about 75%, at least about 80%), at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the glucocerebrosidase molecules are glycosylated.
  • At least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%>, at least about 90%, at least about 95%, about 96%>, at least about 97%, at least about 98%), or at least about 99% of the glycosylated glucocerebrosidase molecules comprise a giycan that comprises (i) at least one terminal mannose, (ii) no more than 5 mannose residues total; and (iii) does not comprise a xylose or an a(l,3)-fucose.
  • from about 5% to about 95% of the glycosylated glucocerebrosidase molecules comprise a giycan that comprises a terminal mannose and 2 mannoses total; e.g., from about 5% to about 95%, from about 10% to about 95%, from about 15% to about 95%, from about 20%) to about 95%), from about 25% to about 95%, from about 30% to about 95%, from about 35% to about 95%), from about 40% to about 95%, from about 45°/» to about 95%, from about 50% to about 95%>, from about 55% to about 95°/», from about 60%) to about 95%), from about 65% to about 95%, from about 70% to about 95%), from about 75% to about 95%, from about 80% to about 95°/», from about 85% to about 95%>, or from about 90% to about 95% of the glycosylated glucoeerebrosidase molecules comprise a glycan that comprises a terminal mannose and 2 mannoses total;
  • glycosylated glucoeerebrosidase molecules comprise a glycan tha comprises a terminal mannose and 3 mannoses total; e.g., from about 5% to about 95%, from about 10% to about 95%, from about 15% to about 95%, from about 20% to about 95%, from about 25% to about 95%, from about 30°/» to about 95%, from about 35% to about 95%, from about 40% to about 95°/», from about 45% to about 95%, from about 50% to about 95%, from about 55% to about 95%, from about 60% to about 95%, from about 65% to about 95°/», from about 70% to about 95%, from about 75% to about 95%, from about 80% to about 95%, from about 85% to about 95%, or from about 90% to about 95% of the glycosylated glucoeerebrosidase molecules comprise a glycan that comprises a terminal mannose and 3 mannoses total; e.g., from about 5% to
  • glycosylated glucoeerebrosidase molecules comprise a glycan that comprises a terminal mannose and 4 mannoses total; e.g., from about 5% to about 95%, from about 10% to about 95%, from about 15% to about 95%, from about 20% to about 95%, from about 25% to about 95%, from about 30°/» to about 95%, from about 35% to about 95%, from about 40% to about 95°/», from about 45% to about 95%, from about 50% to about 95%, from about 55% to about 95%, from about 60% to about 95%, from about 65% to about 95%, from about 70% to about 95%, from about 75% to about 95%, from about 80% to about 95%, from about 85% to about 95%, or from about 90% to about 95% of the glycosylated glucoeerebrosidase molecules comprise a glycan that comprises a terminal mannose and 4
  • glycosylated glucoeerebrosidase molecules comprise a glycan that comprises a terminal mannose and 5 mannoses total; e.g., from about 5% to about 95%, from about 10% to about 95%, from about 15% to about 95%, from about 20% to about 95%, from about 25% to about 95%, from about 30°/» to about 95%, from about 35% to about 95%, from about 40% to about 95°/», from about 45% to about 95%, from about 50% to about 95%, from about 55% to about 95%, from about 60% to about 95%, from about 65% to about 95%, from about 70% to about 95%, from about 75% to about 95%, from about 80% to about 95%, from about 85% to about 95%, or from about 90% to about 95% of the glycosylated glucoeerebrosidase molecules comprise a glycan that comprises a terminal mannose and 2
  • no more than about 50%) of the glycosylated glucoeerebrosidase molecules comprise a glycan that comprises 6 mannoses or more; e.g., no more than about 50%, no more than about 45%), no more than about 40%», no more than about 35%, no more than about 30%), no more than about 25%, no more than about 20%, no more than about 15%, no more than about 10%, or no more than about 5%> of the gly cosylated
  • glucoeerebrosidase molecules comprise a glycan that comprises 6 mannoses or more.
  • Glucoeerebrosidase (also called acid ⁇ -glucosidase, D-glucosyi-N- acylsphingosme glucohydrolase, or GCase) is an enzyme with glucosylceramidase activity (EC 3.2.1.45) that is needed to cleave the ⁇ -glucosidic linkage of the chemical glucocerebroside.
  • Mature human glucoeerebrosidase is a 497 amino acid membrane-associated monomelic glycoprotein of about 67 kDa and has a pH optimum for enzymatic activity of about 5.5.
  • Glucoeerebrosidase has five N-glycosylation amino acid consensus sequences (Asn-X-Ser/Thr), four of which are normally glycosylated (Asnl9, Asn59, Asnl46 and Asn270).
  • Recombinant- produced glucoeerebrosidase (Cerezyme®; SEQ ID NO:2) differs from placenta
  • glucoeerebrosidase (Ceredase®; SEQ ID NO:3) in position 495, in which an argi ine is substituted with a histidine.
  • the lysosomal protein comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to Imiglucerase (Cerezyme®; SEQ ID NO: 2).
  • the lysosomal protein comprises an amino acid sequence that is at least 75%», at least 8G%>, at least 85%), at least 90%», at least 95%, at least 96%), at least 97%, at least 98%, at least 99%, or 100% identical to Alglucerase (Ceredase ⁇ ; SEQ ID NO: 3).
  • the glycan-modified glucoeerebrosidase can be used to treat Gaucher s (types 1 , 2, and 3).
  • the lysosomal protein is an acid a-glucosidase (E.C. 3,2. 1.20).
  • the acid a-glucosidase is a human acid a-ghicosidase.
  • the invention provides a composition comprising an acid a-glucosidase, wherein the composition is characterized by: (a) at least about 60% of the acid a-glucosidase molecules are glycosylated; and (b) at least about 50% of the glycosylated acid a-giucosidase molecules comprise a glycan that comprises: (i) at least one terminal mannose, and (ii) no more than 5 mannose residues total.
  • At least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the acid ⁇ -giucosidase molecules are glycosylated; and at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%», about 96%», at least about 97%, at l east about 98%, or at least about 99% of the glycosylated acid ⁇ -glucosidase molecules comprise a glycan that comprises (i) at least one terminal mannose, (ii) no more than 5 mannose residues total.
  • At least about 50% e.g., at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%>, about 96%>, at least about 97%. at least about 98%, or at least about 99%
  • the glycosylated acid a-glucosidase molecules comprise a glycan that comprises (i) at least one terminal mannose, (ii) no more than 5 mannose residues total; and (iii) does not comprise a xylose or an a(l ,3)-fucose.
  • Acid a-glucosidase is a lysosomal enzyme essential for the degradation of glycogen to glucose in lysosomes, and catalyzes the hydrolysis of a- 1,4- and a- 1,6- glycosidic linkages of glycogen.
  • Human acid ⁇ -glucosidase is encoded by the GAA gene,
  • the lysosomal protein comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to Alglucosidase alfa (Lumizyme® or Myozyme ⁇ ; SEQ ID NO: I).
  • Alglucosidase alfa Commercially available Alglucosidase alfa is produced by recombinant DNA technology in a Chinese hamster ovary cell line.
  • the glycan-modified acid a-gtucosidase can be used to treat Pompe disease, (3) Protease Inhibitors
  • the lysosomal protein is protease inhibitor.
  • the protease inhibitor is a human protease inhibitor.
  • the invention provides a composition comprising a protease inhibitor, wherein the composition is characterized by: (a) at least about 60% of the protease inhibitor molecules are glycosylated; and (b) at least about 50% of the glycosylated protease inhibitor molecules comprise a glycan that comprises: (i) at least one terminal mannose, and (ii) no more than 5 mannose residues total.
  • At least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%», at least about 90%», at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the protease inhibitor molecules are glycosylated; and at least about 50%), at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%», about 96%», at least about 97%), at least about 98%, or at least about 99%) of the glycosylated protease inhibitor molecules comprise a glycan that comprises (i) at least one terminal mannose, (ii) no more than 5 mannose residues total.
  • At least about 50%) (e.g., at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%», about 96%», at least about 97%, at least about 98%, or at least about 99%) of the glycosylated protease inhibitor molecules comprise a glycan that comprises (i) at least one terminal mannose, (ii) no more than 5 mannose residues total; and (iii) does not comprise a xylose or an a(l,3)-fucose.
  • the lysosomal protein is a trypsin inhibitor, such as alphaj -antitrypsin (also known as the serum trypsin inhibitor), ovomucoid, basic pancreatic trypsin inhibitor (e.g., aprotinin), a soybean trypsin inhibitor (SBTI, such as a Kunitz trypsin inhibitor, or a Bowman-Birk trypsin and chymotrypsin inhibitor).
  • alphaj -antitrypsin also known as the serum trypsin inhibitor
  • SBTI soybean trypsin inhibitor
  • Alpha 1 -Antitrypsin is a protease inhibitor belonging to the serpin superfamily.
  • neutrophil elaslase In its absence, neutrophil elaslase is free to break down eiastin, which contributes to the el asticity of the lungs, resulting in respiratory complications such as emphysema, or COPD (chronic obstructive pulmonary disease) in adults and cirrhosis in adults or children.
  • Mature al -antitrypsin is a single-chain glycoprotein of 394 amino acids, and has a number of glycoforms. The three N-linked glycosvlation sites are mainly biantennary (complex) N-glycans.
  • Asparagine 107 (ExPASy amino acid nomenclature) shows a considerable heterogeneity, since tri- and even tetra-antennary N-glycans can be attached to Asnl07. These glycans also cany different amounts of sialic acids. In addition, ai,3 inked fucosylated triantennary N-glycans, which forms part of the "Sialyl Lewis x epitope,” also exist.
  • the lysosomal protein comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%), at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to al -antitrypsin (SEQ ID NO: 4).
  • the gly can-modified alpha 1 -antitrypsin can be used to treat alpha 1 ⁇ antitrypsin deficiency.
  • the lysosomal protein is an esterase inhibitor, such as a CI Esterase Inhibitor, or a Ubiquitin C-Terminal Hydrolase Esterase (UCH) inhibitor (e.g., UCH-L1 Inhibitor, UCH-L2 Inhibitor, or UCH-L3 Inhibitor).
  • esterase inhibitor such as a CI Esterase Inhibitor, or a Ubiquitin C-Terminal Hydrolase Esterase (UCH) inhibitor (e.g., UCH-L1 Inhibitor, UCH-L2 Inhibitor, or UCH-L3 Inhibitor).
  • UCH Ubiquitin C-Terminal Hydrolase Esterase
  • CI -inhibitor (also called CI esterase inhibitor) is a protease inhibitor belonging to the serpin superfamily. Its main function is to inhibit the complement system to prevent spontaneous activation.
  • CI -inhibitor has a 2-domain structure. The C-terminal serpin domain is similar to other serpins, and is responsible for its mhibitory activity. The N-terminal domain is not essential for its inhibitor ⁇ ' activity.
  • CI -inhibitor is highly glycosylated, bearing both N- and O-glycans. The N-terminal domain is especially heavily glycosylated.
  • Human CI - inhibitor is encoded by the SERPING1 gene.
  • HAE hereditary angioneurotic edema
  • the lysosomal protein comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to human CI -inhibitor (Cinryze®, SEQ ID NO: 5). Cinryze ⁇ is a pharmaceutical-grade CI -inhibitor approved for the use of HAE.
  • the glycan-modified CI -inhibitor can be used for treating CI -inhibitor deficiency (Types I, II, III), as well as sepsis, vascular leak syndrome, acute myocardial infarction, pancreatitis, thermal injury, and for the management of xenotransplantation. See, Caliezi C, et al, Pharmacol. Rev. 52 (1): 91-112 (2008).
  • the lysosomal protein is an a-galactosidase A (E.G. 3.2.1.22).
  • the a-galactosidase A is a human a-galactosidase A.
  • the invention provides a composition comprising an ⁇ -galactosidase A, wherein the composition is characterized by: (a) at least about 60%) of the a-galactosidase molecules are glycosylated; and (b) at least about 50% of the glycosylated a-galactosidase molecules comprise a glycan that comprises: (i) at least one terminal mannose, and (ii) no more than 5 mannose residues total.
  • At least about 50% e,g,, at least about 50%, at least about 55%, at least about 60%), at least about 65%), at least about 70%
  • at least about 75% at least about 80%, at least about 85%
  • at least about 90% at least about 95%, about 96%, at least about 97%, at least about 98%>, or at least about 99%
  • the glycosylated acid a-glucosidase molecules comprise a glycan that comprises (i) at least one terminal mannose, (ii) no more than 5 mannose residues total; and (iii) does not comprise a xylose or an cx(l ,3)-fucose.
  • a-galactosidase A (a-D-galactoside galactohydrolase, E.C. 3.2, 1.22) is a lysosomal glycoprotein of about 101 kDa and has a homodimeric structure, It contains a 5-15% N-linked complex and high-mannose oligosaccharide chains. It hydrolyses the terminal a- galactosyl moieties from glycolipids and glycoproteins, It predominantly hydrolyzes ceramide trihexoside, and it can catalyze the hydrolysis of melibiose into galactose and glucose, a- galactosidase A is encoded by the GLA gene.
  • the lysosomal protein comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%), at least 98%, at least 99%, or 100% identical to Agalsidase (Replagal® or
  • Fabrazyme® SEQ ID NO: 10
  • Replagal ⁇ Agalsidase alpha
  • Fabrazyme® Agalsidase beta
  • a cDNA, Agalsidase alpha and beta both have the same amino acid sequence as the native enzyme
  • the glycan-modified ⁇ -galactosidase A can be used to treat Fabry's disease.
  • the invention also provides methods for producing glycan-modified lysosomal proteins, in particular on a large or commercial scale.
  • the method comprises culturing a host ceil in a large scale cell culture in the presence of an RNA effector that targets a gene that encodes an enzyme or a transporter protein that is involved in a glycosylation pathway.
  • the RNA effector transiently reduces the expression level of the target gene, thereby altering the glycosylation profile of a lysosomal protein.
  • the invention provides a method for producing a composition comprising a lysosomal protem, the method comprises: culturing a large scale host ceil culture in a medium that comprises an effective amount of an RNA effector molecule; fa) wherein the host ceil (i) expresses the lysosomal protein, and (ii) comprises a target gene that encodes Mannose-P-dolichol utilization defect 1 protein (MPDUl); (b) wherein the RNA effector is substantially complementary to the target gene that encodes MPDU 1 , and reduces or prevents the expression of the target gene; and (c) wherein the host ceil is cultured for a period of time sufficient for the production of the iyososomal protein.
  • MPDUl Mannose-P-dolichol utilization defect 1 protein
  • MPDUl (also known as Lec35) is an endoplasmic reticulum membrane protein that is required for the utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and giycosylphosphatidyiinositols ⁇ see, e.g., Wopereis et ai,, Clinical Chemistry 52: 574-600, 2006). Mutations in MPDUl result in congenital disorder of glycosylation type I F. The sequence of hamster gene that encodes MPDUl is provided in Appendix II.
  • the host cell may further comprises a second target gene that encodes a mannosyl (a- 1 ,3-)-glycoprotein beta- 1,2-N-acetylglucosaminyltransferase (MGAT); and the method may further comprise: culturing the large scale host ceil culture in a medium that comprises an effective amount of a second RNA effector molecule, wherein the second RNA effector is substantially complementary to the second target gene that encodes MGAT, and wherein the RNA effector reduces or prevents the expression of the second target gene that encodes M GAT.
  • MGAT mannosyl
  • MGAT mannosyl (a- 1 ,3-)-glycoprotein beta- 1,2-N-acetylglucosaminyltransferase
  • MGATs are a family of enzymes that are responsible for the biosynthesis of hybrid-type and complex-type N-glycans ( Figure 1).
  • Known members of MGATs include, e.g., MGAT1 (EC 2.4.1.101), MGAT2 (EC 2.4.1.143), MGAT3 (EC 2.4.1.144), GAT4A and MGAT4B (EC 2.4.1.144), MGATS A and MGAT5B (EC 2.4.1.155).
  • the sequences of hamster gene that encodes MGATl , MGAT2, and MGAT4B are provided in Appendix II, In certain embodiments, MGATl , MGAT2, or MGAT4B, is targeted.
  • MGAT 1 is targeted.
  • MGAT2 is targeted.
  • the invention provides a method for producing a composition comprising a lysosomal protein, the method comprises: culturing a large scale host cell culture in a medium that comprises an effecti ve amount of an RNA effector molecule; (a) wherein the host cell (i) expresses the lysosomal protein, and (ii) comprises a target gene that encodes a mannosyl (a-1 ,3-)-giycoprotein beta-1 ,2-N-acetylglucosaminyltransferase (MGAT); (h) wherein the RNA effector is substantially complementary to the target gene that encodes MGAT, and reduces or prevents the expression of the target gene; and (c) wherein the host cell is cultured for a period of time sufficient for the production of the lyososomal protein.
  • MGATl MGAT2, or MGAT4B
  • MGAT2 is targeted, In one embodiment, MGAT2 is targeted
  • the lysosomal protein is a human lysosomal protein.
  • the host cell is not a human host ceil, it may be desirable to also reduce or prevent the expression of the corresponding host lysosomal protein.
  • CHO cells or CHO-derived ceils
  • the endogenous hamster glucocerebrosidase expressed by CHO cells could co-purify with exogenous human glucocerebrosidase.
  • the invention provides a method for producing a composition comprising an exogenous lysosomal protein, the method comprises: culturing a large scale host cell culture in a medium that comprises an effective amount of an RNA effector molecule; (a) wherein the host cell comprises (i) an exogenous nucleic acid that expresses the exogenous lysosomal protein, and (ii) an endogenous target gene that encodes an ortholog of the lysosomal protein; (b) wherein the RNA effector is substantially complementary to the endogenous target gene that encodes the ortholog, and reduces or prevents the expression of the endogenous target gene; and (c) wherein the host cell is cultured for a period of time sufficient for the production of the lysosomal protein.
  • the host cell is a CHO cell, or CHO-derived cell.
  • the exogenous lysosomal protein is a human lysosomal protein, and the endogenous gene encodes the hamster ortholog of the human lysosomal protein,
  • the exogenous lysosomal protein is huma
  • the exogenous lysosomal protein is human acid a-glucosidase. and the endogenous target gene encodes hamster acid a-glucosidase. in certain embodiments, the exogenous lysosomal protein is a human trypsin inhibitor, and the endogenous target gene encodes the corresponding hamster trypsin inhibitor, in certain embodiments, the exogenous lysosomal protein is a human esterase inhibitor, and the endogenous target gene encodes the corresponding hamster esterase inhibitor. In certain embodiments, the exogenous lysosomal protein is human a-galactosidase A, and the endogenous target gene encodes hamster ct- galactosidase A.
  • the R A effector can be an siRNA, shRNA, or antisense RNA.
  • Additional genes that encode a protein that is involved in lysosome targeting may also be targeted, such as, e.g., a protein that is involved in the synthesis of mantiose-6- phosphate.
  • the RNA effector transiently reduces the expression of its target gene.
  • the method further comprising harvesting said glycoprotein from said large scale culture.
  • RNA effector molecules that are suitable for modifying glycosylation process of a host cell has been disclosed in detail in WO 2011/005786, and is described brief below.
  • RNA effector molecules are ribonucleotide agents that are capable of reducing or preventing the expression of a target gene within a host cel l, or ribonucleotide agents capable of forming a molecule that can reduce the expression level of a target gene within a host cell.
  • a portion of a RNA effector molecule, wherein the portion is at least 10, at least 12, at least 15, at least 17, at least 18, at least 19, or at least 20 nucleotide long, is substantially complementary to the target gene.
  • the complementary region may be the coding region, the promoter region, the 3' untranslated region (3'-UTR), and/or the 5'-UTR of the target gene.
  • RNA effector molecules are complementary to the target sequence (e.g., at least 17, at least 18, at least 19, or more contiguous nucleotides of the RNA effector molecule are complementary to the target sequence).
  • the RNA effector molecules interact with RNA transcripts of target genes and mediate their selective degradation or otherwise prevent their translation.
  • RNA effector molecules can comprise a single RNA strand or more than one RNA strand.
  • RNA effector molecules include, e.g., double stranded RN A
  • RNA effector molecule can be single-stranded or double-stranded.
  • a single-stranded RNA effector molecule can have double- stranded regions and a double-stranded RNA effector can have single-stranded regions.
  • the RNA effector molecules are double-stranded RNA, wherein the antisense strand comprises a sequence that is substantially complementary to the target gene.
  • RNA effector molecule e.g., within a dsRNA (a double-stranded ribonucleic acid) may be fully complementary or substantially complementary. Generally, for a duplex up to 30 base pairs, the dsRNA comprises no more than 5, 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to regulate the expression of its target gene.
  • the RNA effector molecule comprises a single- stranded oligonucleotide that interacts with and directs the cleavage of RN A transcripts of a target gene.
  • single stranded RNA effector molecules comprise a 5' modification including one or more phosphate groups or analogs thereof to protect the effector molecule from nuclease degradation.
  • the RNA effector molecule can be a single-stranded antisense nucleic acid having a nucleotide sequence that is complementary to a "sense" nucleic acid of a target gene, e.g., the coding strand of a double-stranded cDNA molecule or a RNA sequence, e.g., a pre-mRNA, mRNA, miRNA, or pre-miRNA. Accordingly, a antisense nucleic acid can form hydrogen bonds with a sense nucleic acid target.
  • antisense nucleic acids can be designed according to the mles of Watson- Crick base pairing.
  • the antisense nucleic acid can be complementary to the coding or noncoding region of a RNA, e.g., the region surrounding the translation start site of a pre-mRNA or mRNA, e.g., the 5' UTR.
  • An antisense oligonucleotide can be, for example, about 10 to 25 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length).
  • the antisense oligonucleotide comprises one or more modified nucleotides, e.g., phosphorothioate derivatives and/or acridine substituted nucleotides, designed to increase its biological stability of the molecule and/or the physical stability of the duplexes formed between the antisense and target nucleic acids.
  • Antisense oligonucleotides can comprise ribonucleotides only, deoxyribonucleotides only (e.g., oligodeoxynucleotides), or both deoxyribonucleotides and ribonucleotides.
  • an antisense agent consisting only of ribonucleotides can hybridize to a complementary RNA and prevent access of the translation machinery to the target RNA transcript, thereby preventing protein synthesis.
  • An antisense molecule including only deoxyribonucleotides, or deoxyribonucleotides and ribonucleotides, can hybridize to a complementar RNA and the RN A target can be subsequently cleaved by an enzyme, e.g., RNAse H, to prevent translation.
  • the flanking RNA sequences can include 2'-0-methylated nucleotides, and phosphorothioate linkages, and the internal DNA sequence can include phosphorothioate internucleotide linkages.
  • the internal DNA sequence is preferably at least five nucleotides in length when targeting by RNAseH activity is desired.
  • the RNA. effector comprises a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA (a) comprises a sense strand and an antisense strand that are substantially complementary to each other; and (b) wherein said antisense strand comprises a region of complementarity that is substantial ly complementary to one of the target genes, and wherein said region of complementarity is from 10 to 30 nucleotides in length.
  • dsRNA double-stranded ribonucleic acid
  • RNA effector molecule is a double-stranded oligonucleotide .
  • the duplex region formed by the two strands is small, about 30 nucleotides or less in length.
  • dsRNA is also referred to as siRNA.
  • the siRNA may be from 15 to 30 nucleotides in length, from 10 to 26 nucleotides in length, from 17 to 28 nucleotides in length, from 18 to 25 nucleotides in length, or from 19 to 24 nucleotides in length, etc.
  • the duplex region can be of any length that permits specific degradation of a desired target RNA through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15 to 30 base pairs in length.
  • the duplex region may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, or any sub-range there between, including, e.g., 15 to 30 base pairs, 15 to 26 base pairs, 15 to 23 base pairs, 15 to 22 base pairs, 15 to 21 base pairs, 15 to 20 base pairs, 15 to 19 base pairs, 15 to 18 base pairs, 15 to 17 base pairs, 18 to 30 base pairs, 18 to 26 base pairs, 18 to 23 base pairs, 18 to 22 base pairs, 18 to 21 base pairs, 18 to 20 base pairs, 19 to 30 base pairs, 19 to 26 base pairs, 19 to 23 base pairs, 19 to 22 base pairs, 19 to 21 base pairs, 19 to 20 base pairs, 20 to 30 base pairs, 19 to 26
  • the two strands forming the duplex structure of a dsRNA can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (a "hairpin loop") between the 3 '-end of one strand and the 5 '-end of the respective other strand forming the duplex structure.
  • a single stranded chain of nucleotides a "hairpin loop"
  • the hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
  • the two substantially complementary strands of a dsRN A are formed by separate RNA strands, the two strands can be optionally covalently linked.
  • the connecting structure is referred to as a "linker.”
  • dsRNAs having a duplex structure of between 20 and 23, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA
  • a double-stranded oligonucleotide can include one or more single-stranded nucleotide overhangs, which are one or more unpaired nucleotide that protrudes from the terminus of a duplex structure of a double-stranded oligonucleotide, e.g., a dsRNA.
  • a double- stranded oligonucleotide can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
  • the overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucieotide(s) of an overhang can be present on the 5' end, 3' end, or both ends of either an antisense or sense strand of a dsRNA.
  • At least one end of a dsR A has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides.
  • the overhang can comprise a deoxyribonucleoside or a nucleoside analog. Further, one or more of the mternucloside l inkages in the overhang can be replaced with a phosphorothioate. In some embodiments, the overhang comprises one or more
  • deoxyribonucleoside or the overhang comprises one or more dT, e.g., the sequence 5'-dTdT-3' or 5'-dTdTdT-3'.
  • overhang comprises the sequence 5'-dT*dT-3, wherein * is a phosphorothioate intemucleoside linkage.
  • RNA effector molecule as described herein can contain one or more mismatches to the target sequence.
  • a RNA effector molecule as described herein contains no more than three mismatches.
  • the rnismatch(s) is (are) not located in the center of the region of complementarity, but are restricted to be within the last 5 nucleotides from either the 5' or 3' end of the region of complementarity.
  • the antisense strand generally does not contain any mismatch within the central 13 nucleotides.
  • dsRNA can be synthesized by standard methods known in the art as further discussed belo w, e.g., by use of an automated D A synthesizer, such as are
  • the RNA effector molecule is a promoter-directed
  • RNA which is substantially complementary to a noncoding region of an mRNA transcript of a target gene.
  • the pdRNA is substantially complementary to the promoter region of a target gene mRNA at a site located upstream from the transcription start site, e.g., more than 100, more than 200, or more than 1,000 bases upstream from the transcription start site.
  • the pdRNA is substantially complementary to the 3'-UTR of a target gene mRNA transcript.
  • the pdRNA comprises dsRNA of 18-28 bases optionally having 3' di- or tri-nucleotide overhangs on each strand.
  • the pdRNA comprises a gapmer consisting of a single stranded polynucleotide comprising a DNA sequence which is substantially complementary to the promoter or the 3'-UTR of a target gene mRNA transcript, and flanking the polynucleotide sequences (e.g., comprising the 5 terminal bases at each of the 5' and 3' ends of the gapmer) comprises one or more modified nucleotides, such as 2 * MOE, 2'OMe, or Locked Nucleic Acid bases (LNA), which protect the gapmer from cellular nucleases.
  • modified nucleotides such as 2 * MOE, 2'OMe, or Locked Nucleic Acid bases (LNA), which protect the gapmer from cellular nucleases.
  • pdRNA can be used to selectively increase, decrease, or otherwise modulate expression of a target gene. Without being limited to theory, it is believed that pdRNAs modulate expression of target genes by binding to endogenous antisense RNA transcripts which overlap with noncoding regions of a target gene mRNA transcript, and recruiting Argonaute proteins (in the case of dsRNA) or host cell nucleases (e.g., RNase H) (in the case of gapmers) to selectively degrade the endogenous antisense RNAs. In some embodiments, the endogenous antisense RNA negatively regulates expression of the target gene and the pdRNA effector molecule activates expression of the target gene.
  • Argonaute proteins in the case of dsRNA
  • RNase H host cell nucleases
  • pdRNAs can be used to selectively activate the expression of a target gene by inhibiting the negative regulation of target gene expression by endogenous antisense RNA.
  • Methods for identifying antisense transcripts encoded by promoter sequences of target genes and for making and using promoter- directed RNAs are known, see, e.g., WO 2009/046397.
  • the RNA effector molecule comprises an aptamer which binds to a non-nucleic acid ligand, such as a small organic molecule or protein, e.g., a transcription or translation factor, and subsequently modifies (e.g., inhibits) activity.
  • a non-nucleic acid ligand such as a small organic molecule or protein, e.g., a transcription or translation factor
  • An aptamer can fold into a specific structure that directs the recognition of a targeted binding site on the non-nucleic acid ligand. Aptamers can contain any of the modifications described herein.
  • the RNA effector molecule comprises an antagomir.
  • Antagomirs are single stranded, double stranded, partially double stranded or hairpin structures that target a micro R A.
  • An antagomir consists essentially of or comprises at least 10 or more contiguous nucleotides substantially complementary to an endogenous miRNA and more particularly a target sequence of an mi RNA. or pre-miRNA nucleotide sequence.
  • Antagomirs preferably have a nucleotide sequence sufficiently complementary to a miRNA target sequence of abou t 12 to 25 nucleotides, such as about 15 to 23 nucleotides, to allow the antagomir to hybridize to the target sequence. More preferably, the target sequence differs by no more than 1, 2, or 3 nucleotides from the sequence of the antagomir.
  • the antagomir includes a non-nucleotide moiety, e.g., a cholesterol moiety, which can be attached, e.g., to the 3' or 5' end of the oligonucleotide agent.
  • a non-nucleotide moiety e.g., a cholesterol moiety, which can be attached, e.g., to the 3' or 5' end of the oligonucleotide agent.
  • antagomirs are stabilized against nucleo lytic degradation by the incorporation of a modification, e.g., a nucleotide modification.
  • antagomirs contain a phosphorothioate comprising at least the firs t, second, and/or third internucleotide linkages at the 5' or 3' end of the nucleotide sequence.
  • antagomirs include a 2 '-modified nucleotide, e.g., a 2'-deoxy, T- deoxy-2'-fluoro, 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl (2'-0-AP), 2 ' -O-dimethy laminoethy 1 (2 ' -O-DMAOE), 2 ' -O-dimethylaminopropyl f 2 '-0-DM AP ), 2 ' -O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA).
  • antagomirs include at least one 2'-0-metbyl-modified nucleotide.
  • the RNA effector molecule is a promoter-directed RNA (pdRNA) which is substantially complementary to a noncoding region of an mRNA transcript of a target gene.
  • the pdRNA can be substantially complementary to the promoter region of a target gene mRNA at a site located upstream from the transcription start site, e.g., more than 100, more than 200, or more than 1,000 bases upstream from the transcription start site.
  • the pdRNA can substantially complementar to the 3'-UTR of a target gene mR A transcript.
  • the pdRNA comprises dsRNA of 18 to 28 bases optionally having 3' di- or tri-nucleotide overhangs on each strand.
  • the dsRNA is substantially complementary to the promoter region or the 3'-UTR region of a target gene mRNA transcript.
  • the pdRNA comprises a gapmer consisting of a single stranded polynucleotide comprising a DNA sequence which is substantially complementary to the promoter or the 3'- UTR of a target gene mRNA transcript, and flanking the polynucleotide sequences (e.g., comprising the five terminal bases at each of the 5 ' and 3' ends of the gapmer) comprising one or more modified nucleotides, such as 2'MOE, 2'OMe, or Locked Nucleic Acid bases (LNA), which protect the gapmer from cellular nucleases.
  • modified nucleotides such as 2'MOE, 2'OMe, or Locked Nucleic Acid bases (LNA), which protect the gapmer from cellular nucleases.
  • Expressed interfering RNA can be used to selectively increase, decrease, or otherwise modulate expression of a target gene.
  • the dsRNA is expressed in the first transfected cell from an expression vector.
  • the sense strand and the antisense strand of the dsRNA can be transcribed from the same nucleic acid sequence using e.g., two convergent promoters at either end of the nucleic acid sequence or separate promoters transcribing either a sense or antisense sequence.
  • two plasmids can be cotransfected, with one of the plasmids designed to transcribe one strand of the dsRN A while the other is designed to transcribe the other strand.
  • Methods for making and using eiRNA effector molecules are known in the art. See, e.g., WO 2006/033756; U.S. Patent Pubs. No. 2005/0239728 and No. 2006/0035344.
  • the RNA effector moiecule comprises a small single- stranded Piwi-interacting RNA (piRNA effector molecule) which is substantially
  • a piRNA effector molecule can be about 10 to 50 nucleotides in length, about 25 to 39 nucleotides in length, or about 26 to 31 nucleotides in length. See, e.g., U.S. Patent Application Pub. No. 2009/0062228.
  • MicroRNAs are a highly conserved class of small RNA. molecules that are transcribed from DN A in the genomes of plants and animals, but are not translated into protein. Pre-microR As are processed into miRNAs. Processed microRNAs are single stranded -17 to 25 nucleotide (nt) RNA molecules that become incorporated into the RNA-induced silencing complex (RISC) and have been identified as key regulators of development, cell proliferation, apoptosis and differentiation.
  • RISC RNA-induced silencing complex
  • the miRNA is completely complementary with the target nucleic acid.
  • the miRNA has a region of noncomplementarity with the target nucleic acid, resulting in a "bulge" at the region of non- complementarity.
  • the region of noncomplementarity (the bul ge) is flanked by regions of sufficient complementarity, e.g., complete complementarity, to allow duplex formation.
  • the regions of complementarity are at least 8 to 10 nucleotides long (e.g., 8, 9, or 10 nucleotides long).
  • RNA effector molecule can include an
  • RNA effector can target an endogenous miRNA which negatively regulates expression of a target gene, such that the RN A effector alleviates mi RNA-based inhibition of the target gene.
  • the miRN A can comprise naturally occurring nucleobases, sugars, and covalent internucleotide (backbone) linkages, or comprise one or more non-naturally-occurring features that confer desirable properties, such as enhanced cellular uptake, enhanced affinity for the endogenous miRN A target, and/or increased stability in the presence of nucleases.
  • an miRNA designed to bind to a specific endogenous miRNA has substantial complementarity, e.g., at least 70%, 80%, 90%, or 100% complementary, with at least 10, 20, or 25 or more bases of the target miRNA.
  • Exemplary oligonucleiotde agents that target miRNAs and pre-miRNAs are described, for example, in U.S. Patent Pubs. No. 20090317907,
  • a miRNA or pre-miRNA can be 10 to 200 nucleotides in length, for example from 16 to 80 nucleotides in length.
  • Mature miRNAs can have a length of 16 to 30 nucleotides, such as 21 to 25 nucleotides, particularly 21, 22, 23, 24, or 25 nucleotides in length.
  • miRNA precursors can have a length of 70 to 100 nucleotides and can have a hairpin conformation.
  • miRNAs are generated in vivo from pre-miRNAs by the enzymes cDicer and Drosha.
  • miRNAs or pre-miRNAs can be synthesized in vivo by a cell-based system or can be chemically synthesized.
  • mi RNAs can comprise modifications which impart one or more desired properties, such as superior stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell-type, and/or cell permeability, e.g., by an
  • Modifications can also increase sequence specificity, and consequently decrease off-site targeting.
  • the RNA effector molecule Upon contact with a ceil expressing the target gene, the RNA effector molecule inhibits the expression of the target gene by at least 10%, as assayed by, for example, a PGR or branched DNA (bDNA)-based method, or by a protein-based method, such as by western blot.
  • Expression of a target gene in cell culture can be assayed by measuring target gene mRNA levels, e.g., by bDNA or TAQMAN® assay, or by measuring protein levels, e.g., by immunofluorescence analysis or quantitative immunoblot.
  • an RNA effector may bechemically modified to enhance stability or other beneficial characteristics.
  • Oligonucleotides can be modified to prevent rapid degradation of the oligonucleotides by endo- and exo-nucleases and avoid undesirable off-target effects.
  • the nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in CURRENT PROTOCOLS IN NUCLEIC ACID
  • Modifications include, for example, (a) end modifications, e.g., 5 ' end modifications (phosphorylation, conjugation, inverted linkages, etc.), or 3 ' end modifications (conjugation, DN A nucleotides, inverted linkages, etc.); (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar; as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5 ' end modifications (phosphorylation, conjugation, inverted linkages, etc.), or 3 ' end modifications (conjugation, DN A nucleotides, inverted linkages, etc.
  • base modifications e.g., replacement with stabilizing bases, de
  • oligonucleotide compounds useful in this invention include, but are not limited to RNAs containing modified backbones or no natural intemucieoside linkages.
  • RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
  • Specific examples of oligonucleotide compounds useful in this invention include, but are not limited to oligonucleotides containing modified or non-natural intemucieoside linkages.
  • Oligonucleotides having modified intern ucloside linkages include, among others, those that do not have a phosphorus atom in the intemucieoside linkage.
  • Modified intemucieoside linkages include (e.g., RNA backbones) include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, ammoaikyiphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphmates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates,
  • RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, ammoaikyiphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphmates, phosphoramidates including 3 '-a
  • thionoalkylphosphonates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5 '-3' or 2'-5' to 5 '-2'.
  • Various salts, mixed salts and free acid forms are also included.
  • both the sugar and the intemucieoside linkage may be modified, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • One such oligomeric compound a RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA), See, e.g., U.S. Patents No. 5,539,082; No, 5,714,331; and No. 5,719,262, Further teaching of PNA compounds can he found, for example, in Nielsen et al., 254 Science 1497-1500 (1991).
  • Modified oligonucleotides can also contain one or more substituted sugar moieties.
  • the RNA effector molecules e.g., dsRNAs, can include one of the following at the 2' position: H (deoxyribose); OH (ribose); F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N- alkynyi; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and aikynyl can be substituted or unsubstituted Q to Cio alkyl or C 2 to Cio alkenyl and aikynyl.
  • Exemplary suitable modifications include 0[(CH 2 ) n O] ra CH , 0(CH 2 ) n OCH 3 , G(CH 2 ) n NH 2 , 0(CH 2 ) :1 CH 3 , 0(CH 2 ) n ONH 2 , and 0(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to 10, inclusive.
  • oligonucleotides include one of the following at the 2' position: Ci to Cio lower alkyl, substituted lower alky], alkaryl, aralkyl, Q ⁇ alkaryl or O-aralkyl, SH, 8CH 3 , OCN, CI, Br, CN, CF 3 , OCF3.
  • SOCH 3 S0 2 CH 3 , ON0 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalky] amino, substituted silyl, a RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide (e.g., a RNA effector molecule), or a group for improving the pharmacodynamic properties of an oligonucleotide (e.g., a RNA effector molecule), and other substituents having similar properties.
  • a RNA cleaving group e.g., a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide (e.g., a RNA effector molecule), or a group for improving the pharmacodynamic properties of an oligonucleotide (e.g.,
  • the modification includes a 2'-methoxyethoxy (2'-0- CH 2 CH 2 OCH 3 , also known as 2 , -0-(2-methoxyethyl) or 2 -MOE) (Martin et al., 78 Helv. Chim. Acta 486-504 (1995)), i.e., an alkoxy-alkoxy group.
  • Another exemplary modification is 2'- dimethylaminooxyethoxy, i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2 -D AOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethylaminoethoxyethyl or 2 -DMAEOE), i.e., 2'-0-CH 2 -0-CH 2 -N(CH 2 ) 2 .
  • Oligonucleotides can also ha ve sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Representative patents that teach the preparation of such modified sugar stmctures include, but are not limited to, U.S. Patents No. 4,981,957; No. 5,1 18,800;
  • An oligonucleotide e.g., a RNA effector molecule
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (Li).
  • Modified nucleobases include other synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubuiarine, isoguanisine, tubercidine, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine 5 2
  • 5-(cyanoalkyl)uracil 5-(dialkylaminoalkyl)uracii, 5 (dimethyiaminoalkyl)uracil, 5-(halo)uracii, 5-(methoxy)uracil, uracil-5 oxyacetic acid, 5 (methoxycarbonylmethyl)-2-(thio)uracil,
  • 6- (aza)pyriniidine 2 (animo)purine, 2,6-(diamino)purine, 5 substituted pyriniidines,
  • Modified nucleobases also include natural bases that comprise conjugated moieties, e.g., a ligand.
  • the oligonucleotides can also be modified to include one or more locked nucleic acids (LNA).
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3 -endo structural conformation.
  • the addition of locked nucleic acids to oligonucleotide molecules has been shown to increase oligonucleotide molecule stability in serum, and to reduce off-target effects. Elmen et al., 33 Nucl. Acids Res. 439-47 (2005); Mook et al, 6 Mol. Cancer Ther.
  • the oligonucleotides of a RNA effector molecule can be modified by a non-ligand group.
  • a non-ligand group A number of non-iigaiid molecules have been conjugated to oligonucleotides in order to enhance the activity, cellular distribution or cellular uptake of the oligonucleotides, and procedures for performing such conjugations are available in the scientific literature.
  • Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo et al., 365 Biochem. Biophys. Res. Comm.
  • a phospholipid e.g., di-hexadecyi- rac-glyceroi or triethylammonium 1 ,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate
  • RNA conjugates Representative United States patents that teach the preparation of such RNA conjugates have been listed herein.
  • Typical conjugation protocols involve the synthesis of an oligonucleotide bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted wit the molecule being conjugated using appropriate coupling or activating reagents.
  • the conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
  • RNA effector molecules to cells can be achieved in a number of different ways.
  • suitable delivery methods are well known in the art.
  • the skilled person is directed to WO 2011/005786, which discloses exemplary delivery methods that can be used in this invention at pages 187-219, the teachings of which are incorporated herein by reference,
  • deliver ⁇ ' can be performed directly by administering a composition comprising a RNA effector molecule, e.g., an siRNA, into cell culture.
  • delivery can be performed indirectly by administering into the cell one or more vectors that encode and direct the expression of the RNA effector molecule.
  • a reagent that facilitates RNA effector molecule uptake may be used.
  • an emulsion, a cationic lipid, a non-cationic lipid, a charged lipid, a liposome, an anionic lipid, a penetration enhancer, a transfection reagent or a modification to the RNA effector molecule for attachment e.g., a ligand, a targeting moiety, a peptide, a lipophillic group, etc.
  • RNA effector molecules can be delivered using a drug deliver ⁇ ' system such as a nanoparticie, a dendrimer, a polymer, a liposome, or a cationic delivery system.
  • a drug deliver ⁇ ' system such as a nanoparticie, a dendrimer, a polymer, a liposome, or a cationic delivery system.
  • Positively charged cationic deliver ⁇ ' systems facilitate binding of a RNA effector molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient cellular uptake.
  • Cationic lipids, dendrimers, or polymers can either be bound to RNA effector molecules, or induced to form a vesicle, liposome, or micelle that encases the RNA effector molecule. See, e.g., Kim et al., 129 J. Contr. Release 107-16 (2008).
  • the reagent that facilitates RNA effector molecule uptake used herein comprises a charged lipid as described in international Application Ser.
  • RNA effector molecules described herein can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes.
  • the RNA effector molecules can be complexed to lipids, in particular to cationic lipids, Suitable fatty acids and esters include but are not limited to arachidomc acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, iinoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate,
  • the RNA effector molecules are fully encapsulated in the lipid formulation (e.g., to form a SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle).
  • SNALP refers to a stable nucleic acid-lipid particle: a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as a RNA effector molecule or a plasmid from which a RNA effector molecule is transcribed.
  • SNALPs are described, e.g., in U.S. Patent Pubs. No. 2006/0240093, No. 2007/0135372; No. 2009/0291 131; U.S.
  • SPLP refers to a nucleic acid- lipid particle comprising plasmid DNA encapsulated within a lipid vesicle.
  • SNALPs and SPLPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate), SPLPs include "pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in WO 00/03683.
  • the particles in this embodiment typically have a mean diameter of about 50 nm to about 150 nm.
  • nucleic acids when present in the nucleic acid- lipid particles of the present invention are resistant in aqueous solution to degradati on with a nuclease.
  • Nucleic acid-lipid particles and their method of preparation are reported in, e.g., U.S. Patents No. 5,976,567; No. 5,981,501; No. 6,534,484; No. 6,586,410; No. 6,815,432; and WO 96/40964.
  • the lipid to RNA ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) can be in ranges of from about 1 : 1 to about 50: 1, from about 1 : 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1, from about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1, inclusive.
  • a cationic lipid of the formulation can comprise at least one protonatable group having a pKa of from 4 to 15.
  • the cationic lipid can be, for example, N,N-dioleyl-N, - dimethyiammonium chloride (DODAC), N.N-distearyl-N,N-dimethylammomum bromide (DDAB), N-(I-(2,3- dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(i- (2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyioxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane
  • DODAC N,N-dioleyl-N, - dimethyiam
  • DLinAP 3-(N,N ⁇ Dioleyiamino)- 1 ,2-propanedio
  • DOAP 1,2-Diiinoieyloxo ⁇ 3-(2-N,N- dimethylamino)ethoxypropane
  • DLin-EG-DMA 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]- dioxolane
  • DLin- -DMA 2,2-Dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane, or a mixture thereof.
  • the cationic lipid can comprise from about 20 mol% to about 70 mol%, inclusive, or about 40 mol% to about 60 mol%, inclusive, of the total lipid present in the particle. In one embodiment, cationic lipid can be further conjugated to a ligand.
  • a non-cationic lipid can be an anionic lipid or a neutral lipid, such as distearoyl-phosphatidylcholine (DSPC), dioieoylphosphatidyicholine (DOPC), dipalmitoyl- phosphatidylcholine (DPPC), dioieoylphosphatidylglycerol (DOPG), dipalmitoyl- phosphatidylglycerol (DPPG), dioleoyi-phosphatidylethanolamine (DOPE), palmitoyioleoyl- phosphatidylcholine (POPC), palmitoyloleoyl- phosphatidylethanolamme (POPE), dioleoyl- phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-I- carboxylate (DOPE-mal), dipalrnitoyi phosphatidyl ethanolarnine (DPPE), distearoy
  • the lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospho!ipid, a PEG-ceramide (Cer), or a mixture thereof.
  • PEG polyethyleneglycol
  • the PEG-DAA can be, for example, a PEG-dilauryloxypropyl (CI 2), a PEG- dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (CI 6), or a PEG- distearyloxypropyl (CI 8),
  • the lipid that prevents aggregation of particles can be from 0 mo I % to about 20 mol % or about 2 moi % of the total lipid present in the particle.
  • PEG lipid can be further conjugated to a ligand.
  • the nucleic acid-iipid particle further includes a steroid such as, cholesterol at, e.g., about 10 mol% to about 60 moi%, inclusive, or about 48 mol% of the total lipid present in the particle.
  • a steroid such as, cholesterol at, e.g., about 10 mol% to about 60 moi%, inclusive, or about 48 mol% of the total lipid present in the particle.
  • the lipid particle comprises a steroid, a PEG lipid and a cationic lipid of formula (I):
  • each Xa and Xb for each occurrence, is independently CI -6 alkylene; n is 0, 1, 2, 3, 4, or 5; each R is independently H, m is 0, 1 , 2, 3 or 4; Y is absent, O, NR , or S; R 1 is alkyl alkenyl or alkynyl; each of which is optionally substituted with one or more substituents; and R 2 is H, alkyl alkenyl or alkynyl; each of which is optionally substituted each of which is optionally substituted with one or more substituents,
  • the lipidoid ND98-4HC1 (MW 1487) (Formula 2)
  • Cholesterol (Sigma- Aldrich), and PEG-Ceramide CI 6 (Avanti Polar Lipids) ca be used to prepare lipid RNA effector molecule nanoparticies (e.g., LNPOl particles).
  • Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg mL; Cholesterol, 25 mg mL, PEG- Ceramide C16, 100 mg/mL.
  • the ND98, Cholesterol, and PEG-Ceramide CI 6 stock solutions can then be combined in, e.g., a 42:48: 10 molar ratio.
  • the combined lipid solution can be mixed with aqueous RNA effector molecule (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35% to 45% and the final sodium acetate concentration is about 100 mM to 300 mM, inclusive.
  • aqueous RNA effector molecule e.g., in sodium acetate pH 5
  • Lipid RNA effector molecule nanoparticies typically form spontaneously upon mixing.
  • the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 imi cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, inc). In some cases, the extrusion step can be omitted.
  • Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration.
  • Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
  • PBS phosphate buffered saline
  • the nucleic acid-Iipid particle further includes a steroid such as, cholesterol at, e.g., about 10 mol% to about 60 mol%, inclusive, or about 48 mol% of the total lipid present in the particle.
  • a steroid such as, cholesterol at, e.g., about 10 mol% to about 60 mol%, inclusive, or about 48 mol% of the total lipid present in the particle.
  • LNPOl formulations are described elsewhere, e.g., WO 2008/042973.
  • the reagent that facilitates RNA effector molecule uptake used herein comprises a cationic lipid as described in e.g., in International Application Ser. No. PCT/US 10/59206, filed 7 December 2010.
  • the RNA effector molecule composition described herein comprises a cationic lipid selected from the group consisting of: “Lipid H”, “Lipid “; “Lipid L”, “Lipid M”; “Lipid P”; or “Lipid R”, whose formulas are indicated as follows:
  • lipids described above such as, e.g., K8, P8 and L8 which refer to formulations comprising Lipid K, P, and L, respectively.
  • K8, P8 and L8 which refer to formulations comprising Lipid K, P, and L, respectively.
  • Some exemplary lipid formulations for use with the methods and compositions described herein are found in e.g., Table 5:
  • the RNA effector molecule composition described herein further comprises a lipid formulation comprising a lipid selected from the group consisting of Lipid H, Lipid K, Lipid L, Lipid M, Lipid P, and Lipid R, and further comprises a neutral lipid and a sterol.
  • the lipid formulation comprises between approximately 25 mol % - 100 mol% of the lipid.
  • the lipid formulation comprises between 0 mol% - 50 mol% cholesterol,
  • the lipid formulation comprises between 30 mol% - 65 mol% of a neutral lipid.
  • the lipid formulation comprises the relative mol% of the components as listed in Table 6 as follows:
  • L.NP12 formulations and XechGl comprising formulations are described, e.g., in International Application Ser. No. PCT/USIO/ 33777, filed May 5, 2010, which is hereby incorporated by reference.
  • Formulations prepared by either the standard or extrusion- free method can be characterized in similar manners.
  • formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Particle size and particle size distribution of lipid-nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, PA). Particles should be about 20-300 nm, such as 40-100 nm in size. The particle size distribution should be unimodal.
  • the total dsRNA effector molecule concentration in the formulation, as well as the entrapped fraction is estimated using a dye exclusion assay.
  • RNA-binding dye such as Ribogreen (Molecular Probes)
  • a formulation disrupting surfactant e.g. 0.5% Triton- XI 00.
  • the total RNA effector molecule in the formulation can be determined by the signal from the sample containing the surfactant, relative to a standard curve.
  • the entrapped fraction is determined by subtracting the "free" RNA effector molecule content (as measured by the signal in the absence of surfactant) from the total RNA effector molecule content. Percent entrapped RNA effector molecule is typically >85%.
  • the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, or at least 120 nm.
  • the suitable range is typically about at least 50 nm to about at least 1 10 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm, inclusive.
  • Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered.
  • Cationic liposomes possess the advantage of being able to fuse to the cell wall.
  • Non-cationic liposomes although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
  • lipid vesicles In order to cross intact cell membranes, lipid vesicles must pass through a series of fine pores, each with a diameter less tha 50 ran, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drags; and liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation. See, e.g., Wang et ai., DRUG DELIV.
  • Liposomes are useful for the transfer and delivery of active ingredients to the site of action . Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act. Liposomal formulations have been the focus of extensive investigation as the mode of deliver ⁇ ' for many drugs. There is growing evidence tha t for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
  • Liposomes fall into two broad classes, Cationic liposomes are positively charged liposomes which interact with the negatively charged polynucleotide molecules to form a stable complex.
  • the positively charged polynucleotide/liposome complex binds to the negatively charged cell surface and is internalized in an endosome, Due to the acidic pH within the endosome, the liposomes are aiptured, releasing their contents into the cell cytoplasm. Wang et ai., 147 Biochem. Biophys. Res, Commun., 980-85 (1987), [00170] Liposomes which are pH-sensitive or negatively-charged, entrap polynucleotide rather than complex with it.
  • liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
  • Neutral liposome compositions for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC),
  • Anionic liposome compositions generally are formed from dimyristoyl
  • phosphatidvlglycerol while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolarmne (DOPE).
  • DOPE dioleoyl phosphatidylethanolarmne
  • Another type of liposomal composition is formed from phosphatidylcholine ( PC) such as, for example, soybean PC, and egg PC,
  • PC phosphatidylcholine
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids,
  • sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome ( A) comprises one or more glycolipids, such as monosialoganglioside GM1 , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of prepara tion thereof, are known in the art.
  • Sunamoto et al. 53 Bull. Chem. Soc. Jpn. 2778 ( 1980)
  • liposomes comprising a nonionic detergent, 2C1215G, that contains a PEG moiety
  • ilium et al. 167 FEBS Lett. 79 (1984)
  • hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives.
  • Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols e.g., PEG are described by Sears (U.S. Patent No, 4,426,330 and
  • antibodies can be conjugated to a polyakylene derivatized liposome (see e.g., PCX Application US 2008/0014255).
  • Klibanov et al. (268 FEBS Lett, 235 (1990)), described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives.
  • DSPE distearoylphosphatidylethanolamine
  • PEG distearoylphosphatidylethanolamine
  • Liposome compositions containing 1-20 mol% of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Patents No. 5,013,556;
  • Liposomes comprising a number of other lipid-poiymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 and in WO 94/20073. Liposomes comprising PEG-modifted ceramide lipids are described in WO 96/10391 , U.S. Patents
  • liposomes can optionally be prepared to contain surface groups, such as antibodies or antibody fragments, small effector molecules for interacting with cell-surface receptors, antigens, and other like compounds, and these groups can facilitate delivery of liposomes and their contents to specific cell populations.
  • ligands can be included in the liposomes by including in the liposomal lipids a lipid derivatized with the targeting molecule, or a lipid having a polar-head chemical group that can be derivatized with the targeting molecule in preformed liposomes.
  • a targeting moiety can be inserted into preformed liposomes by incubating the preformed liposomes with a ligand-polymer-lipid conjugate.
  • Lipids can be derivatized using a variety of targeting moieties, such as ligands, cell surface receptors, glycoproteins, vitamins (e.g., riboflavin) and monoclonal antibodies by covendingly attaching the ligand to the free distal end of a hydrophilic polymer chain, which is attached at its proximal end to a vesicle-forming lipid.
  • targeting moieties such as ligands, cell surface receptors, glycoproteins, vitamins (e.g., riboflavin) and monoclonal antibodies
  • covendingly attaching the ligand to the free distal end of a hydrophilic polymer chain which is attached at its proximal end to a vesicle-forming lipid.
  • hydrophilic polymer polyethyleneglycol (PEG) has been studied widely. Allen et al..
  • a number of liposomes comprising nucleic acids are known in the art, such as methods for encapsulating high molecular weight nucleic acids in liposomes.
  • WO 96/40062 discloses protein-bonded liposomes and asserts that the contents of such liposomes can include a dsRNA.
  • U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotid.es in liposomes.
  • WO 97/04787 to Love et al. discloses liposomes comprising dsRNAs targeted to the raf gene.
  • methods for preparing a liposome composition comprising a nucleic acid can be found in, e.g., U.S. Patents No. 6,011,020; No. 6,074,667; No. 6,1 10,490; No. 6,147,204;
  • Transfersomes are yet another type of liposomes, and are highly deforrnable lipid aggregates which are attractive candidates for drag delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the
  • Encapsulated nanoparticles can also be used for delivery ofRNA effector molecules.
  • encapsulated nanoparticles include those created using yeast cell wall particles (YCWP).
  • YCWP yeast cell wall particles
  • glucan-encapsulated siRNA particles are payload delivery systems made up of a yeast cell wall particle (YCWP) exterior and a multilayered nanoparticle interior, wherein the multilayered nanoparticle interior has a core comprising a payload complexed with a trapping agent
  • Glucan-encapsulated delivery systems such as those described in U.S. Patent Applications Ser, No. 12/260,998, filed October 29, 2008, can be used to deliver siRNA duplexes to achieve silencing in vitro and in vivo..
  • a host cell can be derived from a yeast, insect, amphibian, fish, reptile, bird, mammal or human, or can be a hybrid cell, such as a hybridoma cell.
  • Host cells can be unmodified cells or cell lines, or cell lines which have been genetically modified (e.g., to facilitate production of a biological product).
  • the host cell is a cell line that has been modified to allow for growth under desired conditions, such as in serum- free media, in cell suspension culture, or in adherent cell culture.
  • a mammalian host cell can be advantageous where the glycoprotein is a mammalian glycoprotein, particularly if the glycoprotein is a biotherapeutic agent or is otherwise intended for administration to or consumption by humans.
  • the host cell is a CHO cell, which is a ceil line used for the expression of many recombinant proteins. Additional mammalian cel l lines used commonly for the expression of recombinant proteins include 293 HEK cells, HeLa cells, COS cells, NIH/3T3 cells, Jurkat Cells, NSQ cells, and HUVEC cells,
  • the host cell is a CHO cell derivative that has been modified genetically to facilitate production of recombinant proteins
  • various CHO cell strains have been developed which permit stable insertion of recombinant DNA into a specific gene or expression region of the cells, amplification of the inserted DNA, and selec tion of cells exhibiting high level expression of the recombinant protein.
  • Examples of CHO cell derivatives useful in methods provided herein include, but are not limited to, CHO-K1 ceils, CHO-DUKX, CHO-DUKX Bl , CHO-DG44 ceils, CHO-ICAM-1 cells, and CHO-hlFNy ceils.
  • Methods for expressing recombinant proteins in CHO cells are known in the art and are described, e.g., in U.S. Patents No, 4,816,567 and No. 5,981,214,
  • Examples of human cell lines useful in methods provided herein include the cell lines 293T (embryonic kidney), 786-0 (renal), A498 (renal), A549 (alveolar basal epithelial), ACHN (renal), BT-549 (breast), BxPC-3 (pancreatic), CAKI-1 (renal), Capan-1 (pancreatic), CCRF-CEM (leukemia), COLO 205 (colon), DLD-1 (colon), DMS 114 (small cell lung), DU145 (prostate), EKVX (non-small cell lung), HCC-2998 (colon), HCT-15 (colon), HCT-116 (colon), HT29 (colon), HT-1080 (fibrosarcoma), HEK 293 (embryonic kidney), HeLa (cervical carcinoma), HepG2 (hepatocellular carcinoma), HL-60(TB) (leukemia), HOP-62 (non- small cell lung), HQP-92 (n
  • adenocarcinoma IGR-OVl (ovarian), IMR32 (neuroblastoma), Jurkat (T lymphocyte), K-562 (leukemia), KM 12 (colon), KM20L2 (colon), LANS (neuroblastoma), LNCap.FGC (Caucasian prostate adenocarcinoma), LOX IMVI (melanoma), i .XI i 529 (non-small cell lung), Ml 4 (melanoma), M19-MEL (melanoma), MALME-3M (melanoma), MCFIOA (mammary epithelial), MCF7 (mammary), MDA-MB-453 (mammary epithelial), MDA-MB-468 (breast), MDA-MB-231 (breast), MDA-N (breast), MOLT-4 (leukemia), NCI/ADR-RES (ovarian), NCI- H226 (non-small
  • TK-10 renal
  • U87 glioblastoma
  • U293 kidney
  • U251 CNS
  • UACC-257 melanoma
  • UACC-62 melanoma
  • UO-31 renal
  • W138 lung
  • XF 498 CNS
  • non-human primate cell lines useful in methods provided herein include the cell lines monkey kidney (CVI-76), African green monkey kidney (VERO-76), green monkey fibroblast (COS-1), and monkey kidney (CVI) cells transformed by SV40 (COS- 7). Additional mammalian cell lines are known to those of ordinary skill in the art and are catalogued at the American Type Culture Collection catalog (Manassas, VA).
  • rodent cell lines useful in methods provided herein include the cell lines baby hamster kidney (BHK) (e.g., BHK21 , BHK TK), mouse Sertoli (TM4), buffalo rat liver (BRL 3A), mouse mammary tumor (MMT), rat hepatoma (HTC), mouse myeloma (NS0), murine hybridoma (Sp2/0), mouse thymoma (EL4), Chinese Hamster Ovary (CHO) and CHO cell derivatives, murine embryonic (NIH/3T3, 3T3 Li), rat myocardial (H9c2), mouse myoblast (C2C12), and mouse kidney (miMCD-3).
  • BHK baby hamster kidney
  • TM4 mouse Sertoli
  • BBL 3A buffalo rat liver
  • MMT mouse mammary tumor
  • HTC mouse myeloma
  • Sp2/0 murine hybridoma
  • EL4 mouse thymoma
  • CHO Chinese Ham
  • the host cell is a multipotent stem cell or progenitor cell.
  • multipotent cells useful in methods provided herein include murine embryonic stem (ES-D3) cells, human umbilical vein endothelial (HuVEC) cells, human umbilical artery smooth muscle (HuASMC) cells, human differentiated stem (HKB-Il) cells, human
  • hMSC mesenchymal stem
  • iPS induced pluripotent stem
  • the host cell is an insect cell, such as Sf9 cell line (derived from pupal ovarian tissue of Spodoptera frugiperda); Hi-5 (derived from Trichoplusla ni egg ceil homogeiiates); or S2 ceils (from Drosophila melanogaster).
  • Sf9 cell line derived from pupal ovarian tissue of Spodoptera frugiperda
  • Hi-5 derived from Trichoplusla ni egg ceil homogeiiates
  • S2 ceils from Drosophila melanogaster
  • the host cells are suitable for growth in suspension cultures.
  • Suspension-competent host cells are generally monodisperse or grow in loose aggregates without substantial aggregation.
  • Suspension-competent host ceils include ceils that are suitable for suspension culture without adaptation or manipulation (e.g., hematopoietic cells, lymphoid cells) and cells that have been made suspension-competent by modification or adaptation of attachment-dependent cells (e.g., epithelial cells, fibroblasts),
  • the host ceil is an attachment dependent ceil which is grown and maintained in adherent culture
  • Exampl es of human adherent cell lines useful in methods provided herein include the ceil lines human neuroblastoma (SH-SY5 Y, IMR32, and LANS), human cervical carcinoma (HeLa), human breast epithelial (MCFIOA), human embryonic kidney (2931 ' ), and human breast carcinoma (S -B 3).
  • the host ceil is a cell line that has been modified to allow for growth under desired conditions, such as in serum-free media, in cell suspension culture, or in adherent cell culture.
  • the host cell can be, for example, a huma Nanialwa Burkitt lymphoma cell (BLcl-kar-Namaiwa), baby hamster kidney fibroblast (BH ), CHO cell, Murine myeloma ceil (NS0, SP2/0), hybridoma cell, human embryonic kidney cell (293 HE ), human retina-derived cell (PER.C6 ⁇ cells, U.S. Patent No.
  • insect cell line (Sf9, derived from pupal ovarian tissue of Spodopiera frugiperda; or Hi-5, derived from Trichoplusia ni egg cell homogenates; see also U.S. Patent No. 7,041 ,500), Madin-Darby canine kidney cell (MDCK), primary mouse brain cells or tissue, primary calf lymph cells or tissue, primary monkey kidney cells, embryonated chicken egg, primary chicken embryo fibroblast (CEF), Rhesus fetal lung cell (FRhL-2), Human fetal lung cell (WI-38, MRC-5), African green monkey kidney epithelial cell (Vero, CV-1), Rhesus monkey kidney cell (LLC-MK2), or yeast cell.
  • MDCK Madin-Darby canine kidney cell
  • primary mouse brain cells or tissue primary calf lymph cells or tissue
  • primary monkey kidney cells embryonated chicken egg, primary chicken embryo fibroblast (CEF), Rhesus fetal lung cell (FRhL-2), Human fetal lung
  • Additional mammalian cell lines commonly used for the expression of recombinant proteins include, but are not limited to, HeLa cells, COS cells, NIH/3T3 cells, Jurkat Cells, and human umbilical vein endothelial cells (HUVEC) cells.
  • HeLa cells include, but are not limited to, HeLa cells, COS cells, NIH/3T3 cells, Jurkat Cells, and human umbilical vein endothelial cells (HUVEC) cells.
  • HUVEC human umbilical vein endothelial cells
  • Host cells can be unmodified or genetically modified (e.g., a cell from a transgenic animal),
  • CEFs from transgenic chicken eggs can have one or more genes essential for the IFN pathway, e.g., interferon receptor, STAT1 , etc., has been disrupted, i.e., is a "knockout.”
  • IFN pathway e.g., interferon receptor, STAT1 , etc.
  • the cell can be modified to allow for growth under desired conditions, e.g., incubation at 30°C, [00193]
  • the host cells may express the glycoprotein of interest endogenous! ⁇ ', or alternatively, the host cell may be engineered to express an exogenous glycoprotein.
  • a host cell may be transfected with one or more expression vectors that encode the glycoprotein.
  • the nucleic acid molecule encoding the glycoprotein may be transiently introduced into the host cell, or stably integrated into the genome of the host cell.
  • one or more recombinant expression vectors encoding a lysosomal protein may be transfected, such that the lysosomal protein is expressed in the host ceil.
  • the host ceil can be engineered such that that the gene encoding the lysosomal protein is activated by an exogenous promoter. This way, a host cell that does not normally express the lysosomal protein (or expresses the lysosomal protein at low level) can be modified to promote the production the lysosomal protein.
  • the glycoprotein may be secreted into the medium in which the host cell is cultured, from which medium the glycoprotein can be recovered.
  • Standard recombinant DNA methodologies may be used to obtain a nucleic acid that encodes a glycoprotein, incorporate the nucleic acid into an expression vector and introduce the vector into a host cell, such as those described in Sambrook, et al. (eds), Molecular Cloning; A Laborator Manual, Third Edition, Cold Spring Harbor, (2001 ); Ausubel, F. M. et al. (eds. ) Current Protocols in Molecular Biology, John Wiley & Sons (1995).
  • a nucleic acid encoding the glycoprotein may be inserted into an expression vector or vectors such that the nucleic acids are operably linked to transcriptional and translational control sequences.
  • the expression vector and expression control sequences are generally chosen to be compatible with the expression host cell used.
  • nucleic acids encoding the lysosomal protein may be first obtained. These nucleic acids can be obtained by amplification and modification of a gene that encodes the lysosomal protein, using e.g., PGR.
  • the expression vector may additionally carry regulatory sequences that control the expression of the
  • glycoprotein in a host cell such as promoters, enhancers or other expression control elements (e. g, , polyadenylation signals) that control the transcription or translation of the nucleic acid(s).
  • expression control elements e. g, , polyadenylation signals
  • Such regulatory sequences are known in the art (see, e.g., Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press (1990)). it will he appreciated by those skilled in the art that the design of the expression vector, including the selection of regulatory sequences may depend on such factors as the choice of the host cell to be
  • regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from
  • CMV cytomegalovirus
  • SV40 Simian Virus 40
  • adenovirus e. g. , the adenovirus major late promoter
  • AdMLP AdMLP
  • the recombinant expression vectors of the invention may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e. g. , origins of replication) and selectable marker genes,
  • the expression vector(s) encoding the glycoprotein may be transfected into a host cell by standard techniques, such as electroporation, calcium-phosphate precipitation, or DEAE-dextran transfection. If desired, viral vectors, such as retro-viral vectors, may also be used to generate stable cell lines (as a source of a continuous supply of the glycoprotein).
  • the methods described hrerein can be applied to any size of cell culture flask and/or bioreactor.
  • the methods can be applied in bioreactors or cell cultures of 10 L, 30 L, 50 L, 100 L, 150 L, 200 L, 300 L, 500 L, 1000 L, 2000 L, 3000 L, 4000 L, 5000 L, 10,000 L or larger.
  • the cell culture size can range from 10 L to 5000 L, from 10 L to 10,000 L, from 10 L to 20,000 L, from 10 L to 50,000 L, from 40 L to 50,000 L, from 100 L to 50,000 L, from 500 L to 50,000 L, from 1000 L to 50,000 L, from 2000 L to 50,000 L, from 3000 I, to 50,000 L, from 4000 L to 50,000 L, from 4500 L to 50,000 L, from 1000 L to 10,000 L, from 1000 L to 20,000 L, from 1000 L to 25,000 L, from 1000 L to
  • Media components include, e.g., buffer, amino acid content, vitamin content, salt content, mineral content, serum content, carbon source content, lipid content, nucleic acid content, hormone content, trace element content, ammonia content, co-factor content, indicator content, small molecule content, hydrolysate content and enzyme modulator content.
  • the growth medium is a chemically defined media such as Biowhittaker ⁇
  • POWERCHO® (Lonza, Basel, Switzerland), HYCLONE PF CHOTM (Thermo Scientific, Fisher Scientific), GlBCO® CD DG44 (Invitrogen, Carlsbad, CA), Medium Ml 99 (Sigma- Aldrich). OPTTPROTM SFM (Gibco), etc).
  • RNA effector molecules are added to the cell culture to regulate the expression level(s) of target gene(s). If more than two or more RNA effector molecules are used, they may be provided at the same concentration, or different concentrations. The RNA effectors may be added simultaneously into the cell culture, or added at different times into the cell culture.
  • an effective amount of an RNA effector is added to the cell culture to allow sufficient reduction of the expression of a target gene.
  • an effecti ve amount of an RNA effector is added to the cell culture such that the expression level of its target gene is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25°/», at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%.
  • RNA effector molecule in general, will be in the range of 0.001 to 200.0 milligrams per unit volume per day.
  • the RNA effector molecule may be provided in the range of 0.001 nM to 200 mM per day, generally in the range of 0.1 nM to 500 nM.
  • a dsRNA can be administered at 0.01 nM, 0.05 nM, 0.1 nM, 0.5 nM, 0.75 nM, 1 nM, 1.5 nM, 2 nM, 3 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 100 nM, 200 nM, 400 nM, or 500 nM per single dose.
  • the RNA effector molecule is administered a cell culture at a concentration less than about 50nM.
  • the composition can be added to the ceil culture once daily, or the RNA.
  • RNA effector molecule can be added as two, three, or more sub-doses at appropriate intervals throughout the day or delivery through a controlled release formulation, In that case, the RNA effector molecule contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage.
  • the dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation, which provides sustained release of the RNA effector molecule over a several-day-period.
  • the effect of a single dose on target gene transcript levels can be long-lasting, such that subsequent doses are administered at not more than 3-, 4-, or 5-day intervals, or at not more than 1-, 2-, 3-, or 4-week intervals.
  • the administration of the RNA effector molecule may be ceased at least 6 hr, at least 12 hr, at least 18 hr, at least 36 hr, at least 48 hr, at least 60 hr, at least 72 hr, at least 96 hr, or at least 120 hr, or at least 1 week, before isolation of the biological product.
  • contacting a host cell (e.g., in a large scale host cell culture) with a RNA effector molecule is complete at least 6 hr, at least 12 hr, at least 18 hr, at least 36 hr, at least 48 hr, at least 60 hr, at least 72 hr, at least 96 hr, or at least 120 hr, or at least 1 week, before isolation of the biological product.
  • RNA effector molecule may be beneficial to provide a RNA effector molecule to the host cell cultures in a way that a constant number (or at least a minimum number) of RNA effector molecules per each cell is maintained. Maintaining the levels of the RN A effector molecule as such can ensure that modul ation of target gene expression is maintained even at high cell densities.
  • the amount of a RNA effector molecule can also be administered according to the cell density.
  • the RNA effector molecule(s) is added at a
  • the RNA effector molecule may be administered at a dose of at least 10 molecules per cell, at least 20 molecules per cell (molecules/cell), at least 30
  • molecules/cell at least 40 molecules/cell, at least 50 molecules/cell, at least 60 molecules/cell, at least 70 molecules/cell, at least 80 molecules/cell, at least 90 molecules/cell at least 100 molecules/cell, at least 200 molecules/cell, at least 300 molecules/cell, at least 400
  • molecules/cell at least 500 molecules/cell, at least 600 molecules/cell, at least 700
  • the RNA effector molecule is administered at a dose within the range of 10-100 molecules/cell, 10-90 molecules/cell, 10-80 molecules/cell, 10-70 molecules/cell, 10-60 molecules/cell, 10-50 molecules/cell, 10-40 molecules/cell, 10-30 molecules/cell, 10-20 molecules/ceil, 90-100 molecules/cell, 80-100 molecules/ceil, 70-100 molecules/cell, 60-100 moiecuies/celi, 50-100 molecules/cell, 40-100 molecules/cell, 30-100 molecules/cell, 20-100 molecules/cell, 30-60 molecules/cell, 30-50 molecules/cell, 40-50 molecules/cell, 40-60 molecules/cell, or any range there between.
  • the RNA effector molecule is administered as a sterile aqueous solution.
  • the RNA effector molecule is formulated in a non-lipid formulation.
  • the RNA effector molecule is formulated in a cationic or non-cationic lipid formulation.
  • the RNA effector molecule is formulated in a cell medium suitable for culturing a host cell (e.g., a serum-free medium).
  • the lysosomal glycoproteins produced in accordance with the methods described herein can be harvested from host cells, and purified using any suitable methods.
  • methods for purifying polypeptides by immune-affinity chromatography are known in the art. Ruiz-Argue Ho et al, J, Gen. Virol, 55:3677-3687 (2004).
  • Suitable methods for purifying desired lysosomal glycoprotein including precipitation and various types of chromatography, such as hydrophobic interaction, ion exchange, affinity, chelating and size exclusion are well-known in the art.
  • Suitable purification schemes can he created using two or more of these or other suitable methods.
  • the glycoprotein can include a "tag" that facilitates purification, such as an epitope tag or a HIS tag.
  • a "tag” that facilitates purification
  • Such tagged polypeptides can conveniently be purified, for example from conditioned media, by chelating chromatography or affinity chromatography.
  • the tag sequence may be cleaved post-purification.
  • normal phase liquid chromatography can be used to separate glycans and/or glycoproteins based on polarity.
  • Reverse-phase chromatography can be used, e.g., with derivatized sugars.
  • Amon-exchange columns can be used to purify sialylated, phosphoryiated, and sulfated sugars.
  • Other methods include high pH anion exchange chromatography and size exclusion chromatography can be used and is based on size separation.
  • Affinity based methods can be selected that preferentially bind certain chemical units and glycan structures.
  • Matrices such as m-ammophenylboronic acid,
  • M- aminophenylboromc acid matrices can form a temporary covalent bond with any molecule (such as a carbohydrate) that contains a 1,2-cis-dioi group. The covalent bond can be subsequently disrupted to eiute the protein of interest.
  • Lectins are a family of carbohydrate-recognizing proteins that exhibit affinities for various monosaccharides. Lectins bind carbohydrates specifically and reversibly. Primary monosaccharides recognized by lectins include
  • Lectin matrices can consist of a number of lectins with varying and/or overlapping specificities to bind glycoproteins with specific glycan compositions. Some lectins commonly used to purify glycoproteins include concavalin A (often coupled to Sepharose or agarose) and Wheat Germ. Anti-glycan antibodies can also be generated by methods known in the art and used in affinity columns to hind and purify glycoproteins.
  • the gly can structure of the lysosomal glycoproteins described herein can be determined using art-known methods for analyzing glycan staictures of glycoproteins, such as chromatography, mass spectrometry (MS), chromatography followed by MS, electrophoresis, electrophoresis followed by MS, nuclear magnetic resonance (NMR), and any combinations thereof, A. preferred technique is Liquid chromatography-mass spectrometry (LC-MS, or alternatively HPLC-MS).
  • an enzyme such as an N-glycanase (e.g. N-glycanase F, N- glycanase-A), can be used to cleave the N-glycan moiety from a glycoprotein.
  • exoglycosidases e.g., sialidase, galactosidase, hexosaminidase, fucosidase, mannosidase etc.
  • sialidase e.g., sialidase, galactosidase, hexosaminidase, fucosidase, mannosidase etc.
  • acid hydrolysis e.g., trifiuoroacetic acid
  • neutral saccharides e.g., galactose, mannose, fucose
  • amino saccharides e.g., N-acetylglucosamine
  • the cleaved or hydrolyzed saccharides can be analyzed using chromatography spectrometry, or electrophoresis methods described above.
  • glycan structure and composition can be analyzed by chromatography, including, e.g., liquid chromatography (LC), high performance liquid chromatography (HPLC), ultra performance liquid chromatography (UPLC), thin layer chromatography (TLC), amide column chromatography, or combinations thereof.
  • LC liquid chromatography
  • HPLC high performance liquid chromatography
  • UPLC ultra performance liquid chromatography
  • TLC thin layer chromatography
  • amide column chromatography or combinations thereof.
  • MS mass spectrometry
  • MALDI- S matrix assisted laser absorption ionisation mass spectrometry
  • FTMS Fourier transform mass spectrometry
  • IMS-MS ion mobility separation with mass spectrometry
  • ETD-MS electron transfer dissociation
  • electrophoresis including, e.g., capillary electrophoresis (CE), CE-MS, gel electrophoresis, agarose gel electrophoresis, aciyiamide gel electrophoresis, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting using antibodies that recognize specific giycan structures, or combinations thereof.
  • CE capillary electrophoresis
  • CE-MS capillary electrophoresis
  • gel electrophoresis agarose gel electrophoresis
  • aciyiamide gel electrophoresis aciyiamide gel electrophoresis
  • SDS-PAGE SDS-polyacrylamide gel electrophoresis
  • Western blotting using antibodies that recognize specific giycan structures, or combinations thereof.
  • the structure of an N-glycan can be determined by two dimensional sugar chain mapping (see, e.g., Anal.
  • Two dimensional sugar chain mapping is a method for deducing the structure of a saccharide chain by plotting the retention time or elution position of the saccharide chain by reverse phase chromatography as the X axis, and the retention time or elution position of the saccharide chain by normal phase chroma tography as the Y axis, respectively, and comparing them with such results of known sugar chains.
  • the structure deduced by two dimensional sugar chain mapping can be confirmed by mass spectrometry.
  • NMR nuclear magnetic resonance
  • I D-NMR one-dimensional NMR
  • 2D-NMR two- dimensional NMR
  • COSY- NMR correlation spectroscopy magnetic-angle spinning N MR
  • TOCSY-NMR total correlated spectroscopy NMR
  • HSQC-NMR ⁇ heteronuclear single-quantum coherence NMR
  • HMQC-NMR rotational nuclear overhauser effect spectroscopy NMR
  • NOESY-NMR nuclear overhauser effect spectroscopy
  • Saccharide composition of a giycan can also be analyzed by fluorescence labeling.
  • acid-hydrolyzed glycans can be labeled with 2-aminopyridine and then analyzed by HPLC.
  • Immunological methods may also be used to determine the structures of N-glycan.
  • lectin molecul es can bind to the carbohydrate moieties of glycoproteins, Therefore, a lectin that binds to a specific N-glycan can be used to identify the presence and quantity of such glycoforms in a composition (e.g., by determining the amount of glycan-bound lectin using a secondary antibody).
  • Examples of lectins that can be used for identifying the glycan structure of an antibody, or a Fc-fusion protein include, e.g., WGA (wheat-germ agglutinin derived from T. vulgaris), Con A
  • a lectin that specifically recognizes a complex N-glycan in which a fucose residue is linked to the N-acetylglucosamine in the reducing end of the N-glycan may be used.
  • Exemplary lectins include, e.g., Lens culinaris lectin LCA (lentil agglutinin derived from Lens culinaris), pea lectin PSA (pea lectin derived from Pisum sativum), broad bean lectin VFA (agglutinin derived from Vicia faba) and Aleuria aurantia lectin AAL (lectin derived from Aleuria aurantia).
  • CE capillary electrophoresis
  • Techniques described herein may be combined with one or more other technologies for the detection, analysis, and or isolation of glycans or glycoproteins.
  • any combination of NMR, mass spectrometry, liquid chromatography, 2-dimensional chromatography, SDS-PAGE, antibody staining, lectin staining, monosaccharide quantitation, capillary electrophoresis, fluorophore-assisted carbohydrate electrophoresis (FACE), micellar elecirokinetic chromatography (ME C), exoglycosidase or endoglycosidase treatments may be used. See, e.g., Anumula, Anal. Biochem, 350(1): 1 , 2006; Klein et al., Anal. Biochem., 179: 162, 1989; Townsend, R,R. Carbohydrate Analysis, High Performance Liquid
  • oMALDI Qq-TOF MS quadrupole-quadrupole time-of-fight mass spectrometry
  • MS/MS tandem mass spectrometry
  • the N-linked glycans are released by treatment with N-glycanase F, reductively aminated with anihranilic acid, and fractionated by norma] phase high-performance liquid chromatography (NP-HPLC).
  • NP-HPLC norma] phase high-performance liquid chromatography
  • the Xuorescent-labeled oligosaccharide pool and fractions are then analyzed by oMALDI Qq-TOF MS and MS/MS in negative ion mode. Each fraction is further digested with an array of exoglycosidase mixtures, and subsequent MALDI TOF S analysis of the resulting products yields information about structural features of the giycan.
  • One exemplary saccharide composition analyzer is BioLC, manufactured by Dionex, which analyzes saccharide composition by HPAEC-PAD (high performance anion- exchange chromatography-pulsed amperometric detection).
  • the biological activity of the glycoprotein compositions described herein may be assessed using any art known method. Such biological activities include, e.g., bioavailability, pharmacokinetics, pharmacodynamics, enzymatic activity etc. Additionally, therapeutic activity of a glycoprotein may be assessed (e.g., efficacy of a lysosomal protein in decreasing severity or symptom of a disease or condition, or in delaying appearance of a symptom of a disease or condition).
  • the potential adverse activity or toxicity e.g., propensity to cause
  • glycoprotein preparations can be analyzed by any available method.
  • immunogenicity of a glycoprotein composition can be assessed, e.g., by determining in vitro by immunoassay (e.g., using an antibody that binds to a recognized immunogenic epitope), or by in vivo administration to determine whether the composition elicits an antibody response in a subject.
  • the invention relates to pharmaceutical compositions comprising the lysosomal proteins described herein.
  • compositions usually one or more pharmaceutical carrier(s) and/or excipient(s). A thorough discussion of such components is available in
  • Such carriers or additives include water, a pharmaceutical acceptable organic solvent, collagen, polyvinyl alcohol, polyvinylpyrrolidone, a carboxyvinyl polymer, carboxymethylcellulose sodium, polyacrylic sodium, sodium alginate, water-soluble dextran, carboxymethyl starch sodium, pectin, methyl cellulose, ethyl cellulose, xanthan gum, gum Arabic, casein, gelatin, agar, di glycerin, glycerin, propylene glycol, polyethylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin (HSA), mannitol, sorbitol, lactose, a
  • HSA human serum albumin
  • the glycoprotein can be lyophilized for storage and reconstituted in a suitable carrier prior to use. Any suitable lyophilization and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilization and
  • aqueous carriers can be used to formulate suitable aqueous carriers.
  • compositions for administration such as plain water (e.g. w.f.i.) or a buffer e.g. a phosphate buffer, a Tris buffer, a borate buffer, a succinate buffer, a histidine buffer, or a citrate buffer.
  • a buffer e.g. a phosphate buffer, a Tris buffer, a borate buffer, a succinate buffer, a histidine buffer, or a citrate buffer.
  • Butter salts will typically be included in the 5-20mM range.
  • compositions are preferably sterile, and may be sterilized by conventional sterilization techniques.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, and tonicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like.
  • pharmaceutical compositions of the invention may have a pH between 5.0 and 9.5, e.g. between 6.0 and 8.0.
  • compositions of the invention may include sodium salts (e.g. sodium chloride) to give tonicity.
  • sodium salts e.g. sodium chloride
  • a concentration of 10+2 mg/ml NaCl is typical e.g. about 9 mg/ml.
  • compositions of the invention may have an osmolarity of between 200 mOsm/kg and 400 mOsm/kg, e.g. between 240-360 mOsm/kg, or between 290-310 mOsm/kg.
  • the invention provide a method for treating Gaucher' s disease (types 1, 2, or 3), comprising administering to a subject in need thereof a therapeutically effectively amount of a glucocerebrosidase as described herein.
  • the subject is preferably human.
  • Subjects in need of treatment of Gaucher's disease include those that demonstra te pre-symptomatic phases of the disease, as well as those that demonstrate various symptoms of Gaucher's disease.
  • the pre-symptomatic patient can be diagnosed with Gaucher's disease by genetic analysis known to the skilled artisan.
  • Gaucher's disease is a heterogeneous disease, and has been subdivided into three different types on the basis of age of onset, clinical signs and involvement of neurologica! symptoms.
  • Type 1 adult type, chronic, non-neuronopathic; MIM# 230800
  • MIM# 230800 chronic, non-neuronopathic
  • It is heterogeneous in its clinical features (Beutler and Grabowski, 1995, Gaucher Disease, in Scriver et aL (eds.), The Metabolic and Molecular Bases of Inherited Diseases.
  • Type 2 infantile, acute neuronopathic; M 1 M# 230900
  • M 1 M# 230900 is a rare and lethal form of the disease. It is characterized by early appearance of visceral signs, enlargement of the abdomen from hepatosplenomegaly and central nervous system involvement such as retroflexion of the head, strabismus, dysphagia, choking spells, and hypertonicity.
  • MIM #321000 neuronopathic neuronopathic; MIM #321000 is characterized by early onset of visceral impairment (e.g., hepatosplenomegaly) and a later appearance of central nervous system symptoms.
  • a therapeutically effectively amount of a glucocerebrosidase is administered that such that symptoms of Gaucher's disease are ameliorated, or the onset of symptoms is delayed.
  • a therapeutically effective amount will, for example, be sufficient to treat, prevent, reduce the severity, delay the onset, and/or reduce the risk of occurrence of one or more symptoms associated with gl cocerebrosidase deficiency.
  • the invention provide a method for treating Pompe disease (also known as acid a-glucosidase deficiency, acid maltase deficiency, glycogen storage disease type II, glycogenosis I I, and lysosomal -g!ucosidase deficiency), comprising administering to a subject in need thereof a therapeutically effectively amount of an acid a-glucosidase as described herein.
  • the subject is preferably human,
  • a therapeutically effectively amount of an acid ⁇ -glucosidase is administered that such that symptoms of Pompe disease are ameliorated, or the onset of symptoms is delayed,
  • a therapeutically effective amount will, for example, be sufficient to treat, prevent, reduce the severity, delay the onset, and/or reduce the risk of occurrence of one or more symptoms associated with acid a-glucosidase deficiency.
  • the therapeutic efficacy of the administered acid ⁇ -glucosidase may be determined by biochemical (see, e.g., Zhu et al,, J, Biol, Cheni, 279: 50336-50341 (2004)) or histological observation of reduced lysosomal glycogen accumulation in, e.g., cardiac myocytes, skeletal myocytes, or skin fibroblasts. Acid ⁇ -glucosidase activity may also be assayed in, e.g., a muscle biopsy sample, in cultured skin fibroblasts, in lymphocytes, and in dried blood spots.
  • Dried blood spot assays are described in e.g., Umpathysivam et al., Clin, Chem, 47: 1378-1383 (2001) and Li et al, Clin. Chem, 50: 1785-1796 (2004).
  • the therapeutic efficacy of the administered acid ⁇ -glucosidase may also be assessed by, e.g., serum levels of creatinine kinase, gains in motor function (e.g., as assessed by the Alberta Infant Motor Scale), changes in left ventricular mass index as measured by echocardiogram, and cardiac electrical activity, as measured by electrocardiogram.
  • Administration of acid a-glucosidase as described herein may result in a reduction in one or more symptoms of Pompe disease such as cardiomegaly, cardiomyopathy, daytime somnolescence, exertional dyspnea, failure to thrive, feeding difficulties, floppiness, gait abnormalities, headaches, hypotonia, organomegaly (e.g., enlargement of heart, tongue, liver), lordosis, loss of balance, lower back pain, morning headaches, muscle weakness, respiratory insufficiency, scapular winging, scoliosis, reduced deep tendon reflexes, sleep apnea, susceptibility to respiratory infections, and vomiting.
  • Pompe disease such as cardiomegaly, cardiomyopathy, daytime somnolescence, exertional dyspnea, failure to thrive, feeding difficulties, floppiness, gait abnormalities, headaches, hypotonia, organomegaly (e.g., enlargement of heart, tongue, liver), lordosis, loss of balance, lower
  • the invention provide a method for treating alpha 1 - antitrypsin deficiency, comprising administering to a subject in need thereof a therapeutically effectively amount of an alpha 1 -antitrypsin as described herein.
  • the subject is preferably human.
  • a therapeutically effectively amount of an alpha 1 -antitrypsin is administered that such that symptoms of alpha 1 -antitrypsin deficiency are ameliorated, or the onset of symptoms is delayed.
  • a therapeutically effective amount will, for example, be sufficient to treat, prevent, reduce the severity, delay the onset, and/or reduce the risk of occurrence of one or more symptoms associated with alpha 1 -antitrypsin deficiency.
  • the invention provide a method for treating CI -inhibitor deficiency (Types I, II, or II I ), comprising administering to a subject in need thereof a therapeutically effectively amount of a CI -inhibitor as described herein.
  • the subject is preferably human.
  • A. therapeutically effectively amount of a C I -inhibitor is administered that such that symptoms of CI -inhibitor deficiency are ameliorated, or the onset of symptoms is delayed.
  • a therapeutically effective amount will, for example, be sufficient to treat, prevent, reduce the severity, delay the onset, and/or reduce the risk of occurrence of one or more symptoms associated with CI -inhibitor deficiency.
  • the invention provide a method for treating sepsis, vascular leak syndrome, acute myocardial infarction, pancreatitis, or thermal injury, comprising administering to a subject in need thereof a therapeutically effectively amount of a CI -inhibitor as described herein.
  • the subject is preferably human.
  • the invention provide a method for reducing or preventing the adverse effect of xenotransplantation, comprising administering to a subject in need thereof a therapeutically effectively amount of a C I -inhibitor as described herein.
  • the subject is preferably human.
  • the CI -inhibitors described herein can also be used to treat other diseases in which classical pathway complement activity (activated CI component) and/or contact system
  • factor I la factor I la
  • kallikrein factor XIa
  • diseases include myocardial infarction (WO 95/06479); acquired systemic inflammatory responses among which severe sepsis, septic shock, ARDS (Adult Respiratory
  • indications may be disorders in which excess classical route complement and/or contact activation, and/or CI mhibitor consumption or (relative) functional CI -inhibitor deficiency has been implicated in the pathophysiology, such as meningitis, rheumatoid arthritis, hyper acute graft rejection after alio- and xenotransplantation and pancreatitis.
  • the invention provide a method for treating Fabr disease comprising administering to a subject in need thereof a therapeutically effectively amount of an a-galactosidase A as described herein.
  • the subject is preferably human.
  • A. therapeutically effectively amount of an a-galactosidase A is administered that such that symptoms of Fabry disease are ameliorated, or the onset of symptoms is delayed.
  • a therapeutically effective amount will, for example, be sufficient to treat, prevent, reduce the severity, delay the onset, and/or reduce the risk of occurrence of one or more symptoms associated with ⁇ -galactosidase A deficiency,
  • Subjects in need of treatment of various lysosomal storage diseases described herein include those that demonstrate pre-symptomatic phases of the disease, as well as those that demonstrate various symptoms of LSD (which can be diagnosed e.g., by genetic analysis known to the skilled artisan).
  • compositions described herein may be administered to a subject orally, topically, transdermally, parenterally, by inhalation spray, vaginally, rectally, or by intracranial injection.
  • parenteral as used herein includes subcutaneous injections, intravenous, intramuscular, intracisternal injection, or infusion techniques. Administration by intravenous, intradermal, intramusclar, intramammary, intraperitoneal, intrathecal, retrobulbar,
  • intrapulmonary injection and or surgical implantation at a particular site is contemplated as well.
  • injection especially intravenous, is preferred.
  • the amounts of a glycoprotein in a given dosage will vary according to the size of the indi vidual to whom the therapy is being administered as well as the characteristics of the disorder being treated. In exemplary treatments, it may be necessary to administer about 1 mg/day, about 5 mg/day, about 10 mg/day, about 20 mg/day, about 50 mg/day, about 75 mg/day, about 100 mg/day, about 150 mg/day, about 200 mg/day, about 250 mg/day, about 400 mg/day, about 500 mg/day, about 800 mg/day, about 1000 mg/day, about 1600 mg/day or about 2000 mg/day.
  • the doses may also be administered based on weight of the patient, at a dose of 0.01 to 50 mg kg.
  • the glycoprotein may be administered in a dose range of 0.015 to 30 mg/kg, such as in a dose of about 0.015, about 0.05, about 0.15, about 0.5, about 1.5, about 5, about 15 or about 30 mg/kg.
  • Dosage can be by a single dose schedule or a multiple dose schedule.
  • Multiple doses will typically be administered at least 1 week apart (e.g., about 2 weeks, about 3 weeks, about 4 weeks, about 6 weeks, about 8 weeks, about 10 weeks, about 12 weeks, about 16 weeks, etc.).
  • glycoprotein compositions described herein may be administered in combination with a second therapeutic agent.
  • a second therapeutic agent for example, for cancer treatment, a
  • chemotherapeutic agent may be used as the second agent.
  • non-steroidal anti-inflammatory drugs NSAlDs
  • analgesiscs glucocorticoids
  • DMARDs disease- modifying antirheumatic drugs
  • examples of such therapeutic agents can be found, e.g., in WO 2008/1 6713.
  • kits that comprise the lysosomal glycoprotein compositions described herein packaged in a manner that facilitates their use for therapy.
  • a kit includes a lysosomal glycoprotein as described herein, packaged in a container such as a sealed bottle or vessel, with a label affixed to the contamer or included in the package that describes use of the composition in practicing the method.
  • the kit can further comprise another container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution, or dextrose solution.
  • the composition is packaged in a unit dosage form.
  • kits for testing the effect of a RNA. effector molecule or a series of RNA effector molecules on the production of a lysosomal glycoprotein by the host cell where the kits comprise a substrate having one or more assay surfaces suitable for culturing cel ls under conditions that allow production of the glycoprotein.
  • the exterior of the substrate comprises wells, indentations, demarcations, or the like at positions corresponding to the assay surfaces.
  • the wells, indentations, demarcations, or the like retain fluid, such as cell culture media, over the assay surfaces.
  • the assay surfaces on the substrate are sterile and are suitable for culturing host cel ls under conditions representative of the culture conditions during large-scale (e.g., industrial scale) production of the glycoprotein.
  • kits provided herein offer a rapid, cost-effective means for testing a wide-range of agents and/or conditions on the production of the glycoprotein, allowing the cell cul ture conditions to be established prior to full-scale production of the glycoprotein.
  • one or more assay surfaces of the substrate comprise a concentrated test agent, such as a RNA effector molecule, such that the addition of suitable media to the assay surfaces results in a desired concentration of the RNA effector molecule surrounding the assay surface.
  • a concentrated test agent such as a RNA effector molecule
  • the RNA effector molecules may be printed or ingrained onto the assay surface, or provided in a lyophilized form, e.g., within wells, such that the effector molecules can be reconstituted upon addition of an appropriate amount of media.
  • the RNA effector molecules are reconstituted by plating cells onto assay surfaces of the substrate.
  • kits provided herein further comprise cell culture media suitable for culturing a cell under conditions allowing for the production of the glycoprotein of interest.
  • the media can be in a ready to use form or can be concentrated (e.g., as a stock solution), lyophilized, or provided in another reconstit table form.
  • kits provided herein further comprise one or more reagents suitable for detecting production of the lysosomal glycoprotein by the cell, cell culture, or tissue culture.
  • the reagent(s) are suitable for detecting a property of the cell, such as maximum cell density, cell viability, or the like, which is indicative of production of the desired glycoprotein.
  • the reagent(s) are suitable for detecting the glycoprotein or a property thereof, such as the in vitro or in vivo biological activity, homogeneity, or structure of the glycoprotein.
  • one or more assay surfaces of the substrate further comprise a carrier for which facilitates uptake of RNA effector molecules by cells.
  • Carriers for RNA effector molecules are known in the art and are described herein.
  • the earlier is a lipid formulation such as LipofectamineTM transfection reagent (Invitrogen; Carlsbad, CA) or a related formulation. Examples of such carrier formulations are described herein.
  • the reagent that facilitates RNA effector molecule uptake comprises a charged lipid, an emulsion, a liposome, a cationic or non-cationic lipid, an anionic lipid, a transfection reagent or a penetration enhancer as described throughout the application herein.
  • the reagent that facilitates RNA effector molecule uptake comprises a charged lipid as described in U.S. Application Ser.
  • one or more assay surfaces of the substrate comprise a RNA effector molecule or series of RNA effector molecules and a carrier, each in concentrated form, such that plating test cells onto the assay surface(s) results in a concentration the RNA effector molecule(s) and the carrier effective for facilitating uptake of the RNA effector molecule(s) by the cells and modulation of the expression of one or more genes targeted by the RNA effector molecules.
  • the substrate further comprises a matrix which facilitates 3 -dimensional cell growth and/or production of the glycoprotein by the cells.
  • the matrix facilitates anchorage-dependent growth of cells.
  • matrix materials suitable for use with various kits described herein include agar, agarose, methylcelrulose.
  • alginate hydrogel e.g., 5% alginate + 5% collagen type I
  • chitosan hydroactive hydrocolloid polymer gels
  • polyvinyl aicohol-hydrogel PVA-H
  • polylactide-co- glycolide PLGA
  • collagen vitrigel PVP/PEQ hydrogels
  • BD PuraMatrixTM hydrogels and copolymers of 2-methacryloyloxyethyl phophorylcholine (MPC).
  • MPC 2-methacryloyloxyethyl phophorylcholine
  • the substrate comprises a microarray plate, a bioehip, or the like which allows for the high-throughput, automated testing of a range of test agents, conditions, and/or combinations thereof on the production of a glycoprotein by cultured ceils
  • the substrate may comprise a 2-dimensional microarray plate or bioehip having m columns and n rows of assay surfaces (e.g., residing within wells) which allow for the testing of ra x n combinations of test agents and/or conditions (e.g., on a 24-, 96- or 384-well microarray plate).
  • the microarray substrates are preferably designed such that all necessary positive and negative controls can be carried out in parallel with testing of the agents and/or conditions.
  • kits provided herein allow for the selection or optimization of at least one factor for enhancing production of the biological product.
  • the kits may allow for the selection of a RNA. effector molecule from among a series of candidate RNA effector molecules, or for the selection of a concentration or concentration range from a wider range of concentrations of a given RN A effector molecule,
  • the kits allow for selection of one or more RNA effector molecules from a series of candidate RNA effector molecules directed against a common target gene.
  • the kits allo w for selection of one or more RNA effector molecules from a series of candidate RNA effector molecules directed against two or more functionally related target genes or two or more target genes of a common host cel l glycosylation pathway.
  • kits that comprise one or more container that independently contain one or more RNA effector molecules and one or more suitable host cells.
  • ETI3PGYSIHTYL RRQ a 1 -antitrypsin (SEQ ID NO: 4)
  • Agalsidase SEQ ID NO: 510
  • Appendix O nucleotide sequences of exemplary target genes from Chinese Hamster
  • SEQ ID NO: 6 mannose-P-dolichol utilization defect 1 (Mpdul)
  • SEQ ID NO: 7 mannosyi (a- 1 ,3 ⁇ )-glycoprotein beta- 1 ,2-N-acet lgiucosaminyltransferase (MGAT2)
  • CTTCAAAAAGATGTG G AAGTTG AAG CAGCAG G AGTGTCCTGG GTGTG ATGTCCTCTCCCTAG GG ACCTACACTGCCAGTCG G
  • SEQ ID NO: 8 mannoside acetylglucosaminyltransferase 1 (MGAT1 )
  • N AAGCCAGCTGGATGAAGGGATGTAATAGGCGCCTGGG AGGG ACACTGAAGTCAGG AGTG
  • G ATAAGTG G AG AG AAG CTGTG CTTTG G G G G ATCT N N NNhiNNN ⁇ NNNNNNhiNNhiNNN ⁇ NNNhiNNiNiN
  • SEQ ID NO: 9 mannoside acetylglucosaminyltransferase 4, isoenzyme B (MGAT4B)
  • CAGAAUCUUCACUUCUGUU 92 A C GAAGUG AAGAUUCUG 93
  • AGC CUC C C C C A CAUAA 1 64 UUAUGUUUGUGGGGAGGCU 165 CAAGAGUGCCGAAGGACUG 166 CAGUCCUUCGGCACUCUUG 167
  • GAAUAAAGGUAUAGGAACU 3 08 AG UUC CUAUAC CUUUAUUC 3 09
  • ACUUGCGAGAGGAUUUCUU 506 AAGAAAUCCUCUCGCAAGU 507

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne de manière générale des compositions et des procédés de production de protéines lysosomales qui présentent une structure glycane modifiée, de telle sorte que la protéine peut être délivrée efficacement dans les lysosomes de cellules cibles (comme des macrophages). Les protéines lysosomales sont produites en modifiant les voies de glycosylation dans une cellule hôte en utilisant une molécule effectrice d'ARN, comme un ARNsi. Les protéines lysosomales à glycane modifié produites au moyen des procédés décrits ici présentent des propriétés améliorées, notamment, par exemple, une absorption spécifique accrue par les cellules cibles (comme les macrophages).
PCT/US2012/047356 2011-07-21 2012-07-19 Polypeptides lysosomaux, procédés de préparation et d'utilisation WO2013013019A2 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201161510437P 2011-07-21 2011-07-21
US61/510,437 2011-07-21
US201161533002P 2011-09-09 2011-09-09
US61/533,002 2011-09-09
US201261617322P 2012-03-29 2012-03-29
US61/617,322 2012-03-29

Publications (2)

Publication Number Publication Date
WO2013013019A2 true WO2013013019A2 (fr) 2013-01-24
WO2013013019A3 WO2013013019A3 (fr) 2013-05-10

Family

ID=47558722

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/047356 WO2013013019A2 (fr) 2011-07-21 2012-07-19 Polypeptides lysosomaux, procédés de préparation et d'utilisation

Country Status (1)

Country Link
WO (1) WO2013013019A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4035659A1 (fr) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes destinés à l'administration d'agents thérapeutiques
EP3963063A4 (fr) * 2019-04-30 2023-09-27 The Trustees of The University of Pennsylvania Compositions pour le traitement de la maladie de pompe

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100186099A1 (en) * 2003-10-28 2010-07-22 Fraser Malcom J Production of Human Glycosylated Proteins in Silk Worm
US20110067146A1 (en) * 2007-04-17 2011-03-17 Plant Research International B.V. Mammalian-type glycosylation in plants by expression of non-mammalian glycosyltransferases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100186099A1 (en) * 2003-10-28 2010-07-22 Fraser Malcom J Production of Human Glycosylated Proteins in Silk Worm
US20110067146A1 (en) * 2007-04-17 2011-03-17 Plant Research International B.V. Mammalian-type glycosylation in plants by expression of non-mammalian glycosyltransferases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SCHENK ET AL.: 'MPDU1 mutations underlie a novel human congenital disorder of glycosylation, designated type If' J. CLIN. INVEST. vol. 108, 2001, pages 1687 - 1695 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4035659A1 (fr) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes destinés à l'administration d'agents thérapeutiques
EP3963063A4 (fr) * 2019-04-30 2023-09-27 The Trustees of The University of Pennsylvania Compositions pour le traitement de la maladie de pompe

Also Published As

Publication number Publication date
WO2013013019A3 (fr) 2013-05-10

Similar Documents

Publication Publication Date Title
WO2013013017A2 (fr) Compositions et procédés pour modifier la glycosylation de substances thérapeutiques pour les troubles du stockage lysosomal
WO2013013013A2 (fr) Compositions et procédés de production de glycoprotéines modifiées
JP2023012509A (ja) 肝疾患の処置または予防のためのｒｎａ
CN105408481B (zh) SERPINA1 iRNA组合物及其使用方法
WO2011109600A1 (fr) Compositions et procédés pour modifier le motif de glycosylation d'un polypeptide
JP2022519184A (ja) Ｒｎａ編集オリゴヌクレオチド及びその使用
JP2022518477A (ja) Ｒｎａ編集オリゴヌクレオチド及びその使用
JP2022518731A (ja) Ｒｎａ編集オリゴヌクレオチド及びその使用
US11377643B2 (en) Therapeutics for glycogen storage disease type III
KR20180002688A (ko) 인자 ＸＩＩ(하게만 인자)(Ｆ12), 칼리크레인 Ｂ, 혈장(플레처 인자) 1(ＫＬＫＢ1) 및 키니노겐 1(ＫＮＧ1) ｉＲＮＡ 조성물 및 그의 이용 방법
KR20150091097A (ko) PCSK9 iRNA 조성물 및 그 사용 방법
JP2011516094A (ja) 干渉ｒｎａを用いたｃｓｎ５遺伝子発現のサイレンシング方法
EP3891274B1 (fr) Compositions et méthodes pour traiter une déficience en ornithine transcarbamylase
TW202220673A (zh) 抑制ｌｐａ表現之組合物及方法
US20130164851A1 (en) Gene amplification and transfection methods and reagents related thereto
EP4159193A1 (fr) Arylsulfatase a mutée
JP2022510041A (ja) Ｍｓｈ３活性に関連するトリヌクレオチドリピート伸長障害の処置のための方法
CN113631709A (zh) 用于治疗kcnt1相关病症的组合物和方法
WO2013013019A2 (fr) Polypeptides lysosomaux, procédés de préparation et d'utilisation
US12018260B2 (en) Tunable Reversir™ compounds
WO2023176863A1 (fr) Oligonucléotide chimiquement modifié ayant une activité d'arni
US20230029227A1 (en) Tunable reversir tm compounds
CA3232862A1 (fr) Compositions et methodes pour le traitement des troubles associes a pcdh19
EP4347837A2 (fr) Méthodes de traitement de troubles liés à des expansions de répétitions nucléotidiques, qui sont associés à l'activité de msh3
WO2023137260A2 (fr) Compositions de bancr et méthodes de traitement d'une maladie

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12814774

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12814774

Country of ref document: EP

Kind code of ref document: A2