WO2013002485A2 - ＮＦＡＴ５／ＴｏｎＥＢＰ 활성화를 위하여 유효성분으로 ＴＡＺ 티로신 인산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물 - Google Patents

ＮＦＡＴ５／ＴｏｎＥＢＰ 활성화를 위하여 유효성분으로 ＴＡＺ 티로신 인산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2013002485A2
WO2013002485A2 PCT/KR2012/003249 KR2012003249W WO2013002485A2 WO 2013002485 A2 WO2013002485 A2 WO 2013002485A2 KR 2012003249 W KR2012003249 W KR 2012003249W WO 2013002485 A2 WO2013002485 A2 WO 2013002485A2
Authority
WO
WIPO (PCT)
Prior art keywords
taz
tonebp
nfat5
tyrosine phosphorylation
activity
Prior art date
Application number
PCT/KR2012/003249
Other languages
English (en)
French (fr)
Other versions
WO2013002485A3 (ko
Inventor
황은숙
Original Assignee
이화여자대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 이화여자대학교 산학협력단 filed Critical 이화여자대학교 산학협력단
Priority claimed from KR1020120043834A external-priority patent/KR101413590B1/ko
Publication of WO2013002485A2 publication Critical patent/WO2013002485A2/ko
Publication of WO2013002485A3 publication Critical patent/WO2013002485A3/ko

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys

Definitions

  • composition for the prevention and treatment of kidney disorders containing inhibitors of TAZ tyrosine phosphorylation as an active ingredient for NFAT 5 / T o n EB P activation
  • the present invention relates to a pharmaceutical composition for preventing and treating kidney disorders and containing an inhibitor of TAZ tyrosine phosphorylation as an active ingredient for NFAT5 / TonEBP activation.
  • Transcriptional Coactivator with PDZ (binding motif) protein is WWTR (WW domain containing transcription regulator 1, Wwtrl) containing WW domain and is a transcriptional cofactor. It is located in the cytoplasm of cells in association with 14-3-3 peptide, but the binding to 14-3-3 peptide is inhibited by external stimulation, leading to migration to the cell nucleus (Hong JH et al, Cell Cycle 5 : 176-179, 2006; Kanai F et al, EMB0 J 19: 6778-6791, 2000). The TAZ protein migrated to the cell nucleus binds to various transcription factor proteins and regulates transcription factor activity through protein structural properties.
  • TAZ affects the expression of surface active substance C through binding to ⁇ -1 and is known to regulate the level of other surface active substances or factors essential for the integrity of alveoli through proteolytic regulation (Park KS et al., J Biol Chem 279: 17384-17390, 2004; Tian Y et al., MOLECULAR AND CELLULAR BIOLOGY, Y Sept. 2007, p. 6383-6395).
  • TAZ protein is expressed in midgestat ion mouse embryos, and TAZ is expressed mainly in the paraaxial mesoderm, limb bud, and neural tube (Murakami M et al., Biochem). Biophys Res ⁇ un 339: 533-539, 2006).
  • TAZ the protein is widely expressed and distributed across various tissues and organs, is very important in regulating the activity of transcription factors associated with growth and disease.
  • many TAZ binding proteins have been identified and related to cell proliferation control and cancer development, but in vivo results are not specifically demonstrated.
  • mice with the TAZ gene eliminated plays an in vivo role of TAZ function It is a critical model that clearly identifies this.
  • the offspring of TAZ knockout mice are mostly dead at young age. Histologic analysis of TAZ knockout mouse offspring showed severe fibrosis (Lung emphysema) in the lungs and cystic formation (Glomerulocytic cystic kidney) in the kidneys (Hossain, Z et al., Proc. Natl. Acad. Sci. USA 104: 1631-1636. 2008; Makita R et al., Am J Physiol Renal Physiol 294: F542-F553, 2008).
  • Tension is the difference in osmolality between the two compartments.
  • the higher osmolyte concentration between the two compartments is called hypertonic, the lower osmolality is called hypotonic, and the two compartments equilibrate as the solvent moves from hypertonic to hypotonic.
  • the osmolality is converted to an osmolality concentration (0311101 £ 11 " ⁇ ).
  • the osmolarity of mammalian kidney medulla is often very high, ten times or more of the blood osmolarity. Constantly repeated hypertonicity causes the cells to shrink and the cells are stressed because of the osmotic efflux of water.
  • hyperosmolarity concentrations were determined by double-stranded DNA break (Ku " ltz, D., and Chakravarty, D. (2001) Proc. Natl. Acad. Sci. USA 98,1999-2004) and cells. Cells are subjected to excessive stress causing death (Michea, L. et al, (2000) Am. J. Physiol. Renal Physiol.
  • NFAT5 / TonEBP also called Nuclear Factor of Activated T Cells 5 (NFAT)
  • NFAT5 / TonEBP is a dimer protein related to TonE that efficiently surrounds its recognition component in the target gene promoter (Stroud, JC et al, 2002. Nat. Struct. Biol. 9: 90-94).
  • NFAT5 / TonEBP stimulates transcription of synthetic enzymes and membrane transporters for organic osmolyte and promotes cellular accumulation of organic osmolytes (SK Woo et al, Int. Rev. Cytol. 215 (2002) 189-202).
  • Organic osmolalization normalizes hypertonic-derived changes in cell volume and intracellular ionic strength.
  • NFAT5 / TonEBP stimulates the expression of HSP70 (Woo, SK et al, 2002. Mol. Cell. Biol. 22: 5753-5760) that protects renal medulla cells from the harmful effects of high urea (W. Neuhofer et al, J. Am. Soc. Nephrol. 12 (2001) 2565-2571).
  • HSP70 W. Neuhofer et al, J. Am. Soc. Nephrol. 12 (2001) 2565-2571
  • TonEBP is an important regulator of many pathways in the hyperosmotic kidney.
  • NFAT5 / TonEBP is bi-directionally regulated. That is, down-regulated and activity is inhibited by hypotonicity and up-regulated and activated by hypertonicity (SK Woo, et al, Am. J. Physiol. Renal Physiol. 278 (2000) ) F1006-F1012).
  • FAT5 / TonEBP shows phosphorylation, nuclear localization, and increased transcriptional activity (SC Dahl, JS Handler, HM Kwon, Am. J. Physiol. Cell Physiol. 280 (2001) C248 -C 253; JD Ferraris, et al, Proc. Natl. Acad. Sci. USA 99 (2002) 739-744).
  • NFAT5 / TonEBP migrates to the nucleus.
  • PKA protein kinase A
  • ATM ataxia telangiectasia mutated
  • phos Patidylinosine is associated with the activity of NCl-derived NFAT5 / TonEBP, which is derived from high NaCl-rich kinases, including phosphatidyl inositol 3-kinase class IA (PI3K-IA), Fyn, and p38.
  • PI3K-IA phosphatidyl inositol 3-kinase class IA
  • Fyn phosphatidyl inositol 3-kinase class IA
  • p38 phosphatidyl inositol 3-kinase class IA
  • c-Abl kinase induced by high concentrations of NaCl induces migration to NFAT5 / TonEBP nuclei, promotes transcriptional activity, and phosphorylates ⁇ - ⁇ 43.
  • ⁇ and the function of NFAT5 / TonEBP in hypertonic conditions have been revealed, respectively, but no studies have been made on tyrosine phosphorylation of TAZ and its inhibition of NFAT5 / TonEBP in hypertonic conditions. .
  • the present inventors have studied the role of TAZ in elongation by studying changes in TAZ activity and interactions with NFAT5 / TonEBP under hypertonic conditions. As a result, TAZ undergoes tyrosine phosphorylation in NFAT5 under hypertonic conditions. Direct and specific binding to / TonEBP was found to inhibit and regulate the activity of NFAT5 / TonEBP. Therefore, in order to recover from renal dysfunction under hypertonic osmotic stress conditions, the present invention has been completed by revealing that it is possible to optimize the activity of NFAT5 / TonEBP through inhibition of TAZ tyrosine phosphorylation.
  • An object of the present invention is to provide a pharmaceutical composition for the prevention and treatment of diseases caused by abnormal osmolarity stress control by the osmolarity concentration containing a TAZ tyrosine phosphorylation inhibitor.
  • Another object of the present invention is to provide a method for screening a candidate for preventing or treating a disease by suggesting a pathogenesis mechanism for diseases caused by abnormal osmotic pressure control by using TAZ.
  • Another object of the present invention is to provide a method for preventing osmotic stress-induced kidney disorders comprising administering the TAZ tyrosine phosphorylation inhibitor to a subject.
  • Another object of the present invention is to provide a method for treating an osmotic stress-induced kidney disorder comprising administering the TAZ tyrosine oxidative inhibitor to a subject.
  • Another object of the present invention is to provide the TAZ tyrosine phosphorylation inhibitor for use in a pharmaceutical composition for the prevention and treatment of osmotic stress-induced kidney disorders.
  • the present invention provides a pharmaceutical composition for the prevention and treatment of respiratory disorders induced by osmotic stress containing a TAZ tyrosine phosphorylation inhibitor.
  • the present invention provides a method for suppressing stress by osmotic pressure concentration in renal tissue, comprising administering to a subject a composition containing a pharmaceutically effective amount of a TAZ tyrosine phosphorylation inhibitor.
  • candidates for the prevention and treatment of osmotic stress-induced kidney disorders comprising selecting a test substance whose tyrosine phosphorylation level of the TAZ protein is reduced compared to a control group not treated with the test substance. Provides screening methods.
  • Candidates for the prevention and treatment of osmotic stress-induced nephropathy comprising screening for the test substance in which the level of TAZ and TonEBP binding activity of step 2) is reduced compared to the control group that did not process the test substance. It provides a screening method of.
  • the present invention provides a method for preventing osmotic stress-induced kidney disorders comprising administering the TAZ tyrosine phosphorylation inhibitor to a subject.
  • the present invention provides a method for treating an osmotic stress-induced kidney disorder comprising administering the TAZ tyrosine phosphorylation inhibitor to a subject.
  • the present invention is for use in the pharmaceutical composition for the prevention and treatment of renal disorders caused by osmotic stress . It provides the TAZ tyrosine phosphorylation inhibitor.
  • TAZ inhibits the activity of NFAT5 / TonEBP
  • c— Abl activity is TAZ and Necessary for the interaction of NFAT5 / TonEBP
  • phosphorylated TAZ inhibits NFAT5 / TonEBP binding activity
  • inhibition of TAZ in hypertonic conditions induced by dehydration in vivo (/ ra) mitigates the effects of tonic stimuli
  • the TAZ tyrosine phosphorylation inhibitors can be used to prevent or treat diseases selected from the group consisting of osmotic stress-induced It can be usefully used.
  • FIG. 1 is a diagram illustrating an improvement in nuclear position of a TAZ under high fault conditions.
  • 1A is a result of Cos7 cells transiently transformed with a GFP-TAZ vector, exposed to different concentrations of NaCl for 4 hours, stained with DAPI, and measured by confocal microscopy.
  • FIG. 1B shows the results of quantitative microscopic determination of the subcellular location of GFP-TAZ in Cos7 cells.
  • 1C shows the results of incubating mIMCD-3 cells under different conditions for 4 hours, TAZ immunostaining, followed by paloidine and DAPI staining.
  • Scale bars 50 ⁇ ⁇ ⁇
  • FIG. 1D shows that after fractionation of nuclei and cytoplasmic proteins from mIMCD-3 cells stimulated by tension stress, the proteins were analyzed by SDS-PAGE, TAZ, 0CT1 and actin (actin). Immunoblotting with antibody to
  • Figure 2 is a diagram of tyrosine phosphorylation of TAZ by hypertonic c-Abl activation.
  • FIG. 2A shows mIMCD-3 cells exposed to 300 and 400 mOsm for 4 hours, immunoprecipitated whole cell extracts (WCE) with anti-TAZ antibody, and immunosuppressive complexes of phosphotyrosine Immunoblot with antibody to phosphotyrosine (pY; 4G10), phosphoser ine TAZ (pS; PS89) and TAZ.
  • FIG. 2B stimulates stable mIMCD-3 cells (mock / DV: D and Flag-TAZ / IMCD) for 4 hours in hypotonic, isotonic and hypertonic, and TAZ immune complexes with 4G10 and anti-TAZ antibodies The results were analyzed by immunoblotting.
  • Figure 2C shows the results of immunoblot analysis of WCE with antibodies to phosphorylated c-Abl (pAbl), c-Abl and actin.
  • 2D overexpresses flagged TAZ in 293T cells, and Flag-M2 agarose. After sedimentation with beads (agarose beads), the active mixture was analyzed by SDS-PAGE and radiographing, and separately, TAZ levels were analyzed by immunoblot.
  • FIG. 2E shows 293T cells transformed with Flag-TAZ with or without c-Abl expression vector, TAZ immune complex and WCE analyzed by SDS-PAGE, immunoblot with 4G10, TAZ and c-Abl antibodies One result.
  • FIG. 2F shows 293T cells transformed with Flag-TAZ and c-Abl expression vectors, genistein (GNS; 50 ⁇ M) or STI-57 STI; FIG. After incubation for 1 hour in the presence of 10 ⁇ M), the ⁇ immune complex was analyzed by immunoblot with 4G10 and ⁇ antibodies.
  • 2G shows mIMCD-3 cells in STI-57KSTI; 10 ⁇ ) hypertonic stimulation with and without, and ⁇ immune complexes were analyzed separately with 4G10 and anti- ⁇ antibodies.
  • 3 shows phosphorylation of tyrosine 316 of TAZ induced by c-Abl.
  • FIG. 3A shows 293T cells transformed with Flag-TAZ and c—Abl expression vectors, TAZ immune complexes analyzed by SDS-PAGE, 4G10 and pY116, pY141, pY300, pY316 TAZ, or
  • FIG. 3B shows the results of incubating parental mIMCD-3 cells in hypertonic medium for 4 hours, immunoprecipitating endogenous TAZ protein, and immunoblotting with pY316 TAZ or TAZ antibody.
  • 3C shows the results of transforming 293T cells with Y316F TAZ with or without WT TAZ and c-Abl expression vectors, analyzing the immune complexes, and immunoblotting with 4G10, pY316 TAZ, and TAZ antibodies.
  • FIG. 3D shows stable transformation of mIMCD3 cells with TAZ expression vector, selection of stable cells in the presence of puromycin, incubation of the cells under hypertonic environment for 4 hours, followed by immunoprecipitation and The result of immunoblot analysis.
  • 4 is a diagram of the physical interaction between phosphorylated TAZ and NFAT5 / TonEBP.
  • 4A-4C show the results of transforming 293T cells with C- Abl, Myc-tagged WT or mutant (Y143F; MT) NFAT5 / TonEBP and Flagged TAZ WT or mutant Y316F as described in each panel to be.
  • FIG. 4A shows the result of immersing the NFAT5 / TonEBP immune complex in culture with an anti-Myc antibody, analyzing by SDS-PAGE, and immunoblotting.
  • 4B shows that cells were transformed, treated with STI-57 10 ⁇ for 1 hour before harvest, and ⁇ immune complexes and WCE were blotted with antibodies to Myc, pY316, and TAZ. All.
  • 4C shows the results of immunoblotting of the TAZ immune complex and WCE with Myc and Flag antibodies.
  • 4D shows that stimulation of mIMCD-3 cells at different tensions for 4 hours, endogenous TAZ immune complexes sedimented with TAZ antibodies, followed by SDS-PAGE, and immunoblotting with NFAT5 / TonEBP and PY316 antibodies to be.
  • FIG. 4E shows the immobilization of tension-stimulated mIMCD3 cells, incubation with TAZ and NFAT5 / TonEBP antibodies, and incubation with specific secondary antibodies and PLA probes using the Duolink in situ PLA kit. It is the result of having observed the sample under confocal microscope.
  • FIG. 5 is a diagram showing the inhibition of NFAT5 / TonEBP by TAZ.
  • FIG. 5A shows 293T cells with NFAT5 / TonEBP and other amounts of TAZ expression vector.
  • NFAT5 / TonEBP and TAZ expressions were transformed with a luciferase reporter gene (pTonE-luc) corresponding to NFAT5 / TonEBP and used as a pCMVP control. Luciferase reporter gene activity was calculated after normalization with ⁇ -galactosidase activity.
  • FIG. 5B shows 293T cells transformed with NFAT5 / TonEBP and TAZ expression vector (FT, Y118F, or Y316F) together with pTonE-luc and pCMVP, and reporter activity was calculated and averaged from three independent experiments. The result is.
  • Figure 5C is incubated for 1 hour with two of the strands of DNA and to over-expression in 293T 'cells, attached to the biotin-containing component to combine the WCE to NFAT5 / TonEBP with the NFAT5 / TonEBP and WT or Y316F TAZ, and Following incubation of streptavidin-agarose beads for an additional 2 hours, followed by SDS-PAGE and immunoblot. DNA bound complexes and WCE were analyzed with NFAT5 / TonEBP and TAZ antibodies.
  • FIG. 6 is a diagram showing the inhibitory effect of TAZ on gene expression inducing NFAT5 / TonEBP.
  • TAZ stable transformant TAZ
  • C0N control
  • ⁇ 7i> 6B is TAZ stable transformants (TAZ) and the control group (C0N) cells are a real-time (real ⁇ time) After a PCR to measure the 4 hour incubation, the BGT1 and SMIT1 level during the different tension conditions. After normalizing relative expression levels to ⁇ -actin levels Calculated in
  • FIG. 6C shows the protein levels of TAZ, NFAT5 / TonEBP, and actin after establishing TAZ knockdown (shTAZ) and control (shcon) cells and stimulating for 4 hours in isotonic and hypertonic conditions. The result confirmed by immunoblot.
  • FIG. 6D shows the results of confirming the mRNA levels of BGT1 and SMIT by real-time PCR after establishing TAZ knockdown and control cells, and stimulating for 4 hours under isotonic and hypertonic conditions.
  • FIG. 6E shows the results of observation using the xCELLigence system for 24 hours after establishing TAZ knockdown and control (shcon) cells and stimulating for 4 hours in isotonic and hypertonic conditions;
  • FIG. 7 shows that in TAZ K0 cells, the recovered TAZ reinhibits NFAT5 / TonEBP activity, but Y316F does not reinhibit NFAT5 / TonEBP activity.
  • FIG. 7A shows TAZ expression in WT and K0 MEF cells by immunoblot.
  • FIG. 7B shows the results of transforming WT and K0 MEF cells into reporter genes (pTonE—luc and pCMV
  • TAZ K0 MEF cells were transformed with a WT or reporter gene (pTonE-luc and pCMV
  • the reporter activity (RLU) of Panels B and (:) is then calculated after normalizing to ⁇ -galactosidase activity and expressed as mean SEM of three independent experiments.
  • the present invention is stress of osmotic pressure containing TAZCRANSCRIPTIONAL C0ACTIVAT0R with PDZ-binding motif tyrosine phosphorylation inhibitor as an active ingredient
  • It provides a pharmaceutical composition for the prevention and treatment of diseases caused by abnormality in (osmolarity stress) control.
  • Diseases caused by abnormal stress control by the osmotic concentration may be renal disease, renal dysfunction or renal failure, but is not limited thereto.
  • the TAZ may have an amino acid sequence as set forth in SEQ ID NO: 1, but is not limited thereto.
  • the TAZ may have an amino acid sequence in which one or several amino acids are added, deleted, or substituted as long as they have the same activity in the amino acid sequence represented by SEQ ID NO: 1.
  • the TAZ may be an amino acid sequence having at least 80% homology, preferably at least 9 (> homology, more preferably at least 95% homology to the amino acid sequence set forth in SEQ ID NO: 1).
  • the tyrosine phosphorylation site of TAZ may be the 316 th tyrosine of TAZ, but is not limited thereto.
  • the TAZ tyrosine phosphorylation inhibitor may be to increase the activity of NFAT5 / TonEBP, but is not limited thereto.
  • the TAZ tyrosine phosphorylation inhibitor may have any one selected from the group consisting of a substrate analog, a compound, a peptide, a peptide mimetics, an aptamer, and an antibody that complements the TAZ protein, but is not limited thereto. .
  • Antibodies to TAZ can specifically inhibit TAZ activity by binding specificly and directly to TAZ.
  • the antibody specifically binding to the TAZ it is preferable to use a polyclonal antibody or a monoclonal antibody, and more preferably to use a monoclonal antibody.
  • Antibodies that specifically bind to the biomarkers may be prepared by known methods known to those skilled in the art, and commercially known antibodies may be purchased and used. Such antibodies can be prepared by injecting an external host with a TAZ protein, which is an immunogen, according to conventional methods known to those skilled in the art. External hosts include mammals such as mice, rats, sheep, rabbits.
  • Immunogens are injected intramuscularly, intraperitoneally or subcutaneously, and can generally be administered in conjunction with an adjuvant to increase antigenicity.
  • Antibodies can be isolated by collecting blood periodically from an external host and collecting serum showing specific titers and specificity for the antigen.
  • Analogs that inhibit the binding domain of TAZ can be made to inhibit the activity of TAZ.
  • non-hydrolyzable peptide analogues of such peptide analogs or fragments of short peptide substrates (US Pat. No. 7,65,034), which are substrates of TAZ, can be used.
  • the non-hydrolyzable peptide analogs include ⁇ -turn dipeptide cores (Nagai et al., Tetrahedron. Lett. 26: 647, 1985), keto-methylene pseudopeptides (Ewenson et al., J. Med. Chem.
  • c-Abl phosphorylation site is tyrosine 316 of TAZ.
  • seed mutant TAZ (Y316F) was constructed by replacing tyrosine 316 with phenylalanine.
  • WT wild-type
  • pY316 TAZ antibodies see FIG. 3C.
  • Wild-type (WT) TAZ and its tyrosine mutants labeled with Flag (Y118F, Y141F, Stable mIMCD-3 cells expressing Y300F, and Y316F) were established and exposed to hypertonic conditions.
  • Hypertonic stimulation induced WT, Y118F, Y141F and Y300F TAZ proteins, but this hypertonic induced phosphorylation was impaired in Y316F mutations (see FIG. 3D), indicating that tyrosine 316 of TAZ is the c-Abl phosphorylation site. Indicates.
  • Transcriptional activity of NFAT5 / TonEBP was measured by luciferase reporter gene (pTonE-luc) in response to FAT5 / TonEBP in the absence of TAZ.
  • Ectopic expression of NFAT5 / TonEBP increased luciferase activity of pTonE-luc, but coexpression of TAZ significantly inhibited this activity in a dose dependent manner (see FIG. 5).
  • TAZ inhibits NFAT5 / TonEBP activity
  • BGT1 and SMIT Relative expression of BGT1 and SMIT was increased by hypertonicity in control cells, but significantly attenuated in tolerantly stimulated TAZ stabilized cells (see FIG. 6B).
  • FIGS. 6C and 6D expression of BGT1 and SMIT gradually increased by decreasing TAZ expression under isotonic and hypertonic conditions.
  • the TAZ tyrosine phosphorylation inhibitor of the present invention can be used to reduce the expression of TAZ, thereby optimizing the expression of target genes and the activity of NFAT5 / TonEBP to alleviate the effects of hypertonic stimulation. It can be seen that it can be usefully used as an active ingredient of the composition for prevention and treatment.
  • composition according to the present invention may further contain one or more active ingredients exhibiting the same or similar functions in addition to the tyrosine phosphorylation inhibitor of TAZ protein.
  • composition can be administered orally or parenterally during clinical administration and intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine dural injection, cerebrovascular injection during parenteral administration. Or by intrathoracic injection, and can be used in the form of general pharmaceutical formulations.
  • composition can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers.
  • the daily dosage of the composition is about 0.0001 to 100 rag / kg, preferably
  • the composition may be administered in various parenteral formulations during actual clinical administration.
  • the composition may be a diluent or excipient such as a conventional stratifier, extender, binder, wetting agent, disintegrating agent, and surfactant.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories.
  • the non-aqueous solvent and the suspending solvent propylene glycol, polyethylene glycol, vegetable oils such as evolved oil, and injectable esters such as ethyl acrylate may be used.
  • the suppository base includes witepsol, macrogol, and twenty-one. (tween) 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the present invention provides a stress-induced osmotic pressure comprising administering to a subject a composition comprising a pharmaceutically effective amount of a TAZ tyrosine phosphorylation inhibitor.
  • It also provides a method for preventing or treating diseases caused by disorders of osmolarity stress.
  • the disease may be selected from the group consisting of renal disease, renal dysfunction, and renal failure, but is not limited thereto.
  • the TAZ tyrosine phosphorylation inhibitor may be to increase the activity of NFAT5 / TonEBP, but is not limited thereto.
  • the pharmaceutically effective amount is 0.0001 to 100 mg / kg, preferably
  • Dosage may vary depending on the specific patient's weight, age, sex, health condition, diet, duration of administration, method of administration, elimination rate, and disease severity.
  • the administration may be administered orally or parenterally during clinical administration and intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrauterine dural injection, cerebrovascular injection or It can be administered by intrathoracic injection and can be used in the form of general pharmaceutical preparations.
  • the subject is a vertebrate, including humans, preferably a mammal, more preferably an experimental animal such as a rat, rabbit, guinea pig, hamster, dog, cat, and most preferably chimpanzee, gorilla, It is the same anthropoid animal.
  • the TAZ tyrosine phosphorylation inhibitor of the present invention can reduce the expression of TAZ by maximizing target gene expression and NFAT5 / TonEBP activity to alleviate the effects of hypertonic stimuli. It can be usefully used for suppression.
  • the present invention provides a method for screening a candidate for preventing or treating a disease caused by an abnormality in the control of osmolarity stress by osmotic pressure using TAZ tyrosine phosphorylation.
  • the TAZ of step 1) may have an amino acid sequence as set forth in SEQ ID NO: 1, but is not limited thereto.
  • the tyrosine phosphorylation level of the protein of step 2) is measured by any one selected from the group consisting of immunofluorescence, enzyme immunoassay (ELISA), western blot and RT—PCR. It may be, but is not limited thereto.
  • ELISA enzyme immunoassay
  • RT—PCR RT—PCR
  • step 3 screening the test substance whose TAZ and TonEBP binding activity levels in step 2) were reduced compared to the control group which did not treat the test substance. Screening methods are provided.
  • step 2 The binding activity of step 2) is Western blot, immunoprecipitation, SDS-
  • It may be any one selected from the group consisting of PAGE and enzyme immunoassay (ELISA), but is not limited thereto.
  • TAZ tyrosine phosphorylation interacting with NFAT5 / TonEBP of the present invention inhibits the activity of NFAT5 / TonEBP
  • c-AM activity is required for the interaction of TAZ and NFAT5 / TonEBP
  • phosphorylated TAZ is NFAT5 / TonEBP
  • the present invention provides a method for preventing osmotic stress-induced kidney disorders comprising administering the TAZ tyrosine phosphorylation inhibitor to a subject.
  • the present invention provides a method for treating an osmotic stress-induced kidney disorder comprising administering the TAZ tyrosine phosphorylation inhibitor to a subject.
  • the present invention provides the TAZ tyrosine phosphorylation inhibitor for use in a pharmaceutical composition for the prevention and treatment of respiratory disorders caused by osmotic stress.
  • TAZ binds to and interacts with TonEBP
  • tyrosine phosphorylation of TAZ inhibits TonEBP activity
  • c-AM activity is required for the interaction of TAZ and TonEBP in vivo (/ wVo).
  • TAZ tyrosine phosphorylation inhibitor may be used in the pharmaceutical composition for the prevention and treatment of renal disorders caused by osmotic stress.
  • HEK293K Human Embryonic Kidney 293 eel Is HEK293K Human Embryonic Kidney 293 eel Is cells were obtained from American Type Culture Collection CATCC, Manassas, VA) and cultured in Dulbecco's modified Eagle medium CDMEM, Invitrogen, Carlsbad, CA). The cells were transiently transformed by the calcium phosphate method. To determine if peripheral tension affects TAZ expression, GFP-tagged TAZ was expressed in Cos7 cells and stimulated with different tension conditions.
  • mIMCD-3 Troponi city-responsive immortalized mouse inner medullary collecting duct-3 eel IsKATCC
  • TAZ Cos7 cells were transformed with TAZ with green fluorescence protein (GFP) or NFAT5 / TonEBP expression vector with Myc followed by treatment at 150, 300, or 400 mOsmo / kg tension for 4 hours.
  • Cells were fixed with 4% paraformaldehyde (4% paraformaldehyde), anti-Myc antibody, 4 ', 6'-diamidine-2'-phenyl indole (4', 6'-diamidine-2'-phenyl indole, DAPI), or fluorescent phalloidinKred. Fluorescence was investigated under confocal microscopy (LSM510 META, Carl Zeiss Inc., Germany).
  • TAZ expression was observed in the nucleus and cytoplasm under isotonic conditions (300 m0sm / kg) and mainly in the cytoplasm under hypotonic conditions (150 m0sm / kg) (FIG. 1A).
  • hypertonic (400 m0sm / kg) stimuli gradually increased the nuclear position of TAZ (FIGS. 1A and B).
  • mIMCD-3 a rat kidney medullary cell.
  • Renal medulla mIMCD3 cells were treated in medium containing NaCl 150, 300, or 400 mOsm / Kg for 2 hours. Thereafter, the kidney medullary mIMCD3 cells were immunostained using the immunostaining of Example ⁇ 1-2>, the antibodies were immunostained using an anti-TAZ antibody (Abeam), and fluorescence was examined under confocal microscopy (LSM510 META , Carl Zeiss Inc., Germany).
  • Protein concentration was determined by Bradford assay, and equivalent amounts of protein were resolved by electrophoretic methods by sodium dodecyl sulfate (SDS) -polyacrylamide gel electrophoresis (PAGE). Electrophoresis was performed on I ⁇ obilon-P membranes (Millipore, Invitrogen). Stop TAZ (Abcam), OCTCTissue- tek, beta-actin ( ⁇ -act inKSanta cruz) After reacting with the primary antibody against, the appropriate secondary antibody bound HR Zymed Laboratories, Inc, South San Francisco, CA USA) and detected ECL (Amersham Biosciences Inc, Piscataway, NJ USA) according to the manufacturer's instructions. Visualized by system.
  • mIMCD-3 cells were transduced with Flag labeled .TAZ and / or Myc labeled NFAT5 / TonEBP expression vectors (vectors). After 48 hours, total cell extracts were obtained and reacted with Flag-M2 agarose beads (agarose beads KSigma-Aldrich), which were then washed with lysis buffer. mIMCD-3 cell extracts were precleared with protein A / G agarose beads at 4 ° C.
  • Blots are myc (Santa Cruz Biotechnology), f lag (Sigma-Aldr ich), NFAT5 / TonEBP (Abcam), pY316 (Abf ront ier), 4G10 (Upstate), phosphorylated Abl (phospho-Abl, pAbl) Antibodies against Cell Signaling, c-Abl (Abeam) and TAZ (Abcam) were reacted with antibodies against myc and flag.
  • This c-Abl-induced tyrosine phosphorylation is inhibited by non-selective tyrosine kinase inhibitors genisteinKSignma-Aldricli and c-Abl kinase specific inhibitor STI-571 (Novartis Pharmaceut icals) (Basel, Switzerland). (FIG. 2F).
  • hypertonicity promoted tyrosine phosphorylation of endogenous TAZ protein with c-Abl activation, but failed to induce tyrosine phosphorylation of TAZ in the presence of the STI-5 group (FIG. 2G).
  • Example 3 c-Abl phosphorylation site was found to be tyrosine 316
  • TAZ contains four tyrosine residues (Y118, Y141, Y300, and Y316), the TAZ specific phosphotyrosine antibodies ( ⁇ 118, ⁇ 141,) can be obtained using synthetic TAZ peptides containing the appropriate phosphotyrosine. ⁇ ⁇ 300, and P Y316) (AbFrontier Inc.) (Seoul, Republic of Korea). '
  • wild mutant TAZ (Y316F) was constructed by replacing tyrosine 316 with phenylalanine, but overexpression of c-Abl increased phosphorylation of wild-type (WT) TAZ, Phosphorylation of the Y316F mutation failed as demonstrated by immunoblotting with 4G10 and pY316 TAZ antibodies (FIG. 3C).
  • wild-type (WT) TAZ labeled with flag and tyrosine mutant thereof Y118F
  • Stable mIMCD-3 cells expressing Y141F, Y300F and Y316F were established and exposed to hypertonic conditions.
  • Virus supernatants were obtained and the resulting virus supernatants were added to mIMCD-3 or MEF cells for 4 hours in the presence of polybrene (4 mg / ml, Sigma-Aldrich). Stable cells were established to puromydn (Sigma-Aldrich) resistance. The established cells were analyzed by co-immunoprecipitation and immunoblot.
  • Transcriptional activity of NFAT5 / TonEBP was measured by luciferase reporter gene (pTonE-luc) in response to NFAT5 / TonEBP in the absence of TAZ. Specifically, 293T cells were placed in 6-well plates at a number of 5 ⁇ 10 5 cells / well,
  • NFAT5 / TonEBP and TAZ expression vectors were transiently transformed, and luciferase (NFAT5 / TonEBP-responsive element-1 inked luciferase, pTonE-luc) and pCMVP to which the elements reacted to NFAT5 / TonEBP were transformed as a trans control.
  • Luciferase activity was analyzed using the Bright-Glo luciferase assay kit (Promega, Madison, Wis.). Relative luciferase units were calculated after normalization to ⁇ -galactosidase activity (TR0PIX, Bedford, Mass.).
  • DNA-binding activity of NFAT5 / TonEBP was measured by DNA-pull-down assay, and specific methods are as follows. .
  • Cells transformed with Myc-labeled NFAT5 / TonEBP and Flag-labeled TAZ and Y316F were HKMG buffer (10 mM Hepes, H 7.9, 100 mM KC1, 5 mM MgCl 2 , 10% glycerol, 0.1% NP-40, and 1 mM DTT), followed by incubation with biotinylated double stranded DNA, followed by incubation with streptavidin agarose beads.
  • DNA sequences comprising elements that bind to NFAT5 / TonEBP are as follows: 5'-ct t ggtggaaat t accgctggt-3 '(SEQ ID NO: 2) and 5'_aaccagcggtccttttccaccaa_3' (SEQ ID NO: 3).
  • DNA-pull-down assay showed that NFAT5 / TonEBP directly
  • TAZ inhibits NFAT5 / TonEBP activity
  • TAZ overexpression or deficiency influences the expression of endogenous NFAT5 / TonEBP target genes, BGT1 and SMIT.
  • mIMCD-3 cells overexpressing TAZ were established. Specifically, mIMCD-3 cells were expressed using virus-expressing flag-TAZ or small hairpin TAZ RNA. A transformed cell line was established in the same manner as in Example ⁇ 4-1>. Next, immunoblot was performed as described in Example ⁇ 1-3>.
  • RNA and reverse transcription were used to isolate total RNA and reverse transcription for cDNA synthesis.
  • Real-time PCR reactions were performed with SYBR Green pre-mix buffer and ABI-Prism 7300 sequence detect or (Perkin-Elmer Applied Biosystems, Foster City, CA). Relative expression levels were confirmed after leveling against Ct values for ⁇ -actin.
  • Gene specific primers are as follows: BGT1, 5′-c t gggagagacgggt 111 gggt at t acat c-3 ′ (SEQ ID NO: 4), 5′—ggaccccaggtcgtggat_3 '(SEQ ID NO: 5); SMIT, 5'-ccgggcgctctatgacctggg-3 '(SEQ ID NO: 6), 5'- caaacagagaggcaccaatcg_3' (SEQ ID NO: 7); and ⁇ -act in, 5 '-agagggaaatcgtgcgtgac-3' (SEQ ID NO: 8), 5'-caatagtgatgacctggccgt- 3 '(SEQ ID NO: 9).
  • TAZ knockdown to determine the cellular index of the presence or absence of TAZ
  • Knockdown (shTAZ) and control (shcon) cells were established and cells were observed in real time for 24 hours. Specifically, stable mIMCD-3 cells (shcon and shTAZ) were placed on E—plate 96 and observed on the xCELLigence system (Real-Time Cell Analyzer, Roche, Germany). After overnight growth, cells were cultured in isotonic or hypertonic medium. Cell index values (CI) were observed continuously for every 15 minutes for 24 hours. Two independent experiments were performed two times and the average of two was calculated according to the manufacturer's instructions (xCELLigence, Roche, Germany).
  • WT and K0 mice were bred. Specific animal breeding is as follows. Wild type (WT) C57BL / 6 mice were purchased from Jackson Laboratories (Bar Harbor, MN). The TAZ knockout (0) mouse was manufactured as follows. In order to remove TAZ ⁇ 2, a vector was removed to remove ⁇ 2, and the vector was injected into embryonic stem cells to establish a recombined cell line. Established cell lines were planted in surrogate mothers to obtain chimera. WT and TAZ knockout (K0) mice were maintained under pathogen free conditions.
  • TAZ expression was confirmed, and when compared with WT, it was confirmed that the expression of TAZ was less in TAZ K0 mice ( 7A).
  • MEF cells transformed with the pTonE-luc reporter gene were subjected to storage, isotonic or hypertonic medium (150, 300, or 400 m0sm / Kg H 2 0 final osmolarity) with NaCl for 2-4 hours. Exposed.
  • hypertonic stimulation increased reporter activity in WT MEF cells, but not TAZ.
  • the above ingredients were mixed and layered on an airtight cloth to prepare a powder.
  • tablets were prepared by tableting according to a conventional method for preparing tablets.
  • the present invention provides a renal impairment induced by osmotic stress, that is,

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 TAZ 티로신 인산화 억제제를 유효성분으로 함유하는 삼투 스트레 스로 유발된 신장 장애의 예방 및 치료용 약학적 조성물에 관한 것으로, 보다 상세 하게는 TAZ가 NFAT5/TonEBP의 활성을 저해하고, c-Abl 활성이 TAZ 및 NFAT5/TonEBP 의 상호작용에 필요하며, 인산화된 TAZ가 NFAT5/TonEBP의 결합활성을 저해하고, 생 체 내(in vivo)에서 탈수로 유래된 고장성 조건에서 TAZ의 억제가 고장성 자극의 영향을 완화시키기 위한 표적 유전자 발현 및 NFAT5/TonEBP의 활성을 극대화하는 것을 확인하였으므로, TAZ 티로신 인산화 억제제는 삼투 스트레스로 유발된 신장 장애의 예방 또는 치료에 유용하게 사용될 수 있다.

Description

【명세서】
【발명의명칭】
NFAT 5 / T o n EB P 활성화를 위하여 유효성분으로 TAZ 티로신 인 산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물
【기술분야】
<ι> 본 발명은 NFAT5/TonEBP 활성화를 위하여 유효성분으로 TAZ 티로신 인산화의 억제제를 함유하는 신장 장애와 예방 및 치료용 약학적 조성물에 관한 것이다.
<2>
【배경기술】
<3> TAZ (Transcriptional Coactivator with PDZ— binding motif)단백질은 WW도메 인 (domain)을 포함하는 WWTRl (WW domain containing transcription regulator 1, Wwtrl)이며， 전사조절 보조인자이다. 14-3-3 펩티드와 결합된 상태로 세포의 세포 질에 위치해 있다가 외부 자극에 의하여 14-3-3 펩티드와 결합이 억제되면서 세포 핵으로의 이동이 일어난다 (Hong JH et al, Cell Cycle 5： 176-179, 2006； Kanai F et al, EMB0 J 19： 6778-6791, 2000). 세포핵으로 이동한 TAZ 단백질은 단백질 구 조적 특성을 통해 다양한 전사인자 단백질과 결합하고， 전사인자의 활성을 조절한 다.
<4>
<5> TAZ는 ΉΈ— 1와 결합올 통해 표면 활성 물질 C의 발현에 영향을 주며 단백질 분해 조절을 통하여 폐포의 온전한 상태에 필수적인 다른 표면 활성 물질 또는 인 자의 수준을 조절하는 것으로 알려져 있다 (Park KS et al., J Biol Chem 279： 17384-17390, 2004； Tian Y et al. , MOLECULAR AND CELLULAR BIOLOGY, Y Sept. 2007, p. 6383-6395). 또한， TAZ 단백질은 임신 중반 마우스 배아 (midgestat ion mouse embryo)에서 TAZ는 주로 축옆의 중배엽 (paraxial mesoderm) , 지아 (limb bud), 및 신경관 (neural tube)에서 발현된다 (Murakami M et al ·， Biochem Biophys Res 腿 un 339： 533-539 , 2006) . 이러한 결과들은， TAZ,단백질이 다양한 조직 및 장기에 걸쳐 넓게 발현 분포하고, 성장 및 질병과 연관된 전사 인자의 활성을 조절 하는데 매우 중요한 것을 제시한다. 그 외에도 TAZ 결합 단백질은 많이 규명되어 세포 증식 조절， 암 발생 등에 관련되었다고 알려져 있으나 생체 내 (/? vivo) 결과 는 구체적으로 증명되어 있지 않다.
<6>
<?> 한편， TAZ유전자를 제거한마우스의 제작은 TAZ 기능의 생체 내에서의 역할 을 잘 규명해 주는 증요한 모델이다. TAZ 넉아웃 마우스 (TAZ knockout mouse)의 자손은 어린 나이에 대부분 사망하는 특징을 보인다. TAZ 넉아웃 마우스 자손의 조직 분석 결과, 폐에서의 심각한 섬유화 (Lung emphysema)와 신장조직에서의 낭포 형성 (Glomerulocytic cystic kidney)을 보였다 (Hossain, Z et al . , Proc. Natl. Acad. Sci. USA 104:1631-1636. 2008; Makita R et al. , Am J Physiol Renal Physiol 294： F542-F553, 2008).
<8>
<9> 장력 (tonicity)은 두 구획 사이의 삼투질 농도의 차이를 의미한다. 두 구획 사이에서 삼투질 (osmolyte) 농도가 높은 쪽을 고장성이라 하고, 삼투질 농도가 낮 은 쪽을 저장성이라 하며， 용매가 고장성에서 저장성으로 이동하여 두 구획이 평형 이 된다. 상기 삼투질 농도는 삼투압 농도(0311101£11"^ )로 환산된다. 염분과 요소
(urea)의 높은 농도로 인하여, 포유동물 신장 수질의 삼투압 농도는 종종 혈액 삼 투압 농도의 10 배 또는 그 이상으로 매우 높다. 끊임없이 반복되는 고장성 (hypertonicity)은 세포를 줄어들게 하고， 물의 삼투 유출 (osmotic efflux) 때문에 세포는 스트레스를 받게 된다. 또한, 고삼투압 농도는 이중나선 DNA 절단 (double- stranded DNA break) (Ku " ltz, D.， and Chakravarty, D.(2001) Proc. Natl. Acad. Sci. U. S. A. 98,1999-2004) 및 세포 죽음 (Michea, L. et al, (2000) Am. J. Physiol. Renal Physiol. 278， F209-F218)의 원인이 되는 과도한 스트레스를 세포 에 부과한다. 따라서， 상피의 수송 및 세포 부피를 유지하는 조절 메커니즘 (mechanism)을 필요로 한다 (Sun, A et al. , Kidney International 36(5), 831- 842.1989； Natke Jr. , E. , Renal, Fluid and Electrolyte Physiology F1657- F1665(6), 258. 1990) .
<io>
<n> 신장의 장력 변화는 알도즈 리덕타제 (aldose reductase)(Ko, B.C. et al.,
J. Biol. Chem.272 :16431-16437, 1997) , 베타인 /GABA 수송체 (betaine/GABA transporter, BGT)(Miyakawa, H et al. 1998. Am. J. Physiol. 274:F753_F761) , 타 우린 수송체 (taurine transporter, TauT)(Ito, T et al . 2004. Biochem. J. 382:177-182), HSP-70(Woo, S.K et al, Mol. Cell. Biol. 22:5753—5760)， 나트륨 / 미오—이노시톨 공동수송체 (sodium/my으 inositol cotransporter , SMIT)(Rim, J.S et al. 1998. J. Biol. Chem. 273:20615-20621), 요소 수송체 (urea transporter)(Nakayama, Y et al , J. Biol. Chem. 275:38275—38280) 및 아쿠아포린 (aquaporin, AQP)(Hasler, U et al. , 2006. J. Am. Soc. Nephrol. 17: 1521-1531)을 포함하는， 다양한 유전자의 발현을 조절하는 것으로 밝혀졌다. 각각의 경우에, 유 전자 발현의 증가는 TonE TGGAAA顯 NCN, 여기서 N은 표적 유전자의 프로모터 (promoter)에 위치한 임의의 뉴클레오티드이다)을 통해 조절되는 것이 확인된 바 있다 (Miyakawa, H et al, Proc.Natl. Acad. Sci. U. S. A. 96:2538-2542).
<12>
<i3> TonE一결합 단백질 (tonicity一 responsive enhancer binding protein,
NFAT5/TonEBP)은 NFAT(Nuclear factor of activated T cells 5)라고도 불리며 표적 유전자 프로모터에서 이것의 인식 성분을 효율적으로 둘러싸는， TonE에 관련된 이 합체 (dimer) 단백질이다 (Stroud, J.C et al, 2002. Nat. Struct . Biol. 9:90-94). NFAT5/TonEBP는 유기적 삼투질 (organic osmolyte)을 위한 합성 효소와 막 수송체 (membrane transporter)의 전사를 자극하고, 유기적 삼투질의 세포 축적을 촉진한 다 (S.K. Woo et al, Int. Rev.Cytol. 215(2002) 189-202). 유기적 삼투질은 세포 부피 및 세포 내 이온 세기 (ionic strength)에서 고장성이 유래된 변화를 정상화한 다. 또한, NFAT5/TonEBP는 높은 요소의 유해한 영향으로부터 신장 수질 세포를 보 호하는 HSP70(Woo, S.K et al , 2002. Mol. Cell. Biol. 22 :5753-5760)의 발현을 자 극한다 (W. Neuhofer et al, J. Am. Soc. Nephrol. 12(2001) 2565-2571) . 따라서， NFAT5/TonEBP은 고장성 신장 (hyperosmotic kidney)에서 많은 경로의 중요한 조절자 이다.
<14>
<15> 한편， NFAT5/TonEBP는 이방향성으로 (bi-directionally) 조절된다. 즉， 저장 성에 의해 저발현 (down-regulated) 및 활성이 억제되고， 고장성에 의해 고발현 (up- regulated) 및 활성화된다 (S.K. Woo, et al, Am. J. Physiol . Renal Physiol. 278(2000) F1006-F1012). 고장성에 반응하여 FAT5/TonEBP는 인산화, 핵으로의 이 동 (nuclear localization), 전사활성의 증가를 나타낸다 (S.C. Dahl , J.S. Handler, H.M. Kwon, Am. J. Physiol. Cell Physiol. 280(2001) C248-C253； J.D. Ferraris, et al, Proc. Natl. Acad. Sci. USA 99(2002) 739-744) . 등장성의 상태에서， NFAT5/TonEBP는 핵과 세포질 모두에서 분포하지만， 생체 내에서의 절수 (Cha, J.H., et al. 2001. J. Am. Soc. Nephrol . 12:2221-2230) 또는 시험관 내에서의 고장성 환경 (S.C. Dahl, J.S. Handler, H.M. Kwon, , Am. J. Physiol. Cell Physiol. 280(2001) C248-C253; Zhang, Z., et al. 2005. Am. J. Physiol .Renal Physiol. 289:F506-F511)에 노출됨에 따라， NFAT5/TonEBP는 핵으로 이동한다. 기존에, 단백 질 키나아제 (protein kinase A, PKA), ATM(ataxia telangiectasia mutated), 포스 파티딜이노시를 3-키나아제 클래스 IA( phosphatidyl inositol 3- kinase class IA, PI3K-IA), Fyn 및 p38를 포함하는 다수의 키나아제 (kinase)가 높은 NaCl로 유래된 NFAT5/TonEBP의 활성과 관계가 있는 것이 확인된 바 있다 (Burg, M. B. , Ferraris, J. D. , and Dmitrieva, N. 1.(2007)， Physiol. Rev. 87, 1441-1474) . 또한, 고농 도의 NaCl로 유도된 c-Abl 키나아제는 NFAT5/TonEBP 핵으로의 이동, 전사 활성 촉 진을 유도하며， ΤοηΕΒΡ-Π43를 인산화시킨다. 상기와 같이， ΤΑΖ의 생체내 역할과 NFAT5/TonEBP의 고장성 조건에서의 기능 등이 각각 밝혀진 바 있으나, 고장성 조건 에서 TAZ의 티로신 인산화와 이에 따른 NFAT5/TonEBP의 활성 억제에 대해서는 연구 된 바 없다.
<16>
<17> 이에 , 본 발명자들은 고장성 조건에서， TAZ의 활성 변화와 NFAT5/TonEBP와의 상호작용 연구를 통해 TAZ의 신장에서 역할에 대해 연구한 결과, 고장성 조건에서 TAZ가 티로신 인산화 변형을 거쳐 NFAT5/TonEBP와 직접적으로 그리고 특이적으로 결합하여 NFAT5/TonEBP의 활성을 억제조절함을 확인하였다. 따라서, 고장성 삼투 압 스트레스 조건하에서 발생하는 신장 기능 장애로부터 회복을 위하여， TAZ 티로 신 인산화의 억제를 통한 NFAT5/TonEBP의 활성의 최적화가 가능할 것으로 밝힘으로 써 본 발명을 완성하였다.
<18>
【발명의 내용】
【기술적 과제】
<19> 본 발명의 목적은 TAZ 티로신 인산화 억제제를 함유하는 삼투압농도에 의한 스트레스 (osmolarity stress) 조절 이상으로 기인한 질환의 예방 및 치료용 약학적 조성물을 제공하는 것이다.
<20> 또한, 본 발명의 다른 목적은 TAZ를 이용하여 삼투압 농도에 의한 스트레스 조절 이상으로 기인한 질환에 대한 발병기전을 제시함으로써 질병의 예방 또는 치 료제 후보물질을 스크리닝하는 방법을 제공하는 것이다.
<2i> 또한， 본 발명의 다른목적은 상기 TAZ티로신 인산화 억제제를 개체에 투여 하는 단계를 포함하는 삼투스트레스로 유발된 신장 장애의 예방 방법을 제공하는 것이다.
<22> 또한, 본 발명의 다른 목적은 상기 TAZ티로신 민산화 억제제를 개체에 투여 하는 단계를 포함하는 삼투 스트레스로 유발된 신장 장애의 치료 방법을 제공하는 것이다. <23> 아을러， 본 발명의 다른 목적은 삼투 스트레스로 유발된 신장 장애의 예방 및 치료용 약학적 조성물에 사용하기 위 한 상기 TAZ 티로신 인산화 억제제를 제공 하는 것이다.
<24>
【기술적 해결방법】
<25> 상기 목적을 달성하기 위하여 , 본 발명은 TAZ 티로신 인산화 억제제를 함유 하는 삼투 스트레스로 유발된 신장 장애의 예방 및 치료용 약학적 조성물을 제공한 다 ·
<26> 또한 , 본 발명은 약학적으로 유효한 양의 TAZ 티로신 인산화 억제제를 함유 하는 조성물을 개체에 투여하는 단계를 포함하는 신장 조직 내 삼투압 농도에 의 한 스트레스의 억제 방법을 제공한다.
<27> 또한 , 본 발명은
<28> 1) TAZ 발현 세포주에 피검물질을 처 리하는 단계 ;
<29> 2) 상기 세포주에서 TAZ 단백질의 티로신 인산화 수준을 측정하는 단계 ; 및
<30> 3) 상기 TAZ 단백질의 티로신 인산화 수준이 피검물질을 처 리하지 않은 대조 군에 비해 감소된 피 검물질을 선별하는 단계를 포함하는， 삼투 스트레스로 유발된 신장 장애의 예방 및 치료제 후보물질의 스크리닝 방법을 제공한다 .
<31> 또한， 본 발명은
<32> 1) TAZ 및 TonEBP 발현 세포주에 피검물질을 처리하는 단계 ;
<33> 2) 단계 1)의 세포주에서 TAZ 및 TonEBP의 결합 활성을 측정하는 단계 ; 및
<34> 3) 단계 2)의 TAZ 및 TonEBP 결합 활성 수준이 피검물질을 처 리하지 않은 대 조군에 비해 감소된 피검물질을 선별하는 단계를 포함하는， 삼투 스트레스 유발 신 장애의 예방 및 치료제 후보물질의 스크리닝 방법을 제공한다.
<35> 또한， 본 발명은 상기 TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 삼투스트레스로 유발된 신장 장애의 예방 방법을 제공한다 .
<36> 또한 , 본 발명은 상기 TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 삼투 스트레스로 유발된 신장 장애의 치료 방법을 제공한다.
<37> 아울러， 본 발명은 삼투 스트레스로 유발된 신장 장애의 예방 및 치료용 약 학적 조성물에 사용하기 위한 .상기 TAZ 티로신 인산화 억 제제를 제공한다.
<38>
【유리 한 효과】
<39> 본 발명에서는 TAZ가 NFAT5/TonEBP의 활성을 저해하고， c— Abl 활성 이 TAZ 및 NFAT5/TonEBP의 상호작용에 필요하며， 인산화된 TAZ가 NFAT5/TonEBP의 결합활성을 저해하고, 생체 내 (/ ra)에서 탈수로 유래된 고장성 조건에서 TAZ의 억제가 고 장성 자극의 영향을 완화시키기 위한 표적 유전자 발현 및 NFAT5/TonEBP의 활성을 극대화하는 것을 확인함으로써, TAZ 티로신 인산화 억제제는 삼투 스트레스로 유발 된 신장 장애， 즉， 신질환， 신기능장애 및 신부전으로 구성된 군으로부터 선택된 질환의 예방또는 치료에 유용하게 사용될 수 있다.
<40>
【도면의 간단한 설명】
<41> 도 1은 고장성 조건에서 TAZ의 핵 위치 향상에 관한도이다.
<42> 도 1A는 Cos7 세포는 GFP— TAZ 백터로 일시적으로 형질전환하고， 4시간 동안 다른 농도의 NaCl에 노출한 후에, 세포를 DAPI로 염색하고， 공초점현미경으로 측정 한 결과이다.
<43> 도 1B는 Cos7 세포안의 GFP-TAZ의 세포 이하의 위치는 현미경으로 정량한 결 과이다.
<44> 도 1C는 mIMCD-3 세포를 4시간동안다른 조건에서 배양하고, TAZ 면역염색 하고， 그 후에 팔로이딘 및 DAPI 염색한 결과이다. 스케일 바 (Scale bars) ： 50 μηι
<45> 도 1D는 장력 스트레스에 의해 자극된 mIMCD-3 세포로부터 핵 (nuc) 및 세포 질 (cyto) 단백질을 분획한 후에， 단백질을 SDS— PAGE로 분석하고， TAZ, 0CT1 및 액 틴 (actin)에 대한항체와 함께 면역블랏한 결과이다.
<46> 도 2는 고장성에 의해 유도된 c-Abl 활성화에 의한 TAZ의 티로신 인산화에 관한 도이다.
<47> 도 2A는 mIMCD-3 세포를 4시간 동안 300 및 400 mOsm에 노출시키고, 전체 세 포 추출물 (Whole cell extracts, WCE)를 항— TAZ 항체로 면역침강하고， 면역 복합체 를 포스포티로신 (phosphotyrosine)(pY; 4G10) , 포스포세린 (phosphoser ine) TAZ(pS; PS89) 및 TAZ에 대한 항체와 함께 면역블랏한 결과이다.
<48> 도 2B는 안정한 mIMCD-3 세포 (mock/頂: D 및 Flag-TAZ/IMCD)를 저장성， 등장 성 및 고장성에서 4시간 동안 자극하고, TAZ 면역 복합체를 4G10 및 항 -TAZ 항체로 면역블랏하여 분석한 결과이다.
<49> 도 2C는 WCE를 인산화된 c-Abl(pAbl), c-Abl 및 액틴에 대한 항체로 면역블 랏하여 분석한 결과이다.
<50> 도 2D는 Flag를 붙인 TAZ를 293T 세포에서 과발현시키고， Flag-M2 아가로스 비드 (agarose beads)를 이용하여 침강시킨 후， 상기 활성 혼합물을 SDS-PAGE 및 방 사선촬영으로 분석하고， 별도로, TAZ수준을 면역블랏으로 분석한 결과이다.
<5i> 도 2E는 293T 세포를 c-Abl 발현 백터가 있거나 없는 Flag-TAZ로 형질전환하 고， TAZ 면역 복합체 및 WCE를 SDS-PAGE로 분석하고, 4G10, TAZ 및 c-Abl 항체로 면역블랏한 결과이다.
<52> 도 2F는 293T세포를 Flag-TAZ 및 c-Abl 발현 백터로 형질전환시키고， 제니 스테인 (genistein)(GNS; 50 μΜ) 또는 STI-57 STI; 10 μΜ)의 존재하에 1시간 동 안 배양한 후에 ΤΑΖ 면역 복합체를 4G10 및 ΤΑΖ 항체로 면역블랏하여 분석한 결과 이다.
<53> 도 2G는 mIMCD-3 세포를 STI-57KSTI; 10 μΜ) 가 있거나 없는 고장성으로 자극하고, ΤΑΖ 면역 복합체를 4G10 및 항 -ΤΑΖ항체로 별도로 분석한 결과이다. <54> 도 3은 c-Abl로 유도한 TAZ의 티로신 316에서의 인산화를 나타낸 도이다.
<55> 도 3A는 293T 세포를 Flag-TAZ 및 c— Abl 발현 백터로 형질전환하고, TAZ 면 역 복합체를 SDS-PAGE로 분석하고, 4G10 및 pY116, pY141, pY300, pY316 TAZ, 또는
TAZ에 대한 항체와 면역블랏한 결과이다.
<56> 도 .3B는 모 (Parental) mIMCD-3 세포를 고장성의 배지에 4시간 동안 배양하 고， 내생적 TAZ 단백질을 면역침강하고， pY316 TAZ 또는 TAZ 항체로 면역블랏한 결 과이다.
<57> 도 3C는 293T세포를 WT TAZ 및 c-Abl 발현 백터가 있거나 없는 Y316F TAZ로 형질전환시키고， 면역 복합체를 분석하고, 4G10, pY316 TAZ, 및 TAZ 항체로 면역블 랏한 결과이다.
<58> 도 3D는 mIMCD3 세포를 TAZ 발현 백터로 안정하게 형질전환시키고, 안정한 세포를 퓨로마이신 (puromycin)이 있는 데서 선별하고， 상기 세포들을 4 시간 동안 고장성 환경하에서 배양하고， 그후에 면역침강 및 면역블랏분석한 결과이다.
<59> 도 4는 인산화된 TAZ 및 NFAT5/TonEBP 사이의 물리적 상호작용에 관한 도이 다. 도 4A 내지 4C는 293T 세포를 각 패널에 기재한 바와 같이 C-Abl， Myc-tagged WT 또는 돌연변이형 (Y143F; MT) NFAT5/TonEBP 및 Flag를 붙인 TAZ WT 또는 돌연변 이형 Y316F로 형질전환시킨 결과이다.
<60> 도 4A는 NFAT5/TonEBP 면역 복합체를 항 -Myc 항체를 이용한 배양으로 침강시 키고， SDS-PAGE로 분석하고， 면역블랏한 결과이다.
<61> 도 4B는 세포를 형질전환하고, 수확 전 1시간 동안 STI-57 10 μΜ)를 처리 하고, ΤΑΖ 면역 복합체 및 WCE는 Myc, pY316, 및 TAZ에 대한 항체로 블랏한 결과이 다.
<62> 도 4C는 TAZ 면역 복합체 및 WCE는 Myc 및 Flag 항체로 면역블랏한 결과이 다.
<63> 도 4D는 mIMCD-3 세포를 4 시간 동안 다른 장력으로 자극하고, 내생적 TAZ 면역 복합체는 TAZ 항체로 침강하고， 그 후에 SDS-PAGE 하고， NFAT5/TonEBP 및 PY316 항체로 면역블랏한 결과이다.
<64> 도 4Ε는 장력으로 자극된 mIMCD3 세포를 고정하고, TAZ 및 NFAT5/TonEBP 항 체와 배양하고, Duolink in situ PLA kit를 이용하여 특이적 2차 항체와 PLA 탐침 (probe)과 함께 배양한후에 시료를 공초점 현미경하에서 관찰한 결과이다.
<65> 도 5는 TAZ에 의한 NFAT5/TonEBP의 억제에 관한도이다.
<66> 도 5A는 293T 세포를 NFAT5/TonEBP 및 다른 양의 TAZ 발현백터와 함께
NFAT5/TonEBP에 대응하는 루시퍼라제 리포터 유전자 (pTonE-luc)로 형질전환시키고， pCMVP 대조군으로 사용하여， NFAT5/TonEBP 및 TAZ 발현은 면역블랏 분석한 결과이 ' 다. 루시퍼라제 리포터 유전자 활성을 β—갈락토시다제 (β-galactosidase) 활성으 로표준화 (nomalization)한 뒤에 산출하였다.
<67> 도 5B는 293T 세포를 pTonE-luc 및 pCMVP 함께 NFAT5/TonEBP 및 TAZ 발현 백터 (FT, Y118F, 또는 Y316F)를 형질전환하고, 리포터 활성을 3개 독립적인 실험으 로부터 산출하고 평균으로 표현한 결과이다.
<68> 도 5C는 NFAT5/TonEBP를 WT 또는 Y316F TAZ와 함께 293T'세포에 과발현시키 고， WCE를 NFAT5/TonEBP에 결합하는 요소를 포함하는 비오틴이 붙은 2중 가닥 DNA 으로 1시간 동안 배양하고， 연이어 부가적인 2 시간 동안 스트랩타아비딘-아가로스 비드 (streptavidin-agarose beads)를 배양한 후， SDS-PAGE 및 면역블랏한 결과이 다. DNA가 결합된 복합체 및 WCE는 NFAT5/TonEBP 및 TAZ 항체로 분석하였다. *ᅳ P < 0.05； **, P < 0.005.
<69> 도 6은 NFAT5/TonEBP를 유도하는 유전자 발현에서 TAZ의 저해 효과에 관한 도이다.
<70> 도 6A는 TAZ 안정한 형질전환체 (TAZ) 및 대조군 (C0N)세포는 다른 장력 조건 에서 4시간 동안 배양하고， TAZ 및 NFAT5/TonEBP의 발현을 면역블랏으로 확인한 결 과이다ᅳ
<7i> 도 6B는 TAZ 안정한 형질전환체 (TAZ) 및 대조군 (C0N)세포는 다른 장력 조건 에서 4시간 동안 배양하고， BGT1 및 SMIT1 수준을 측정하기 위해 실시간 (real¬ time) PCR한 결과이다. 상대적인 발현 수준을 β-액틴 수준에 대하여 표준화한 후 에 계산하였다.
<72> 도 6C는 TAZ 넉다운 (knockdown) (shTAZ) 및 대조군 (shcon)세포를 수립하고, 등장성 및 고장성 조건에서 4 시간 동안 자극한 후에, TAZ, NFAT5/TonEBP, 및 액틴 의 단백질 수준을 면역블랏으로 확인한 결과이다.
<73> 도 6D는 TAZ 넉다운 (knockdown) 및 대조군 (shcon)세포를 수립하고， 등장성 및 고장성 조건에서 4 시간 동안 자극한후에， 상대적인 BGT1 및 SMIT의 mRNA 수준 을 실시간 -PCR로 확인한 결과이다.
<74> 도 6E는 TAZ 넉다운 (knockdown) 및 대조군 (shcon)세포를 수립하고， 등장성 및 고장성 조건에서 4 시간 동안 자극한 후에， 24시간 동안 xCELLigence system를 이용하여 관측한 결과이다;
<75> *, P < 0.05； **, P < 0.005.
<76> 도 7은 TAZ K0 세포에서， 회복된 TAZ에 의해 NFAT5/TonEBP 활성을 재억제시 키지만, Y316F는 NFAT5/TonEBP 활성을 재억제시키지 못하는 것을 확인한 도이다.
<77> 도 7A는 TAZ 발현을 면역블랏에 의해 WT및 K0 MEF 세포에서 확인한도이다.
<78> 도 7B는 WT 및 K0 MEF 세포를 리포터 유전자 (pTonE— luc 및 pCMV|3로 형질전 환하고， 다른 장력 조건에서 24시간 동안 처리한 결과이다.
<79> 도 7C는 TAZ K0 MEF 세포를 WT 또는 리포터 유전자 (pTonE-luc 및 pCMV|3와 함께 Y316F TAZ 발현백터로 형질전환시키고， 그 후에 세포를 등장성 또는 고장성 배지에서 24시간 동안 자극한 후에， 패널 B 및 (：의 리포터 활성 (RLU)을 β-갈락토 시다제 활성으로 표준화한 후에 계산하고， 세개의 독립된 실험의 평균 SEM 으로서 표현한도이다.
<80> 도 7D는 전체 RNA를 WT 및 Κ0 마이스의 신장에서 분리하고 (10— 12 주， η =
4)， 역전사한후에 실시간 -PCR분석한 결과이다;
<81> **， Ρ < 0.005； ρ < 0.0005.
<82>
【발명의 실시를 위한 최선의 형태】
<83> 이하， 본 발명을 상세히 설명한다.
<84>
<85> 본 발명은 TAZCRANSCRIPTIONAL C0ACTIVAT0R with PDZ-binding motif) 티로 신 인산화 억제제를 유효성분으로 함유하는 삼투압 농도에 의한 스트레스
(osmolarity stress) 조절 이상으로 기인한 질환의 예방 및 치료용 약학적 조성물 을 제공한다. <86> 상기 삼투압 농도에 의한 스트레스 조절 이상으로 기인한 질환은 신질환， 신 기능장애 또는 신부전인 것일 수 있으나， 이에 한정되지 않는다.
<87> 상기 TAZ는 서열번호 1로 기재되는 아미노산 서열을 갖는 것일 수 있으나， 이에 한정하지 않는다.
<88> 상기 TAZ는 서열번호 1로 기재되는 아미노산 서열에서 동일한 활성을 갖는 한， 하나 또는 몇 개의 아미노산이 첨가， 결실， 치환되는 아미노산서열을 가질 수 있다.
<89> 상기 TAZ는 서열번호 1로 기재되는 아미노산 서열에 80% 이상의 상동성， 바 람직하게 9(» 이상의 상동성， 더욱 바람직하게 95% 이상의 상동성을 갖는 아미노산 서열일 수 있다.
<90> 상기 TAZ의 티로신 인산화부위는 TAZ의 316 번째 티로신인 것일 수 있으나, 이에 한정하지 않는다.
<91> 상기 TAZ 티로신 인산화 억제제는 NFAT5/TonEBP의 활성을 증가시키는 것일 수 있으나， 이에 한정하지 않는다.
<92> 상기 TAZ 티로신 인산화 억제제는 TAZ 단백질에 상보적으로 결합하는 기질 유사체， 화합물， 펩티드， 펩티드 미메틱스， 앱타머 및 항체로 구성된 군으로부터 선택된 어느 하나를 갖는 것일 수 있으나, 이에 한정하지 않는다.
<93>
<94> 항체
<95> TAZ에 대한 항체는 TAZ에 특이적이고 직접적으로 결합하여 TAZ의 활성을 효 과적으로 억제할 수 있다. 상기 TAZ에 특이적으로 결합하는 항체는 폴리클로날 (polyclonal) 항체 또는 모노클로날 (monoclonal ) 항체를 사용하는 것이 바람직하 며， 모노클로날 항체를 사용하는 것이 더욱 바람직하다. 상기 바이오마커에 특이 적으로 결합하는 항체는 당업자에게 알려진 공지의 방법^로 제작하여도 무방하며 , 상업적으로 알려진 항체를 구입하여 사용할 수 있다. 상기 항체는 당업자에게 알 려진 종래 방법에 따라 면역원인 TAZ 단백질을 외부 숙주에 주사함으로써 제조될 수 있다, 외부 숙주는 마우스, 래트， 양, 토끼와 같은 포유동물을 포함한다. 면 역원은 근내， 복강내 또는 피하 주사방법으로 주사되며, 일반적으로 항원성을 증가 시키기 위한 보조제 (adjuvant)와 함께 투여할 수 있다. 외부 숙주로부터 정기적으 로 혈액을 채취하여 형상된 역가 및 항원에 대한 특이성을 보이는 혈청을 수거하여 항체를 분리할 수 있다.
<96> <97> 기질 유사체
<98> TAZ의 결합 도메인을 억제하는 유사체 (예 : 펩티드 또는 비펩티드성 약제 )를 제작하여 TAZ의 활성을 억제할 수 있다. 특히 상기 펩티드 유사체 또는 TAZ의 기 질인 작은 펩티드 기질 (short peptide substrate: 미합중국 특허 제 7,65으 034호) 의 단편의 비가수분해형 펩티드 유사체가 사용될 수 있다. 상기 비가수분해성 펩 티드 유사체는 β-턴 디펩티드 코어 (Nagai et al .， Tetrahedron. Lett. 26:647， 1985) , 케토-메틸렌 슈도펩티드류 (Ewenson et al. , J. Med. Chem. 29:295, 1986； Ewenson et al . , in Peptides: Structure and Funct ion(Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985)， 아제핀 (Huffman et al . , in Peptides: Chemistry and Biology, G.R. Marshall ed. , ESCOM Publisher: Leiden, Netherlands, 1988), 벤조디아제핀 (Freidinger et al. , in Peptides; Chemistry and Biology, G.R. Marshal 1 ed. , ESCOM Publisher: Leiden, Netherlands, 1988) , β 아미노알콜 (Gordon et al . , Biochem. Biophys. Res. Co隱 un. 126:419 1985) 및 치환 감마 락탐환 (Garvey et al . , in Peptides: Chemistry and Biology, G.R. Mar she 11 ed. , ESCOM Publisher: Leiden, Netherlands, 1988) 을사용하여 생성할수 있다.
<99>
<ιοο> 본 발명자들은 고장성 자극에 의하여 TAZ의 핵 위치가 변화하는지 확인하였 고， 고장성 (400 m0sm/kg) 자극은 점차적으로 TAZ의 핵 위치를 증가시켰다 (도 1 참 조).
<101>
<102> 고장성으로 유도된 c-Abl 활성화로 인한 TAZ의 티로신 인산화를 확인하고자 하였다. 면역침강된 TAZ 단백질이 무세포 시스템에서 c-Abl에 의해 직접적으로 인 산화되는 것을 확인하였다 (도 2D 참조). 따라서， 293T 세포안에서 c-Abl와 TAZ의 공동 발현은 TAZ의 티로신 인산화를 증가시켰다 (도 2E 참조).
<103>
<i04> c-Abl 인산화 부위는 TAZ의 티로신 316인 것을 확인하였다. TAZ 인산화 및 활성에서 Y316의 증요성을 조사하고자， 티로신 316을 페닐알라닌 (phenylalanine)으 로 교체함으로씨 돌연변이 TAZ(Y316F)를 구축하였다. c— Abl의 과발현은 야생형 (WT) TAZ의 인산화를 증가시켰으나， 4G10 및 pY316 TAZ 항체로 면역블랏함으로써 증명한 바와 같이， Y316F 돌연변이를 인산화하는 것은 실패하였다 (도 3C 참조). 추가하여, Flag로 표지된 야생형 (WT) TAZ 및 이의 티로신 돌연변이 (Y118F, Y141F, Y300F, 및 Y316F)를 발현하는 안정한 mIMCD-3 세포를 수립하였고, 고장성 조건에 노출하였다. 고장성 자극은 WT, Y118F, Y141F 및 Y300F TAZ 단백질을 유도하였으 나， 이러한 고장성으로 유도된 인산화는 Y316F 돌연변이에서 손상되었으며 (도 3D 참조)， 이는 TAZ의 티로신 316이 c-Abl 인산화 부위인 것을 나타낸다.
<105>
<106> 고장성이 매개하는 신호 경로에서 인산화된 TAZ의 기능을 확인하고자, TAZ와 고장성 신호 경로의 주요 조절자인 NFAT5/TonEBP 사이의 상호작용을 조사하였다. 공동 -면역침강한 후에 면역블랏 분석한 결과， TAZ 및 NFAT5/TonEBP 사이의 물리적 상호작용을 증명하였다 (도 4A 참조). mIMCD-3 세포의 핵에서 각각의 TAZ- NFAT5/TonEBP 상호작용을 가시화하기 위하여， 원 위치 (/ situ) proximity ligation assay(PLA) system를 실시하였다. 그 결과, 등장성 또는 고장성 배지에 서 배양된 mIMCD-3 세포의 핵에서 각각의 TAZ-NFAT5/TonEBP 상호작용을 가시화하였 지만, 저장성 배지에서는 가시화하지 못하였다 (도 4E 참조).
<107>
<108> NFAT5/TonEBP활성에 대한 TAZ-NFAT5/TonEBP상호작용의 효과를 확인하였다.
NFAT5/TonEBP의 전사적 활성을 TAZ가 없는 조건에서, FAT5/TonEBP에 반웅하는 루 시퍼라제 리포터 유전자 (luciferase reporter gene, pTonE-luc)로 측정하였다. NFAT5/TonEBP의 이소성 (Ectopic) 발현은 pTonE-luc의 루시퍼라제 활성을 증가시켰 으나, TAZ의 공동발현은 현저히 용량 의존적으로 이러한 활성을 현저히 억제하였다 (도 5 참조). 이러한 결과는 TAZ— NFAT5/TonEBP 상호작용이 NFAT5/TonEBP의 醒 결 합활성을 저해함으로써 NFAT5/TonEBP의 전사적 활성을 억제하는 것을 나타낸다.
<109> ᅳ
<ιιο> TAZ가 NFAT5/TonEBP 활성을 억제하기 때문에, TAZ 과발현 또는 결핍이 내생 적 NFAT5/TonEBP표적 유전자인 BGT1 및 SMIT의 발현에 영향올 주는지 조사하였다. BGT1 및 SMIT의 상대적인 발현은 대조군 세포에서 고장성에 의해 증가하였으나， 고 장성으로 자극된 TAZ 안정화 세포에서 현저히 약화되었다 (도 6B 참조). 역으로， BGT1 및 SMIT의 발현은 등장성 및 고장성 조건에서 TAZ 발현의 감소에 의해 점차적 으로 증가하였다 (도 6C 및 6D 참조).
<111>
<Π2> TAZ의 부족에 의한 NFAT5/TonEBP 활성의 증가가 TAZ 회복에 의해 직접적으로 역전될 수 있는 것을 확인하였다. 그 결과， 상기 증가된 TAZ K0 세포에서 pTonE- luc 활성은 WT TAZ의 회복에서 기본적 수준으로 되돌아갔다. 하지만， Y316F TAZ의 도입은 리포터 활성 저해에 다소 효과적이지 않았다 (도 7C 참조). 시험관 내에서 TAZ가 신장 세포에서 삼투조절물질 유전자의 발현을 억제하기 때문에 , TAZ K0신장 에서 삼투조절물질 유전자의 생체 내 발현 수준을 측정하였다. ¥ΐ 및 TAZ Κ0마이 스의 신장 수질에서 SMIT 및 BGT1의 상대적인 발현 수준을 분석하였고， 그 결과, TAZ Κ0 마이스의 신장에서 심각한 형태학적 결핍에도 불구하고， SMIT 및 BGT1의 발 현은 WT 신장에 비해 TAZ K0 신장에서 현저히 증가한 것을 확인하였다 (도 7D 참조 ).
<113>
<ιΐ4> 그러므로, 본 발명의 TAZ 티로신 인산화 억제제는 감소된 TAZ의 발현이 고장 성 자극의 영향을 완화시키기 위한 표적 유전자의 발현과 NFAT5/TonEBP의 활성을 최적화할 수 있으므로 신질환, 신기능장애 또는 신부전의 예방 및 치료를 위한 조 성물의 유효성분으로 유용하게 사용될 수 있음을 알 수 있다.
<115>
<Π6> 본 발명에 따른 조성물은 TAZ 단백질의 티로신 인산화 억제제에 추가로 동일 또는유사한 기능을 나타내는 유효성분을 1종 이상을 함유할 수 있다.
<117> 상기 조성물은 임상 투여 시에 경구 또는 비경구로 투여가 가능하며 비경구 투여시 복강내주사， 직장내주사， 피하주사， 정맥주사， 근육내주사, 자궁내 경막주 사, 뇌혈관내 주사 또는 흉부내 주사에 의해 투여될 수 있고, 일반적인 의약품 제 제의 형태로사용될 수 있다.
<118> 상기 조성물은 단독으로, 또는 수술， 방사선 치료, 호르몬 치료， 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
<ιΐ9> 상기 조성물의 일일 투여량은 약 0.0001 내지 100 rag/kg이고, 바람직하게는
0.001 내지 10 rag/kg이며, 하루 1회 내지 수회 나누어 투여하는 것이 바람직하나 환자의 체중, 연령, 성별, 건강상태， 식이， 투여시간， 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가다양하다.
<120> 상기 조성물은 실제 임상 투여 시에 비경구의 여러 가지 제형으로 투여될 수 있는데， 제제화할 경우에는 보통 사용하는 층진제, 증량제， 결합제， 습윤제, 붕해 '제， 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 비경구 투여를 위 한 제제에는 멸균된 수용액, 비수성용제， 현탁제, 유제， 동결건조제제， 좌제가 포 함된다. 비수성용제， 현탁용제로는 프로필렌글리콜 (Propylene glycol), 폴리에틸 렌 글리콜, 을리브 오일과 같은 식물성 기름， 에틸을레이트와 같은 주사 가능한 에 스테르 등이 사용될 수 있다. 좌제의 기제로는 위템솔 (witepsol), 마크로골, 트원 (tween) 61， 카카오지, 라우린지， 글리세로제라틴 등이 사용될 수 있다.
<121>
<122> 또한 , 본 발명은 약학적으로 유효한 양의 TAZ 티로신 인산화 억제제를 함유 하는 조성물을 개체에 투여하는 단계를 포함하는 삼투압 농도에 의한 스트레스
(osmolarity stress) 조절 이상으로 기인한 질환을 예방 또는 치료하는 방법을 제 공한다.
<123> 상기 질환이란 신질환， 신기능장애 및 신부전으로 구성된 군으로부터 선택 되는 것일 수 있으나， 이에 한정되지 않는다.
<124> 상기 TAZ 티로신 인산화 억제제는 NFAT5/TonEBP의 활성을 증가시키는 것일 수 있으나, 이에 한정되지 않는다.
<125> 상기 약학적으로 유효한 양이란 0.0001 내지 100 mg/kg이고, 바람직하게는
0.001 내지 10 mg/kg이며, 이에 한정되는 것은 아니다. 투여량은 특정 환자의 체 증， 연령， 성별， 건강상태, 식이， 투여기간, 투여방법, 제거율， 질환의 증증도 등 에 따라 변화될 수 있다.
<126> 상기 투여는 임상투여 시에 경구 또는 비경구로 투여가 가능하며 비경구 투 여시 복강내주사， 직장내주사， 피하주사, 정맥주사， 근육내주사， 자궁내 경막주사， 뇌혈관내 주사 또는 흉부내 주사에 의해 투여될 수 있고， 일반적인 의약품 제제의 형태로사용돨수 있다.
<127> 상기 개체는 인간을 포함한 척추동물이고 바람직하게는 포유동물이며， 그보 다 바람직하게는 쥐， 토끼, 기니아피그, 햄스터， 개， 고양이와 같은 실험동물이고， 가장 바람직하게는 침팬지, 고릴라와 같은 유인원류 동물이다.
<128> 본 발명의 TAZ 티로신 인산화 억제제는 감소된 TAZ의 발현이 고장성 자극의 영향을 완화시키기 위한 표적 유전자 발현 및 NFAT5/TonEBP의 활성을 극대화할 수 있으므로， 신장 조직 내 삼투압 농도에 의한 스트레스의 억제를 위하여 유용하게 사용될 수 있다.
<\29>
<130> 또한， 본 발명은 TAZ 티로신 인산화를 이용하여 삼투압 농도에 의한 스트레 스 (osmolarity stress) 조절 이상으로 기인한 질환의 예방 또는 치료제 후보물질을 스크리닝하는 방법을 제공한다.
<131> 구체적으로 , 본 발명은
<132> 1) TAZ 발현 세포주에 피검물질을 처리하는 단계 ;
<133> 2) 상기 세포주에서 TAZ 단백질의 티로신 인산화 수준을 측정하는 단계; 및 <i34> 3) 상기 TAZ 단백질의 티로신 인산화 수준이 피검물질을 처리하지 않은 대조 군에 비해 감소된 피검물질을 선별하는 단계를 포함하는， 삼투 스트레스로 유발된 신장 장애의 예방 및 치료제 후보물질의 스크리닝 방법을 제공한다.
<135> 상기 방법에 있어서， 단계 1)의 TAZ는 서열번호 1로 기재되는 아미노산서열 을 갖는 것일 수 있으나, 이에 한정하지 않는다.
<136> 상기 방법에 있어서， 단계 2)의 단백질의 티로신 인산화 수준은 면역형광법, 효소면역분석법 (ELISA), 웨스턴 블릇 (western blot) 및 RT— PCR로 구성된 군으로부 터 선택된 어느 하나로 측정하는 것일 수 있으나， 이에 한정되지 않는다. <137> 아을러 , 본 발명은
<138> 1) TAZ 및 TonEBP발현 세포주에 피검물질을 처리하는 단계;
<139> 2) 단계 1)의 세포주에서 TAZ 및 TonEBP의 결합 활성을측정하는 단계; 및
<140> 3) 단계 2)의 TAZ 및 TonEBP 결합활성 수준이 피검물질을 처리하지 않은 대 조군에 비해 감소된 피검물질을 선별하는 단계를 포함하는, 삼투 스트레스 유발 신 장애의 예방 및 치료제 후보물질의 스크리닝 방법올 제공한다.
<i4i> 상기 단계 2)의 결합 활성은 웨스턴 블릇 (Western Blot), 면역침강법, SDS-
PAGE 및 효소면역분석 (ELISA)으로 구성된 군으로부터 선택된 어느 하나인 것일 수 있으나， 이에 한정하지 않는다.
<142> 본 발명의 NFAT5/TonEBP와 상호작용하는 TAZ 티로신 인산화가 NFAT5/TonEBP 의 활성을 저해하고， c-AM 활성이 TAZ 및 NFAT5/TonEBP의 상호작용에 필요하며, 인산화된 TAZ가 NFAT5/TonEBP의 결합활성을 저해한다는 것과 생체 내 (in vivo)에서 탈수로 유래된 고장성 조건에서 TAZ의 억제가 고장성 자극의 영향을 완화시키기 위 한 표적 유전자 발현 및 NFAT5/TonEBP의 활성을 극대화할 수 있는 것을 확인하였으 므로， TAZ 티로신 인산화 수준의 변화 또는 TAZ 및 TonEBP 결합 활성 수준을 신질 환， 신기능장애 및 신부전으로 구성된 군으로부터 선택된 질환의 예방 또는 치료제 후보물질의 스크리닝에 유용하게 사용될 수 있다.
<143>
<144> 또한， 본 발명은 상기 TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 삼투스트레스로 유발된 신장 장애의 예방 방법을 제공한다.
<145> 또한， 본 발명은 상기 TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 삼투 스트레스로 유발된 신장 장애의 치료 방법을 제공한다.
<146> 아울러, 본 발명은 삼투 스트레스로 유발된 신장 장애의 예방 및 치료용 약 학적 조성물에 사용하기 위한상기 TAZ 티로신 인산화 억제제를 제공한다. <147> 본 발명에서는 TAZ가 TonEBP와 결합하고, 상호작용하며， TAZ의 티로신 인산 화가 TonEBP의 활성을 저해하고， c-AM 활성이 TAZ 및 TonEBP의 상호작용에 필요하 몌 생체 내 (/ wVo)에서 탈수로 유래된 고장성 조건에서 TAZ의 억제가 고장성 자 극의 영향을 완화시키기 위한 표적 유전자 발현 및 TonEBP의 활성을 극대화할 수 있는 것을 확인하였으므로, TAZ 티로신 인산화 억제제를 삼투 스트레스로 유발된 신장 장애의 예방 방법 또는 치료 방법에 유용하게 사용할 수 있다. 아울러， 상기 TAZ 티로신 인산화 억제제를 삼투 스트레스로 유발된 신장 장애의 예방 및 치료용 약학적 조성물에 사용할수 있다.
<148>
【발명의 '실시를 위한 형태】
<149> 이하， 본 발명을 실시예 및 제조예에 의하여 상세히 설명한다.
<150> 단， 하기 실시예 및 제조예는 본 발명을 구체적으로 예시하는 것이며, 본 발 명의 내용이 실시예 및 제조예에 의해 한정되는 것은 아니다.
<151>
<152> <실시예 1> 고장성 자극에 의한 TAZ의 핵 위치 확인
<153> <1-1>세포 배양
- <i54>- Cos7(Afr ican Green Monkey SV40一 transf 'd kidney fibroblast cell line) 및
HEK293K Human Embryonic Kidney 293 eel Is) 세포를 American Type Culture CollectionCATCC, Manassas, VA)로부터 얻었고， Dulbecco's modified Eagle mediumCDMEM, Invitrogen, Carlsbad, CA)에서 배양하였다. 세포를 인산 칼슘 (calcium phosphate) 방법으로 일시적으로 형질전환하였다. 주변 장력이 TAZ 발현 에 영향을 미치는지 확인하기 위해， GFP로 표지된 (GFP-tagged) TAZ를 Cos7 세포에 서 발현시켰고, 다른 장력 조건으로 자극하였다.
<155> mIMCD-3(Toni city-responsive immortalized mouse inner medullary collecting duct-3 eel IsKATCC)를 10% 열 불활성화시킨 FBS(HyClone, Logan, UT) 를 보층한 DMEM에서 유지하였다. mIMCD-3 세포를 NaCl과 함께 2-4 시간 동안 저장 성 등장성 또는 고장성 배지 (150， 300, 또는 400 m0sm/Kg ¾0 최종 삼투압농도)에 노출하였다. 등장성 또는 고장성 자극을 위해 세포를 2 시간 동안 저장성 조건에 노출한 뒤 등장성 또는 고장성 배지에서 4시간 동안 처리하였다.
<156>
<157> <1-2> 면역염색 (immunofluorescence staining)을 통한 고장성 자극에 의한
TAZ의 핵 위치 확인 Cos7 세포를 녹색 형광 단백질 (green fluorescence protein, GFP)을 붙인 TAZ 또는 Myc을 붙인 NFAT5/TonEBP 발현 백터로 형질전환시킨 후 150， 300, 또는 400 mOsmo/kg 장력에서 4 시간 동안 처리하였다. 세포를 4% 파라포름알데히드 (4% paraformaldehyde)로 고정하였고， 항 Myc 항체， 4'，6'-다이아미딘 -2'-페닐 인돌 (4' ,6'-diamidine-2'-phenyl indole, DAPI ) , 또는 형광성의 팔로이딘 (fluorescent phalloidinKred)으로 염색하였다. 형광을 공초점 현미경하에 조사하였다 (LSM510 META, Carl Zeiss Inc. , Germany) .
그 결과, 등장성 조건 (300 m0sm/kg)에서 TAZ 발현은 핵 및 세포질에서 관찰 되었고， 저장성 조건 (150 m0sm/kg) 에서 주로 세포질에서 관찰되었다 (도 1A) . 하 지만, 고장성 (400 m0sm/kg) 자극은 점차적으로 TAZ의 핵 위치를 증가시켰다 (도 1A 및 B).
또한, 쥐 신장수질 세포인 mIMCD-3에서 고장성 자극에 대하여 내생적 TAZ의 위치를 확인하였다. 신장 수질 mIMCD3 세포를 NaCl 150, 300, 또는 400 mOsm/Kg를 포함하는 배지에 2시간 동안 처리하였다. 그 후에， 상기 신장 수질 mIMCD3 세포를 상기 실시예 <1-2>의 면역염색을 이용하고, 항체는 항 TAZ 항체 (Abeam)를 이용하여 면역 색하였고, 공초점 현미경하에 형광을 조사하였다 (LSM510 META, Carl Zeiss Inc. , Germany) .
그 결과， 외인성의 TAZ분포와 일관되게， 항 TAZ 항체를 이용한면역염색은 내인성 TAZ가 등장성， 저장성 및 고장성 조건에서 각각 전체세포 (pancellular), 세포질 및 핵에 분포하는 것을 보였다 (도 1C).
<1-3>면역블랏 (i隨 unoblot)을 통한고장성 자극에 의한 TAZ의 핵 위치 확인 상기 실시예 <1-1>에 기재된 바와 같이 배양된 mIMCD-3 세포를 차가운 용해 완충용액 (10% glycerol, 50 mM HEPES, 0.1% Triton X-100, 150 mM NaCl , 50 mM 베 타 -글리셀로인산칼슘 (beta— glycerophosphate), 25 mM NaF, 20 mM EGTA, 15 mM MgCl2> 1 mM DTT, 1 mM PMSF, 1 yg/ml 프로테아제 억제제 (protege inhibitor), 1 mM Na3V04)으로 30분 동안 용해하였고， 상청액으로서 용해물올 모으기 위해 원심분 리 (4°C, 12000 rpm, 20 분)하였다. 단백질 농도는 Bradford 분석에 의해 측정하였 고, 단백질의 동등한 양은 도데실 황산 나트륨 (sodium dodecyl sulfate, SDS)-폴리 아크릴아미드 겔 전기영동 (polyacrylamide gel electrophoresis, PAGE)에 의해 전 기이동적인 방법으로 해결하였고, I隱 obilon-P 막 (Millipore, Invitrogen)에 전기 이동시켰다. 막을 TAZ(Abcam) , OCTCTissue— tek) , 베타—액틴 ( β— act inKSanta cruz) 에 대한 1차 항체와 함께 반웅시킨 다음， 적절한 2차 항체는 HR Zymed Laboratories, Inc, South San Francisco, CA USA)를 결합하였고, 제조사의 지침서 에 따라 ECL(Amersham Biosciences Inc, Piscataway, NJ USA) 검출 시스템으로 시 각화하였다.
<166> 그 결과， 핵 및 세포질 세포 분획의 TAZ를 면역블랏하여 확인하였을 때， 상 기 내생의 TAZ의 핵 위치는 고장성 조건의 신장세포에서 향상되었다 (도 1D).
<167>
<168> <실시예 2>고장성으로 유도된 c—Abl 활성화로 인한 TAZ의 티로신 인산화 확 인
<169> 고장성으로 유도된 c-Abl 활성화로 인한 TAZ의 티로산 인산화를 확인하고자 표지된 단백질에 대하여 면역침강한 후에'， 특이적 항체를 이용한 면역블랏하였다. 구체적으로， mIMCD-3 세포를 Flag표지된 .TAZ 및 /또는 Myc 표지된 NFAT5/TonEBP 발 현 백터 (vector)로 형질도입하였다. 48사간 후, 총 세포 추출물을 수득하였고 Flag-M2 아가로즈 비드 (agarose beadsKSigma-Aldrich)와 같이 반응시켰고， 상기 비드는 그런 다음 용해 완층용액 (lysis buffer)으로 세척하였다. mIMCD-3 세포 추 출물을 단백질 A/G 아가로즈 비드 (protein A/G agarose beads)와 함께 4°C에서 1 시간 동안 프리클리어 (preclear)하였고, 그 다음 항 -TAZ 항체 및 단백질 A/G 아가 로즈 (protein A/G agarose)와 함께 4°C에서 밤새 반응시켰다. 상기 아가로즈 비드 를 용해 완층용액으로 세척하였다. 면역 복합체 또는 총 세포 추출물을 SDS-PAGE 으로 분석하였고, I隱 obilon-P 막 (Millipore, Invitrogen)으로 이동시켰다. 블롯 (blot)은 myc (Santa Cruz Biotechnology) , f lag(Sigma-Aldr ich) , NFAT5/TonEBP(Abcam) , pY316(Abf ront ier) , 4G10(Upstate) , 인산화된 Abl (phospho- Abl, pAbl)(Cell Signaling), c-Abl (Abeam) 및 TAZ(Abcam)에 대한 항체 증 myc 및 flag에 대한항체와 반응시켰다.
<170> 세린 (serine) 89의 인산화는 14-3-3 결합을 통한 TAZ의 세포질 유지를 요구 하기 때문에 [Kanai F et al.,(2000), EMBO J 19(24) :6778—6791]， TAZ 인산화에서 고장성의 효과를 확인하였다. 실시예 <1-3>에 기재된 바와 같이， 4G10(Upstate) 및 TAZ의 인산화된 세린 (serine)(pS89)에 대한 항체 (Santa Cruz Biotechnology Inc.)를 이용하여 면역블랏올 실시하였다.
<i7i> 그 결과， mIMCD-3 세포의 고장성 자극은 등장성 조건과 비교하였을 때 TAZ
' 의 세린 89의 인산화에 영향을 주지 않은 것을 확인하였다 (도 2A). 그러나, TAZ의 티로신 잔기에서 인산화는 고장성 조건에서 두드러지게 증가하였다 (4G10) (도 2A). 이러한 관찰은 이소성으로 발현된 TAZ 단백질의 티로신 인산화가 저장성이 아닌 고 장성에 의해 증가하는 것에 대한 결과로 확인하였다 (도 2B). 고장성에 반웅하여， 전체 c-Abl가 아닌 인산화된 c-Abl의 증가된 탐지에 의해 증명되는 바와 같이 (도 2C), 내생적 c— Abl 티로신 키나아제 (tyrosine kinase)는 고장성 자극에 의해 활성 화된다.
<i72> c-Abl이 TAZ에 대한 상류의 티로신 키나아제인지 확인하기 위해, 재조합 c-
Abl 키나아제를 이용한 시험관 내 키나아제 분석을 확인하였다. 면역침강된 TAZ 단백질은 무세포 시스템에서 c-Abl에 의해 직접적으로 인산화된다 (도 2D). 따라 서， 293T 세포안에서 c-Abl와 TAZ의 공동 발현은 TAZ의 티로신 인산화를 증가시켰 다 (도 2E).
<173> 이러한 c-Abl로 유도된 티로신 인산화는 비선택성 티로신 키나제 저해제인 제니스테인 (genisteinKSignma-Aldricli) 및 c-Abl 키나제 특이적 저해제인 STI- 571(Novartis Pharmaceut icals) (Basel , Switzerland)에 의해 저해되었다 (도 2F). 또한， 고장성은 c-Abl 활성화와 함께 내생의 TAZ 단백질의 티로신 인산화를 촉진하 였지만， STI-5기가 있을 때에는 TAZ의 티로신 인산화를 유도하는 것은 실패하였다 ( 도 2G).
<174>
<175> <실시예 3> c-Abl 인산화부위는 티로신 316인 것을 확인
<i76> TAZ 안에서 c-Abl 인산화 부위 확인올 시도하였다. TAZ는 4개의 티로신 잔 기를 포함하기 때문에 (Y118, Y141, Y300, 및 Y316), 적절한 포스포티로신 (phosphotyrosine)을 포함하는 합성의 TAZ 펩티드를 이용하여 TAZ 특이적 포스포티 로신 항체 (ρΥ118, ρΥ141, ρΥ300, 및 PY316)(AbFrontier Inc.) (Seoul, Republic of Korea)를 만들었다. '
<i77> 그 결과， 상기 TAZ의 c-Abl로 유도한 티로신 인산화는 상기 실시예 <1-3>의 방법 및 4G10 및 pY316 TAZ 항체를 이용하여 면역블랏하였을 때 , 현저하게 탐지되 었으나， 다른 항체로는 탐지되지 않았다 (도 3A). 또한， 고장성이 선택적으로 Y316 에서 내생적 TAZ의 티로신 인산화를 증가시키는 것을 확인하였다 (도 3B). TAZ 인 산화 및 활성에서 Y316의 중요성을 연구하고자， 티로신 316을 페닐알라닌 (phenylalanine)으로 교체함으로써 들연변이 TAZ(Y316F)를 구축하였다, c-Abl의 과발현은 야생형 (WT) TAZ의 인산화를 증가시켰으나, 4G10 및 pY316 TAZ 항체로 면 역블랏함으로씨 증명한 바와 같이, Y316F 돌연변이를 인산화하는 것은 실패하였다 ( 도 3C). <i78> 추가하여, Flag로 표지된 야생형 (WT) TAZ 및 이의 티로신 돌연변이 (Y118F,
Y141F, Y300F 및 Y316F)를 발현하는 안정한 mIMCD-3 세포를 수립하였고， 고장성 조 건에 노출하였다.
<179> 그 결과, 고장성 자극은 WT, Y118F, Y141F 및 Y300F TAZ 단백질을 유도하였 으나， 이러한 고장성으로 유도된 인산화는 Y316F 돌연변이에서 실패하였으며 (도 3D), 이는 TAZ의 티로신 316이 c-Abl 인산화부위인 것을 나타낸다.
<180>
<181> <실시예 4>고장성에 의해 유도된 인산화를통한 NFAT5/TonEBP와물리적으로 상호작용하는 TAZ 확인
<182> <4-1> 레트로바이러스 형질도입에 의한 안정한 세포주 수립 및 고장성에 의 해 유도된 인산화를 통합 NFAT5/TonEBP와물리적으로 상호작용하는 TAZ 확인
<183> 고장성이 매개하는 신호 경로에서 인산화된 TAZ의 기능을 확인하고자， TAZ와 고장성 신호 경로의 주요 조절자인 FAT5/TonEBP 사이의 상호작용을 조사하였다. TAZ 및 NFAT5/TonEBP 사이의 상호작용을 확인하기 위해, 293T 세포에서 c_Abl와 함 께 Flag-TAZ 및 NFAT5/TonEBP를 일시적으로 발현하였다. 구체적으로, 바이러스를 '만드는 불멸화 세포를 10% FBS로 보층한 DMEM에 배양하였고， 인산칼슘 형질전환 방 법을 이용하여 TAZ를 발현하는 레트로바이러스 백터를 형질전환하였다. 바이러스 상층액을 수득하였고， 수득한 바이러스 상층액을 폴리브렌 (polybrene)(4 mg/ml , Sigma-Aldrich)이 있을 때에 4 시간 동안 mIMCD-3 또는 MEF 세포에 첨가하였다. 안정한 세포를 퓨로 마이신 (puromydn)(Sigma-Aldrich) 저항성으로 수립하였다. 상기 수립된 세포를 공동-면역침강 및 면역블랏으로 분석하였다.
<184> 그 결과 공동—면역침강 및 면역블랏 분석은 TAZ 및 NFAT5/TonEBP사이의 물 리적 상호작용을 증명하였다 (도 4A). 하지만, Y316F 돌연변이 TAZ는 NFAT5/TonEBP 와 상호작용할 수 없었다 (도 4A). 게다가, STI-5기가 처리된 세포는 TAZ 및 NFAT5/TonEBP 사이의 물리적 상호작용이 감소하였고， TAZ의 티로신 인산화가 감소 하였으며 (도 4B), 이 결과는 TAZ 및 NFAT5/TonEBP 사이의 티로신 인산화가 독립적 인 상호작용인 것을 나타낸다.
<185> 또한, NFAT5/TonEBP는 c-Abl에 의해 티로신 143에서 인산화되기 때문에,
NFAT5/TonEBP의 티로신 인산화가 TAZ와의 상호작용에 필수적인지 시험하였다. TAZ 면역 복합체에서 야생형 (WT)과 돌연변이 NFAT5/TonEBP의 비슷한 존재에서 나타난 바와 같이 , NFAT5/TonEBP와 TAZ 사이의 상호작용은 Y143F 돌연변이에서 유지되었다 (도 4C). 가장 중요하게, 내생적 TAZ 면역 복합체의 분석은 등장성 조건하에서 NFAT5/TonEBP와 상호작용하는 TAZ 및 고장성 조건에서 더 강하게 티로신 인산화-의 존적인 방법에서 확인하였다 (도 4D). 이러한 내생적 TAZ 및 FAT5/TonEBP 사이의 물리적 상호작용은 저장성 조건에서 탐지되지 않았다 (도 4D).
<186>
<187> <4-2>원 위치 (//7 situ) proximity ligation assay(PLA) systems을 통한 고 장성에 의해 유도된 인산화를 통한 NFAT5/TonEBP와 물리적으로 상호작용하는 TAZ 확인
<i88> mIMCD-3 세포의 핵에서 각각의 TAZ_NFAT5/TonEBP 상호작용을 가시화하기 위 하여, 원 위치 (/ situ) proximity ligation assay(PLA) system를 실시하였다. 구 체적으로， 신장 수질 mIMCD-3 세포를 슬라이드 글라스에 놓고, 등장성 및 고장성 배지에서 4 시간 동안 배양하였다. 세포를 고정하였고， 마우스 항 TAZ 항체 (1:100， Abeam) 및 토끼 항 NFAT5/TonEBP 항체로 배양하였다 (Miyakawa H, et al,(1999), Proc Natl Acad Sci U S A 96(5) :2538-2542. ) . In situ PLA를 제조업자의 지시에 따라수행하였다 (DUO-link, 01 ink Bioscience, Uppsala, Sweden) .
<i89> 더욱이， 상기 원 위치 (/ situ) proximity ligation assay(PLA) system은 등 장성 또는 고장성 배지에서 배양된 mIMCD-3 세포의 핵에서 각각의 TAZ- FAT5/TonEBP 상호작용을 가시화하였지만， 저장성 배지에서는 가시화하지 못하였다 (도 4E).
<190>
<i9i> <실시예 5> TAZ에 의한 NFAT5/TonEBP의 DNA-결합 및 전사적 활성 억제 확인
<192> <5-1> 리포터 유전자 분석 (Importer gene assays)을 통한 TAZ에 의한
NFAT5/TonEBP의 전사적 활성 억제 확인
<193> NFAT5/TonEBP 활성에 TAZ-NFAT5/TonEBP 상호작용의 효과를 확인하였다.
NFAT5/TonEBP의 전사적 활성을 TAZ가 없는 조건에서, NFAT5/TonEBP에 반응하는 루 시퍼라제 리포터 유전자 (luciferase reporter gene, pTonE-luc)로 측정하였다. 구 체적으로， 293T 세포를 6-웰 플레이트에 5X105 세포 /웰의 수로 두었고，
NFAT5/TonEBP 및 TAZ 발현백터를 일시적으로 형질전환시켰고, NFAT5/TonEBP에 반웅 하는 요소가 연결된 루시퍼라제 (NFAT5/TonEBP-responsive element-1 inked luciferase, pTonE-luc) 및 pCMVP를 형질전환 대조군으로 형질전환시켰다. 루시 퍼라제 활성은 Bright-Glo luciferase assay kit(Promega, Madison, WI)를 이용하 여 분석하였다. 상대적인 루시퍼라제 단위를 β—갈락토시다제 활성 (β- galactosidase activity)(TR0PIX, Bedford, MA)으로 표준화한후에 계산하였다. <i94> NFAT5/TonEBP의 이소성 (Ectopic) 발현은 pTonE— hie의 루시퍼라제 활성을 증 가시켰으나， TAZ의 공동발현은 현저히 용량 의존적으로 이러한 활성을 현저히 억제 하였다 (도 5A). 더욱이， 상기 NFAT5/TonEBP를 유도하는 리포터 활성은 WT 또는 Y118F TAZ에 의해 저해되는 반면, FAT5/TonEBP와 상호작용하는 Y316F의 블능과 일 치하여 Y316F TAZ는 NFAT5/TonEBP활성을 억제하지 못하였다 (도 5B) .
<195>
<i96> <5-2> DNA 풀 -다운 분석 (DNA-pull-down assay)을 통한 TAZ에 의한
NFAT5/TonEBP의 DNA-결합 활성 억제 확인
<197> 상기 TAZ가 매개하는 NFAT5/TonEBP 전사적 활성의 저해는 TAZ가 있을 때
NFAT5/TonEBP의 DNA-결합 활성을 시험함으로써 확인하였다. DNA-pull-down assay 를 통해 NFAT5/TonEBP의 DNA-결합 활성을 측정하였으며 , 구체적인 방법은 하기와 같다. . Myc으로 표지된 NFAT5/TonEBP 및 Flag로 표지된 TAZ 및 Y316F를 형질전환 시킨 세포를 HKMG buffer(10 mM Hepes, H 7.9, 100 mM KC1, 5 mM MgCl2, 10% glycerol, 0.1% NP-40, and 1 mM DTT)에 용해한 후 비오틴을 붙인 이중 가닥 DNA와 함께 배양하였고, 그 후에 스트렙타아비딘 아가로즈 비즈와 함께 배양하였다. 참 전물을 H腿 G buffer로 3회 세척하였고, 면역블랏 분석을 위해 SDS-PAGE로 적용하였 다. NFAT5/TonEBP에 결합하는 요소를 포함하는 DNA 서열은 하기와 같다: 5'- ct t ggtggaaaat t accgctggt-3 ' (서열번호 2) 및 5' _aaccagcggtccttttccaccaa_3' (서열 번호 3).
<198> 그 결과， DNA-pull-down assay는 NFAT5/TonEBP가 직접적으로
NFAT5/TonEBP-결합 요소를 포함하는 DNA 서열에 직접적으로 결합하는 것을 나타내 었고， 이러한 DNA- NFAT5/TonEBP 연관성은 현저히 TAZ의 과발현에 의해 저해되었지 만， Y316F돌연변이는 DNA- NFAT5/TonEBP 연관성을 저해하지 못하였다 (도 5C ) . 이 러한 결과는 TAZ- NFAT5/TonEBP 상호작용이 NFAT5/TonEBP의 DNA 결합 활성을 저해 함으로써 NFAT5/TonEBP의 전사적 활성을 억제하는 것을 나타낸다.
<199>
<200> <실시예 6> TAZ에 의한 고장성조건에서 삼투조절물질의 축적 유전자의 발현 및 세포 지수의 조절 확인
<20i> TAZ가 NFAT5/TonEBP활성올 억제하기 때문에 , TAZ 과발현 또는 결핍이 내생 적 NFAT5/TonEBP표적 유전자인 BGT1 및 SMIT의 발현에 영향을주는지 조사하였다. 먼저, TAZ를 과발현하는 mIMCD-3 세포를 수립하였다. 구체적으로， mIMCD-3 세포를 바이러스 발현 flag-TAZ 또는 작은 헤어핀 (small hairpin) TAZ RNA를 이용하여 실 시예 <4-1>과 동일한 방법으로 실시하여 형질전환된 세포주를 수립하였다. 다음 으로， 실시예 <1-3>에 기재된 바와 같이 면역블랏하였다.
<202> 그 결과, TAZ를 형질전환하여 수립한 TAZ 과발현 안정화 세포에서 TAZ는 대 조군인 mIMCD-3 세포에 비해 과발현하는 반면, NFAT5/TonEBP 발현은 두 개 세포 클론에서 유사하였고， 장력 자극 (challenges )에 의해 바뀌지 않는 것을 확인하였다 (도 6Α)·
<203>
<204> <6-1>실시간 PCR분석 (Rea卜 time PCR analysis)을 통한 TAZ에 의한 고장성 조건에서 삼투조절물질의 축적 유전자의 발현 확인
<205> TAZ 과발현 안정화세포 및 대조군 mIMCD-3 세포로부터 TRIzol (Gibco-BRL,
Invitrogen)를 이용하여 전체 RNA를 분리하였으며, cDNA 합성을 위해 역전사에 이 용하였다. 실시간 PCR 반응을 SYBR Green pre—mix buffer 및 ABI-Prism 7300 sequence detect or (Perkin-Elmer Applied Biosystems , Foster City, CA) 함께 수행 하였다. 상대적인 발현 수준을 β-액틴 (β-actin)에 대한 Ct 값에 대해 평준화한 후 확인하였다. 유전자 특이적 프라이머는 하기와 같다: BGT1, 5'- c t gggagagacgggt 111 gggt at t acat c-3 ' (서열번호 4) , 5'—ggaccccaggtcgtggat_3' (서열 번호 5); SMIT, 5'-ccgggcgctctatgacctggg-3' (서열번호 6)， 5'- caaacagagaggcaccaatcg_3' (서열번호 7)； 및 β -act in, 5 ' -agagggaaatcgtgcgtgac- 3' (서열번호 8)， 5'-caatagtgatgacctggccgt-3' (서열번호 9).
<206> 그 결과, 상기 BGT1 및 SMIT의 상대적인 발현은 대조군 세포에서 고장성에 의해 증가하였으나, 고장성으로 자극된 TAZ 안정화 세포에서 현저히 약화된 것을 확인하였다 (도 6B).
<207>
<208> 또한， 수립된 TAZ 넉다운 (knockdown) (shTAZ) 및 대조군 (shcon)세포를 등장성 및 고장성 조건에서 4 시간 동안 자극한 후에, TAZ, NFAT5/TonEBP 및 액틴의 단백 질 수준을 실시예 <1_3>의 면역블랏으로 확인하였다.
<209> 그 결과, TAZ 넉다운 (knockdown) 세포에서 TAZ의 발현이 감소된 것을 확인하 였다 (도 6C). ―
<2\0>
<2ΐι> 또한， TAZ 넉다운 (knockdown) (shTAZ) 및 대조군 (shcon)세포를 수립하고, 장성 및 고장성 조건에서 4 시간 동안 자극한 후에， BGT1 및 SMIT의 발현 수준을 실시예 <6-1>의 실시간 PCR분석으로 확인하였다. <2i2> 그 결과, BGT1 및 SMIT의 발현은 등장성 및 고장성 조건에서 TAZ 발현의 감 소에 의해 점차적으로 증가하였다 (도 6D).
<213>
<214> <6-2>실시간 세포 관측 (Real-time cell monitor ing)을 통한 TAZ에 의한 고 장성조건에서 세포 지수의 조절 확인
<2i5> TAZ의 존재 여부에 따른 세포 지수를 확인하고자, TAZ 넉다운
(knockdown) (shTAZ) 및 대조군 (shcon)세포를 수립하고, 24시간 동안 실시간으로 세 포를 관측하였다. 구체적으로， 안정한 mIMCD— 3 세포 (shcon 및 shTAZ)를 E— Plate 96에 두었고， xCELLigence system(Real-Time Cell Analyzer, Roche , Germany)에서 관측하였다. 하룻밤 동안 생장시킨 후에， 세포를 등장성 또는 고장성 배지에서 배 양하였다. 세포 지수 값 (CI)를 지속적으로 24시간 동안 매 15분 동안관측하였다. 2 회의 세 개의 독립적인 실험을 수행하였으며， 2 회의 평균을 제조업자의 지시에 따라 계산하였다 (xCELLigence, Roche, Germany) .
<216> 그 결과， 24시간 동안 실시간 세포 관측은 세포 지수가 대조군 세포 (shcon) 보다 TAZ 넉다운 (knockdown) (shTAZ) 세포에서 대체로 더 높았고， 고장성으로 자극 된 shTAZ 세포는 빠르게 증가하는 것을 나타내었다 (도 6E). 이러한 결과는 NFAT5/TonEBP의 활성화는 TAZ가 없을 때, 고장성 자극에 의해 촉진될 수 있는 것을 제시한다.
<217>
<218> 〈실시예 7> TAZ결핍 세포에서 TAZ의 회복은 중가된 NFAT5/TonEBP활성 억제 를유도하지만， Y316F는 FAT5/TonEBP활성 억제를 유도하지 않는 것을 확인
<2i9> TAZ의 부족에 의한 NFAT5/TonEBP 활성의 증가가 TAZ 회복에 의해 직접적으로 역전될 수 있는 것을 확인하였다. 먼저， WT 및 K0 마우스를 사육하였다. 구체적 인 동물 사육은 다음과 같다. 야생형 (Wild type, WT) C57BL/6 마우스를 Jackson Laboratories (Bar Harbor , MN)로부터 구입하였다. TAZ 넉아웃 (knockout , 0) 마우 스의 제작 방법은 하기와 같다. TAZ Εχοη 2를 제거하기 위하여 Εχοη 2를 제거하는 백터를 제작하였고， 제작된 백터를 배아줄기세포 (embryonic stem cell)에 주입하여 재조합 (recombination)된 세포주를 확립하였다. 확립된 세포주를 대리모에 심어 키메라 (chimera)를 획득하였다. WT 및 TAZ 넉아웃 (knockout， K0) 마우스를 병원 균이 없는 조건하에서 유지하였다. 모든 동물 실험은 IACUC 가이드라인에 따라 수 행하였으며， 이화여자대학교의 IACUC에 승인을 받았다 (ELAGC-09— 1017 및 IACUC 2010-13-3). 사육한 후에, TAZ 또는 Y316F 돌연변이의 재도입을 위하여 WT 및 TAZ K0 마우스로부터 MEF 세포를 분리하였다. MEF 세포를 10¾> 열 불활성화시 킨 FBSCHyClone , Logan, UT)를 보층한 DMEM에서 유지하였다.
<220> WT 및 TAZ K0 마이스 MEF 세포를 실시 예 <1_3>의 면역블랏으로 분석하였을 때， TAZ 발현 여부를 확인하였으며 , WT와 비교하였올 때 TAZ K0 마이스에서 TAZ의 발현이 적은 것을 확인하였다 (도 7A) .
<221>
<222> pTonE-luc 리포터 유전자로 MEF를 형질전환 한 후 다른 장력의 배지로 자극 하였다. 구체적으로 , pTonE-luc 리포터 유전자로 형 질전환된 MEF 세포를 NaCl과 함께 2-4 시간 동안 저장성 , 등장성 또는 고장성 배지 ( 150， 300 , 또는 400 m0sm/Kg H20 최종 삼투압농도)에 노출하였다 .
<223> 그 결과， 고장성 자극은 WT MEF 세포에서 리포터 활성을 증가시켰으나 , TAZ
K0세포에서 더 큰 영향을 미 쳤다 (도 7B) . 또한 , 상기 증가된 TAZ K0 세포에서 pTonE-luc 활성은 WT TAZ의 회복에서 기본적 수준으로 되돌아갔다. 하지만， Y316F TAZ의 도입은 리포터 활성 저해에 다소 효과적이지 않았다 (도 7C) .
<224> .
<225> 아을러 , 시험관 내에서 TAZ가 신장 세포에서 삼투조절물질 유전자의 발현을 억제하기 때문에， TAZ K0 신장에서 삼투조절물질 유전자의 생체 내 발현 수준을 측 정하였다 . WT 및 TAZ K0 마이스의 신장 수질에서 SMIT 및 BGT1의 상대적인 발현 수준을 실시 예 <6-1>의 방법으로 분석하였고 , 그 결과, TAZ K0 마이스의 신장에서 심각한 형 태학적 결핍에도 불구하고， SMIT 및 BGT1의 발현은 ¥ΐ 신장에 비해 ΤΑΖ Κ0 신장에서 현저히 증가하는 것을 확인하였다 (도 7D) .
<226>
<227> <제조예 1> 약학적 제제의 제조
<228> <1-1> 산제의 제조
<229> ΤΑΖ 티로신 인산화 억제제 2 g
<230> 유당 1 g
<231> 상기의 성분을 흔합하고 기밀포에 층진하여 산제를 제조하였다 .
<232>
<233> <1-2> 정제의 제조
<234> TAZ 티로신 인산화 억제제 100 mg
<235> 옥수수전분 100 rag
<236> -Π- ^ 100 mg <237> .스테아린산마그네슘 2 rag
<238> 상기의 성분을 흔합한 후， 통상의 정제의 제조방법에 따라서 타정하여 정제 제조하였다.
<239>
<240> <1-3>캡슐제의 제조
<241> TAZ티로신 인산화 억제제 100 mg
<242> 옥수수전분 100 mg
<243> 유 당 100 rag
<244> 스테아린산마그네슘 2 mg
<245> 상기의 성분을 흔합한 후， 통상의 캡슐제의 제조방법에 따라서 젤라틴
Figure imgf000028_0001
에 층전하여 캡슐제를 제조하였다.
<246>
<247> <1-4>환의 제조
<248> TAZ 티로신 인산화 억제제 1 g
<249> 유당 1.5 g
<250> 글리세린 1 g
<251> 자일리톨 0.5 g
<252> 상기의 성분을 흔합한 후， 통상과 동일한 방법에 따라 1환 당 4 g ' 되도록 제조하였다.
<253>
<254> <1-5>과립의 제조
<255> TAZ 티로신 인산화 억제제 150 rag
<256> 대두추출물 50 rag
<257> 포도당 200 mg
<258> 전분 600 rag
<259> 상기의 성분을 흔합한 후， 30 % 에탄올 100 mg을 첨가하여 섭씨 60 °C에서 건조하여 과립을 형성한후 포에 층진하였다.
<260>
【산업상 이용 가능성】
<261> 상기에서 보는 바와 같이 , 본 발명은 삼투 스트레스로 유발된 신장 장애 즉
, 신질환, 신기능장애 또는 신부전과 같은 질환의 예방 및 치료를 위한 약제의 개 발과 이를 이용한 예방 또는 치료 방법 개발， 즉 단백질 치료제， 발현 및 활성 조 절물질， 유전자 치료제 또는 세포 치료제 등에 유용하게 사용될 수 있다-

Claims

【청구의 범위】
【청구항 11
TAZ (Transcriptional Coact i vat or with PDZ一 binding motif) 티로신 인산화 억제제를 유효성분으로 함유하는 삼투 스트레스로 유발된 신장 장애의 예방 및 치 료용 약학적 조성물ᅳ
【청구항 2]
제 1항에 있어서， 상기 삼투 스트레스로 유발된 신장 장애는 신질환, 신기능 장애 및 신부전으로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 약 학적 조성물.
【청구항 3】
제 1항에 있어서, 상기 TAZ는 서열번호 1로 기재되는 아미노산 서열을 갖는 것을 특징으로 하는 약학적 조성물.
【청구항 4】
제 3항에 있어서， 상기 TAZ의 티로신 인산화 부위는 TAZ의 316 번째 티로신 인 것을특징으로 하는 약학적 조성물.
【청구항 5】 、
제 1항에 있어서， 상기 TAZ 티로신 인산화 억제제는 NFAT5/TonEBP의 활성을 증가시키는 것을 특징으로 하는 약학적 조성물.
【청구항 6]
제 1항에 있어서, TAZ 티로신 인산화 억제제는 TAZ 단백질에 상보적으로 결 합하는 화합물, 펩티드， 펩티드 미메틱스, 앱타머 및 항체로 구성된 군으로부터 선 택된 어느 하나인 것을 특징으로 하는 약학적 조성물.
【청구항 7】
TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 신장조직 내 삼투압농도에 의한스트레스 (osmolarity stress)의 억제 방법.
【청구항 8】
제 7항에 있어서 , TAZ 티로신 인산화 억제제는 NFAT5/TonEBP의 활성을 증가 시 키는 것을 특징으로 하는 방법 .
【청구항 9】
1) TAZ 발현 세포주에 피검물질을 처리하는 단계 ;
2) 단계 1)의 세포주에서 TAZ 단백질의 티로신 인산화 수준을 측정하는 단 계 ; 및
3) 단계 2)의 TAZ 단백질의 티로신 인산화 수준이 피검물질을 처 리하지 않은 대조군에 비해 감소된 피검'물질을 선별하는 단계를 포함하는， 삼투 스트레스로 유 발된 신장 장애의 예방 및 치료제 후보물질의 스크리닝 방법 ,
【청구항 10】
제 9항에 있어서， 단계 2)의 단백질의 티로신 인산화 수준은 면역 형광법， 효 소면역분석 법 (ELISA) , 웨스턴 블롯 (Western Blot ) 및 RT-PCR로 구성된 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 하는 스크리닝 방법 .
【청구항 11】
1) TAZ 및 TonEBP 발현 세포주에 피검물질을 처 리하는 단계 ;
2) 단계 1)의 세포주에서 TAZ 및 TonEBP의 결합 활성을 측정하는 단계 ; 및
3) 단계 2)의 TAZ 및 TonEBP 결합 활성 수준이 피 검물질을 처 리하지 않은 대 조군에 비해 감소된 피검물질을 선별하는 단계를 포함하는 , 삼투 스트레스 유발 신 장애의 예방 및 치료제 후보물질의 스크리닝 방법 .
【청구항 12】
제 11항에 있어서， 단계 2)의 결합 활성은 웨스턴 블롯 (Western Blot ) , 면역 침강법， SDS-PAGE 및 효소면역분석 (ELISA)으로 구성 된 군으로부터 선택된 어느 하 나로 측정하는 것을 특징으로 하는 스크리닝 방법 .
【청구항 13】
제 1항의 TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 삼 투스트레스로 유발된 신장 장애의 예방 방법 .
【청구항 14]
제 1항의 TAZ 티로신 인산화 억제제를 개체에 투여하는 단계를 포함하는 삼 투 스트레스로 유발된 신장 장애의 치료 방법 .
【청구항 15】
•삼투 스트레스로 유발된 신장 장애의 예방 및 치료용 약학적 조성물에 사용 하기 위한 제 1항의 TAZ티로신 인산화 억제제.
PCT/KR2012/003249 2011-06-30 2012-04-26 ＮＦＡＴ５／ＴｏｎＥＢＰ 활성화를 위하여 유효성분으로 ＴＡＺ 티로신 인산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물 WO2013002485A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20110064253 2011-06-30
KR10-2011-0064253 2011-06-30
KR1020120043834A KR101413590B1 (ko) 2011-06-30 2012-04-26 ＮＦＡＴ５／ＴｏｎＥＢＰ 활성화를 위하여 유효성분으로 ＴＡＺ 티로신 인산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물
KR10-2012-0043834 2012-04-26

Publications (2)

Publication Number Publication Date
WO2013002485A2 true WO2013002485A2 (ko) 2013-01-03
WO2013002485A3 WO2013002485A3 (ko) 2013-02-21

Family

ID=47424618

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/003249 WO2013002485A2 (ko) 2011-06-30 2012-04-26 ＮＦＡＴ５／ＴｏｎＥＢＰ 활성화를 위하여 유효성분으로 ＴＡＺ 티로신 인산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물

Country Status (1)

Country Link
WO (1) WO2013002485A2 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009045179A1 (en) * 2007-10-04 2009-04-09 Agency For Science, Technology And Research (A*Star) Taz/wwtr1 for diagnosis and treatment of cancer
US7700824B2 (en) * 2004-08-04 2010-04-20 Agency For Science, Technology And Research Methods
US20100305324A1 (en) * 2009-06-02 2010-12-02 Korea Research Institute Of Chemical Technology Pharmaceutical composition for preventing or treating osteoporosis or obesity comprising phenyltetrazole derivative

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7700824B2 (en) * 2004-08-04 2010-04-20 Agency For Science, Technology And Research Methods
WO2009045179A1 (en) * 2007-10-04 2009-04-09 Agency For Science, Technology And Research (A*Star) Taz/wwtr1 for diagnosis and treatment of cancer
US20100305324A1 (en) * 2009-06-02 2010-12-02 Korea Research Institute Of Chemical Technology Pharmaceutical composition for preventing or treating osteoporosis or obesity comprising phenyltetrazole derivative

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RYOSUKE MAKITA ET AL.: 'Multiple renal cysts, urinary concentration defects, and pulmonary emphysematous changes in mice lacking TAZ' AM J PHYSIOL RENAL PHYSIOL. vol. 294, 2008, pages F542 - F553 *

Also Published As

Publication number Publication date
WO2013002485A3 (ko) 2013-02-21

Similar Documents

Publication Publication Date Title
Dhekne et al. A pathway for Parkinson’s Disease LRRK2 kinase to block primary cilia and Sonic hedgehog signaling in the brain
Oishi et al. Krüppel-like transcription factor KLF5 is a key regulator of adipocyte differentiation
Yang et al. WNK kinases regulate thiazide-sensitive Na-Cl cotransport
Lu et al. Regulation of gene transcription by voltage-gated L-type calcium channel, Cav1. 3
Li et al. Daxx cooperates with the Axin/HIPK2/p53 complex to induce cell death
Gozdz et al. GSK3α and GSK3β phosphorylate arc and regulate its degradation
JP2016514681A (ja) 代謝と細胞生存を調節するミトコンドリア由来のペプチドｍｏｔｓ３
Li et al. GAS5 protects against osteoporosis by targeting UPF1/SMAD7 axis in osteoblast differentiation
Das et al. Transferrin receptor 1-mediated iron uptake regulates bone mass in mice via osteoclast mitochondria and cytoskeleton
WO2008097840A2 (en) Methods and compositions relating to the regulation of muc1 by hsf1 and stat3
Bae et al. Chaperone stress 70 protein (STCH) binds and regulates two acid/base transporters NBCe1-B and NHE1
Wang et al. LPA3-mediated lysophosphatidic acid signaling promotes postnatal heart regeneration in mice
Yang et al. Sequential changes of endoplasmic reticulum stress and apoptosis in myocardial fibrosis of diabetes mellitus-induced rats
Liu et al. „Cerebral dopamine neurotrophic factor “schützt H9c2-Kardiomyozyten vor Apoptose
Andrieu et al. The GTPase Gem and its partner Kif9 are required for chromosome alignment, spindle length control, and mitotic progression
Weiss et al. Copper-induced translocation of the Wilson disease protein ATP7B independent of Murr1/COMMD1 and Rab7
Chen et al. PID1 in adipocytes modulates whole-body glucose homeostasis
WO2019081730A1 (en) METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF TUBULIN-ASSOCIATED DISEASES CARBOXYPEPTIDASES
Xuan et al. Downregulation of Cypher induces apoptosis in cardiomyocytes via Akt/p38 MAPK signaling pathway
Ghosh et al. PI3P-dependent regulation of cell size and autophagy by phosphatidylinositol 5-phosphate 4-kinase
JP5814128B2 (ja) 肝疾患治療薬
Dai et al. A non-translational role of threonyl-tRNA synthetase in regulating JNK signaling during myogenic differentiation
ES2386916T3 (es) Métodos de diagnosticar osteoartritis
KR101413590B1 (ko) ＮＦＡＴ５／ＴｏｎＥＢＰ 활성화를 위하여 유효성분으로 ＴＡＺ 티로신 인산화의 억제제를 함유하는 신장 장애의 예방 및 치료용 약학적 조성물
US20220370463A1 (en) Stabilized c-fms intracellular fragments (ficd) promote osteoclast differentiation and arthritic bone erosion

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12805039

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12805039

Country of ref document: EP

Kind code of ref document: A2