WO2012154024A1

WO2012154024A1 - Cis-prenyl transferase from the plant hevea brasiliensis

Info

Publication number: WO2012154024A1
Application number: PCT/MY2012/000013
Authority: WO
Inventors: Alam MAQSUDUL; Nazalan Mohd Najimudin MOHD; Ann Saito JENNIFER; Paily Thottathil GINCY
Original assignee: Universiti Sains Malaysia
Priority date: 2011-05-12
Filing date: 2012-01-30
Publication date: 2012-11-15
Also published as: MY160195A

Abstract

An isolated polynucleotide comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 encoding cis-prenyl transferase of the plant Hevea brasiliensis.

Description

CIS-PRENYL TRANSFERASE FROM THE PLANT HEVEA BRASILIENSIS

FIELD OF INVENTION

The present invention relates to sequences of isolated polynucleotides encoding cis- prenyl transferase (CPT) from the plant Hevea brasiliensis and corresponding polypeptides derived thereof. Specifically, the disclosed polynucleotide sequences encode homologues of the mentioned enzymes, from a specific clone of Hevea brasiliensis, which possess preferred catalytic activities in enhancing rubber production especially upon transferring the polynucleotide sequence into a host cell.

BACKGROUND OF THE INVENTION

Polyisoprenoids are important building blocks in many plants for producing functional compounds and metabolites. It is a polymer made of isoprene units. The types of compounds derived thereof are largely determined by the length of the polymers and types of allylic terpenoid diphosphate units being ligated to form the polymers. Natural rubber is one form of polyisoprenoids and also a crucial raw material used in fabrication of various products. Particularly, natural rubber is constituted of isoprene units not less than a hundred, while Hevea brasiliensis is the main source producing natural rubber. Though it is known biosynthesis of polyisoprenoids in plant involves a cluster of enzymes generally named prenyl transferase, the enzyme, cis-prenyl transferase, in Hevea brasiliensis responsible for rubber production is not yet fully characterized especially from the genetic aspect. Cis-prenyl transferase catalyses addition of extra isoprene unit into the backbone chain of polyisoprenoids in Hevea brasiliensis via condensation and arranges the polymerised units in cis-configuration. Past effort put into identifying cis-prenyl transferase from the plant Hevea brasiliensis can be seen in academic publication of K. Asawateratanaku (Eur. J. Biochem. 270(2003) 4671-4680), United States patent application no. 7880058 and United States patent publication no. 20100186111. However, there exist different homologues or isoforms for cis-prenyl transferase in different sub-clone of Hevea brasiliensis, while these homologues show differences in catalytic activity and stability. Identification of new homologue may substantially boast natural rubber yield in Hevea brasiliensis or even develop recombinant cells for other species capable of biosynthesising natural rubber.

SUMMARY OF THE INVENTION

One of the objects of the present invention is to provide genetic information, particularly in the form of polynucleotide sequence, related to homologues of the enzyme cis-prenyl transferase from Hevea brasiliensis that the found homologues possesses preferred catalytic activity and stability. Further object of present invention is to provide a recombinant gene construct containing genetic information of the preferred homologues of cis-prenyl transferase from Hevea brasiliensis. The recombinant gene construct is transferable into a host cell and prompts synthesis of the preferred homologues within the host cells. Another object of the present invention is to disclose a transformed host cell, preferably cells of a transgenic plant of Hevea brasiliensis, with one or more copies of the mentioned recombinant gene construct to overexpress the preferred homologues of cis-prenyl transferase. Consequently, the overexpressed cis-prenyl transferase may lead to increase production of natural rubber from the transgenic plants.

It is another object of the present invention to offer a method of identifying genotype of sub-clone of Hevea brasiliensis having a gene encoding the preferred cis-prenyl transferase homologues. At least one of the preceding objects is met, in whole or in part, by the present invention, in which one of the embodiments of the present invention is an isolated polynucleotide comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 encoding homologue of cis-prenyl transferase of the plant Hevea brasiliensis. Preferably, polynucleotides sequence of SEQ ID NO: 1 or SEQ ID NO: 2 derives from clone RRIM 600 of Hevea brasiliensis. Further embodiment of the present invention is an isolated polypeptide capable of polymerizing isoprene monomers comprising amino acids sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. Specifically, these polypeptides are putative proteins encoded by the polynucleotides sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

A recombinant gene construct is disclosed in one embodiment of the present invention also. The construct carries polynucleotide sequence setting forth in SEQ ID NO: 1 or SEQ ID NO: 2 and capable of expressing the encoded cis-prenyl transferase in a host cell.

In another aspect, the present invention also includes a transformed host cell comprising the mentioned recombinant gene construct.

Still, in another embodiment, the present invention is a method of identifying presence of a polynucleotide encoding cis-prenyl transferase of the clone RRIM 600 of the plant Hevea brasiliensis in a sample containing a plurality of polynucleotide sequences comprising the steps of providing nucleotide probes having sequence complementary to nucleic acid position 519 to 709 as in nucleotide sequence set forth in SEQ ID NO: 1 or nucleic acid position 694 to 834 as in nucleotide sequence set forth in SEQ ID NO: 2 on a platform; bringing the sample into contact with the provided probes for hybridizing any complementary strand available in the plurality of polynucleotide sequence with the probes, wherein the polynucleotides sequence are tagged with signal-emitting moieties; and detecting signals emitted from any hybridized polynucleotides sequence to identify presence of the polynucleotide encoding cis-prenyl transferase of the clone RRIM 600 of the plant Hevea brasiliensis after washing off unbound polynucleotides sequence.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the polynucleotide sequence SEQ ID No: 1 encoding one of the disclosed homologues of the enzyme cis-prenyl transferase (CPT 2) from the plant Hevea brasiliensis; shows the polynucleotide sequence SEQ ID No: 2 encoding one of the disclosed homologues of the enzyme Cis prenyl transferase (CPT 5) of the plant Hevea brasiliensis; shows the polypeptide sequence SEQ ID NO: 3 encoded by SEQ ID NO: 1 in figure 1 ; shows the polypeptide sequence SEQ ID NO: 4 encoded by SEQ ID NO: 2 in figure 2; shows the phylogenetic tree comparing SEQ ID No.l and 2 along with the nucleotides encoding the protein for the enzyme cis prenyl transferases; is the electrophoresed agarose gel image showing the PCR

amplification result of CPT 2, in which Lane 1 is negative control, Lanes 2 and 3 are samples of CPT 2 and Lane 4 is lkbp DNA ladder Marker (Promega); is the electrophoresed agarose gel image showing the PCR

amplification result of CPT 5, in which Lane 1 is negative control, Lanes 2 and 3 are samples of CPT 5 and Lane 4 is lkbp DNA ladder Marker (Promega); is a gel picture showing restriction digestion of CPT 2 in which Lane 1 is the digestion mixture and Lane 2 is the 1 kbp ladder marker (Promega); is a gel picture showing restriction digestion of CPT 5 in which Lane 1 is the digestion mixture and Lane 2 is the 1 kbp ladder marker (Promega); Figure 10 shows SDS PAGE analysis of expressed protein of CPT 2 under 37° C, where Lane 1 is Control, Lane 2 is Protein marker and Lane 3 is protein induced with 1 mM IPTG; and Figure 1 1 shows SDS PAGE analysis of expressed protein of CPT 5 under 37° C, where Lane 1 is Control, Lane 2 is Protein marker and Lane 3 is protein induced with 1 mM IPTG.

DETAILED DESCRIPTION OF THE INVENTION

One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The embodiment describes herein is not intended as limitations on the scope of the invention. The term "gene" is defined as the genomic sequence of the plant Hevea brasilliensis particularly polynucleotide sequences encoding polypeptide sequence of the enzyme cis-prenyl transferase.

The term "cis-prenyl transferase" used throughout of the description herein refers to a group of enzymes catalyzing sequential addition of at least one C5 units to polyisoprenoids.

The term "CPT" refers to cis-prenyl transferase, while "CPT 2" is homologue encoded by the polynucleotide sequence as in SEQ ID NO: 1 and "CPT 5" is homologue encoded by the polynucleotide sequence as in SEQ ID NO: 2.

The term "polynucleotide", as used herein, is a nucleic acid containing a sequence that is greater than about 100 nucleotides in length.

The term "isolated polynucleotide" or "isolated nucleotide sequence" used herein refers to polymer of RNA or DNA acquired from biological sample or produced chemically via any known method in the art. The polymer can be single- or double- stranded.

The term "oligonucleotide", as used herein, is a short polynucleotide or a portion of polynucleotide which preferably comprises from about 8 to 35 nucleotides. In respect to the embodiment of the present invention, nucleotides contained within the oligonucleotides can be analogs or derivatives of naturally occurring nucleotides.

The abbreviation used throughout the specification to refer to nucleic acids comprising nucleotide sequences are the conventional one-letter abbreviations. Thus, when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Also, unless other wise specified, nucleic acid sequences that are presented as a series of one-letter abbreviations are presented in the 5 '->3' direction.

The term "wild-type", as used herein, refers to a gene or gene product that has characteristics of that gene or gene product that is most frequently observed in population and is, thus, arbitrarily designated the "normal" or "wild-type" form of the gene. In contrast, the term "variance" or "mutant", as used herein refers to gene or gene product that displays modifications in sequence and/or functional properties when compared to wild-type gene or product.

As used herein, the term "complementary" and derivatives thereof are used in reference to pairing of nucleic acids by the well known rules that Ά pairs with T or U and C pairs with G. Complement can be "partial" or "complete". In partial complement, only some of the nucleic acid bases are matched according to the base pairing rules; while in complete or total complement, all the bases are matched according to the paring rule. The degree of complement between the nucleic acid strands may have significant effects on the efficiency and strength of hybridization between nucleic acid strands as well known in the art. This may be of particular in detection method that depends upon binding between nucleic acids. The term "hybridization" or "hybridizing" used herein refers to the pairing action of two at least substantially complementary strands under appropriate conditions of temperature and ionic strength. The conditions of temperature and ionic strength also control stringency of the "hybridization" defining the extent of complementary of the two strands needed for successful pairing.

The term 'host cell" or "transformed cell" used herein refers to cell received a foreign gene material or a recombinant gene construct and capable of producing a product according to the genetic information presented in the foreign gene material.

The present invention discloses an isolated polynucleotide comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 encoding polypeptide homologous to the cis-prenyl transferase of the plant Hevea brasiliensis . More preferably, the disclosed isolated polynucleotides are originated from clone RRIM 600 of the plant Hevea brasiliensis. It was found by the inventors of the present invention that mRNAs encoding these homologues are expressed in the plant parts, particularly leaves, of the clone RRIM 600. The RRIM 600 is a subclone of the plant Hevea brasiliensis that it is known being able to provide stable and good yield even subjected to extreme weather change. Its stable and substantially good yield is desirable in natural rubber production for meeting high market demand, especially fluctuation in supply caused by global climate changes. These homologues of cis- prenyl transferase in RRIM 600 are believed to be crucial in attaining stable and good yield. Thus, polynucleotides encoding these homologues may be used for producing natural rubber in vivo or in vitro.

Consequently, in another preferred embodiment, the present invention also provides isolated polypeptides comprising amino acids sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4 for polymerizing isoprene monomers. One skilled in the art shall appreciate the fact that these polypeptides may be respectively encoded by the polynucleotides SEQ ID NO: 1 and SEQ ID NO: 2 or encoded by other substantially identical polynucleotides owing to codon degeneracy, while such modification shall not depart from the scope of the present invention as well. Further, these polypeptides maybe acquired from a host cell synthesizing these polypeptides in vivo that the host cell can be bacteria or plant cells besides Hevea brasiliensis using any known method in the art. Yet, it is possible also the disclosed polypeptides being synthesized chemically.

In another embodiment, the present invention includes a transformed host cell created to carry polynucleotides having sequence SEQ ID NO: 1 or SEQ ID NO: 2 which, in turn, result in producing corresponding encoded polypeptides in the transformed host cells. Preferably, the transformed host cell is plant cells of specific plant tissues having the substrate isopentenyl diphosphate readily to be polymerized to form polyisoprenoids by the expressed cis-prenyl transferase thereof. Specifically, the transformed cells contain at least one copy of the exogenously introduced polynucleotide template having sequence of SEQ ID NO: 1 or SEQ ID NO: 2 for expressing full length of the mature cis-prenyl transferase of the sub-clone RRIM 600 and bio-synthesizing cis-polyisoprenoids from the isopentenyl diphosphate available in the tansformed cells. The expressed cis-preny transferase of the sub-clone RRIM 600 in these transformed cells may lead to stable and increased yield of natural rubber. Further, the mentioned transformed cells may constitute part of transgenic 'plant tissues. Preferably, the transformed tissues bearing exogenous polynucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 are, but not limited to, lacticifer tissues of the transgenic plant. Expression of the preferred cis-prenyl transferase homologues imparts desired properties to the transgenic plant for rubber production. Transformation is preferably performed onto embryonic plant cells or seeds to acquire a transgenic plant thereof. According to another preferred embodiment, the transgenic plant is Hevea brasiliensis having an upsurge production of the preferred cis-prenyl transferase homologues caused by overexpression of the polynucleotides SEQ ID NO: 1 or SEQ ID NO: 2. More preferably, the transformed tissues of the transgenic Hevea brasiliensis possess additional copies of nucleotide template having open reading frame encoding the preferred cis-prenyl transferase homologues in contrast to normal tissues. These additional copies of nucleotide template boast the expression of mRNA coding the preferred cis-prenyl , transferase homologues which subsequently cause overexpression of the preferred homologues. The overexpressed cis-prenyl homologues in the transgenic Hevea brasiliensi plant are likely to result in elevated rubber production provided that isopentenyl diphosphate available in the transgenic plant is abundant. Various methods for cells transformation can be conducted accordingly to obtain the mentioned transformed host cells, particularly cells of higher plants. To realize the transformation, the polynucleotide having the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is preferably arranged in a transportable recombinant gene construct to provide an open reading frame to boast the synthesis of the preferred homologues. The cell transforming method can be, but not limited to, high velocity ballistic bombardment or electroporation to transport the recombinant gene construct into the targeted cells.

As in the foregoing description, cell transformation requires a recombinant gene construct incorporated with the preferred polynucleotide sequence to be expressed. Specifically, the recombinant gene construct of the present invention comprises nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 in a host cell for expressing homologue of cis-prenyl transferase of the plant Hevea brasiliensis in the host cell. The recombinant gene construct preferably refers to vector. Relying on the cell types to be transformed, various vectors can be used in the present invention. For transforming plant cells or yeasts, the present invention uses plasmid for preparing the recombinant gene construct while the choice of the specific type of plasmid depends on the method carrying out the transformation. Likewise, bacterial vectors or cassettes are used to prepare recombinant gene construct capable of expressing the nucleotide template of SEQ ID NO: 1 or SEQ ID NO: 2. The plasmids or vectors essentially retain sequence initiating translation of the incorporated reading frame, at least one selectable marker for screening of the transformed cells and sequence prompting chromosomal integration or autonomous replication within the host cells. More preferably, the recombinant gene construct may further comprise a promoter region operably- linked to enhance expression of the polynucleotide template.

The present invention also offers a method of identifying presence of a polynucleotide encoding cis-prenyl transferase of the clone RRIM 600 of Hevea brasiliensis in a sample containing a plurality of polynucleotide templates comprising the steps of providing nucleotide probes having sequence complementary to nucleic acid position 519 to 709 as in nucleotide sequence set forth in SEQ ID NO: 1 or nucleic acid position 694 to 834 as in nucleotide sequence set forth in SEQ ID NO: 2 on a platform; bringing the sample into contact with the provided probes for hybridizing any complementary strand available in the plurality of polynucleotide templates with the probes, wherein the polynucleotides templates are tagged with signal-emitting moieties; and detecting signals emitted from any hybridized polynucleotide sequence to identify presence of the polynucleotide encoding cis-prenyl transferase of the clone R IM 600 of Hevea brasiliensis after washing off unbound polynucleotide sequence. The disclosed method is particularly useful for screening transformed cells or preferred sub-clone of Hevea brasiliensis possessing the gene sequence needed for the expression of the disclosed cis-prenyl transferase homologues. The disclosed method is suitable to be applied in microarray to achieve rapid identification. In accord with the preferred embodiment, the signal-emitting moieties are flurophore with or without quencher. The sample in the described method may refer to PCR products amplified from the gene of cis-prenyl transferase or RNA extracted from cells sample. Apart from the described method, other generally recognized approaches such as restriction fragment length polymorphisms (RFLP), allele-specific PCR, nested PCR and the like can be used as well for identification of presence of nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 in a given sample.

The following example is intended to further illustrate the invention, without any intent for the invention to be limited to the specific embodiments described therein.

Example 1

Amplification, Cloning and Sequencing of CPT 2 and CPT 5 from Hevea brasiliensis RRIM 600

Total RNA was isolated from young leaves of Hevea brasiliensis RRIM 600 using QIAGEN- RNeasy Mini Kit according to the manufacturer's instructions. The quality as well as quantity was checked by agarose gel electrophoresis and Thermo Scientific Nano Drop 2000 accordingly. cDNA first strand was synthesised using Superscript® VILO™ cDNA Synthesis Kit (invitrogen) according to the manufacturer's instructions. The gene was amplified from the cDNA by PCR using primers CPT 2F and CPT 2R for polynucleotide sequence SEQ ID NO: 1 and CPT 5F and CPT 5R for polynucleotide sequence SEQ ID NO: 2. The PCR reaction (50 μΐ,) contained Ι μΙ, of cDNA, 20 pmoles of each primer, 5 μΐ-οί 1 OX Pfu Buffer, 5 μΐ, of 2.5 mM dNTP mix and 2.5 units of PfuTurbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions. Initial denaturation for 5 min at 94°C followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 45°C for 30 sec and extension at 72°C for 1 min with a final extension at 72°C for 7 min. The PCR product was analysed by 1% agarose gel and the amplicon was eluted from the gel using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions. The purified PCR product was ligated into pCR® 4 Blunt TOPO® Vector (invitrogen) and transformed into One Shot® Machl™-T1R Chemically Competent E. coli cells (invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) according to the manufacturer's instructions. The presence of the insert was checked by digesting with EcoRI(NEB) and positive plasmids were subjected to sequencing.

Oligonucleotides sequences used as primers

CPT 2 F: ATGGAAATATATACGGGTCAGAGG

CPT 2 R: TTATTTCAAATATTCCTTGTGCTTC

CPT 5 F: CCGAGTCACATACAGGCTTCG

CPT 5 R: ATAAGGCAGGATGAGCTAGGAAC

Example 2

Analysis of the sequence

The nucleotide sequences and the aminoacid sequences were analysed by BLASTN and BLASTP programmes respectively. The sequences along with the other reported CPT sequences aligned with Clustal W programme. Phylogenetic analysis was carried out using the Neighbour Joining (NJ) method implemented in the MEGA 4 programme.

Polynucleotide sequence SEQ ID NO: 1 and SEQ ID NO: 2 shows similarity to other CPTs reported from Hevea. But shows some difference revealing its uniqueness. The functional characterisation of this invention allows partially or fully the production of natural rubber invitro and a transgenic rubber plant with increased rubber production. The present invention also reveals the catalytic properties of CPT 2 by homology model.

Example 3

Homology Modeling

Models have been built using Modeller 9v8. The structures have been modelled on the dimer, which was generated using the symmetry records in the deposited PDB file and UCSF Chimera. Thus, Modeller 9v8 was run using both the BLAST-guided PDB retrieved templates from PDB.

Example 4

Pathway Construction Showcasing Role of CPTs in Rubber Biosynthesis

Automatic metabolic pathway reconstruction was done by identifying orthologs for predicted rubber proteins in Arabidopsis genome and sequence orthologs. CPT catalyzed enzymatic reactions encoded within rubber genome were constructed out of 566 enzymatic reactions available in Resnet-Plant 3.0 database for Pathway Studio and from metabolic pathway databases (MPW)

Example 5

Expression of the Protein Full length gene was amplified from the positive clones by PCR using primers ECPT 2F and ECPT 2R for CPT 2 and ECPT 5F and ECPT 5R for CPT 5. The PCR reaction (50 iL) contained 50 ng of the plasmid, 20 pmoles of each primer, 5 μί of 10X Pfu Buffer, 5 μΐ, of 2.5 mM dNTP mix and 2.5 units of PfuTurbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions. Initial denaturation for 5 min at 94°C followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec and extension at 72°C for 1 min with a final extension at 72°C for- 7 min. The PCR product was analysed by 1% agarose gel and the amplicon was eluted from the gel using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions. The purified PCR product was ligated into pCR® 4 Blunt TOPO® Vector (invitrogen) and transformed into One Shot® Machl™-T1R Chemically Competent E. coli cells (invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) according to the manμfacturer's instructions. The insert was released from the plasmid by digesing with Nhe 1 and Xho 1 (NEB) for CPT 2 and Xho 1 and Bam H 1 for CPT 5. The insert was gel purified using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions and ligated into pET-21 a vector (Novagen) linerised with Nhe 1 and Xhol (NEB) for CPT 2 and into pET-14 b vector (Novagen) linerised with Xhol and Bam HI (NEB) for CPT 5. The ligation mixture was transformed into BL21 (DE3) chemically competent E.coli cells (Novagen). From the positive colonies plasmids were isolated and the sequence was confirmed by Restriction digestion and sequencing. The positive colonies were used for protein induction and the protein induction was done at 15,20,25 and 37°C with 0.5, land 1.5 mM IPTG.

The oligonucleotides used as primers for the expression studies are listed in the following. The ECPT 2F and ECPT 2R are used for expression of CPT 2, while ECPT 5F and ECPT 5R are used for expression of CPT 5.

ECPT 2F GCGCTAGCATGGAAATATATACGGGTCAGAGG

ECPT 2R ACCTCGAGTTATTTCAAATATTCCTTGTGCTTC

ECPT 5F GCCTCGAGATGGAATTATACACCGGTG

ECPT 5R ACGGATCCTTATTTTAAGTATTCCTTATG It is to be understood that the present invention may be embodied in other specific forms and is not limited to the sole embodiment described above. However modification and equivalents of the disclosed concepts such as those which readily occur to one skilled in the art are intended to be included within the scope of the claims which are appended thereto.

Claims

1. An isolated polynucleotide comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 encoding cis-prenyl transferase of the plant Hevea brasiliensis.

2. An isolated polynucleotide of claim 1, wherein the plant Hevea brasiliensis is clone RJ IM 600.

3. An isolated polypeptide capable of polymerizing isoprene monomers comprising amino acids sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.

4. A recombinant gene construct having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 for expressing cis-prenyl transferase of the plant Hevea brasiliensis in a host cell.

5. A recombinant gene construct of claim 4 further comprising a promoter region to enhance expression of the cis-prenyl transferase.

6. A transformed host cell comprising a recombinant gene construct of claim 4.

7. A method of identifying presence of a polynucleotide encoding cis-prenyl transferase of the clone RRIM 600 of the plant Hevea brasiliensis in a sample containing a plurality of polynucleotide sequences comprising the steps of providing nucleotide probes having sequence complementary to nucleic acid position 519 to 709 as in nucleotide sequence set forth in SEQ ID NO: 1 or nucleic acid position 694 to 834 as in nucleotide sequence set forth in SEQ ID NO: 2 on a platform;

bringing the sample into contact with the provided probes for hybridizing any complementary strand available in the plurality of polynucleotide sequence with the probes, wherein the polynucleotides sequence are tagged with signal- emitting moieties; and

detecting signals emitted from any hybridized polynucleotides sequence to identify presence of the polynucleotide encoding cis-prenyl transferase of the clone RRJM 600 of the plant Hevea brasiliensis after washing off unbound polynucleotides sequence.

A method of claim 7, wherein the signal-emitting moieties are flurophore with or without quencher.