WO2012153854A1 - Modulateur des cytokines-chimiokines - Google Patents

Modulateur des cytokines-chimiokines Download PDF

Info

Publication number
WO2012153854A1
WO2012153854A1 PCT/JP2012/062230 JP2012062230W WO2012153854A1 WO 2012153854 A1 WO2012153854 A1 WO 2012153854A1 JP 2012062230 W JP2012062230 W JP 2012062230W WO 2012153854 A1 WO2012153854 A1 WO 2012153854A1
Authority
WO
WIPO (PCT)
Prior art keywords
domain
nucleotide
represented
sequence
mrna
Prior art date
Application number
PCT/JP2012/062230
Other languages
English (en)
Japanese (ja)
Inventor
幹雄 西澤
忠芳 奥村
Original Assignee
学校法人立命館
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 学校法人立命館 filed Critical 学校法人立命館
Publication of WO2012153854A1 publication Critical patent/WO2012153854A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs

Definitions

  • the present invention relates to a nucleic acid (antisense nucleotide) that is complementary to a natural (endogenous) antisense transcript that is complementary to the mRNA of a cytokine chemokine involved in inflammation or infection, and changes the stability of the mRNA, and Utilization of its cytokine / chemokine mRNA stability regulating action, and a natural (endogenous) antisense transcript that is complementary to the cytokine / chemokine mRNA involved in inflammation and infection and changes the stability of the mRNA
  • the present invention relates to a complementary nucleic acid (sense nucleotide) and use of its cytokine / chemokine mRNA stability regulating action.
  • Natural (endogenous) antisense transcript (N atural A ntisense T ranscript; hereinafter also referred to as "NAT") and, inherent in the organism, a RNA having a nucleotide sequence complementary to mRNA, specifically Specifically, it is RNA synthesized using a DNA strand encoding a sense gene (that is, a non-template strand of mRNA) as a template.
  • Sense-antisense RNA has the ability to form double strands. For example, double-stranded RNA is necessary for RNA interference, and is used to control protein translation by small RNAs called microRNAs (miRNAs). It is known that double-stranded RNA is involved.
  • Non-patent Documents 1 and 2 Recent comprehensive cDNA analysis revealed that a considerable amount of NAT was transcribed (Non-patent Documents 1 and 2). For example, it has been suggested that about 2,500 pairs (Non-patent Document 3) exist in mice and about 2,600 pairs (Non-patent Document 4) exist in humans. Does not contain a lot of untranslatable NAT.
  • Non-Patent Document 5 it has been reported that NAT complementary to endothelial nitric oxide synthase (eNOS) mRNA increases in the presence of a histone deacetylase inhibitor and decreases the amount of eNOS mRNA (non-patent literature). 6). Also in yeast, it is known that NAT of the PHO84 gene suppresses mRNA expression through histone deacetylation (Non-patent Document 7).
  • eNOS endothelial nitric oxide synthase
  • the present inventors have a NAT complementary to the 3′-untranslated region (UTR) of inducible nitric oxide synthase (iNOS) mRNA, and that this antisense RNA hybridizes with iNOS RNA mRNA.
  • the mRNA is stabilized and the production amount of iNOS and the synthesis amount of NO increase, and the sense oligodeoxynucleotide (ODN) complementary to the NAT inhibits the binding of NAT to the iNOS mRNA. It was reported that iNOS production and NO synthesis by iNOS can be suppressed (Patent Documents 1 and 2, Non-Patent Document 8).
  • Nishizawa and its collaborators have a complementary NAT in the region that forms a secondary structure with two stem-loops, which is important for the nuclear export of interferon (IFN) - ⁇ mRNA.
  • Antisense RNA contributes to the stabilization of IFN- ⁇ mRNA, and NAT knockdown by sense ODN leads to mRNA instability, whereas overexpression of antisense RNA significantly stabilizes the mRNA (Patent Document 3).
  • the object of the present invention was to search for NAT capable of regulating the expression of cytokines and chemokine genes related to inflammation and infection, and to use a sense oligonucleotide complementary to the NAT and an antisense oligonucleotide homologous to the NAT, It is to provide a novel means for preventing and treating diseases such as inflammatory diseases and viral infections.
  • the present inventors selected 21 genes (including cytokines and chemokine genes) induced by IL-1 ⁇ and attempted to detect NAT complementary to the 3 ′ UTR of mRNA. As a result of strand-specific RT-PCR, it was found that NAT was transcribed from 16 out of 21 genes (76%). Next, we have 7 genes (CCL2, CCL20, CX3CL1, IL-23 p19 subunit, CD69, NF- ⁇ B p65 subunit, TNF- ⁇ ) in which both mRNA and NAT are abundantly transcribed.
  • RNA sequences containing loop portions within the conserved region of the predicted secondary structure have altered (increased or decreased) the expression level of the target mRNA.
  • a sense ODN designed outside the conserved region of the secondary structure did not affect the expression level of the target mRNA.
  • the present inventors have a NAT containing a region corresponding to 3′UTR in many cytokine-chemokine genes induced by IL-1 ⁇ , and the expression of the gene is regulated by NAT. Furthermore, using a sense oligonucleotide having a sequence complementary to the region containing the loop portion of the secondary structure that can be taken by the NAT (hence, homologous to mRNA), expression control (up-regulation and down-regulation) of the gene is performed. It was concluded that (regulation) is possible, and the present invention was completed.
  • the present invention is as follows. [1] Induced by IL-1 ⁇ , CCL2, CCL20, CX3CL1, IL-23A, CD69, NF- ⁇ B p65, TNF- ⁇ , Fam89a, Grk5, phosopholipid scramblase 1, Runx1, semaphorin 4A, Steap4, lymphphotoxin ⁇ Psmb10 Alternatively, an antisense nucleotide comprising a sequence complementary to the 3′UTR of the TLR2 gene and capable of regulating the expression of the gene.
  • a sense oligonucleotide comprising a sequence complementary to an endogenous antisense transcript comprising a sequence complementary to the 3 ′ UTR of the TLR2 gene and capable of regulating expression of the gene.
  • the sense oligonucleotide according to [6] above which is any of the following (a) to (g): (a) In the 3′UTR sequence of CCL2 mRNA represented by SEQ ID NO: 1, domain 1 represented by nucleotide numbers 25-51 or domain 2 represented by nucleotide numbers 103-175, or those of orthologs in other mammals Sense oligonucleotide capable of regulating the expression of the CCL2 gene, comprising a nucleotide sequence having 90% or more identity with a sequence comprising at least part of one or more loop structures in the corresponding domain (b) In the 3'UTR sequence of CCL20 mRNA represented by SEQ ID NO: 2, domain 1 represented by nucleotide numbers 65-107, domain 2 represented by nucleotide numbers 124-155, or domain 3 represented by nucleotide numbers 214-282 Or expression of the CCL20 gene comprising a nucleotide sequence having at least 90% identity with a sequence comprising at least
  • the antisense nucleotide of the present invention can regulate the expression of the gene by interacting with the 3 'UTR of the mRNA in the same manner as NAT for mRNA of various genes induced by IL-1 ⁇ .
  • the sense oligonucleotide of the present invention can regulate the expression of a target gene to a desired level by interacting with NAT to regulate its gene expression regulation action positively or negatively.
  • FIG. 5 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of CCL2 mRNA and designed sense ODN (indicated by underline). It is a figure which shows the predicted secondary structure of 3'UTR of CCL20 * mRNA.
  • FIG. 4 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of CCL20 mRNA and the designed sense ODN (indicated by underline). It is a figure which shows the predicted secondary structure of 3'UTR of CX3CL1 mRNA.
  • FIG. 5 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of CCL2 mRNA and designed sense ODN (indicated by underline). It is a figure which shows the predicted secondary structure of 3'UTR of CX3CL1 mRNA.
  • FIG. 3 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of CX3CL13 mRNA and the designed sense ODN (indicated by underline).
  • FIG. 4 shows the predicted secondary structure of 3′UTR of IL-23A mRNA.
  • FIG. 3 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of IL-23A mRNA and the designed sense ODN (indicated by underline).
  • FIG. 3 shows the predicted secondary structure of 3 ′ UTR of CD69 mRNA.
  • FIG. 3 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of CD69 mRNA and the designed sense ODN (indicated by underline). It is a figure which shows the predicted secondary structure of 3'UTR of NF- ⁇ B p65 mRNA.
  • FIG. 3 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3 ′ UTR of NF- ⁇ B p65 mRNA and designed sense ODN (indicated by underline). It is a figure which shows the predicted secondary structure of 3'UTR of TNF- (alpha) mRNA.
  • 3 shows the position of a conserved region (indicated by domain “+”) containing one or more loop structures of 3′UTR of TNF- ⁇ mRNA and the designed sense ODN (indicated by underline). It is a figure which shows the expression fluctuation
  • the present invention provides antisense nucleotides of these genes, which have an effect of regulating the expression of genes related to various inflammations / infections including cytokines and chemokines induced by IL-1 ⁇ .
  • the target gene (mRNA) in the present invention is an endogenous antisense transcript containing a sequence complementary to its 3 ′ untranslated region (3′UTR) in the gene group induced by IL-1 ⁇ .
  • chemokine (CC motif) ligand 2 CCL2
  • chemokine (CC motif) ligand 20 CCL20
  • chemokine (C-X3-C motif) ligand 1 CX3CL1
  • IL-23A cluster of differentiation 69
  • CD69 nuclear factor- ⁇ B p65 subunit
  • NF- ⁇ B p65 nuclear factor- ⁇ B p65
  • TNF- ⁇ tumor necrosis factor- ⁇
  • family with sequence similarity 89 member A (Fam89a); G protein-coupled receptor kinase 5 (Grk5); phosopholipid scramblase 1; runt-related transcription factor 1 (Runx1); sema domain, immunoglobulin domain, transmembrane domain and short cytoplasmic domain 4A (semaphorin 4A); six-transmembrane epithelial antigen of prostate 4 (Stepa); chemokine (CC motif) ligand 2 (CCL2); chemokine (CC
  • the antisense nucleotide of the present invention may be any nucleotide as long as it contains a sequence complementary to the 3 'UTR of the target mRNA and can regulate the expression (protein production) of the target gene.
  • the “complementary” sequence is not only a sequence that is completely complementary to mRNA, but also 1 to a number (as long as it can hybridize with and interact with mRNA under physiological conditions of cells). 2, 3, 4 or 5) may contain base mismatches.
  • the sequence complementary to the 3′UTR of the target mRNA is a stringent condition such as those described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999 For example, hybridization at 6 ⁇ SSC (sodium chloride / sodium citrate) / 45 ° C., followed by one or more washings at 0.2 ⁇ SSC / 0.1% SDS / 50-65 ° C.) It is a sequence that can hybridize with.
  • SSC sodium chloride / sodium citrate
  • the antisense nucleotides of the present invention may contain 3′UTR of the target mRNA. It is preferred to include a sequence complementary to a portion that is not thermodynamically stable therein.
  • the portion that is not thermodynamically stable includes a region that is in a single-stranded state when the mRNA has a secondary structure (for example, a region corresponding to the loop portion of the stem-loop structure).
  • the secondary structure of the 3'UTR of the target mRNA is represented by mfold (see GCG Software; Proc. Natl. Acad. Sci.
  • nucleotide sequence information based on the nucleotide sequence information of the region. Can be predicted using an existing RNA secondary structure prediction program. Any of these nucleotide sequence information is readily available.
  • CCL2, CCL20, CX3CL1, IL-23A, CD69, NF- ⁇ B p65 and TNF- ⁇ mRNA 3′UTR sequences are shown in SEQ ID NOs: 1-7, respectively. Show.
  • the antisense nucleotide against CCL2 of the present invention is the domain 1 and / or nucleotide number 103-175 represented by nucleotide number 25-51 in the rat CCL2 mRNA 3'UTR sequence represented by SEQ ID NO: 1.
  • a sequence containing at least a part of one or more loop structures (for example, 3 bases or more) in the domain corresponding to each domain in the rat CCL2 Containing a complementary nucleotide sequence is the domain 1 and / or nucleotide number 103-175 represented by nucleotide number 25-51 in the rat CCL2 mRNA 3'UTR sequence represented by SEQ ID NO: 1.
  • a sequence containing at least a part of one or more loop structures for example, 3 bases or more
  • the antisense nucleotide against CCL20 of the present invention in the rat CCL20 ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ mRNA 3'UTR sequence shown in SEQ ID NO: 2, is in domain 1 and / or nucleotide numbers 124-155 shown in nucleotide numbers 65-107 In the domain 2 shown and / or in the domain 3 shown by nucleotide numbers 214-282, in the CCL20 ortholog in other mammals, one or more loop structures in the domain corresponding to each domain in the rat CCL20 A nucleotide sequence complementary to a sequence containing at least a part (for example, 3 bases or more) is included.
  • the antisense nucleotide against CX3CL1 of the present invention is the domain 1 and / or nucleotide number 1305-1369 represented by nucleotide number 1103-1202 in the 3′UTR sequence of rat CX3CL1 mRNA represented by SEQ ID NO: 3.
  • domain 6 indicated by -1810 in the CX3CL1 ortholog in other mammals, the domain corresponding to each domain in the rat CX3CL1 is complementary to a sequence containing at least a part of one or more loop structures. Contains nucleotide sequence.
  • the antisense nucleotide against IL-23A of the present invention is the domain 1 and / or nucleotide represented by nucleotide number 37-55 in the 3′UTR sequence of rat IL-23A mRNA represented by SEQ ID NO: 4
  • the domain 2 shown by the number 193-303 and / or the domain 3 shown by the nucleotide number 380-448 and / or the domain 4 shown by the nucleotide number 555-600 in the IL-23A ortholog in other mammals
  • the antisense nucleotide against CD69 of the present invention is the domain 1 and / or nucleotide number 120-186 represented by nucleotide number 15-32 in the 3′UTR sequence of rat CD69 mRNA represented by SEQ ID NO: 5.
  • domain 6 shown by -786 in the CD69 ortholog in other mammals, the domain corresponding to each domain in rat CD69 is complementary to a sequence containing at least a part of one or more loop structures. Contains nucleotide sequence.
  • the antisense nucleotide for NF- ⁇ B p65 of the present invention is the domain 1 and / or the nucleotides 161-301 in the 3′UTR sequence of rat NF- ⁇ B p65 mRNA shown in SEQ ID NO: 6. Or in domain 2 indicated by nucleotide number 343-380 and / or domain 3 indicated by nucleotide number 401-412 and / or domain 4 indicated by nucleotide number 473-523, to NF- ⁇ B p65 ortholog in other mammals In that case, it comprises a nucleotide sequence complementary to a sequence containing at least a part of one or more loop structures in the domain corresponding to each domain in the rat NF- ⁇ B p65.
  • the antisense nucleotide against TNF- ⁇ of the present invention is the domain 1 and / or nucleotide represented by nucleotide number 304-405 in the 3′UTR sequence of rat TNF- ⁇ mRNA represented by SEQ ID NO: 7
  • the nucleotide sequence of the peripheral region of the ARE motif common to multiple species is well conserved among mammalian species. Since the secondary structure is similar, the region can be preferably selected.
  • Table 1 shows the number of ARE motifs present in the 3'UTR of the above-mentioned 7 genes of rat, mouse and human and the common ARE motifs between human-rat and among three species.
  • the length of the antisense nucleotide of the present invention is not particularly limited, and a nucleotide sequence complementary to a sequence comprising at least a part of one or more loop structures in the domain in the full length of NAT or 3′UTR of the target mRNA. It may contain a partial sequence of NAT, but from the viewpoint of sequence specificity, it contains at least 10 bases, preferably about 12 bases or more, more preferably about 15 bases or more, a portion complementary to the target sequence. . In addition, from the viewpoint of ease of administration when used as a pharmaceutical, those having a base length of 500 bases or less, preferably 300 bases or less, more preferably 150 bases or less are mentioned.
  • the antisense nucleotide of the present invention is an oligonucleotide having about 10 to 50 bases
  • the nucleotide is a sequence that causes a sequence-nonspecific reaction (for example, 5′-CG-3 ′, 5′-GGGG-3 ', 5'-GGGGG-3' and the like are preferably selected, and are preferably selected from those having no similar complementary strand sequence in RNA other than the target mRNA.
  • the absence of a similar complementary strand sequence in other RNAs can be confirmed by performing a homology search against the target mammalian genome sequence using the antisense oligonucleotide candidate sequence as a query. .
  • homology search means known nucleic acid homology search software (for example, NCBI BLAST (National Center Biotechnology Information Basic Basic Local Alignment Search Tool) NBLAST and XBLAST programs (version 2.0), FASTA program in GCG software package Etc.) can be used.
  • NCBI BLAST National Center Biotechnology Information Basic Basic Local Alignment Search Tool
  • XBLAST XBLAST programs (version 2.0)
  • FASTA program in GCG software package Etc. can be used as a genomic DNA data set.
  • a genomic DNA data set for example, all human genome data provided by Celera can be used.
  • the antisense nucleotide of the present invention is used in various forms depending on the method of introduction into cells.
  • the antisense nucleotide when it is an oligonucleotide having about 10 to 50 bases, it may be any one of single-stranded DNA, single-stranded RNA, and DNA / RNA chimera, and it is further added with known modifications. There may be.
  • the “nucleotide” may include not only purine and pyrimidine bases but also those having other modified heterocyclic bases.
  • the nucleotide molecule constituting the antisense nucleotide may be natural DNA or RNA, but various chemicals may be used to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA). Modifications can be included. For example, in order to prevent degradation by nuclease, etc., phosphate residues (phosphates) of each nucleotide constituting the antisense oligonucleotide may be changed to chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. Substituents can be substituted.
  • PS phosphorothioate
  • methylphosphonate methylphosphonate
  • phosphorodithionate etc.
  • Substituents can be substituted.
  • the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R is, for example, CH 3 (2′-O-Me), CH 2 CH 2 OCH 3 (2′-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 , CH 2 CH 2 CN and the like may be substituted).
  • R is, for example, CH 3 (2′-O-Me), CH 2 CH 2 OCH 3 (2′-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 , CH 2 CH 2 CN and the like may be substituted).
  • the base moiety pyrimidine, purine
  • BNA LNA
  • ENA ENA
  • the antisense oligonucleotide of the present invention synthesizes a complementary sequence based on the target mRNA (cDNA) sequence using a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.). Can be prepared.
  • the antisense oligonucleotide of the present invention is provided in a special form such as a liposome or a microsphere, or a hydrophobic substance such as a polycationic substance such as polylysine or a lipid (eg, phospholipid, cholesterol, etc.) is added thereto. It can be provided in the form.
  • the antisense oligonucleotide of the present invention is converted to a peptide having a membrane permeation function (for example, Drosophila-derived Antennapedia homeodomain (AntP), human immunodeficiency virus (HIV) -derived TAT, herpes simplex virus (HSV) -derived Modification with a cell-passing domain such as VP22) can promote the uptake of the oligonucleotide into cells.
  • a membrane permeation function for example, Drosophila-derived Antennapedia homeodomain (AntP), human immunodeficiency virus (HIV) -derived TAT, herpes simplex virus (HSV) -derived Modification with a cell-passing domain such as VP22
  • the antisense nucleotide of the present invention is a polynucleotide having a longer base length
  • introduction of the nucleotide into a cell can be carried out using a gene transfer method known per se.
  • double-stranded DNA is preferably used as the nucleotide.
  • the antisense nucleotide of the present invention extracts, for example, total RNA from a cell that expresses the target gene NAT (for example, a cell that highly expresses target mRNA and NAT by IL-1 ⁇ stimulation).
  • SEQ ID NOs: 1-7 Based on the sequence information of the target mRNA shown in the above, a primer that can amplify an appropriate region of the complementary strand sequence is designed, and RT-PCR is performed (see Examples below).
  • the obtained cDNA is inserted into an appropriate expression vector containing a promoter that can function in host animal cells.
  • expression vectors include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sendai virus and other viral vectors, animal cell expression plasmids (eg, pA1-11, pXT1, pRc / CMV, pRc / RSV). , PcDNAI / Neo) or the like.
  • Examples of the promoter used in the expression vector include EF1 ⁇ promoter, CAG promoter, SR ⁇ promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Molone murine leukemia virus) LTR. HSV-TK (herpes simplex virus thymidine kinase) promoter and the like are used. Of these, EF1 ⁇ promoter, CAG promoter, MoMuLV LTR, CMV promoter, SR ⁇ promoter and the like are preferable.
  • the expression vector may optionally contain an enhancer, a poly A addition signal, a selection marker gene, an SV40 replication origin, and the like.
  • the selection marker gene include a dihydrofolate reductase gene, a neomycin resistance gene, a puromycin resistance gene, and the like.
  • the antisense nucleotide of the present invention can regulate target gene expression (protein production) by interacting with the target mRNA.
  • Various genes including cytokine / chemokine gene induced by IL-1 ⁇ have various physiological activities such as inflammation-inducing or anti-inflammatory action, infection defense, regulation of immune response, etc.
  • the contained drug can be used as a target gene expression regulator for the prevention and / or treatment of various diseases including inflammatory diseases and infectious diseases.
  • antisense nucleotides that can enhance the expression of CCL2 can be used for angiogenesis and wound healing, while CCL2 migrates to monocytes and eosinophils, so that it can suppress the expression of CCL2.
  • Nucleotides are useful for the prevention and treatment of chronic inflammatory diseases including arteriosclerosis and allergic inflammation. Since CCL20 exhibits antibacterial activity against a wide range of microorganisms, antisense nucleotides that can enhance the expression of CCL20 are effective in preventing and treating various microbial infections. On the other hand, since CCL20 plays an important role in the initiation and maintenance of adaptive immunity, antisense nucleotides that can suppress the expression of CCL20 are bronchial asthma, multiple sclerosis, rheumatoid arthritis, various dermatitis, inflammatory It is effective for the prevention and treatment of autoimmune diseases such as bowel disease.
  • Antisense nucleotides that can enhance CX3CL1 expression can be used for angiogenesis, while antisense nucleotides that can suppress CX3CL1 expression prevent or treat inflammatory diseases including arteriosclerosis and glomerulonephritis It is useful for the prevention and treatment of anti-rejection and rheumatoid arthritis.
  • IL-23A is important for the maintenance of cellular immunity, and its overexpression causes multi-organ inflammation. Therefore, antisense nucleotides that can enhance IL-23A expression are effective in the prevention and treatment of infectious diseases.
  • antisense nucleotides that can suppress the expression of IL-23A are useful for the prevention and treatment of autoimmune diseases and inflammatory diseases.
  • CD69 plays an important role in the differentiation and activation of lymphocytes
  • antisense nucleotides that can enhance the expression of CD69 are effective in the prevention and treatment of infectious diseases.
  • CD69 is expressed in most inflammatory cells that are expressed locally, and an anti-antibody that can suppress the expression of CD69 due to detection of autoantibodies against CD69 from patients with rheumatoid arthritis and systemic lupus erythematosus (SLE).
  • Nucleotides are useful for the prevention and treatment of autoimmune diseases and inflammatory diseases.
  • NF- ⁇ B is a transcription factor having an important role in the immune system
  • antisense nucleotides that can enhance the expression of NF- ⁇ B p65 are effective in preventing and treating infectious diseases.
  • NF- ⁇ B is constantly activated in cancer cells and inhibits apoptosis, and is also involved in pathogenesis such as bone metabolism, bronchial asthma, arthritis, inflammatory bowel disease, sepsis, Antisense nucleotides that can suppress the expression of NF- ⁇ B p65 are useful for the prevention and treatment of cancer, osteoporosis, autoimmune diseases and inflammatory diseases. Since TNF- ⁇ shows protection against infection and anti-tumor action by inducing apoptosis and enhancing antibody production by inflammatory mediators and plasma cells, antisense nucleotides that can enhance the expression of TNF- ⁇ prevent infection and cancer. It is effective for treatment.
  • TNF- ⁇ is involved in the pathogenesis of rheumatoid arthritis, psoriasis, diabetes, hyperlipidemia, sepsis, and osteoporosis
  • antisense nucleotides that can suppress the expression of TNF- ⁇ are used to prevent and treat these diseases. Useful for.
  • the medicament containing the antisense nucleotide of the present invention has low toxicity, and as such a solution or a pharmaceutical composition of an appropriate dosage form, can be used as a human or non-human mammal (eg, mouse, rat, guinea pig, rabbit, sheep, Pigs, cows, cats, dogs, monkeys, etc.) can be administered orally or parenterally (eg, inhalation administration, intravascular administration, subcutaneous administration, transmucosal administration, etc.).
  • these nucleic acids are used as a prophylactic / therapeutic agent for the above-mentioned various diseases, they can be formulated and administered according to a method known per se.
  • the antisense nucleotide of the present invention is inserted alone or in a functional manner into the appropriate expression vector for mammalian cells such as a retroviral vector, lentiviral vector, adenoviral vector, adeno-associated viral vector and the like. Then, it can be formulated according to conventional means.
  • the nucleotide can be administered as it is or together with an auxiliary agent for promoting intake by a gene gun or a catheter such as a hydrogel catheter. Alternatively, it can be aerosolized and locally administered into the trachea as an inhalant.
  • the nucleotide may be formulated (injection) alone or with a carrier such as a liposome and administered intravenously, subcutaneously, etc. .
  • the antisense nucleotide of the present invention may be administered per se or as an appropriate pharmaceutical composition.
  • the pharmaceutical composition used for administration may contain the antisense nucleotide of the present invention and a pharmacologically acceptable carrier, diluent or excipient.
  • a pharmaceutical composition is provided as a dosage form suitable for oral or parenteral administration.
  • compositions for parenteral administration for example, injections, aerosols, suppositories and the like are used, and injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, intravenous injections, etc. May be included.
  • Such an injection can be prepared according to a known method. Aerosol formulations can be placed in compressed acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like. Alternatively, it may be formulated as an incompressible pharmaceutical product such as a nebulizer or an atomizer.
  • Suppositories used for rectal administration may be prepared by mixing the nucleic acid with a normal suppository base.
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), and syrups. Agents, emulsions, suspensions and the like.
  • Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field.
  • a carrier and excipient for tablets for example, lactose, starch, sucrose, and magnesium stearate are used.
  • the above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dosage of the active ingredient.
  • dosage forms include tablets, pills, capsules, injections (ampoules), aerosols, and suppositories.
  • the antisense nucleotide of the present invention is preferably contained, for example, usually 5 to 500 mg per dosage unit dosage form, particularly 5 to 100 mg for injections, and 10 to 250 mg for other dosage forms.
  • the dosage of the above-mentioned medicament containing the antisense nucleotide of the present invention varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, the dosage of the antisense nucleotide of the present invention is usually 0.01 to 20 mg. It is convenient to administer about 0.1 kg / kg body weight, preferably about 0.1-10 mg / kg body weight, more preferably about 0.1-5 mg / kg body weight by intravenous injection or inhalation once to several times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
  • the above-described pharmaceutical composition may contain other drugs as long as an undesirable interaction is not caused by the combination with the antisense nucleotide of the present invention.
  • Other drugs include, for example, antiviral drugs, antitumor drugs, antibacterial drugs, antifungal drugs, antiprotozoal drugs, antibiotics, antiseptic drugs, antiseptic shock drugs, endotoxin antagonists, immunomodulators, non-steroidal drugs
  • anti-inflammatory drugs steroid drugs, inflammatory mediator action inhibitors, inflammatory mediator production inhibitors, anti-inflammatory mediator action inhibitors, anti-inflammatory mediator production inhibitors.
  • Oligonucleotides that contain a nucleotide sequence that is complementary to the nucleotide sequence of the endogenous antisense transcript (NAT) inhibits NAT's regulation of expression on the target mRNA. It is possible to regulate the stability of the target mRNA and regulate the expression of the target gene (protein production) positively or negatively. Therefore, the present invention also provides a sense oligonucleotide homologous to the 3 'UTR of a gene having an expression-regulating activity of a gene in which NAT is induced, induced by IL-1 ⁇ .
  • the target gene (mRNA) is the same as described above for the antisense nucleotide of the present invention.
  • the sense oligonucleotide of the present invention includes a sequence complementary to NAT (and thus a sequence homologous to the 3 ′ UTR), which contains a sequence complementary to the 3 ′ UTR of the target mRNA, and changes the stability of the target mRNA.
  • Any oligonucleotide can be used as long as it can be used.
  • the “complementary” sequence is not only a sequence that is completely complementary to NAT, but as long as it can hybridize with NAT under physiological conditions of cells and inhibit the action of NAT on mRNA, It may contain one to several (2, 3, 4 or 5) base mismatches.
  • the sequence complementary to the target NAT refers to stringent conditions such as those described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999 (eg 6 ⁇ Under the condition of SSC (sodium chloride / sodium citrate) / 45 ° C hybridization, followed by 0.2 ⁇ SSC / 0.1% SDS / 50-65 ° C one or more washings).
  • SSC sodium chloride / sodium citrate
  • the antisense nucleotide against the target mRNA interacts with a thermodynamically unstable portion of the mRNA to regulate the stability of the mRNA
  • the sense oligonucleotide of the present invention contains the target oligonucleotide in the target mRNA.
  • the “homologous” sequence is not only a sequence that is completely identical to the specific partial nucleotide sequence of the target mRNA, but also the action of NAT on the mRNA by hybridizing with NAT on the mRNA under physiological conditions of the cell. 1 to several (2, 3, 4 or 5) bases may be different as long as they can be inhibited.
  • the “homologous” sequence is 90% or more identity to the target mRNA in the overlapping region when the sequence of the target site of the target mRNA and the sequence of the sense oligonucleotide are aligned.
  • the sense oligonucleotide of the present invention does not contain a sequence that causes a non-sequence-specific reaction (for example, 5′-CG-3 ′, 5′-GGGG-3 ′, 5′-GGGGG-3 ′, etc.). It is preferable to select from those having no similar sequence in RNA other than the target mRNA. The absence of similar sequences in other RNAs can be confirmed by methods similar to those described above for antisense oligonucleotides.
  • the sense oligonucleotide for CCL2 NAT of the present invention in the rat CCL2 mRNA 3'UTR sequence shown in SEQ ID NO: 1, is represented by domain 1 shown by nucleotide numbers 25-51 or nucleotide numbers 103-175
  • the sequence corresponding to each domain in the rat CCL2 includes at least a part of one or more loop structures (for example, 3 bases or more). Contains a homologous nucleotide sequence.
  • TTAAGTAATGTTAAACTTAT (CCL2-Se1; SEQ ID NO: 8) that can enhance the expression of CCL2 mRNA as a sense oligonucleotide homologous to domain 1
  • CCL2 mRNA as a sense oligonucleotide that is homologous to domain 2
  • Examples include, but are not limited to, TCCATTTTTTTATTTCTCTG (CCL2-Se2; SEQ ID NO: 9) that can be enhanced.
  • the sense oligonucleotide for CCL20 NAT of the present invention is represented by the domain 1 shown by nucleotide numbers 65-107 and nucleotide numbers 124-155 in the rat CCL20 mRNA 3'UTR sequence shown by SEQ ID NO: 2.
  • domain 2 indicated by nucleotide 2 or nucleotide number 214-282, or in the CCL20 ortholog in other mammals at least a part of one or more loop structures in the domain corresponding to each domain in the rat CCL20 It includes a nucleotide sequence that is homologous to a sequence that includes (eg, 3 bases or more).
  • GGTTTCACCTGCACATCACT (CCL20-Se1; SEQ ID NO: 10) can suppress the expression of CCL20 mRNA
  • a sense oligonucleotide homologous to domain 3 expression of CCL20 mRNA Examples include, but are not limited to, GTTTAGCTATTTAATGTTAA (CCL2-Se2; SEQ ID NO: 11) that can be enhanced.
  • the sense oligonucleotide for CX3CL1 NAT of the present invention in the 3′UTR sequence of rat CX3CL1 mRNA shown in SEQ ID NO: 3, is in domain 1, nucleotide numbers 1305-1369 shown as nucleotide numbers 1103-1202.
  • the CX3CL1 ortholog in other mammals contains a nucleotide sequence homologous to a sequence containing at least a part of one or more loop structures in the domain corresponding to each domain in the rat CX3CL1.
  • ACTTGTGCATGTGTGTACTT (CX3CL1-Se1; SEQ ID NO: 13) can enhance the expression of CX3CL1 mRNA as a sense oligonucleotide homologous to domain 1, and CX3CL1 mRNA as a sense oligonucleotide homologous to domain 2
  • Examples include, but are not limited to, ACAAAGTGTCTACTGAAGCA (CX3CL1-Se2; SEQ ID NO: 14) and CTACTGAAGCAGAGAGCAGC (CX3CL1-Se3; SEQ ID NO: 15) that can suppress the expression of CX3CL1 mRNA.
  • the sense oligonucleotide for IL-23A NAT of the present invention in the 3′UTR sequence of rat IL-23A mRNA shown in SEQ ID NO: 4, is the domain 1, nucleotide number shown by nucleotide numbers 37-55 In the domain 2 represented by 193-303, the domain 3 represented by nucleotide numbers 380-448 or the domain 4 represented by nucleotide numbers 555-600, and the IL-23A ortholog in other mammals, the rat IL- A nucleotide sequence homologous to a sequence comprising at least part of one or more loop structures within the domain corresponding to each domain of 23A.
  • a sense oligonucleotide homologous to domain 1 AATCCATCAATGCAGACATC (IL23-Se1; SEQ ID NO: 16) capable of suppressing the expression of IL-23A mRNA
  • IL-23A GAAGCTGGCAGACAGCTGCA IL23-Se2; SEQ ID NO: 17
  • TCCTTCAGTTCTAACAGAAC IL23-Se3; SEQ ID NO: 18
  • the sense oligonucleotide homologous to domain 4 include, but are not limited to, AACAGTTTAGAGGATTGTTA (IL23-Se4; SEQ ID NO: 19) that can suppress the expression of IL-23A mRNA.
  • the sense oligonucleotide for CD69 NAT of the present invention is the domain 1 represented by nucleotide numbers 15-32 and nucleotide numbers 120-186 in the 3′UTR sequence of rat CD69 mRNA represented by SEQ ID NO: 5.
  • domain 2 indicated in domain 3 indicated by nucleotide numbers 218-252, domain 4 indicated by nucleotide numbers 344-370, domain 5 indicated by nucleotide numbers 389-633 or domain 6 indicated by nucleotide numbers 656-786.
  • the CD69 ortholog in other mammals contains a nucleotide sequence homologous to a sequence containing at least a part of one or more loop structures in the domain corresponding to each domain in the rat CD69.
  • GCCAATGCTTATGAAAACA can enhance the expression of CD69 mRNA
  • IL-23A ⁇ mRNA examples include, but are not limited to, GTGGCAGATCTCTGTCAGGA (CD69-Se3; SEQ ID NO: 22) that can enhance expression.
  • the sense oligonucleotide for NF- ⁇ B p65 NAT of the present invention is the domain 1 represented by nucleotide numbers 161-301 in the 3 ′ UTR sequence of rat NF- ⁇ B p65 mRNA represented by SEQ ID NO: 6,
  • domain 2 represented by nucleotide number 343-380
  • domain 3 represented by nucleotide number 401-412 or domain 4 represented by nucleotide number 473-523
  • the NF- ⁇ B p65 ortholog in other mammals A nucleotide sequence homologous to a sequence containing at least a part of one or more loop structures in the domain corresponding to each domain in rat NF- ⁇ B p65.
  • a sense oligonucleotide homologous to domain 1 GAACTCTTGAGACCCTGCTT (p65-Se1; SEQ ID NO: 23) capable of enhancing the expression of NF- ⁇ B ⁇ p65 mRNA
  • NF- GCAACGCTCCTAGGAGCAGC p65-Se3; SEQ ID NO: 25
  • AACTCTCCATGCTGAGCAGT p65-Se4; sequence that can suppress the expression of NF- ⁇ B p65 mRNA as a homologous sense oligonucleotide to domain 4 No. 26
  • the sense oligonucleotide for TNF- ⁇ NAT of the present invention is the domain 1, nucleotide number 430 represented by nucleotide number 304-405 in the 3′UTR sequence of rat TNF- ⁇ mRNA represented by SEQ ID NO: 7.
  • the rat TNF- ⁇ A nucleotide sequence homologous to a sequence comprising at least part of one or more loop structures within the domain corresponding to each domain in For example, AGATGTCTCAGGCCTCCCTT (TNF-Se1; SEQ ID NO: 27) capable of enhancing the expression of TNF- ⁇ mRNA as a sense oligonucleotide homologous to domain 1, and TNF- ⁇ as a sense oligonucleotide homologous to domain 2 GGAACCCCCTATATTTATAA (TNF-Se2; SEQ ID NO: 28) that can enhance the expression of mRNA and TAATTGCACCTGTGACTATT (TNF-Se3; SEQ ID NO: 29) that can suppress the expression of TNF- ⁇ mRNA, as a sense oligon
  • the length of the sense oligonucleotide of the present invention is not particularly limited, but from the viewpoint of sequence specificity, the portion complementary to the target sequence in the target NAT is at least 10 bases or more, preferably about 12 bases or more, more preferably Contains about 15 bases or more.
  • the portion complementary to the target sequence in the target NAT is at least 10 bases or more, preferably about 12 bases or more, more preferably Contains about 15 bases or more.
  • those having a base length of 50 bases or less, preferably 40 bases or less, more preferably 30 bases or less are mentioned.
  • the sense oligonucleotide of the present invention may be any of single-stranded DNA, single-stranded RNA, and DNA / RNA chimera, and may be those with known modifications.
  • the “nucleotide” may include not only purine and pyrimidine bases but also those having other modified heterocyclic bases.
  • the sense oligonucleotide is DNA (ODN)
  • the RNA: DNA hybrid formed by the target NAT and the sense ODN can be recognized by endogenous RNase H and cause selective degradation of the target NAT.
  • the nucleotide molecule constituting the sense oligonucleotide may be natural DNA or RNA, but in order to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA), the above antisense As with nucleotides, various chemical modifications can be included.
  • the sense oligonucleotide of the present invention synthesizes a sequence homologous to the target mRNA (cDNA) sequence using a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.). Can be prepared.
  • the sense oligonucleotide of the present invention is provided in a special form such as a liposome or a microsphere, or a form to which a hydrophobic substance such as a polycationic substance such as polylysine or a lipid (eg, phospholipid, cholesterol, etc.) is added. Can be provided at.
  • the sense oligonucleotide of the present invention is converted into a peptide having a membrane permeation function (for example, Drosophila-derived Antennapedia homeodomain (AntP), human immunodeficiency virus (HIV) -derived TAT, herpes simplex virus (HSV) -derived VP22. And the like can be promoted by incorporating the oligonucleotide into a cell.
  • a membrane permeation function for example, Drosophila-derived Antennapedia homeodomain (AntP), human immunodeficiency virus (HIV) -derived TAT, herpes simplex virus
  • the sense oligonucleotide of the present invention can change the target gene expression (protein production) regulating action by the NAT by interacting with the target NAT. Since various genes including cytokine / chemokine gene induced by IL-1 ⁇ have various physiological activities such as inflammation-inducing or anti-inflammatory action, infection defense, and regulation of immune response, the sense oligonucleotide of the present invention is used.
  • the contained drug can be used as a target gene expression regulator for the prevention and / or treatment of various diseases including inflammatory diseases and infectious diseases.
  • sense oligonucleotides that can enhance the expression of CCL2 can be used for angiogenesis and wound healing, while CCL2 migrates to monocytes and eosinophils, so that it can suppress the expression of CCL2.
  • Nucleotides are useful for the prevention and treatment of chronic inflammatory diseases including arteriosclerosis and allergic inflammation. Since CCL20 exhibits antibacterial activity against a wide range of microorganisms, sense oligonucleotides that can enhance the expression of CCL20 are effective in the prevention and treatment of various microbial infections.
  • sense oligonucleotides that can suppress the expression of CCL20 are bronchial asthma, multiple sclerosis, rheumatoid arthritis, various dermatitis, inflammatory It is effective for the prevention and treatment of autoimmune diseases such as bowel disease.
  • Sense oligonucleotides that can enhance CX3CL1 expression can be used for angiogenesis, while sense oligonucleotides that can suppress CX3CL1 expression prevent or treat inflammatory diseases including arteriosclerosis and glomerulonephritis It is useful for the prevention and treatment of anti-rejection and rheumatoid arthritis.
  • IL-23A is important for the maintenance of cellular immunity, and its overexpression causes multi-organ inflammation. Therefore, sense oligonucleotides that can enhance IL-23A expression are effective in the prevention and treatment of infectious diseases. On the other hand, sense oligonucleotides that can suppress the expression of IL-23A are useful for the prevention and treatment of autoimmune diseases and inflammatory diseases. Since CD69 plays an important role in the differentiation and activation of lymphocytes, a sense oligonucleotide that can enhance the expression of CD69 is effective in the prevention and treatment of infectious diseases.
  • CD69 is expressed in most inflammatory cells that are expressed locally, and autoantibodies against CD69 are detected in patients with rheumatoid arthritis and systemic lupus erythematosus (SLE). Nucleotides are useful for the prevention and treatment of autoimmune diseases and inflammatory diseases. Since NF- ⁇ B is a transcription factor having an important role in the immune system, a sense oligonucleotide that can enhance the expression of NF- ⁇ B p65 is effective in the prevention and treatment of infectious diseases.
  • NF- ⁇ B is constantly activated in cancer cells and inhibits apoptosis, and is also involved in pathogenesis such as bone metabolism, bronchial asthma, arthritis, inflammatory bowel disease, sepsis,
  • a sense oligonucleotide capable of suppressing the expression of NF- ⁇ B p65 is useful for the prevention and treatment of cancer, osteoporosis, autoimmune diseases and inflammatory diseases.
  • TNF- ⁇ shows protection against infection and anti-tumor action by inducing apoptosis and enhancing antibody production by inflammatory mediators and plasma cells. Therefore, sense oligonucleotides that can enhance the expression of TNF- ⁇ prevent infection and cancer. It is effective for treatment.
  • TNF- ⁇ is involved in the pathogenesis of rheumatoid arthritis, psoriasis, diabetes, hyperlipidemia, sepsis, and osteoporosis
  • sense oligonucleotides that can suppress the expression of TNF- ⁇ are used to prevent and treat these diseases. Useful for.
  • the medicament containing the sense oligonucleotide of the present invention has low toxicity and can be used as a liquid or as a pharmaceutical composition of an appropriate dosage form as a human or non-human mammal (eg, mouse, rat, guinea pig, rabbit, sheep, Pigs, cows, cats, dogs, monkeys, etc.) can be administered orally or parenterally (eg, inhalation administration, intravascular administration, subcutaneous administration, transmucosal administration etc.).
  • these nucleic acids are used as a prophylactic / therapeutic agent for the above-mentioned various diseases, they can be formulated and administered in the same manner as the antisense nucleotide of the present invention.
  • the dose of the above-mentioned medicament containing the sense oligonucleotide of the present invention varies depending on the administration subject, target disease, symptom, administration route, etc.
  • the dose of the sense oligonucleotide of the present invention is usually 0.01 to 20 mg. It is convenient to administer about 0.1 kg / kg body weight, preferably about 0.1-10 mg / kg body weight, more preferably about 0.1-5 mg / kg body weight by intravenous injection or inhalation once to several times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
  • the above-described pharmaceutical composition may contain other drugs as long as no undesirable interaction is caused by the combination with the sense oligonucleotide of the present invention.
  • Other drugs include, for example, antiviral drugs, antitumor drugs, antibacterial drugs, antifungal drugs, antiprotozoal drugs, antibiotics, antiseptic drugs, antiseptic shock drugs, endotoxin antagonists, immunomodulators, non-steroidal drugs
  • anti-inflammatory drugs steroid drugs, inflammatory mediator action inhibitors, inflammatory mediator production inhibitors, anti-inflammatory mediator action inhibitors, anti-inflammatory mediator production inhibitors.
  • the present invention also provides a method of screening for a substance that regulates target gene expression (protein production) by regulating the action of NAT on the target mRNA.
  • the screening method of the present invention is characterized by detecting the hybridization between a target mRNA and NAT for the target mRNA in the presence and absence of a test substance and comparing the degree thereof.
  • target mRNA and NAT are isolated by a conventional method, one of them is solid-phased and the other is labeled with an appropriate labeling agent, and the test is performed under conditions where RNA can form a physiological secondary structure.
  • Examples include a method of hybridizing both in the presence and absence of a substance and comparing the amount of label bound to the solid phase under both conditions.
  • mRNA and NAT the full length thereof may be used, respectively, or the 3 ′ UTR of mRNA and a fragment containing a NAT sequence complementary to the region may be used.
  • the solid phase material examples include semiconductors such as silicon, inorganic materials such as glass and diamond, films mainly composed of high molecular substances such as polyethylene terephthalate and polypropylene, and the shape of the solid phase includes a slide glass, Examples include, but are not limited to, microwell plates, microbeads, and fiber types.
  • functional groups such as amino group, aldehyde group, SH group, and biotin are introduced into the RNA in advance, while reacting with the RNA on the solid phase.
  • Functional groups eg, aldehyde group, amino group, SH group, streptavidin, etc.
  • the solid phase and RNA are cross-linked by covalent bond between the two functional groups, or the polyanionic RNA is immobilized.
  • the method include, but are not limited to, a method of immobilizing RNA using polycation coating of a phase and electrostatic bonding.
  • the solid-phase RNA preparation methods include the Affymetrix method, which synthesizes RNA one nucleotide at a time on a substrate (glass, silicon, etc.) using a photolithography method, the micro spotting method, the inkjet method, and the bubble jet (registered trademark) method
  • the Stanford method in which RNA prepared in advance is spotted on the substrate using the above method, but considering the base length of the RNA to be used, it is preferable to use the Stanford method or a method combining both.
  • a radioisotope for example, an enzyme, a fluorescent substance, a luminescent substance, or the like is used.
  • the radioisotope for example, [ 32 P], [ 3 H], [ 14 C] and the like are used.
  • the enzyme a stable enzyme having a large specific activity is preferable.
  • ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used.
  • the fluorescent material for example, fluorescamine, fluorescein isothiocyanate, Cy3, Cy5 and the like are used.
  • luminescent substance for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
  • biotin- (strept) avidin can also be used for binding between the probe and the labeling agent.
  • the test substance may be any known substance or new substance, such as a nucleic acid, carbohydrate, lipid, protein, peptide, organic low molecular weight compound, compound library prepared using combinatorial chemistry techniques, solid phase Examples include random peptide libraries prepared by synthesis or phage display methods, or natural components derived from microorganisms, animals and plants, marine organisms, and the like.
  • concentration of the test substance to be added varies depending on the type of compound (solubility, toxicity, etc.), but is appropriately selected within the range of, for example, about 0.1 nM to about 100 nM. Examples of the incubation time include about 1 to about 24 hours.
  • the test substance After bringing the RNA on the solid phase into contact with the labeled RNA (and the test substance) and incubating, the RNA that did not bind to the solid phase is washed away, and the amount of RNA bound to the solid phase is detected.
  • the test substance can be selected as a candidate for a substance that enhances the action of NAT on the target mRNA.
  • the test substance can be selected as a candidate for a substance that suppresses the action of NAT on the target mRNA. it can.
  • a target substance is contacted more directly by contacting a test substance with a cell that expresses the target mRNA and NAT, and measuring a change in the amount of the mRNA and / or protein encoded in the cell.
  • Substances that enhance or suppress gene expression can be selected.
  • the cell that expresses the target mRNA and NAT may be a cell that can naturally express both RNAs (for example, IL-1 ⁇ -stimulated hepatocytes), or a DNA that expresses either or both of them.
  • the introduced recombinant cell may also be used.
  • examples of host cells include animal cells such as H4IIE-C3 cells, HepG2 cells, 293T cells, HEK293 cells, COS7 cells, 2B4T cells, CHO cells, MCF-7 cells, and H295R cells.
  • the target mRNA and DNA encoding NAT are both isolated by conventional methods, converted into double-stranded DNA by reverse transcription, etc., and then inserted into an expression vector having a promoter that can function in the host cell.
  • it can be prepared by introducing this vector into a host cell by the calcium phosphate coprecipitation method, PEG method, electroporation method, microinjection method, lipofection method or the like.
  • test substance those described above are used.
  • a medium suitable for culturing the cell for example, a minimum essential medium (MEM) containing about 5 to 20% fetal calf serum, Dulbecco's modified Eagle medium (DMEM), RPMI1640 Medium, 199 medium, F12 medium, etc.
  • various buffers eg, HEPES buffer, phosphate buffer, phosphate buffered saline, Tris-HCl buffer, borate buffer, acetate buffer, etc.
  • HEPES buffer phosphate buffer, phosphate buffered saline, Tris-HCl buffer, borate buffer, acetate buffer, etc.
  • the concentration of the test substance to be added varies depending on the type of compound (solubility, toxicity, etc.), but is appropriately selected within the range of, for example, about 0.1 nM to about 100 nM.
  • Examples of the incubation time include about 1 to about 48 hours. If necessary, the cells may be infected with the virus during the incubation.
  • RNA is extracted from the cells and the target mRNA level is measured by RT-PCR, real-time PCR or Northern blot analysis, or the culture supernatant is collected and various immunoassays known per se Or the amount of protein encoded by the target gene is measured by Western blotting or the like.
  • the test substance can be selected as a candidate for a target gene expression enhancing substance.
  • the test substance can be selected as a candidate for a target gene expression inhibitor.
  • Substances capable of enhancing or suppressing the expression of the target gene selected by the screening method described above are used for the prevention and / or prevention of the above-mentioned various diseases in the same manner as antisense nucleotides and sense oligonucleotides that can enhance or suppress the expression of the gene. Alternatively, it can be used as a therapeutic drug.
  • a medicine containing a substance selected by the above screening method has low toxicity, and can be used as a liquid or as a pharmaceutical composition of an appropriate dosage form as a human or non-human mammal (eg, mouse, rat, guinea pig, rabbit). , Sheep, pigs, cows, cats, dogs, monkeys, etc.) or orally (eg, inhalation administration, intravascular administration, subcutaneous administration, etc.).
  • the pharmaceutical composition used for administration may comprise a selected substance and a pharmacologically acceptable carrier, diluent or excipient.
  • compositions for parenteral administration for example, injections, aerosols, suppositories and the like are used, and injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, intravenous injections, etc. May be included.
  • Such an injection can be prepared according to a known method.
  • a method for preparing an injection it can be prepared, for example, by dissolving, suspending or emulsifying a substance for enhancing or suppressing the expression of a selected target gene in a sterile aqueous liquid or oily liquid that is usually used for injection.
  • an aqueous solution for injection for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)) and the like may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solub
  • the prepared injection solution is preferably filled in a suitable ampoule.
  • Aerosol formulations can be placed in compressed acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like. Alternatively, it may be formulated as a non-compressible pharmaceutical product such as a nebulizer or an atomizer.
  • a suppository used for rectal administration may be prepared by mixing a substance for enhancing or suppressing the expression of the target gene with a normal suppository base.
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), and syrups. Agents, emulsions, suspensions and the like.
  • Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field.
  • a carrier and excipient for tablets for example, lactose, starch, sucrose, and magnesium stearate are used.
  • the above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dosage of the active ingredient.
  • dosage forms include tablets, pills, capsules, injections (ampoules), aerosols, and suppositories.
  • the substance for enhancing or suppressing the expression of the target gene is usually contained in an amount of 5 to 500 mg per dosage unit dosage form, particularly 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.
  • the dose of the above-mentioned pharmaceutical containing a substance that enhances or suppresses the expression of the target gene varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, the substance is usually 0.01 to 20 mg per dose It is convenient to administer about 0.1 kg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight by intravenous injection once to several times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
  • Hepatocytes were isolated from male Wistar rats (SPF / VAF Crlj: WI; Charles River Japan) as described in Prostaglandins 1993; 45: 459-474 and seeded at 37 ° C. Incubated overnight. Hepatocytes (3.0 ⁇ 10 5 cells / dish) were transfected with sense ODN. Each ODN (1.5 ⁇ g) was mixed with 1.5 ⁇ L of magnet-assisted transfection A reagent (IBA), added to each well, incubated on the magnetic plate for 15 minutes, and then the medium was treated with fresh William's E medium (Sigma-Aldrich). ).
  • IBA magnet-assisted transfection A reagent
  • the cells were cultured overnight and treated with 1 nM human IL-1 ⁇ (Otsuka Pharmaceutical Co., Ltd.) for 4 hours (RNA preparation) or 8 hours (cell extraction). Animal experiments were conducted with the approval of the Animal Experiment Committee of Ritsumeikan University Biwako Kusatsu Campus.
  • the secondary structure of 3'UTR of mRNA was predicted by the mfold program (Zuker). A common conserved region was selected from the predicted structure of the 3'UTR of mRNA. Each region contained at least one stem-loop structure.
  • Sense ODN Sense ODN protected with a phosphothioate bond was designed according to the method described in J. Neurochem. 2003; 86: 374-382 (Gene Design).
  • the designed sense ODN sequence corresponds to an mRNA sequence containing at least one loop of a common region conserved between human and rat, and CpG motifs and G-quartets were avoided.
  • Tables 2 and 3 summarize the PCR primers, NAT reverse transcription primers and PCR primers used for mRNA amplification for the seven genes CCL2, CCL20, CX3CL1, IL-23A, CD69, NF- ⁇ B p65 and TNF- ⁇ . It was.
  • the present inventors selected 7 genes (CCL2, CCL20, CX3CL1, IL-23A, CD69, NF- ⁇ B p65 and TNF- ⁇ ) in which both mRNA and NAT are abundantly transcribed, and applied NATRE technology. .
  • the present inventors predicted the secondary structure of the 3′UTR of these mRNAs (FIGS. 1A-7A), and each sense ODN competes with the mRNA that leads to inhibition of the mRNA-NAT interaction.
  • Sense ODNs were designed according to the rule of containing at least one loop of the storage region (FIGS. 1B-7B) (Table 5 and FIGS. 1B-7B).
  • Elongation factor 1alpha (EF) mRNA was used as an internal standard, and the values in the graph indicate each mRNA / EF mRNA (%), and were expressed as a relative amount with respect to the expression level in non-sense ODN-introduced cells.
  • Sense ODNs designed for RNA sequences that contain loop portions within conserved regions of predicted secondary structure have altered (increased or decreased) the expression level of the target mRNA, whereas Sense ODNs (TNF-Se4 and TNF-Se6) designed outside the conserved region of secondary structure did not affect the expression level of the target mRNA.
  • the antisense nucleotide and sense oligonucleotide of the present invention are used as a regulator of the expression of an inflammation / infection-related gene in which an endogenous antisense transcript is present, which is induced by IL-1 ⁇ . Useful for treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pain & Pain Management (AREA)
  • Plant Pathology (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)
  • Endocrinology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention porte sur de nouveaux moyens permettant de moduler l'expression de gènes des cytokines-chimiokines associés à l'inflammation et à l'infection. En particulier, l'invention concerne : un nucléotide antisens qui comprend la séquence complémentaire à la région 3' non traduite (3'UTR) du gène de CCL2, CCL20, CX3CL1, IL-23A, CD69, NF-κB p65, TNF-α, Fam89a, Grk5, de la phospholipide scramblase 1, de Runx1, de la sémaphorine 4A, de Steap4, de la lymphotoxine β Psmb10 ou de TLR2 induit par IL-1β et qui est capable de moduler l'expression du gène ; un oligonucléotide sens qui contient la séquence complémentaire au produit de la transcription antisens endogène contenant la séquence complémentaire à la région 3'UTR du gène et qui est capable de moduler l'expression du gène ; et un agent qui permet de prévenir et/ou traiter la maladie inflammatoire ou l'infection et qui contient le nucléotide sens ou antisens.
PCT/JP2012/062230 2011-05-12 2012-05-11 Modulateur des cytokines-chimiokines WO2012153854A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2011107707 2011-05-12
JP2011-107707 2011-05-12

Publications (1)

Publication Number Publication Date
WO2012153854A1 true WO2012153854A1 (fr) 2012-11-15

Family

ID=47139327

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2012/062230 WO2012153854A1 (fr) 2011-05-12 2012-05-11 Modulateur des cytokines-chimiokines

Country Status (1)

Country Link
WO (1) WO2012153854A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015026249A1 (fr) 2013-08-23 2015-02-26 Instytut Biochemii I Biofizyki Pan Utilisation d'une molécule mir172 pour diminuer l'inflammation

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007142303A1 (fr) * 2006-06-08 2007-12-13 Amino Up Chemical Co., Ltd. Procédé pour réguler la quantité de produit génique, et agent destiné à réguler la quantité de produit génique
WO2007142304A1 (fr) * 2006-06-08 2007-12-13 Amino Up Chemical Co., Ltd. OLIGONUCLÉOTIDE SENS CAPABLE DE RÉGULER L'EXPRESSION DE L'iNOS ET COMPOSITION LE CONTENANT
JP2010104280A (ja) * 2008-10-29 2010-05-13 Ritsumeikan インターフェロン−α発現調節剤
JP2011504110A (ja) * 2007-11-23 2011-02-03 パナジェン インコーポレイテッド マイクロｒｎａアンチセンスｐｎａ、これを含む組成物、及びその使用及び評価方法

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007142303A1 (fr) * 2006-06-08 2007-12-13 Amino Up Chemical Co., Ltd. Procédé pour réguler la quantité de produit génique, et agent destiné à réguler la quantité de produit génique
WO2007142304A1 (fr) * 2006-06-08 2007-12-13 Amino Up Chemical Co., Ltd. OLIGONUCLÉOTIDE SENS CAPABLE DE RÉGULER L'EXPRESSION DE L'iNOS ET COMPOSITION LE CONTENANT
JP2011504110A (ja) * 2007-11-23 2011-02-03 パナジェン インコーポレイテッド マイクロｒｎａアンチセンスｐｎａ、これを含む組成物、及びその使用及び評価方法
JP2010104280A (ja) * 2008-10-29 2010-05-13 Ritsumeikan インターフェロン−α発現調節剤

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
BEVILACQUA, ANNAMARIA ET AL.: "Stabilization of cellular mRNAs and up-regulation of proteins by oligoribonucleotides homologous to the Bc12 adenine-uridine rich element motif.", MOL. PHARMACOL., vol. 71, no. 2, 2007, pages 531 - 538 *
DATABASE DATABASE 10 April 2011 (2011-04-10), retrieved from http://www.ncbi.nlm.nih.gov/ nuccore/13928713?sat=14&satkey=6568607 accession no. M_031530 *
EMI YOSHIKAI ET AL.: "Sense Oligo o Mochiita NATRE Technology ni yoru Messenger RNA Ryo no Chosetsu", ANTISENSE SYMPOSIUM KOEN YOSHISHU, 2010, pages 36 *
GHISOLFI, LAURA ET AL.: "Increased Bcl2 expression by antisense oligoribonucleotides targeting the adenine-uridine-rich element motif.", MOL. PHARMACOL., vol. 68, no. 3, 2005, pages 816 - 821 *
LACHANCE, CLAUDE ET AL.: "Posttranscriptional gene expression regulation in CpG-activated macrophages depends on FXR1P RNA-binding protein.", FEMS IMMUNOL. MED. MICROBIOL., vol. 51, no. 2, 2007, pages 422 - 430 *
LAL, ASHISH ET AL.: "p16(INK4a) translation suppressed by miR-24.", PLOS ONE, vol. 3, no. ISS. 3, 2008, pages E1864 *
MATSUI, KOSUKE ET AL.: "Natural antisense transcript stabilizes inducible nitric oxide synthase messenger RNA in rat hepatocytes.", HEPATOLOGY, vol. 47, no. 2, 2008, pages 686 - 697 *
MEI, MEI ET AL.: "Suppression of breast cancer cells in vitro by polyamidoamine-dendrimer-mediated 5-fluorouracil chemotherapy combined with antisense micro-RNA 21 gene therapy.", JOURNAL OF APPLIED POLYMER SCIENCE, vol. 114, 2009, pages 3760 - 3766 *
NAKAMACHI, YUJI ET AL.: "MicroRNA-124a is a key regulator of proliferation and monocyte chemoattractant protein 1 secretion in fibroblast-like synoviocytes from patients with rheumatoid arthritis.", ARTHRITIS RHEUM., vol. 60, no. 5, 2009, pages 1294 - 1304 *
SAUER, INES ET AL.: "Interferons limit inflammatory responses by induction of tristetraprolin.", BLOOD, vol. 107, no. 12, 2006, pages 4790 - 4797 *
ZHANG, YONG ET AL.: "Genome-wide in silico identification and analysis of cis natural antisense transcripts (cis-NATs) in ten species.", NUCLEIC ACIDS RES., vol. 34, no. 12, 2006, pages 3465 - 3475 *
ZHANG, YONG ET AL.: "NATsDB: Natural Antisense Transcripts DataBase.", NUCLEIC ACIDS RES., vol. 35, 2007, pages D156 - D161 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015026249A1 (fr) 2013-08-23 2015-02-26 Instytut Biochemii I Biofizyki Pan Utilisation d'une molécule mir172 pour diminuer l'inflammation

Similar Documents

Publication Publication Date Title
Yin et al. MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways
EP3760234B1 (fr) Interférence arn pour le traitement de troubles à gain de fonction
Jung et al. c‐Myc‐mediated overexpression of miR‐17‐92 suppresses replication of hepatitis B virus in human hepatoma cells
EP2203559B1 (fr) Traitement combiné de l'infection par le virus de l'hépatite c
EP2458005A1 (fr) Substance se liant à l'élément cis de fgf21
US8492357B2 (en) Micro-RNA mediated modulation of colony stimulating factors
WO2019196887A1 (fr) Nouveau petit arn activateur
US20230138103A1 (en) Gene silencing agents for targeting coronavirus genes and uses thereof
WO2012153854A1 (fr) Modulateur des cytokines-chimiokines
JP2010104280A (ja) インターフェロン−α発現調節剤
US8338185B2 (en) Methods of determining potency of chemically-synthesized oligonucleotides
JP5794532B2 (ja) インターフェロン−αモジュレーター
JP2014236717A (ja) 内在性ｃｏｘ−２アンチセンスｒｎａ阻害薬、その用途及びそのスクリーニング方法
US10378015B2 (en) Targeting hepatitis B virus (HBV) host factors
JP5249998B2 (ja) オステオポンチンｓｉＲＮＡ
US20130158101A1 (en) Regulators of nfat and/or store-operated calcium entry
US8048864B1 (en) Regulators of NFAT and/or store-operated calcium entry
WO2024048528A1 (fr) Agent prophylactique et/ou agent thérapeutique pour maladies cardiaques et laminopathie
JP2005323591A (ja) オステオポンチンｓｉＲＮＡ
WO2012020839A1 (fr) Composition pharmaceutique destinée à la thérapie du cancer
KR100992239B1 (ko) Ｍｉｇ１２ 유전자의 신규한 용도
WO2011115271A1 (fr) Inhibiteur d'angiogenèse de tumeur
JP2022062731A (ja) Ｅｐｓｔｅｉｎ－Ｂａｒｒウイルス関連癌に特異的な抗腫瘍剤
JP2010213585A (ja) 骨芽細胞分化マーカー、骨形成促進剤及び骨形成抑制剤
WO2007100091A1 (fr) Composition permettant de supprimer l'expression de la fucosyltransferase

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12782249

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12782249

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP