WO2012141504A2 - Brg-1 유래의 브로모도메인 및 이의 용도 - Google Patents

Brg-1 유래의 브로모도메인 및 이의 용도 Download PDF

Info

Publication number
WO2012141504A2
WO2012141504A2 PCT/KR2012/002773 KR2012002773W WO2012141504A2 WO 2012141504 A2 WO2012141504 A2 WO 2012141504A2 KR 2012002773 W KR2012002773 W KR 2012002773W WO 2012141504 A2 WO2012141504 A2 WO 2012141504A2
Authority
WO
WIPO (PCT)
Prior art keywords
radiation
bromodomain
brg
recombinant protein
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2012/002773
Other languages
English (en)
French (fr)
Other versions
WO2012141504A3 (ko
Inventor
권종범
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ewha Womans University
Original Assignee
Ewha Womans University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020110033502A external-priority patent/KR20120115913A/ko
Priority claimed from KR1020110081688A external-priority patent/KR101308288B1/ko
Application filed by Ewha Womans University filed Critical Ewha Womans University
Publication of WO2012141504A2 publication Critical patent/WO2012141504A2/ko
Publication of WO2012141504A3 publication Critical patent/WO2012141504A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a bromodomain derived from -1 and its use. More specifically, the present invention relates to a recombinant protein comprising two or more bromodomains derived from BRG-1, a polynucleotide encoding the recombinant protein, and the poly A radiosensitizing composition for cancer cell radiotherapy, comprising an expression vector comprising a nucleotide, a bromodomain derived from BRG-1, a recombinant protein comprising two or more of the above domains or fragments thereof having binding activity to acetylated histones, bro Radiation sensitizing composition for cancer cell radiation comprising a domain, a polynucleotide encoding a fragment thereof having a binding activity to a acetylated histone or a recombinant protein comprising at least two domains or a vector comprising the polynucleotide as an active ingredient And bromodomains, containing two or more such domains
  • Radiation therapy is currently known as an essential treatment method for various types of cancers, but it has been pointed out that obtaining radiation resistance of cancer cells and damaging normal tissues in high dose radiation treatments lowers the efficiency of radiation therapy. Therefore, research on radiation therapy sensitizers to improve the efficiency of radiation therapy has been attempted.
  • Radiation therapy is one of the most important and powerful therapies for many types of cancers, especially for local cancers that do not cause metastasis.
  • radiation therapy only a few of the tumors to be treated by radiation therapy, such as lymphomas and normal epithelial tumors, are responsive to radiation therapy.
  • IR neoplastic responsiveness to ionizing radiation
  • Radiation therapy in brain tumor treatment is a method of removing abnormal cells by delaying the cell cycle (DNA damage checkpoint) or induction of apoptosis in response to DNA damage caused by radiation.
  • DNA damage checkpoint the cell cycle
  • the problem of radiation therapy is that the radiation-resistant cancer cells cause cancer recurrence due to the inherent radiation resistance of cancer cells and the increased resistance to radiation therapy, and the radiation-resistant cells are also resistant to anticancer drugs.
  • histones are basic proteins that are commonly present in the nucleus of eukaryotic cells, ranging from multicellular organisms including humans to unicellular organisms represented by fungi (fungus, yeast), and ionically bind to genomic DNA.
  • Histones usually consist of five components (H1, H2A, H2B, H3 and H4) and are highly similar across species.
  • the germinating yeast histone H4 102 amino acids in full length
  • the human histone H4 102 amino acids in full length
  • histones are the most highly conserved proteins among eukaryotes. Genomic DNA is superimposed by regular binding to this histone, and the complex of both forms a basic structural unit called a nucleosome. The nucleosomes aggregate to form a chromatin structure of the chromosome. Histone is subjected to modifications such as acetylation, methylation, phosphorylation, ubiquitination, and SUMOization at the N-terminal part called histonetail, and the gene expression and DNA replication by maintaining or specifically restructuring the chromatin structure. And reactions on chromosomal DNA such as DNA repair are regulated.
  • HATs histone acetyltransferases
  • HDACs histone deacetylases
  • bromodomain is known as a domain structure of a protein that binds to histone acetylated lysine.
  • BRG1, BRD2, BRD3, etc. are known as proteins which interact with acetylated histones.
  • BRG1 is known as a key constituent protein of the SWI / SNF complex, a chromatin remodeling factor.
  • the mammalian SWI / SNF complex consists of 8 to 12 proteins and has a BRG-1 or hBrm as a core subunit having ATPase activity.
  • SWI / SNF acts as a tumor suppressor, and its mechanism of action is that SWI / SNF interacts with HDAC to mediate G1 / S arrest by Rb. It is known. Recent research suggests the potential for new molecular mechanisms for cancer suppression of SWI / SNF through the fact that SWI / SNF plays a role in promoting the phosphorylation and function of the cancer suppressor H2AX, which plays an important role in maintaining genome stability. This has been presented.
  • bromodomain of BRG-1 (BRG-1) or a recombinant protein comprising two or more bromodomains increases radiation sensitivity in radiation-resistant cancer cells as well as radiation-sensitive cancer cells. It was confirmed that the cell death can be enhanced to complete the present invention.
  • One object of the present invention is to provide a recombinant protein comprising two or more bromodomains derived from BRG-1.
  • Another object of the present invention is to provide a polynucleotide encoding the recombinant protein.
  • Another object of the present invention is to provide a vector having the polynucleotide.
  • Still another object of the present invention comprises a bromodomain derived from BRG-1, a recombinant protein comprising two or more bromodomains or a fragment thereof having a binding activity to an acetylated histone as an active ingredient, radiation for cancer cell radiotherapy It is to provide a sensitizer composition.
  • Another object of the present invention comprises a polynucleotide encoding a bromodomain, a recombinant protein comprising two or more of the domains, or a fragment thereof having a binding activity to an acetylated histone, or a vector comprising the polynucleotide as an active ingredient. It is to provide a radiation sensitive composition for cancer cell radiation treatment.
  • Another object of the present invention includes a bromodomain, a recombinant protein comprising two or more of the domains, or a fragment thereof having a binding activity to an acetylated histone, and as a control in a method of confirming whether the desired agent is a radiation sensitive agent It is to provide a cancer cell that can be used.
  • BRG-1-derived bromodomains of the present invention may exhibit radiation sensitivity in radiation-resistant cancer cells as well as radiation-sensitive cancer cells. As it can increase apoptosis, it can be widely used for more effective chemotherapy.
  • Figure 1 is a schematic diagram showing the manufacturing process of the BRG-1 bromodomain expression vector.
  • Figure 2 is a diagram showing the configuration of the BRG-1 bromodomain multimeric expression vector.
  • Figure 3 shows the results of confirming the survival rate of the BRG-1 bromodomain and its multimer-expressing normal cell 293T transformant according to gamma irradiation, after irradiation with a total dose of 0 to 5 Gy, Survival (A), expression of BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B), and IC50 values (C) are shown and confirmed.
  • Figure 4 shows the results of confirming the survival rate of gamma-ray irradiation of colon cancer cells HT-29 transformant expressing BRG-1 bromodomain and dimer thereof, cancer cells after irradiation with a total dose of 0 to 10 Gy Survival rate (A), expression of BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B), and IC50 value (C).
  • Figure 5 shows the results of confirming the survival rate according to gamma irradiation of the HRG-116 transformant colon cancer cells expressing BRG-1 bromodomain and dimer thereof, the cancer cells after irradiation with a total dose of 0 to 5 Gy Survival rate (A), expression of BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B), and IC50 value (C).
  • Figure 6 shows the results of confirming the survival rate according to gamma irradiation of ARG transformant lung cancer cells expressing BRG-1 bromodomain and its dimers, after irradiation with a total dose of 0 to 10 Gy, survival rate of cancer cells (A), BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B), and IC50 value (C) are shown and confirmed.
  • Figure 7 shows the results of confirming the survival rate according to gamma irradiation of the BRG-1 bromodomain and breast cancer cell MDA-MB-231 transformant expressing a dimer thereof, after irradiation with a total dose of 0 to 10 Gy , Cancer cell viability (A), expression of BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B), and IC50 value (C).
  • Figure 8 shows the results of confirming the survival rate according to the gamma irradiation of BRG-1 bromodomain and breast cancer cell SK-BR3 transformant expressing a dimer thereof, the cancer cells after irradiation with a total dose of 0 to 5 Gy Survival rate (A), expression of BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B), and IC50 value (C).
  • Figure 9 shows the results of confirming the survival rate according to gamma irradiation of colon cancer cell HCT-116 transformant expressing the BRG-1 bromodomain dimer and tetramer, respectively, after irradiation with a total dose of 0 to 5 Gy , Cancer cell survival rate (A), BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B) is confirmed and shown.
  • Figure 10 shows the results of confirming the survival rate according to gamma irradiation of ARG transformant lung cancer cells expressing BRG-1 bromodomain dimer and tetramer, respectively, after irradiation with radiation of a total dose of 0 to 10 Gy, Survival rate (A), BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B) is confirmed and shown.
  • Figure 11 shows the results of confirming the survival rate according to gamma irradiation of lung cancer cells NCI-H446 transformant expressing BRG-1 bromodomain dimer and tetramer, respectively, after irradiation with a total dose of 0 to 5 Gy , Cancer cell survival rate (A), BRG-1 bromodomain and BRG-1 bromodomain multimeric recombinant protein (B) is confirmed and shown.
  • BRG-1 protein is a protein that interacts with acetylated histones among about 30 kinds of bromodomain-containing proteins known in humans, and is a key sub having the ATPase activity of the SWI / SNF complex, a chromatin remodeling factor. Means a protein known as a core subunit.
  • bromodomain refers to some polypeptide sites of a protein having the activity of binding to an acetylated histone as a constituent of the protein and a nucleotide sequence encoding it.
  • the bromodomain includes a polypeptide or a polynucleotide fragment encoding a site having an activity that binds to acetylated K14 of histone protein H3 derived from BRG-1 protein.
  • double strand damage of DNA is caused by external environmental factors such as radiation and, if not properly repaired, can lead to chromosomal substitution, gene loss and genomic instability, which can lead to cancer.
  • high doses of radiation treatment result in damage to normal tissue.
  • SWI / SNF is known to act as a cancer suppressor
  • BRG-1 is known as a key constituent protein of the SWI / SNF complex.
  • the present invention enhances cell death by increasing radiation sensitivity in not only radiation-sensitive cancer cells but also radiation-resistant cancer cells.
  • radiation sensitivity can be more effectively increased when artificially reconstituted and expressed BRG-1 bromodomain dimer and tetrameric recombinant protein (Example 4).
  • colon cancer cell HCT116 S, hereinafter S means radiation-sensitive cancer cells
  • lung cancer cell A549 R, hereinafter R means radiation-resistant cancer cells
  • hepatic cancer cell HepG2 R with recombinant vector pCMV-BRG1-BRD.
  • Hepat3B (R) cells were transformed to confirm that BRG-1 bromodomain was expressed. When these cancer cells expressed BRG-1 bromodomain polypeptide, the cancer cells were significantly sensitive to gamma radiation. It was confirmed that it can increase the cell death by increasing.
  • BRG-1 bromodomain multimeric recombinant protein transforms HEK 293T cells, which are normal cell lines, into BRG.
  • the expression of -1 bromodomain multimeric recombinant protein was confirmed, and the expression of these multimeric recombinant protein significantly increased the sensitivity to gamma radiation compared to the expression of BRG-1 bromodomain monomer, resulting in apoptosis. It was confirmed that it can be enhanced.
  • radiation sensitivity or radiation resistance are classified by the slope value of the linear model created using the cell survival rate when irradiated with gamma radiation of 0 to 2 Gy. This classification method has been reported by Jerry R. Williams et al. (Acta Oncologica, 46, 628-638, 2007).
  • radiation sensitivity refers to a cell having a feature in which the slope value is in the range of 0.00 to 0.30
  • radiation resistance refers to a cell having a feature in the range of 0.31 to 1.00.
  • Radiation sensitive cells are known for HEK 293T, SW1222, HCT116, LoVo, CBS, LS174T, 379.2, 80S4, 14-3-3 + / +, 40-16, 14-3-3-/-, N6CH3 and are radiation resistant
  • the cells are known as DLD-1, HT29, WiDR, SW480, SW116, 19S186, Caco2, Caco2-neoras, U251, U87, T98G.
  • Colon cancer cells HCT116 (S), lung cancer cells A549 (R), liver cancer cells HepG2 (R) and liver cancer cells Hep3B (R) are all cancer cells expressing BRG-1. Therefore, in the present invention, the cancer cells to be treated with radiation preferably express BRG-1.
  • BRG-1 binds to acetylated histones, particularly the acetylated K14 of H3 via bromodomains, thereby increasing the gamma radiation sensitivity of cancer cells and enhancing cell death.
  • fragments of bromodomains derived from BRG-1 have a binding activity to acetylated histones, and preferably have a binding activity to acetylated K14 of H3.
  • the cancer cells are preferably colon cancer, lung cancer, liver cancer cells, but are not limited thereto, and cancer cells to which bromodomain-containing proteins are expressed may be applicable.
  • the radiation sensitizer of the present invention may increase sensitivity in chemotherapy as well as radiation therapy of cancer cells
  • the radiation sensitizer of the present invention may also be used for the use of the sensitizer to increase the sensitivity in chemotherapy. Belongs to the category of.
  • Recombinant protein comprising two or more bromodomains derived from BRG-1
  • non-limiting examples of BRG-1 derived bromodomains include not only polypeptides isolated from native BRG-1 protein, but also cells synthesized or transformed with polynucleotides encoding BRG-1 derived brodomains. And the fragments thereof.
  • An example of a bromodomain from BRG-1 may have a polypeptide sequence of SEQ ID NO: 1.
  • the fragment of BRG-1-derived bromodomain has binding activity to the acetylated histone, its length and site are not limited.
  • bromodomain derived from BRG-1 in the present invention includes conservative variants and derivatives thereof having binding activity to acetylated histones.
  • Bromodomains derived from BRG-1 are amino acid sequences having at least 70% similarity to the sequences described in SEQ ID NO: 1 as well as the sequences, preferably at least 80% similarity, more preferably at least 90% similarity And even more preferably an amino acid sequence that exhibits at least 95% similarity, most preferably at least 98% similarity, and has a polypeptide that substantially binds to an acetylated histone.
  • sequence having such similarity is an amino acid sequence having a biological activity substantially the same as or corresponding to that of a bromodomain derived from BRG-1
  • protein variants having amino acid sequences in which some sequences are deleted, modified, substituted, or added are also present. It is obvious that it is included within the scope of the invention.
  • a recombinant protein comprising two or more bromodomains derived from BRG-1 constitutes a fusion protein with a polypeptide other than a natural enzymatic activity site of BRG-1, such as an ATPase active site, or further N-terminus, C- Terminal or intermediate amino acid sequences such as linkers or tags.
  • bromodomain derived from BRG-1 is used mixed with a polypeptide.
  • Protein variants and derivatives are well known to those skilled in the art and may include amino acid sequence modifications.
  • modifications of amino acid sequences typically include one or more of three classes, namely, substitution, insertion or deletion variants.
  • Insertions include amino and / or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertion will usually be an insertion of, for example, one to four residues smaller than the insertion portion of an amino or carboxyl terminal fusion.
  • Bromodomains derived from BRG-1 may delete N-terminal, C-terminal or intermediate amino acids that are not involved in the intrinsic activity of the polypeptide.
  • Amino acid substitutions typically consist of one residue, but can occur at many different gene sites at once, and insertion will usually occur at a size of about 1 to about 10 amino acid residues. Deletion or insertion is preferably in adjacent pairs, ie two residues are deleted or two residues are inserted. Substitutions, deletions, insertions or any combination thereof may be combined to form the final construct. Mutations should not occur in sequences outside the reading frame, and preferably do not create complementary regions that can produce secondary mRNA structures unless a change in the secondary structure of the mRNA is desired.
  • substitution of one amino acid residue with another biologically and / or chemically similar is known to those skilled in the art as conservative substitutions.
  • conservative substitutions are those in which one hydrophobic moiety is replaced with another hydrophobic moiety or a polar moiety is replaced with another polar moiety.
  • One example of integrity substitution is shown in Table 1 below.
  • substitutions include combinations shown in Table 1 above.
  • Peptides include one or more amino acid substitutions, for example 2 to 10 conservative substitutions, 2 to 5 conservative substitutions, 4 to 9 conservative substitutions, such as 2, 5 or 10 conservative substitutions.
  • a "recombinant protein” is a fusion protein produced by linking two or more genes that encode a bromodomain. Translation of the fusion gene results in a single polypeptide having functional properties derived from each original bromodomain. Bromodomains in recombinant proteins can be linked immediately adjacent or linked through linkers. Recombinant proteins can be artificially produced by recombinant DNA technology for use in biological research or therapy. The functionality of recombinant proteins exerts a modular approach to the functional domains of many proteins.
  • a "linker” can be an amino acid sequence or insertion that can be used to link or separate two distinct polypeptides or polypeptide fragments.
  • Polypeptides provided herein can have an amino acid linker comprising, for example, amino acids GLS, ALS or LLA.
  • a “tag” can be a distinct amino acid sequence that can be used to detect or purify a provided polypeptide.
  • Recombinant proteins comprising two or more bromodomains derived from BRG-1 may be linked to internalization sequences or protein transduction domains to effectively enter the cell.
  • Liarginine is known as a potent cell penetrating peptide. Derivatives of polyarginine delivered full-length p53 protein to oral cancer cells, inhibiting their growth and metastasis.
  • recombinant proteins comprising two or more bromodomains derived from BRG-1 may comprise cell internalization transporters or sequences.
  • the cell internalization sequence may be any internalization sequence known or newly discovered in the art, or a conservative variant thereof.
  • intracellular transporters and sequences include polyarginine (such as R9), antennapedia sequences, TAT, HIVTat, penetratin, Antp-3A (Antp mutant), Buforin II, transpotane, MAP (model amphipathic peptide), K-FGF, Ku70, prion, pVEC, Pep-1, SynB1, Pep-7, HN-1, BGSC (bis-guanidinium-spermidine-cholesterol) and BGTC (bis Guanidinium-tren-cholesterol).
  • bromodomains derived from BRG-1 or recombinant proteins comprising two or more thereof further include BGSC (bis-guanidinium-spermidine-cholesterol) or BGTC (bis-guanidinium-tren-cholesterol) can do.
  • BGSC bis-guanidinium-spermidine-cholesterol
  • BGTC bis-guanidinium-tren-cholesterol
  • Bromodomains derived from BRG-1, recombinant proteins comprising more than one bromodomain or fragments thereof having binding activity to acetylated histones may further comprise tumor specific targeting sequences, but are not particularly limited thereto. Do not.
  • the radiation sensitive agent detects only tumor cells and preferably is not introduced into normal cells.
  • One approach to this is to utilize polypeptides (such as modified or fused proteins) that have both internalization and tumor specific targeting capabilities.
  • Tumor vasculature is different from that of surrounding normal tissue. Biochemically, tumor vessels distinguish themselves from the rest of the vessels by expressing many angiogenesis-related molecules such as specific integrins, endothelial growth factor receptors, proteases, cell surface proteoglycans and extracellular matrix components (Ruoslahti, 2000). . In vivo selection of phage representing libraries for peptides that return to tumor vasculature when injected into mice suggests several motifs for tumor regression.
  • NGR-containing peptides have proven useful for delivering cytotoxic drugs, pro-apoptotic peptides, and tumor necrosis factors to tumor vasculature.
  • the third motif, GSL was also frequently isolated when screened for various types of tumors. Tumor regression of phage carrying RGD, NGR and GSL motif peptides is independent of tumor type, but rather regression depends on the angiogenic properties of the tumor vasculature.
  • the receptor for the NGR tumor regression peptide is not integrin.
  • aminopeptidase N (APN or CD13) has been identified as a receptor for NGR motif peptides in tumor vasculature.
  • NGR-containing peptides have proven useful for delivering cytotoxic drugs, pro-apoptotic peptides, and tumor necrosis factors to tumor vasculature.
  • NGR peptides can bind to primary and metastatic tumors of the prostate, but not to normal prostate tissue. NGR peptides also exhibit the ability for cytosolic internalization.
  • targeting molecules include human epithelial cell mucin (Muc-1; 20 amino acid core repeats for Muc-1 glycoproteins, present in breast and prostate cancer cells), Ha-ras oncogenes, p53, cancerous antigens ( CEA), raf oncogene product, gp100 / pme17, GD2, GD3, GM2, TF, sTn, MAGE-1, MAGE-3, BAGE, GAGE, tyrosinase, gp75, melan-A / Mart-1, gp100, HER2 / neu, EBVLMP 1 & 2, HPV-F4, 6, 7, prostate-specific antigen (PSA), HPV-16, MUM, alpha-fetoprotein (AFP), CO17-1A, GA733, gp72, p53, ras tumor Gene product, HPV E7, Wilm tumor antigen
  • Immunoliposome-mediated targeting can be performed using, but not particularly limited to, monoclonal antibodies against the folate receptor, monoclonal antibodies against CA-125, and monoclonal antibodies against the HER2 / neu antigen.
  • a polynucleotide encoding a bromodomain derived from BRG-1, a recombinant protein comprising at least two bromodomains, or a fragment thereof having binding activity to an acetylated histone may be, for example, a nucleotide, nucleotide analogue, or nucleotide substituent. But it is not particularly limited thereto.
  • the polynucleotide encoding the bromodomain derived from BRG-1 according to the present invention may be a polynucleotide encoding the amino acid sequence set forth in SEQ ID NO: 1, preferably the polynucleotide set forth in SEQ ID NO: 2, As a sequence having at least 70% similarity with said sequence, preferably at least 80% similarity, more preferably at least 90% similarity, even more preferably at least 95% similarity, most preferably at least 98% similarity Substantially the protein encoded thereby may comprise a polynucleotide capable of binding activity to the acetylated histone.
  • a polynucleotide encoding a recombinant protein containing two or more bromodomains derived from BRG-1 may be a polynucleotide linked to include two or more polynucleotides encoding the amino acid sequence of SEQ ID NO. But it is not particularly limited thereto.
  • a "polynucleotide” refers to a bromodomain derived from BRG-1 of the present invention, a recombinant protein comprising two or more of the above bromodomains, or a DNA encoding a fragment thereof having binding activity to an acetylated histone.
  • RNA derived from DNA for example, integrated into a genomic DNA of a plasmid or virus or prokaryotic or eukaryotic cell that autonomously replicates (eg, transduction); Or recombinant DNA present as a separate molecule (eg cDNA or genomic or cDNA fragments prepared by PCR, restriction endonuclease digestion, or chemical or in vitro synthesis), but is not particularly limited thereto.
  • Bromodomains derived from BRG-1, recombinant proteins comprising more than one bromodomain or polynucleotides encoding fragments thereof having binding activity to acetylated histones may be operably linked to expression control sequences.
  • vectors comprising one or more of said polynucleotides, wherein said polynucleotides are operably linked to expression control sequences.
  • the polynucleotides of the present invention can be used in many direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral polynucleotides, phage polynucleotides, phages, cosmids, or cells or carriers, For example, via delivery of genetic material using cationic liposomes.
  • Such polynucleotides of the present invention can be used with lipids such as, for example, liposomes such as cationic liposomes (eg DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
  • liposomes such as cationic liposomes (eg DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
  • Liposomes may further comprise proteins to facilitate targeting specific cells, as desired.
  • Administration of the composition comprising the compound and the cationic liposomes can be administered to the blood centered on the target organ or inhaled into the airways to target the cells of the airway.
  • Polynucleotides delivered to cells to be integrated into the host cell genome typically contain an integration sequence. These sequences are sometimes virus related sequences, especially when viral based systems are used. These viral integration systems are also integrated into polynucleotides delivered using non-polynucleotide based delivery systems such as liposomes, whereby the polynucleotides contained in the delivery system can be integrated into the host genome.
  • Other common techniques for incorporation into the host genome include systems designed to facilitate homologous recombination with the host genome, for example. Such systems typically have sequences on either side of the polynucleotide to be expressed that have sufficient homology with the target sequence in the host genome so that recombination between the vector polynucleotide and the target polynucleotide can occur to integrate the polynucleotide delivered into the host genome. Depends.
  • the polynucleotides encoding bromodomains, recombinant proteins comprising two or more of those bromodomains, or fragments thereof may be used in a variety of mechanisms (eg, pure DNA) well known in the art in vivo and / or ex vivo in a subject's cells. Uptake, liposome fusion, intramuscular injection of DNA via gene gun, cellular foreign body uptake, and the like.
  • Bromodomains polynucleotides encoding recombinant proteins comprising two or more bromodomains, or fragments thereof, or conservative variants thereof, can transform cancer cells in the form of a vector.
  • the delivery vector can be any nucleotide construct used to deliver a gene into a cell (such as a plasmid), for example as part of a recombinant retrovirus or adenovirus.
  • a plasmid or viral vector is a polynucleotide encoding a bromodomain, a recombinant protein comprising two or more of those bromodomains, or fragments thereof, without transporting into the cell, and the gene of the gene in the cell to which it is delivered. Promoters that promote expression.
  • the promoter is then derived from a virus or retrovirus, the viral vector being for example adenovirus, adeno-binding virus, herpes virus, vaccinia virus, polio virus, AIDS virus, neurotrophic virus, Sindbis and other RNAs.
  • Viruses, the virus having an HIV skeleton, and the like, and the retroviruses may be murine malonym leukemia virus, MMLV, and retroviruses expressing the desirable properties of MMLV as a vector.
  • the adenovirus vectors are relatively stable, easy to use, have high titers, can be delivered in aerosol formulations, and can transform cells that do not divide.
  • Chickenpox virus vectors are large and have multiple sites for gene insertion, are heat stable and can be stored at room temperature.
  • Genetically engineered viral vectors can also be used to suppress the immune response of the host organism, induced by viral antigens, and this type of vector can carry the coding region for interleukin 8 or 10.
  • retroviruses are also animal viruses belonging to the viral family of retroviridae, including all types, subfamily, classes, and affinities. Because retroviruses are essentially packages that package polynucleotide contents therein, they have the advantage that they can carry a greater gene load than other viral vectors, i.e. transgenes or marker genes, which are commonly used but do not grow. May not be useful in cells.
  • replication-deficient adenoviruses as vectors are that they are limited to the extent that they can spread to other cell types. Because they can replicate in early infected cells, they cannot form new infectious virus particles.
  • Recombinant adenoviruses have been found to achieve high efficiency gene delivery after being delivered directly to the airway endothelial cells, hepatocytes, vascular epithelial cells, CNS milk tissues and many other tissue sites in vivo. Recombinant adenoviruses achieve genetic transformation by binding to specific cell surface receptors, and the virus is then internalized by receptor-mediated cellular foreign body uptake in the same way as wild-type or replication-deficient adenoviruses.
  • Viral vectors are based on adenoviruses with the E1 gene removed, and these virions are produced in cell lines such as human 293 cell lines.
  • both the E1 and E3 genes are removed from the adenovirus genome.
  • AAV adeno-binding virus
  • AAV adeno-binding virus
  • a type of vector can transport about 4 to 5 kbp and wild type AAV is known to stably insert into chromosome 19.
  • a vector may be a P4.1 C vector produced by Avigen (San Francisco, Calif.), which may be a herpes simplex virus thymidine kinase gene, HSV-tk, and / or marker genes such as green fluorescent protein, May contain a gene encoding GFP.
  • AAV contains a pair of inverted terminal repeats (ITRs) on either side of at least one cassette containing a promoter, which is cell-specific expression operably linked to a heterologous gene.
  • ITRs inverted terminal repeats
  • Heterologous in this context refers to any nucleotide sequence or gene that is not native to AAV or B19 parvovirus.
  • AAV and B19 coding regions have been deleted, resulting in a vector that is safe and noncytotoxic.
  • AAV ITRs or modifications thereof confer infectious and site-specific integration but do not exhibit cytotoxicity, and promoters direct cell-specific expression.
  • the disclosed vectors can provide DNA molecules that can be integrated into mammalian chromosomes without substantial toxicity.
  • Genes inserted into viruses and retroviruses usually contain promoters and / or enhancers to help regulate the expression of the desired gene product.
  • a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed position relative to the transcription start site.
  • the promoter contains the core elements necessary for the basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and reaction elements.
  • Molecular genetic experiments performed with large human herpes viruses provided a means by which large heterologous DNA fragments could be cloned, propagated and established in cells susceptible to herpes virus infection.
  • These large DNA viruses simple herpes virus, HSV; Epstein-Barr virus, EBV
  • HSV simple herpes virus
  • EBV Epstein-Barr virus
  • EBV recombinants can maintain large pieces of DNA in infected B-cells, such as episomal DNA.
  • Individual clones carried human gene inserts up to 330 kbp that appeared genetically stable. Maintaining these episomes requires EBNA1, a specific EBV nuclear protein that is structurally expressed during infection with EBV.
  • these vectors can be used for transformation, where a large amount of protein can be produced temporarily in vitro.
  • the herpesvirus amplicon system is also used to package cells larger than 220 kbp and infect cells that can keep DNA stable as episomes.
  • Promoters that regulate transcription from vectors of mammalian host cells include a variety of sources, such as from the genomes of viruses such as polyoma virus, apes virus 40 (SV40), adenoviruses, retroviruses, hepatitis B virus, cytomegalovirus, Or from heterologous mammalian promoters such as the beta actin promoter.
  • viruses such as polyoma virus, apes virus 40 (SV40), adenoviruses, retroviruses, hepatitis B virus, cytomegalovirus, Or from heterologous mammalian promoters such as the beta actin promoter.
  • the early and late promoters of the SV40 virus are conveniently obtained as SV40 restriction fragments which also contain the origin of SV40 virus replication.
  • the immediate early promoter of human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment.
  • promoters obtained from host cells or related species are also useful herein.
  • the promoter also contains response elements that mediate transcriptional regulation. Enhancers sometimes determine the regulation of gene expression. While many enhancer sequences are known from mammalian genes (globin, elastase, albumin, -fetoprotein and insulin), typically anyone will use enhancers from eukaryotic viruses for general expression. Examples thereof are the SV40 enhancer (100-270 bp), which acts later in the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma virus enhancer used later in the origin of replication, and adenovirus enhancers.
  • SV40 enhancer 100-270 bp
  • Promoters and / or enhancers are specifically activated by unusual chemical events or light causing their function.
  • the system can be controlled by reagents such as tetracycline and dexamethasone.
  • reagents such as tetracycline and dexamethasone.
  • methods of enhancing viral vector gene expression by exposure to radiation such as gamma radiation, or alkylated chemotherapeutic drugs.
  • the promoter and / or enhancer region may act as a structural promoter and / or enhancer to maximize expression of the region of the transcription unit to be transcribed.
  • the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in a particular type of cell at a particular time.
  • This type of promoter is a CMV promoter (650 bp).
  • Such other promoters include the SV49 promoter, cytomegalovirus (full length promoter), and retroviral vector LTR.
  • Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription that may affect mRNA expression. These regions are transcribed as polyadenylated fragments in the untranslated portion of mRNA encoding tissue factor proteins.
  • the 3 'untranslated region also includes a transcription termination site.
  • the transfer unit may also contain a polyadenylation region.
  • One advantage of this region is that it increases the likelihood that transcribed units will be processed and transported like mRNA.
  • the identification and use of polyadenylation signals in expression constructs is well established. In some transcription units, the polyadenylation region is derived from the SV40 initial polyadenylation signal and consists of about 400 bp.
  • the viral vector may comprise a polynucleotide sequence that encodes a marker product.
  • This marker product is used to determine whether a gene has been delivered to a cell and expressed once delivered.
  • suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analogs G418, hydromycin, and puromycin.
  • DHFR dihydrofolate reductase
  • neomycin thymidine kinase
  • neomycin analogs G418, hydromycin hydromycin
  • puromycin puromycin
  • the vector used in one embodiment of the present invention encodes three nuclear localization signals (NLS; SEQ ID NO: 3), myc epitope (SEQ ID NO: 4), and the bromodomain of the BRG-1 gene of the BRG-1 gene. Containing one or more sequences (bromodomain, BRD; SEQ ID NO: 1 or 2).
  • recombinant vectors pCMV-BRG1-BRD, pEGFP-myc-BRG1-BRD (-dimer or -tetramer) having the cleavage map of FIGS.
  • the radiation sensitive composition according to the invention may further comprise a carrier to assist in the administration, delivery or use of the effective drug.
  • the carrier can be, for example, small molecules, pharmaceutical drugs, fatty acids, detectable markers, inclusion tags, nanoparticles or enzymes.
  • the carrier can be selected to naturally minimize any degradation of the active ingredient and to minimize any harmful side effects in the subject, as is well known to those skilled in the art.
  • an appropriate amount of pharmaceutically acceptable salt is used in the formulation to make the formulation isotonic.
  • pharmaceutically acceptable carriers include saline, Ringer's solution and dextrose solution. The pH of the solution is preferably about 5 to about 8, more preferably about 7 to about 7.5.
  • Carriers also include sustained release preparations, such as semipermeable matrices of solid hydrophobic polymers containing the antibody, wherein the matrix is in the form of an article of any form, for example a film, liposomes or microparticles.
  • Pharmaceutical carriers will most often be standard carriers for drugs administered to humans, such as sterile water, saline, and buffered solutions of physiological pH.
  • the radiation sensitive composition according to the present invention may include carriers, thickeners, diluents, buffers, preservatives, surface active agents, etc., in addition to the molecules selected. It may also include one or more active ingredients such as antibacterial agents, anti-inflammatory agents, anesthetics and the like.
  • Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, such as saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, or fixed oils.
  • Intravenous vehicles include fluid and nutrient supplements, electrolyte supplements (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may be present, such as antimicrobials, antioxidants, chelating agents, inert gases, and the like.
  • Formulations for topical administration include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickening agents and the like may also be preferred.
  • Formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, disposable bags, or tablets. Thickeners, flavors, diluents, emulsifiers, dispersing aids or binders are also preferred.
  • Radiation sensitive compositions according to the invention are potentially used in inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
  • organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid.
  • the radiation sensitive composition according to the invention may be in the form of a solution, suspension (eg integrated into microparticles, liposomes, or cells). These can target particular cell types via antibodies, receptors, or receptor ligands. Vehicles such as stealth and other antibody conjugated liposomes (including lipid mediated drug targeting for colonic carcinoma), receptor mediated targeting of DNA via cell specific ligands, lymphocyte directed tumor targeting, and biomarkers An example is the very specific therapeutic retrovirus targeting of murine glial cells within. In general, receptors may be structurally or ligand-induced in the pathway of cellular foreign uptake.
  • receptors dense into a clathrin-coated seed, enter the cell via the clathrin-coated endoplasmic reticulum, pass through the acidified endosome where the receptor is sorted, and then recycle to the cell surface and intracellularly. Stored or degraded in lysosomes.
  • Internalization pathways perform a variety of functions such as nutrient uptake, removal of activated proteins, removal of macromolecules, opportunistic influx of viruses and toxins, binding and degradation of ligands, and receptor-level regulation. Many receptors follow one or more intracellular pathways depending on cell type, receptor concentration, ligand type, ligand valence, and ligand concentration.
  • the carrier molecule may be covalently linked to a recombinant protein comprising two or more bromodomains derived from BRG-1.
  • the carrier molecule may be linked to the amino terminus of the disclosed peptides.
  • the carrier molecule may be linked to the carboxy terminus of a recombinant protein comprising two or more bromodomains.
  • the carrier molecule may be linked to an amino acid in a recombinant protein comprising two or more bromodomains.
  • the radiation composition according to the present invention may further comprise a linker linking the recombinant molecule comprising two or more carrier molecules and bromodomains.
  • Bromodomains or recombinant proteins comprising two or more thereof may also be used to coat bovine serum albumin (BSA; Tkachenko et al., (2003) for coating microparticles, nanoshell nanoparticles or with recombinant proteins comprising two or more thereof. ) J Am Chem Soc, 125, 4700-4701).
  • BSA bovine serum albumin
  • the radiation sensitive composition according to the invention may be administered to a mammal.
  • mammal includes humans, livestock and breeding animals, and zoo, competition or pet animals, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, and the like. Means all animals classified as mammals.
  • the mammal is a human.
  • the radiation sensitive composition according to the invention may be administered by topical, oral, or parenteral routes.
  • the radiation sensitive composition may be administered by in vitro, intracranial, intravaginal, intranasal, subcutaneous, intradermal, intracardiac, gastric, intravenous, intramuscular, intraperitoneal injection, transdermal, intranasal, or inhalation.
  • “Intracranial administration” means delivery of a substance directly to the brain, including, for example, intramedullary, intravaginal, intraventricular, or butterfly-via delivery via a catheter or needle.
  • the exact amount of radiation sensitive composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder to be treated, the particular polynucleotide or vector used, the mode of administration, and the like. Therefore, it is not possible to specify the exact amount for all radiation sensitive agents. However, appropriate amounts can be determined by those skilled in the art using conventional experiments taught herein.
  • the radiation sensitive composition may be in the form of a solution or suspension (eg, integrated with microparticles, liposomes, or cells). These can target specific cell types by antibody, receptor, or receptor ligand. Excipients such as 'stealth' and other antibody conjugate liposomes (including lipid mediated drugs targeting colon carcinoma), receptor mediated targeting of DNA via cell specific ligands, lymphocyte directed tumor targeting, and murine glioma Highly specific therapeutic retrovirus targeting of cells is used in vivo. In general, receptors are involved in the pathway of constitutive or ligand-induced endocytosis.
  • receptors cluster in the clathrin-coated recesses, enter the cell through the clathrin-coated vesicles, pass through the acidified endosomes where the receptors are aligned, and then recycle to the cell surface, or are stored intracellularly, Or in lysosomes.
  • Internalization pathways provide a variety of functions such as nutrient uptake, activating protein removal, macromolecular clearance, opportunistic entry of viruses and toxins, dissociation and denaturation of ligands, and receptor-level regulation. Most receptors follow one or more internalization pathways depending on cell type, receptor concentration, ligand type, ligand valence, and ligand concentration.
  • the radiation sensitive composition can be administered in a number of ways depending on whether topical or systemic treatment is desired and on the site to be treated. Administration can be effected locally (ocular, vaginal, rectal, intranasal route), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection. .
  • Effective dosages and schedules of radiation sensitive compositions can be determined empirically, and such determinations are within the skill of one in the art.
  • the dosage range of dosage of the radiation sensitive composition is wide enough to produce the desired effective effect on the symptoms of the disorder.
  • a “therapeutically effective amount” of a radiation sensitive composition may include (1) the effect of inhibiting tumor growth to some extent, including the effect of slowing tumor growth and stopping it completely; (2) reducing the number of tumor cells; (3) effect of reducing tumor size; (4) inhibiting tumor cells from invading into peripheral organs (ie, reducing, slowing or completely stopping tumor cells from invading into peripheral organs); (5) the inhibitory effect of metastasis (ie, the reduction, alleviation or complete stopping effect of metastasis); (6) potentiating effects of anti-tumor immune responses that may, but not necessarily, inhibit or reject tumors; And / or (7) the effect of alleviating to some extent one or more symptoms associated with the tumor.
  • the dose should not be large enough to cause side effects such as unwanted cross-reactions, hypersensitivity reactions, etc.
  • the dosage depends on age, condition, sex and degree of disease of the patient, route of administration, or whether other drugs are included in the regimen and can be determined by one skilled in the art.
  • the dose may be adjusted by the physician as a result of any response. Dosages may vary and may be administered in one or more dosage forms of administration per day, for several days or days. Dosage ranges are highly dependent on the use of the radiation sensitive composition, the severity of the condition, and the route of administration.
  • the radiation sensitive composition in use as a research tool for irradiation, can be used in doses as low as 0.01% (w / v).
  • This dose may be as low as 0.02% (w / v) and may be as high as 2% (w / v) in topical treatment.
  • the upper limit of a given polypeptide can be up to 2-5% (w / v or v / v), for example when delivered as an initial bolus directly to a tumor mass.
  • the recommended upper dose limit for parenteral routes of administration may be 1% (w / v or v / v) depending on the severity of the injury.
  • Such an upper dose limit may vary from agent to agent, depending on, for example, how the polypeptide (s) is combined with other agents that promote the action of the polypeptide or act in conjunction with the polypeptide (s).
  • an upper limit of 0.01 g / body weight may be used over a time course determined by the physician based on the improvement of the condition.
  • the upper limit of a given polynucleotide concentration delivered locally may vary between 5 and 10 / depending on, for example, how the polynucleotide is combined with other agents that promote the function of the polynucleotide or act in conjunction with the polynucleotide. would. This may be repeated at a frequency determined by the physician based on the situation of improvement.
  • the upper limit of a given polynucleotide concentration delivered internally is 50-100 /.
  • the frequency will be determined by the physician based on the situation of improvement.
  • the surgical site can be pre-conditioned with a polypeptide provided prior to surgery.
  • concentration of polypeptide may be 10-200 M, mixed with 10-30% Pluronic gel or any such carrier which allows penetration of peptide (s) within the site and left for at least 3-6 hours prior to surgery.
  • Conditioning as such a pre-procedure can improve the healing response to subsequent surgery, including reducing the inflammatory response.
  • the radiation sensitive composition for cancer cell radiotherapy according to the present invention can be used in combination with radiation therapy.
  • Radiotherapy is a topical treatment that damages the DNA of malignant cells. Normal cells have a greater ability to repair these damages than tumor cells. Radiotherapy takes advantage of this difference.
  • radiation therapy is a form of topical therapy
  • side effects are generally limited to the treated area.
  • a common systemic symptom is fatigue.
  • genetic factors are prevalent in secondary cancers in some patients, radiation also contributes to an increased risk.
  • the radiation sensitive composition according to the present invention can reduce these side effects by reducing the required amount of radiation.
  • radiation sensitivity can be increased not only in radiation-sensitive cancer cells, but also in radiation-resistant cancer cells.
  • Treatment regimens are based on treatment goals and possible side effects.
  • the course of treatment may be a short course of about 1 day and a long course of about 10 weeks, with a typical duration of 2 to 7 weeks, usually consisting of 5 days of treatment each week.
  • the patient receives radiation through a linear accelerator that most commonly produces electrons that produce x-rays that are used as or used as a treatment beam. Treatment is painless and usually lasts less than 5 minutes.
  • the therapeutic target may be healing or palliation. If radiotherapy potentially targets healing, the duration of treatment is usually longer, and usually consists of small daily doses over a long period of treatment. This approach minimizes late side effects. If the treatment is strictly aimed at remission, a short treatment schedule consisting of large daily treatment doses over a short period of time is used. In such cases, late side effects may not occur during the lifetime of the patient.
  • Radiotherapy has many possible specific prescriptions. It may be given as a primary tumor treatment, as a preoperative or postoperative therapy, or as a component of a combination or combination therapy.
  • Radiotherapy is suitable in nearly two thirds of cancer patients and is used for healing and alleviation purposes.
  • Many tumors such as prostate cancer, breast cancer, head and neck cancer, lung cancer, brain tumors, gastrointestinal tumors, liver cancers, soft tissue sarcomas, cervical cancers, lymphomas, etc., will receive radiotherapy as part of the treatment regimen.
  • the radiation source is preferably gamma radiation of 137 Cs, but is not limited thereto.
  • Radiotherapy includes external beam radiation (x-ray, -ray, protons and neutrons), brachytherapy and radioactive material implantation. Radiotherapy can be administered by a 2-D, 3-D, confocal, intensity-modulation (IMRT) and image-guide (IGRT) approach. Standard radiotherapy suitable for most solid tumors is given at 2 Gy / day in a total dose of about 60 Gys (50-70 Gys). However, it is common for those skilled in the art to select the desired radiation dose based on the particular subject, device, and tumor type.
  • the radiation sensitive composition according to the invention constitutes an improvement over existing radiation therapy by increasing the sensitivity of cancer cells to radiation.
  • provided methods allow cancer cells to have at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more sensitivity to radiation.
  • sensitivity and “radiation sensitivity” refer to viable cell numbers based on radiation dose.
  • an increase in radiation sensitivity can lead to a decrease in the number of cells surviving at any radiation dose, a reduction in the radiation dose required for lethal doses, or a combination thereof.
  • Brachytherapy also known as sealed source radiotherapy or endocurietherapy
  • endocurietherapy is a form of radiotherapy that places a radioactive source within or next to the area in need of treatment.
  • external beam radiotherapy or teletherapy
  • Brachytherapy is commonly used for the treatment of local prostate cancer and head and neck cancer.
  • Brachytherapy includes mold brachytherapy, strontium plate therapy, intragap brachytherapy, intracavity brachytherapy, and vascular brachytherapy.
  • mold brachytherapy tumors close to the epidermis can be treated using a sealed source placed close to the skin.
  • Dosimetry is primarily performed in connection with the Manchester system, which is a rule-based approach designed to ensure that doses for the entire portion of the target volume are within 10% of the prescribed dose.
  • Surface applicators commonly referred to as strontium plate therapy, are used for lesions very close to the epidermis of less than one thickness.
  • the plate is a hollow thin silver casing, which seals off the radioactive strontium-90 powder salt.
  • the beta (electron) particles produced due to the radioactive decay of strontium penetrate very shallowly.
  • the Sr90 plate is placed on a layer of ablated pterygium.
  • a constant dose of about 10-12 Gy is delivered at the contact timing.
  • the former only penetrates the water in the air, so the radiation protection problem is slightly reduced, which is very different from other radiation sources.
  • intragap brachytherapy the source is inserted into the tissue.
  • Prostate cancer treatment using iodine-125 species is also classified as intragap brachytherapy.
  • gamma emitters refer to commonly used gamma ray emitting isotopes.
  • Intracavity brachytherapy places the source in an existing intracorporeal cavity.
  • Intravascular brachytherapy places a catheter with a source inside the vessel. The most common application of this method is the treatment of restenosis in the coronary stent, but this therapy can also be used for the treatment of peripheral vascular stenosis.
  • High dose rate (HDR) brachytherapy is a common brachytherapy. Applicators in the form of catheter are generally disposed in accordance with the Manchester or Paris system or in the patient. Next, a high dose rate source (mainly iridium 192, Ir-192) is steered along the catheter at the wire end by the machine. The source stays at a preplanned position for a predetermined time, then advances along the catheter and repeats this so that the required dose distribution is achieved.
  • a high dose rate source mainly iridium 192, Ir-192
  • LDR low dose rate
  • HDR high dose rate
  • LDR brachytherapy with machines works in a similar way.
  • the source is in the form of active and inactive balls, which are also manipulated in the patient using a machine.
  • a radioprotectant may be administered to a healthy tissue of a subject when the radiation sensitive agent is administered.
  • radioprotectants will include compositions that trap free radicals to prevent oxidative damage.
  • cancer cells comprising a BRG-1 derived bromodomain, a recombinant protein comprising two or more bromodomains, or fragments thereof may be used as a positive control when screening whether a candidate agent is a radiation sensitive agent.
  • candidate agents can be identified from large libraries or chemical libraries of natural products or synthetic (or semi-synthetic) extracts according to methods known in the art.
  • extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic-, or animal-based extracts, fermentation broth, and synthetic compounds, as well as modifications of existing compounds. It can also be used for random or directed synthesis (eg, semi-synthetic or total synthesis) of many chemical compounds, including sugar-, lipid-, peptide-, polypeptide-, and polynucleotide-based compounds.
  • Synthetic compound libraries are commercially available from, for example, Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI).
  • bacteria, fungi from a number of sources including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FIa.), And PharmaMar, USA (Cambridge, Mass.).
  • Natural compound libraries in the form of plant and animal extracts are commercially available.
  • natural and synthetic production libraries are produced according to methods known in the art, for example by standard extraction and fractionation.
  • any library or compound is readily denatured using standard chemical, physical, or biochemical methods.
  • Colon cancer cells HT-29 (R) and HCT116 (S) were cultured using McCoys 5a medium (manufactured by WelGene) containing 10% fetal bovine serum, and lung cancer cells using F-12K medium (manufactured by WelGene).
  • McCoys 5a medium manufactured by WelGene
  • F-12K medium manufactured by WelGene
  • A549 (R) and NCI-H446 (S) were cultured, and normal cells 293T (S), breast cancer cells MDA-MB-231 (R), and SK-BR3 (Minimum Essential Medium Eagle medium (manufactured by ATCC) were used). S) were incubated under 37, 5% CO 2 , respectively.
  • a gene cloned by fusing three nuclear localization signals (NLS) and a myc epitope portion to a GFP-N1 vector having a high expression rate was nucleated. Made to function inside. At this time, the three nuclear position signal and myc epitope portion was used 693 ⁇ 833 base portion of the pCMV / myc / nuc vector.
  • the bromodomain (BRD) portion of the BRG-1 gene was obtained by using SEQ ID NOs: 5 and 6 as primers through polymerase chain reation (PCR).
  • the obtained fragment was cloned into a GFP-N1 vector in which three nuclear position signals and a myc epitope portion were fused (Fig. 1).
  • the cloned pCMV-BRG1-BRD vector was cultured by the above culture method.
  • Normal cell 293T (S), Colon cancer cell HT-29 (R), Colon cancer cell HCT116 (S), Lung cancer cell A549 (R), Lung cancer cell NCI Transformants were prepared by transducing H446 (S), breast cancer cell MDA-MB-231 (R), and breast cancer cell SK-BR3 (S) using the calcium phosphate method.
  • SEQ ID NO: 5 forward: 5'-gctcctcgagatggccgagaaactctcccct -3 '
  • a single-stranded end of the monomer of the BRG1-BRD prepared as described above was carried out to perform a linkage reaction ( blunt end ligation).
  • a linkage reaction blunt end ligation
  • a gel of a size expected to obtain only a dimer without a restriction enzyme recognition site was cut, and DNA was purified on the gel.
  • DNA fragments encoding bromodomain dimers were obtained through polymerase chain reaction using primers of SEQ ID NOs: 5 and 6 having Xho1 and Hind3 restriction enzyme recognition sites, respectively, as a template.
  • the obtained DNA fragment was cloned into pEGFP-myc vector according to the method of Example 2 to prepare a bromodomain dimer expression vector (pEGFP-myc-BRG1-BRD-dimer).
  • the cloned pEGFP-myc-BRG1-BRD-dimer vector was cultured by the above culture method.
  • Normal cells 293T (S), colon cancer cells HT-29 (R), colon cancer cells HCT116 (S), lung cancer cells A549 (R) Transformed into breast cancer cells MDA-MB-231 (R) and breast cancer cells SK-BR3 (S).
  • SEQ ID NO: 7 (forward): 5'-gccgagaaactctcccct-3 '
  • the prepared vector was transfected into normal hepatocyte HEK 293T (S), colon cancer cell HCT116 (S), lung cancer cell A549 (R) and lung cancer cell NCI-H446 (S) according to the method of Example 2 above. Got.
  • SEQ ID NO: 9 (forward): 5'-gctcgtcgacaagccgagaaactctcccct -3 '
  • transformed 293T cells were dispensed into 100 culture dishes with 2 x 10 5 cells and irradiated with radiation the next day.
  • the source was -ray (137Cs; Cell Irradiation System, GC 3000 Elan-Model b; MDS Nordion, Ontario, Canada), and after 10 days of irradiation with a total dose of 0 to 5 Gy, the cell survival rate was shown in FIG. 3. It was.
  • Bromodomain expression vector pEGFP-myc-BRG1-BRD
  • bromodomain multimeric expression vector pEGFP-myc-BRG1-BRD-dimer and pEGFP-myc-BRG1-BRD-
  • S normal hepatocyte HEK 293T
  • the cells transformed with the pEGFP-myc vector killed cancer cells even at a radiation intensity weaker than the result of about 10% survival at 4 Gy (FIG. 3A), and their IC50 values.
  • the BRG1 bromodomain multimerized to 1.60, 1.20 and 0.97, respectively it was confirmed that the radiation sensitivity of the cells was increased (FIG. 3C).
  • Example 4-1 In order to confirm the survival rate of cancer cells transformed to express BRG1 bromodomain or dimer thereof according to gamma irradiation, the survival rate of the transformed cancer cells was confirmed using the method of Example 4-1. To 8 are shown.
  • each cancer cell has a viral vector that is easy to express bromodomain or dimer thereof. The experiment was carried out by fabrication.
  • bromodomain expression vector pMX-myc-BRG1-BRD
  • pMX-myc-BRG1-BRD-dimer pMX-myc-BRG1-BRD-dimer
  • BRG-1 in cells transformed with a bromodomain expression vector (pMX-myc-BRG1-BRD) or a bromodomain dimer expression vector (pMX-myc-BRG1-BRD-dimer) in colorectal cancer cells HCT116 (S) It was confirmed that bromodomain is expressed in monomeric or dimeric form (FIG. 5B). Also, in this case, a cell transformed with the pMX-myc vector as a control that does not express bromodomains with a survival rate of about 10% at 3 Gy intensity irradiation was weaker than a result of survival rate of about 10% at 4 Gy. Cancer cells were also killed (A in FIG. 5), and their IC50 values were 1.88, 1.12, and 1.02, respectively. As the BRG1 bromodomain multimerized, the radiation sensitivity of the cells was increased (FIG. 5C).
  • the overexpressed bromodomains can increase the radiation sensitivity and effectively kill cancer cells, and that the effect can be stably maintained in various cancer cells such as colon, lung and breast.
  • the bromodomain expressed is multimerized, the effect may be increased.
  • the survival rate of the transformed cancer cells was confirmed using the method of 4-1 above. To 11 are shown.
  • Bromodomain expression vector pMX-myc-BRG1-BRD
  • bromodomain multimeric expression vector pMX-myc-BRG1-BRD-dimer and pMX-myc-BRG1-BRD-tetramer in colorectal cancer cells HCT116 (S)
  • FIG. 9B bromodomain expression vector
  • the bromodomain was multimerized by showing a lower survival rate than that of a cell transformed with the pMX-myc vector as a control that does not express bromodomain. It was confirmed that the radiation sensitivity of the cells is increased (FIG. 9A).
  • Bromodomain expression vector pMX-myc-BRG1-BRD
  • bromodomain multimeric expression vector pMX-myc-BRG1-BRD-dimer and pMX-myc-BRG1-BRD-tetramer in lung cancer cells
  • FIG. 10B bromodomain expression vector
  • the bromodomain was multimerized by showing a lower survival rate than that of cells transformed with the pMX-myc vector as a control that does not express bromodomain. It was confirmed that the radiation sensitivity of the cells is increased (FIG. 10A).
  • Bromodomain expression vector pMX-myc-BRG1-BRD
  • bromodomain multimeric expression vector pMX-myc-BRG1-BRD-dimer and pMX-myc-BRG1-BRD in lung cancer cell NCI-H446 (R) -tetramer
  • Fig. 11B bromodomain expression vector
  • the bromodomain was multimerized by showing a lower survival rate than that of a cell transformed with the pMX-myc vector as a control that does not express bromodomain. It was confirmed that the radiation sensitivity of the cells is increased (FIG. 11A).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질, 상기 재조합 단백질을 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 발현 벡터, BRG-1 유래의 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 포함하는 암세포 방사선 치료용 방사선 민감제 조성물, 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 유효성분으로 포함하는 암세포 방사선 치료용 방사선 민감제 조성물 및 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 포함하는 암세포에 관한 것이다.

Description

BRG-1 유래의 브로모도메인 및 이의 용도
본 발명은 -1 유래의 브로모도메인 및 이의 용도에 관한 것으로, 보다 구체적으로 본 발명은 BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질, 상기 재조합 단백질을 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 발현 벡터, BRG-1 유래의 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 포함하는 암세포 방사선 치료용 방사선 민감제 조성물, 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 유효성분으로 포함하는 암세포 방사선 치료용 방사선 민감제 조성물 및 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 포함하는 암세포에 관한 것이다.
미국의 경우 약 2/3의 환자가 통증완화치료를 포함하여 궁극적으로는 방사선 치료를 받고 있는데 반하여, 한국에서는 전체 암 환자의 1/3 정도가 방사선치료를 받고 있다.
방사선 치료는 현재 다양한 종류의 암에 필수적인 치료 방법으로 알려져 있으나, 암세포의 방사선 내성획득, 고선량의 방사선 치료 시 정상조직의 손상 등이 방사선치료의 효율을 저하시키는 문제점으로 지적되어 왔다. 따라서, 방사선 치료의 효율을 증진시키기 위한 방사선 치료 민감제에 대한 연구가 시도되고 있다.
한편, 방사선치료는 많은 종류의 암에 대해 특히 전이를 일으키지 않는 국부 암에 대해 가장 중요하고 강력한 치료법 중 하나이다. 그러나, 방사선요법에 의해 치료될 종양들 중에서 오직 소수만이, 이를테면 림프종과 정상 상피종만이 방사선요법에 반응성이 있다. 다른 많은 고체성 종양, 예를 들면 흑색종, 신경아교세포종, 및 전립선암 등은 전형적으로 방사선에 대해 매우 내성적이며, 매우 많은 양의 방사선 처리가 필요하다. 방사선치료가 실패하는 이유는 흔히 복합적이고 가변적이다. 종양 인자들, 예컨대 위치, 크기 및 부적절한 혈관 공급(산소결핍)은 모두 이온화 방사선(IR)에 대한 신생물의 반응성의 결핍에 중요한 역할을 할 수 있다. 아마도 가장 중요한 것은 방사선-민감성 조절에 관련된 세포 및 유전적 인자들, 예를 들면 차등적인 조직-특이적 유전자 발현인데, 그것은 방사선-내성 세포 표현형을 유발할 수 있다. 과학자들은 IR에 대한 종양세포 민감성을 증가시키기 위한 다양한 방법을 개발하기 위해 오랫동안 노력해 왔다. 일례로, 저산소성 방사선 민감성 증강물질, 고농도의 산소가 있고, 보다 최근에는 방사선 민감성에 관련된 많은 유전적 인자들을 표적화하는 것이 포함된다. 그러나 지난 수십 년 동안 분자 생물학과 생화학분야에서 과학적으로 큰 발전이 있었음에도 불구하고, 암 유전학과 분자 방사선 생물학 분야에서는 효과적이고 특이한 방사선 민감성 증강물질의 개발의 진전이 제한적으로 이루어져 왔을 뿐이다.
뇌종양 치료법 중 방사선 요법은 방사선에 의한 DNA 손상에 대하여 세포 주기를 지연(DNA damage checkpoint)시키거나 세포사멸(apoptosis)을 유도하여 비정상 세포를 제거하는 방법이다. 그러나 방사선 요법의 문제점은 암세포의 내재적인 방사선 저항성과 방사선 치료에 따른 내성증가로 인해서 방사선 저항성 암세포들이 암의 재발을 유발시키며 방사선 저항성 세포는 항암제에도 내성을 가진다.
따라서, 방사선에 대해서 내재적인 방사선 저항성을 가진 암세포의 방사선 민감성을 증진시키는 방사선 민감성 증진제의 개발이 절실히 요구되고 있다.
한편, 히스톤(histone)은, 사람을 비롯한 다세포 생물부터 진균류(곰팡이, 효모)로 대표되는 단세포 생물에 이르기까지, 진핵세포의 핵 내에 공통으로 존재하고, 게놈 DNA와 이온 결합하는 염기성 단백질이다. 히스톤은 통상 5종류의 성분(H1, H2A, H2B, H3 및 H4)으로 이루어져 있고, 생물종을 초월하여 고도로 유사하다. 예컨대 히스톤 H4의 경우, 출아효모 히스톤 H4(전체 길이 102 아미노산 배열)와 사람 히스톤 H4(전체 길이 102 아미노산 배열)에서는 92%의 아미노산 배열이 일치하고, 차이는 겨우 8잔기 뿐이다. 생물 중에 수만 종류 존재하는 것으로 상정되고 있는 천연 단백질 중에서, 히스톤은 진핵생물 종간에서 가장 고도로 보존된 단백질인 것이 알려져 있다. 게놈 DNA는 이 히스톤과의 규칙적인 결합에 의해 포개져 있고, 양자의 복합체는 뉴클레오솜(nucleosome)이라는 기본적인 구조 단위를 형성한다. 그리고, 이 뉴클레오솜이 응집하는 것에 의해 염색체의 크로마틴 구조가 형성되어 있다. 히스톤은 히스톤테일이라고 불리는 N-말단 부분에서, 아세틸화, 메틸화, 인산화, 유비퀴틴화, 및 SUMO화 등의 수식을 받고, 크로마틴 구조를 유지 또는 특이적으로 구조 변환하는 것에 의해 유전자 발현, DNA 복제, DNA 수복 등의 염색체 DNA상에서 생기는 반응이 조절된다. 히스톤의 번역 후 수식은 후성적인 조절 메커니즘이고, 진핵세포의 유전자 조절에 대하여 필수로 생각되고 있다. 최근의 연구를 통해 뉴클레오좀 구조를 변형하여 전사인자와 DNA와의 접근을 촉진시키는 SWI/SNF, RSC, NURF, NRD 등과 같은 염색질 재형성 인자(chromatin remodeling factor), 히스톤의 아세틸화 상태를 조절하는 히스톤 아세틸전이효소(histone acetyltransferases, HATs)와 히스톤 디아세틸라제(HDACs)가 중요한 조절인자로 작용함이 밝혀졌다.
한편, 히스톤의 아세틸화 리신에 결합하는 단백질의 도메인 구조로서 브로모도메인이 알려져 있다. 사람에서는 30여 종류의 브로모도메인 함유 단백질이 존재한다. 이 중에서, 아세틸화 히스톤과 상호 작용하는 단백질에는 BRG1, BRD2, BRD3 등이 알려져 있다. 이들 중에서, BRG1은 염색질 재형성 인자인 SWI/SNF 복합체의 핵심 구성 단백질로 알려져 있다. 포유류 SWI/SNF 복합체는 8 ~ 12개의 단백질로 구성되어 있으며 ATPase 활성을 갖는 핵심 서브유닛(core subunit)으로 BRG-1 또는 hBrm을 갖고 있다.
유전자 적중 마우스 실험을 통해 SWI/SNF가 암 억제인자(tumor suppressor)로 작용한다는 사실이 밝혀졌고, 그 작용 기전으로 SWI/SNF가 HDAC과 작용해 Rb에 의한 G1/S 어레스트(arrest)를 매개하는 것이 알려져 있다. 최근 연구에 의하면, SWI/SNF가 유전체 안정성 유지에 중요한 역할을 하는 암 억제인자 H2AX의 인산화 및 그 기능을 촉진시키는 역할을 한다는 사실을 통해 SWI/SNF의 암 억제 기능에 대한 새로운 분자 기전의 존재 가능성이 제시되었다. 또한, SWI/SNF를 불활성화시키거나 siRNA를 이용해 BRG-1/hBRM을 결손(knockdown) 시키면 H2AX인산화 및 repair foci 형성이 현저하게 감소되어 세포가 DNA 손상에 민감해지고 DNA 이중가닥 절단(DNA double strand break, DSB) 복구가 잘 이루어지지 않는다는 것을 통해, SWI/SNF가 DSB 복구에 직접적인 역할을 한다는 것 역시 제시되었다.
그러나, 아세틸화 히스톤과 BRG-1의 결합의 저해가 종양 세포에 영향을 미치는지의 여부에 대해서는, 지금까지 전혀 보고된 바가 없다.
이에, 본 발명자들은 BRG-1(Brahma-related gene 1)의 브로모도메인 또는 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질이 방사선에 민감한 암세포뿐만아니라, 방사선에 저항성이 있는 암세포에서도 방사선 민감도를 증가시켜 세포사멸을 증진시킬 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 하나의 목적은 BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질을 제공하는 것이다.
본 발명의 다른 목적은 상기 재조합 단백질을 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 폴리뉴클레오티드를 갖는 벡터를 제공하는 것이다.
본 발명의 또 다른 목적은 BRG-1 유래의 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 유효성분으로 포함하는, 암세포 방사선 치료용 방사선 민감제 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 유효성분으로 포함하는 암세포 방사선 치료용 방사선 민감제 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 브로모도메인, 상기 도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이의 단편을 포함하여, 목적하는 제제가 방사선 민감성 제제인지를 확인하는 방법에서 대조군으로 사용될 수 있는 암세포를 제공하는 것이다.
본 발명의 BRG-1 유래의 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합단백질 또는 이들의 단편은 암세포의 방사선 치료시 방사선에 민감한 암세포 뿐만 아니라, 방사선에 저항성이 있는 암세포에서도 방사선 민감도를 증가시켜 세포사멸을 증진시킬 수 있으므로, 보다 효과적인 항암치료에 널리 활용될 수 있을 것이다.
도 1은 BRG-1 브로모도메인 발현벡터의 제조 과정을 나타내는 계략도이다.
도 2는 BRG-1 브로모도메인 다량체 발현벡터의 구성을 나타내는 그림이다.
도 3은 BRG-1 브로모도메인 및 이의 다량체를 발현하는 정상세포 293T 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 5 Gy의 방사선을 조사한 후, 정상세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B), 및 IC50 값(C)을 확인하여 나타낸 것이다.
도 4는 BRG-1 브로모도메인 및 이의 이량체를 발현하는 대장암세포 HT-29 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 10 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B), 및 IC50 값(C)을 확인하여 나타낸 것이다.
도 5는 BRG-1 브로모도메인 및 이의 이량체를 발현하는 대장암세포 HCT-116 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 5 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B), 및 IC50 값(C)을 확인하여 나타낸 것이다.
도 6은 BRG-1 브로모도메인 및 이의 이량체를 발현하는 폐암세포 A549 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 10 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B), 및 IC50 값(C)을 확인하여 나타낸 것이다.
도 7은 BRG-1 브로모도메인 및 이의 이량체를 발현하는 유방암세포 MDA-MB-231 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 10 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B), 및 IC50 값(C)을 확인하여 나타낸 것이다.
도 8은 BRG-1 브로모도메인 및 이의 이량체를 발현하는 유방암세포 SK-BR3 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 5 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B), 및 IC50 값(C)을 확인하여 나타낸 것이다.
도 9는 BRG-1 브로모도메인 이량체 및 사량체를 각각 발현하는 대장암세포 HCT-116 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 5 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B)을 확인하여 나타낸 것이다.
도 10은 BRG-1 브로모도메인 이량체 및 사량체를 각각 발현하는 폐암세포 A549 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 10 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B)을 확인하여 나타낸 것이다.
도 11는 BRG-1 브로모도메인 이량체 및 사량체를 각각 발현하는 폐암세포 NCI-H446 형질전환체의 감마선 조사에 따른 생존율을 확인한 결과를 나타낸 것으로, 총선량 0 내지 5 Gy의 방사선을 조사한 후, 암세포의 생존율(A), BRG-1 브로모도메인 및 BRG-1 브로모도메인 다량체 재조합단백질의 발현(B)을 확인하여 나타낸 것이다.
이하, 본 발명을 자세히 설명한다.
본원에서 사용되는 "BRG-1 단백질"은 사람에서 알려진 30여 종류의 브로모도메인 함유 단백질 중에서 아세틸화 히스톤과 상호 작용하는 단백질로서, 염색질 재형성 인자인 SWI/SNF 복합체의 ATPase 활성을 갖는 핵심 서브유닛(core subunit)으로 알려진 단백질을 의미한다.
본원에서 사용되는 "브로모도메인"은 단백질을 구성하는 구성 요소로서 아세틸화 히스톤에 결합하는 활성을 갖는 단백질의 일부 폴리펩티드 부위 및 이를 암호화하는 뉴클레오티드 서열을 의미한다. 본 발명에서 상기 브로모도메인은 BRG-1 단백질로부터 유래된 히스톤 단백질 H3의 아세틸화된 K14에 결합하는 활성을 갖는 부위의 폴리펩티드 또는 이를 암호화하는 폴리뉴클레오티드 절편을 포함한다.
일반적으로, DNA의 이중가닥 손상은 방사선과 같은 외부환경요인에 의해 유발되며, 적절히 복구되지 않으면 염색체치환, 유전자 소실 및 유전체불안정성을 초래하여 암을 발생할 수 있게 한다. 또한, 고선량의 방사선 치료는 정상조직의 손상을 초래한다.
한편, SWI/SNF는 암 억제인자로 작용한다고 알려져 있으며, BRG-1은 SWI/SNF 복합체의 핵심 구성 단백질로 알려져 있다.
그런데, 본 발명자들은 BRG-1의 브로모도메인에 해당하는 폴리펩티드가 암세포에 존재할 때 감마 방사선을 조사하면, 방사선에 민감한 암세포뿐만아니라, 방사선에 저항성이 있는 암세포에서도 방사선 민감도를 증가시켜 세포사멸을 증진시킬 수 있을 뿐만아니라, BRG-1 브로모도메인 이량체 및 사량체 재조합 단백질을 인위적으로 재조하여 발현시킨 경우에 더욱 효과적으로 방사선 민감도를 증가시킬 수 있음을 발견하였다(실시예 4).
본 발명에서는 재조합 벡터 pCMV-BRG1-BRD로 대장암세포 HCT116(S, 이하 S는 방사선 민감성 암세포를 의미함), 폐암세포 A549(R, 이하 R은 방사선 저항성 암세포를 의미함), 간암세포 HepG2(R), 간암세포 Hep3B(R)들을 형질전환하여, BRG-1 브로모도메인이 발현되는 것을 확인하였고, 이들 암세포에서 BRG-1 브로모도메인 폴리펩티드를 발현시킨 경우에는 암세포들이 감마 방사선에 대하여 상당히 민감도가 증가하여 세포사멸을 증진시킬 수 있음을 확인하였다. 또한, BRG-1 브로모도메인 다량체 재조합 단백질을 암호화하는 재조합 벡터 (pEGFP-myc-BRG1-BRD-dimer 및 pEGFP-myc-BRG1-BRD-tetramer)로 정상세포주인 HEK 293T 세포를 형질전환하여 BRG-1 브로모도메인 다량체 재조합 단백질이 발현되는 것을 확인하였고, 이들 다량체 재조합 단백질을 발현시킨 경우에 감마 방사선에 대한 민감도가 BRG-1 브로모도메인 단량체를 발현시킨 것에 비해 상당히 증가하여 세포사멸을 증진시킬 수 있음을 확인하였다.
방사선 민감성 또는 방사선 저항성의 기준은 0 내지 2 Gy의 감마 방사선을 조사하였을 때의 세포 생존율을 이용하여 작성한 선형 모델의 기울기 값에 의해 분류되어진다. 이러한 분류 방법은 Jerry R. Williams 등이 논문(Acta Oncologica, 46, 628-638, 2007)을 통해 보고한 바 있다. 본원에서 사용된 용어 "방사선 민감성"은 상기 기울기 값이 0.00 내지 0.30의 범위에 포함되는 특징을 갖는 세포를 의미하고, "방사선 저항성"은 0.31 내지 1.00 범위에 포함되는 특징을 갖는 세포를 의미한다. 방사선 민감성 세포에는 HEK 293T, SW1222, HCT116, LoVo, CBS, LS174T, 379.2, 80S4, 14-3-3+/+, 40-16, 14-3-3-/-, N6CH3가 알려져 있고, 방사선 저항성 세포에는 DLD-1, HT29, WiDR, SW480, SW116, 19S186, Caco2, Caco2-neoras, U251, U87, T98G가 알려져 있다.
대장암세포 HCT116(S), 폐암세포 A549(R), 간암세포 HepG2(R), 간암세포 Hep3B(R)는 모두 BRG-1을 발현하는 암세포이다. 따라서, 본 발명에서 방사선 치료대상 암세포는 BRG-1을 발현하는 것이 바람직하다.
BRG-1은 브로모도메인을 통해, 아세틸화 히스톤, 특히 H3의 아세틸화된 K14에 결합하여, 암세포의 감마 방사선 민감도를 증가시키고 세포사멸을 증진시키는 것으로 유추된다.
따라서, BRG-1 유래의 브로모도메인의 단편은 아세틸화 히스톤에 결합 활성을 갖는 것이고, H3의 아세틸화된 K14에 결합하는 활성을 갖는 것이 바람직하다.
상기 암세포는 대장암, 폐암, 간암세포인 것이 바람직하나 이에 한정되지 않으며, 브로모도메인 함유 단백질이 발현되는 암세포는 모두 해당될 수 있다.
본 발명의 방사선 민감제는 암세포의 방사선 치료뿐만아니라, 화학요법에서도 민감성을 증가시킬 수 있기 때문에, 화합요법에서 민감도를 증가시키는 민감제의 용도로 본 발명의 방사선 민감제를 사용하는 경우도 본 발명의 범주에 속한다.
1. BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합단백질
본 발명에서, BRG-1 유래 브로모도메인의 비제한적인 예로는 천연의 BRG-1 단백질에서 분리된 폴리펩티드 뿐만 아니라, 합성하거나, BRG-1 유래의 브로도메인을 암호화하는 폴리뉴클레오티드로 형질전환시킨 세포로부터 분리된 것도 포함하며, 이들의 단편도 포함한다.
BRG-1 유래의 브로모도메인의 일례는 서열 번호 1인 폴리펩티드 서열을 가질 수 있다.
본 발명에서, BRG-1 유래의 브로모도메인의 단편은 아세틸화 히스톤에 결합 활성을 갖는 한, 그 길이 및 부위는 제한되지 아니한다.
또한, 본 발명에서 BRG-1 유래의 브로모도메인은 아세틸화 히스톤에 결합 활성을 갖는 이들의 보존성 변이체 및 유도체를 포함한다.
본 발명에 따른 BRG-1 유래의 브로모도메인은 상기 서열번호 1로 기재된 서열뿐만 아니라 상기 서열과 70% 이상의 유사성을 가지는 아미노산 서열, 바람직하게는 80% 이상의 유사성, 더욱 바람직하게는 90% 이상의 유사성, 보다 더욱 바람직하게는 95% 이상의 유사성, 가장 바람직하게는 98% 이상의 유사성을 나타내는 아미노산 서열로서 실질적으로 아세틸화 히스톤에 결합 활성을 갖는 폴리펩티드를 포함한다. 또한, 이러한 유사성을 갖는 서열로서 실질적으로 BRG-1 유래의 브로모도메인과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질 변이체도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명에서 BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합단백질은 BRG-1의 천연 효소활성 부위, 예컨대 ATPase 활성 부위를 제외한 다른 폴리펩티드와 융합 단백질을 구성하거나 추가의 N-말단, C-말단 혹은 중간체 아미노산 서열, 예컨대 링커 또는 태그를 포함할 수 있다.
이하, BRG-1 유래의 브로모도메인은 폴리펩티드로 혼용해서 사용된다.
단백질 변이체와 유도체는 당업자들에게 잘 알려져 있고, 아미노산 서열 변형을 포함할 수 있다. 예를 들어 아미노산 서열의 변형은 전형적으로 세 가지 부류, 즉 치환, 삽입 또는 결실 변이체 중 하나 또는 그 이상의 부류를 포함한다. 삽입은 아미노 및/또는 카르복실 말단 융합뿐 아니라 단일 또는 다중 아미노산 잔기의 서열내 삽입을 포함한다. 삽입은 통상 아미노 또는 카르복실 말단 융합의 삽입부분보다 작은, 예를 들면 하나 내지 4개의 잔기 정도의 삽입이 될 것이다. BRG-1 유래의 브로모도메인은 폴리펩티드의 본질적인 활성에 관여하지 않는 N-말단, C-말단 또는 중간 아미노산이 결실될 수 있다.
아미노산 치환은 전형적으로 하나의 잔기로 이루어지지만, 많은 상이한 유전자 부위에서 한꺼번에 일어날 수 있고, 삽입은 보통 약 1 내지 약 10개의 아미노산 잔기의 크기로 일어날 것이다. 결실이나 삽입은 바람직하게는 인접한 쌍에서, 즉 2개의 잔기가 결실되거나 2개의 잔기가 삽입된다. 치환, 결실, 삽입 또는 그것들의 어떠한 조합도 최종 구성물을 이루기 위해 조합될 수 있다. 돌연변이는 리딩 프레임 밖의 서열에서는 일어나지 않아야 하며, 바람직하게는 mRNA의 이차 구조의 변화를 원하지 않는 한, 이차 mRNA구조를 생성할 수 있는 상보하는 영역을 생성하지 않는 것이 좋다.
예를 들어 한 아미노산 잔기를 생물학적으로 및/또는 화학적으로 유사한 다른 것으로 치환하는 것은 당업자들에게는 보존성 치환으로서 알려져 있다.
예를 들어 보존성 치환은 하나의 소수성 잔기를 다른 소수성 잔기로, 혹은 극성 잔기를 다른 극성 잔기로 치환하는 것이다. 보전성 치환의 일례가 하기 표 1에 기재되어 있다.
표 1
원래의 잔기 예시적인 치환 원래의 잔기 예시적인 치환
Ala Ser Leu Ile; Val
Arg Lys Lys Arg; Gln
Asn Gln Met Leu; Ile
Asp Glu Phe Met; Leu; Tyr
Cys Ser Pro Gly
Gln Asn Ser Thr
Glu Asp Thr Ser
Gly Pro Trp Tyr
His Gln Tyr Trp; Phe
Ile Leu; Val Val Ile; Leu
이러한 치환은 상기 표 1에 나타낸 조합을 포함한다.
전형적으로 보존성 치환은 결과적으로 생성되는 폴리펩티드의 생물학적 활성에는 거의 영향을 주지 않는다. 펩티드는 하나 또는 그 이상의 아미노산 치환, 예를 들면 2 내지 10개의 보존성 치환, 2 내지 5개의 보존성 치환, 4 내지 9개의 보존성 치환, 예컨대 2, 5 또는 10개의 보존성 치환을 포함한다.
본원에서 사용되는 "재조합 단백질"은 브로모도메인을 암호화하는 둘 또는 그 이상의 유전자들이 연결됨으로써 생성된 융합단백질이다. 융합 유전자의 번역 결과 각각의 원래 브로모도메인으로부터 유도된 기능 특성을 가지는 단일한 폴리펩티드가 생성된다. 재조합 단백질 내의 브로모도메인은 바로 인접하여 연결되거나 링커를 통해 연결되어질 수 있다. 재조합 단백질은 생물학적 연구나 치료에 사용하기 위한 재조합 DNA 기술에 의해 인공적으로 생성될 수 있다. 재조합 단백질의 기능성은 많은 단백질의 기능성 도메인이 모듈 방식으로 발휘한다.
본원에서 사용되는 "링커"는 두 개의 구별되는 폴리펩티드 또는 폴리펩티드 단편을 연결하거나 분리하기 위해 사용될 수 있는 아미노산 서열 또는 삽입부분일 수 있다. 본원에서 제공되는 폴리펩티드는, 예를 들면 아미노산 GLS, ALS 또는 LLA를 포함하는 아미노산 링커를 가질 수 있다. 본원에서 사용되는 "태그"는 제공된 폴리펩티드를 검출하거나 정제하기 위해 사용될 수 있는 구별되는 아미노산 서열일 수 있다.
2. 내재화 서열
BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합단백질은 효과적으로 세포 안으로 들어가기 위해 내재화 서열 혹은 단백질 변환 도메인에 연결될 수 있다.
최근의 연구 결과 여러 개의 세포 침투 펩티드, 이를테면 HIV 바이러스의 TAT 전이활성 도메인, 안테나페디아, 및 쉽게 분자 및 작은 펩티드를 원형질막을 가로질러 수송할 수 있는 트랜스포탄(transportan)이 확인되었다. 또한, 폴리아르기닌은 원형질막을 가로질러 펩티드와 단백질을 훨씬 더 효율적으로 수송함으로써 펩티드 중재된 수송에 대한 매력적인 도구가 되고 있다. 노나아르기닌은 가장 효율적인 폴리아르기닌 기저 단백질 변환 도메인 중 하나이고, TAT나 안테나페디아보다 더 큰 최대 흡수를 나타낸다. 펩티드 중재된 세포독성은 또한 폴리아르기닌-기저 내재화 서열이 더 작은 것으로 나타났다. R9 중재된 막 수송은 헤파란 술페이트 프로테오글리칸 결합 및 세포내 패키징을 통해 촉진된다. 일단 내재화되면, 헤파란은 헤파라나제에 의해 분해되고, 그 결과 R9가 방출되어 세포질로 이동된다. 강력한 세포 침투 펩티드로서 리아르기닌이 알려져 있는데, 폴리아르기닌의 유도체가 전체 길이의 p53 단백질을 구강 암세포에 전달하여 그것의 성장과 전이를 억제하였다.
따라서, BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질은 세포 내재화 수송물질 또는 서열을 포함할 수 있다. 세포 내재화 서열은 공지되어 있거나 새롭게 당해 기술분야에서 발견된 임의의 내재화 서열, 또는 그것의 보존성 변이체일 수 있다. 세포내재화 수송물질 및 서열의 비-제한적인 예로는 폴리아르기닌(예컨대 R9), 안테나페디아 서열, TAT, HIVTat, 페네트라틴(Penetratin), Antp-3A(Antp 돌연변이체), Buforin II, 트랜스포탄, MAP(모델 양친매성 펩티드), K-FGF, Ku70, 프리온, pVEC, Pep-1, SynB1, Pep-7, HN-1, BGSC(비스-구아니디니움-스퍼미딘-콜레스테롤) 및 BGTC(비스-구아니디니움-트렌-콜레스테롤)가 있다. 또한 BRG-1 유래의 브로모도메인 또는 이를 둘 이상 포함하는 재조합단백질은 추가로 BGSC(비스-구아니디니움-스퍼미딘-콜레스테롤) 또는 BGTC (비스-구아니디니움-트렌-콜레스테롤)을 포함할 수 있다.
표 2
명칭 서열
폴리아르기닌 RRRRRRRRR
Antp RQPKIWFPNRRKPWKK
HIV-Tat GRKKRRQRPPQ
페네트라틴 RQIKIWFQNRRNKWKK
Antp-3A RQIAIWFQNRRNKWAA
Tat RKKRRQRRR
부포린 II TRSSRAGLQFPVGRVHRLLRK
트랜스포탄 GWTLNSAGYLLGKINKALAALAKKIL
모델 양친매성 펩티드(MAP) KLALKLALKALKAALKLA
K-FGF AAVALLPAVLLALLAP
Ku70 VPNLK-PNLKE
프리온 MANLGYWLLALFVTNWTDVGLCKKRPKP
pVEC LLIILRRRIRKQAHAHSK
Pep-1 KETWWETWWTEWSQPKKKRKV
SynB1 RGGRLSYSRRRFSTSTGR
Pep-7 SDLWEMMNVSLACQY
HN-1 TSPLNIHNGQKL
BGSC(비스-구아니디니움-스퍼미딘-콜레스테롤)
Figure PCTKR2012002773-appb-I000001
BGSC
BGTC(비스-구아니디니움-트렌-콜레스테롤)
Figure PCTKR2012002773-appb-I000002
BGTC
3. 종양-특이적 표적화
BRG-1 유래의 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편은 종양 특이적 표적화 서열을 추가로 포함할 수 있으나, 특별히 이에 제한되지 않는다.
방사선 민감제는 오직 종양 세포만을 감지하며, 정상 세포에 도입되는 않는 것이 바람직하다. 이를 위한 한 접근법은 내재화 및 종양 특이적 표적화 능력 두 가지 모두를 가지고 있는 폴리펩티드(예컨대 변형되거나 융합된 단백질)를 활용하는 것이다. 종양 혈관 구조는 주변의 정상 조직의 혈관구조와 다르다. 생화학적으로, 종양 혈관은 많은 혈관신생-관련 분자, 예컨대 특정한 인테그린, 내피세포 성장인자 수용체, 프로테아제, 세포표면 프로테오글리칸 및 세포외재성 매트릭스성분 들을 발현함으로써 자기 자신을 나머지 혈관과 구별한다(Ruoslahti, 2000). 마우스에 주사되었을 때 종양혈관구조로 복귀되는 펩티드에 대한 라이브러리를 나타내는 파지의 생체 내 선별은 종양 회귀에 대한 여러 모티프를 시사하였다. 그것에는 순환성 펩티드 CDCRGDCFC의 RGD, 및 순환성 종양-회귀 펩티드, CNGRC의 NGR이 포함된다. NGR-함유 펩티드는 세포독성 약물, 프로-아폽토시스성 펩티드, 및 종양 괴사 인자 를 종양 혈관구조로 전달하는 데 유용한 것으로 증명되었다. 세 번째 모티프인 GSL 또한 다양한 유형의 종양으로 선별할 때 자주 분리되었다. RGD, NGR 및 GSL 모티프 펩티드를 운반하는 파지의 종양 회귀는 종양 유형과 무관하며, 오히려 회귀는 종양 혈관구조의 혈관신생 특성에 좌우된다. NGR 종양 회귀 펩티드에 대한 수용체는 인테그린이 아니다. 대신, 아미노펩티다제 N(APN 또는 CD13)은 종양 혈관구조에서 NGR 모티프 펩티드에 대한 수용체로서 확인되었다. NGR-함유 펩티드는 세포독성 약물, 프로-아폽토시스성 펩티드, 및 종양 괴사 인자 를 종양 혈관구조로 전달하는 데 유용한 것으로 증명되었다. NGR 펩티드가 전립선의 일차 및 전이성 종양에 결합할 수 있지만, 정상적인 전립선 조직에는 결합하지 않는다. NGR 펩티드는 또한 시토졸성 내재화에 대한 능력을 나타낸다.
특이한 조직을 표적으로 할 수 있는 어떠한 분자든지 본 발명의 폴리펩티드의 표적화 분자로서 사용될 수 있다. 예를 들어 표적화 분자는 사람 상피 세포 뮤신(Muc-1; Muc-1 당단백질에 대한 20 아미노산 코어 반복, 유방암세포와 전립선 암세포에 존재한다), Ha-ras 종양유전자생성물, p53, 암태아성 항원(CEA), raf 종양유전자 생성물, gp100/pme17, GD2, GD3, GM2, TF, sTn, MAGE-1, MAGE-3, BAGE, GAGE, 티로시나제, gp75, 멜란-A/Mart-1, gp100, HER2/neu, EBVLMP 1 & 2, HPV-F4, 6, 7, 전립선-특이적 항원(PSA), HPV-16, MUM, 알파-페토단백질(AFP), CO17-1A, GA733, gp72, p53, ras 종양유전자 생성물, HPV E7, 빌름 종양 항원-1, 텔로머라제, 흑색종 강글리오시드, 또는 단순 경막 서열과 상호작용하는 분자일 수 있으나, 특별히 이에 제한되지 않는다.
살아있는 신체에서 암세포에 치료제를 선택적으로 전달하는 것은 암에 특이적인 생체 마커의 표적화가 집중적으로 연구되는 또 다른 연구 영역이다. 폴레이트 수용체에 대한 단클론성 항체, CA-125에 대한 단클론성 항체 및 HER2/neu 항원에 대한 단클론성 항체를 사용하여 면역리포솜-중재된 표적화를 수행할 수 있으나, 특별히 이에 제한되지 않는다.
4. 폴리뉴클레오티드
BRG-1 유래의 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 코딩하는 폴리뉴클레오티드는 예를 들면 뉴클레오티드, 뉴클레오티드 유사체, 또는 뉴클레오티드 치환체일 수 있으나, 특별히 이에 제한되지 않는다.
본 발명에 따른 BRG-1 유래의 브로모도메인을 코딩하는 폴리뉴클레오티드는 서열번호 1에 기재된 아미노산 서열을 코딩하는 폴리뉴클레오티드일 수 있으며, 바람직하게는 서열번호 2로 기재된 폴리뉴클레오티드이며, 상기 서열뿐만 아니라 상기 서열과 70% 이상의 유사성을 가지는 서열, 바람직하게는 80% 이상의 유사성, 더욱 바람직하게는 90% 이상의 유사성, 보다 더욱 바람직하게는 95% 이상의 유사성, 가장 바람직하게는 98% 이상의 유사성을 나타내는 서열로서 실질적으로 이에 의하여 코딩된 단백질이 아세틸화 히스톤에 결합 활성을 갖을 수 있는 폴리뉴클레오티드를 포함할 수 있다. 또한, BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합단백질을 코딩하는 폴리뉴클레오티드는 상기 서열번호 1에 기재된 아미노산 서열을 코딩하는 폴리뉴클레오티드가 둘 이상 포함되도록 연결되어 포함되어 있는 폴리뉴클레오티드가 될 수 있으나, 특별히 이에 제한되지 않는다.
본원에서 사용되는 "폴리뉴클레오티드"는 본 발명의 BRG-1 유래의 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 코딩하는 DNA 또는 상기 DNA로부터 유래된 RNA를 의미한다, 예를 들어, 자율적으로 복제하는 플라스미드 또는 바이러스 또는 원핵세포 혹은 진핵세포의 게놈 DNA에 통합되는(예컨대 유전자도입); 또는 별도의 분자로서 존재하는(예컨대 PCR, 제한 엔도뉴클레아제 소화, 혹은 화학적 또는 시험관 내 합성에 의해 제조된 cDNA 또는 게놈 혹은 cDNA 단편) 재조합 DNA 등이 될 수 있으나, 특별히 이에 제한되지 않는다.
BRG-1 유래의 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 암호화하는 폴리뉴클레오티드는 발현 조절 서열에 작동가능하게 연결될 수 있다. 또한, 상기 폴리뉴클레오티드를 하나 또는 그 이상으로 포함하는 벡터가 제공되는데, 벡터 안에서 상기 폴리뉴클레오티드는 발현 조절 서열에 작동가능하게 연결된다.
생체 내에서나 시험관 내에서 폴리뉴클레오티드를 전달하기 위해 사용될 수 있는 방법은 다수 공지되어 있다. 이들 방법은 크게 두 부류로 나누어지는데, 하나는 바이러스를 기초로 한 전달 시스템이고, 다른 하나는 바이러스를 기초로 하지 않는 전달 시스템이다. 예를 들어, 본 발명의 폴리뉴클레오티드는 많은 직접적인 전달 시스템, 예컨대 일렉트로포레이션, 리포펙션, 칼슘 포스페이트 침전, 플라스미드, 바이러스 벡터, 바이러스 폴리뉴클레오티드, 파지 폴리뉴클레오티드, 파지, 코스미드, 또는 세포 또는 담체, 예컨대 양이온 리포솜을 이용한 유전자 물질의 전달을 통해 전달될 수 있다.
상기 본 발명의 폴리뉴클레오티드는 예를 들면 리포솜, 예컨대 양이온 리포솜(예를들면 DOTMA, DOPE, DC-콜레스테롤) 또는 음이온 리포솜과 같은 지질과 함께 사용될 수 있다. 리포솜은 추가로, 필요에 따라, 특정 세포를 표적화하는 것을 촉진하기 위한 단백질을 포함할 수 있다. 화합물과 양이온 리포솜을 포함하는 조성물의 투여는 표적 기관에 구심성인 혈액에 투여되거나 기도의 세포를 표적으로 하기 위해 기도 안으로 흡입될 수 있다.
숙주 세포 게놈 안에 통합될 세포에 전달되는 폴리뉴클레오티드는 전형적으로 통합 서열을 함유한다. 이들 서열은 때로 바이러스 관련된 서열로, 특히 바이러스 기초 시스템이 사용될 때 그러하다. 이들 바이러스 통합 시스템은 또한 비-폴리뉴클레오티드 기초 전달 시스템, 예컨대 리포솜을 사용하여 전달되는 폴리뉴클레오티드 안에 통합되고, 그로써 전달 시스템에 함유된 폴리뉴클레오티드는 숙주 게놈 안에 통합될 수 있다.
숙주 게놈 안에 통합하기 위한 다른 일반적인 기법들로는 예를 들면 숙주 게놈과의 동종 재조합을 촉진하기 위해 계획된 시스템을 포함한다. 그런 시스템은 전형적으로 벡터 폴리뉴클레오티드와 표적 폴리뉴클레오티드 사이의 재조합이 일어나서 숙주 게놈 안으로 전달된 폴리뉴클레오티드가 통합될 수 있도록 숙주 게놈 내의 표적 서열과 충분한 상동성을 가지는, 발현될 폴리뉴클레오티드의 양옆의 서열에 의존한다.
브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 이들의 단편을 암호화하는 폴리뉴클레오티드는 피험자의 세포에 생체 내에서 및/또는 생체 외에서 당해 기술분야에 잘 알려져 있는 다양한 메커니즘(예컨대 순수한 DNA의 흡수, 리포솜 융합, 유전자 총을 경유한 DNA의 근육내 주사, 세포 이물흡수작용 등)에 의해 전달될 수 있다.
5. 벡터
브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합단백질 또는 이들의 단편을 암호화하는 폴리뉴클레오티드, 또는 그것의 보존성 변이체는 벡터 형태로 암세포를 형질전환시킬 수 있다.
전달 벡터는 유전자를 세포(예컨대 플라스미드) 안으로 전달하기 위하여, 예컨대 재조합 레트로바이러스 또는 아데노바이러스의 일부로서 사용되는 어떠한 뉴클레오티드 구성물일 수 있다.
본원에서 사용되는 플라스미드 또는 바이러스 벡터는 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합단백질 또는 이들의 단편을 암호화하는 폴리뉴클레오티드를 분해됨이 없이 세포안에 수송하는 것이고, 그것이 전달되는 세포에서 유전자의 발현을 촉진하는 프로모터를 포함한다. 이때, 상기 프로모터는 바이러스 혹은 레트로바이러스로부터 유도되는데, 상기 바이러스 벡터는 예를 들면 아데노바이러스, 아데노-결합 바이러스, 포진 바이러스, 백시니아 바이러스, 폴리오 바이러스, AIDS 바이러스, 신경 영양성 바이러스, 신드비스 및 다른 RNA 바이러스와, HIV 골격을 가지고 있는 상기 바이러스 등이 될 수 있고, 상기 레트로바이러스는 쥐과의 말로니 백혈병 바이러스, MMLV, 및 벡터로서 MMLV의 바람직한 특성을 발현하는 레트로바이러스 등이 될 수 있다.
상기 아데노바이러스 벡터는 상대적으로 안정하며, 사용하기가 용이하고, 고역가를 가지고 있으며, 에어로솔 제형으로 전달될 수 있고, 분할하지 않는 세포를 형질전환할 수 있다. 수두바이러스 벡터는 크고 유전자 삽입을 위한 부위가 여러 개이며, 열에 안정하고 실온에서 보관할 수 있다. 또한 바이러스 항원에 의해 유도된, 숙주 유기체의 면역 반응을 억제하기 위해 유전공학적으로 제조된 바이러스 벡터를 사용할 수 있으며, 이런 유형의 벡터는 인터류킨 8 또는 10에 대한 코딩 영역을 운반할 수 있다.
또한, 상기 레트로바이러스는 모든 유형, 하위패밀리, 부류, 친화성을 포함하여 레트로비리다에의 바이러스 패밀리에 속하는 동물 바이러스이다. 레트로바이러스는 본질적으로 폴리뉴클레오티드 내용물을 그 안에 포장하는 패키지이기 때문에, 다른 바이러스 벡터보다 더 큰 유전자 하중, 즉 도입유전자 또는 마커 유전자를 운반할 수 있다는 장점이 있어, 통상적으로 사용되고 있으나, 다만 증식하지 않는 세포에서는 유용하지 않을 수 있다.
이러한 복제-결핍성 아데노바이러스를 벡터로서 사용할 때의 장점은 그것들이 다른 세포 유형으로 확산될 수 있는 정도로만 제한된다는 것이다. 왜냐하면 그것들은 초기 감염된 세포 내에서 복제할 수 있지만, 새로운 감염성 바이러스 입자를 형성할 수는 없기 때문이다. 재조합 아데노바이러스는 직접 기도 내피세포, 간세포, 혈관 상피세포, CNS 유조직 및 많은 다른 조직 부위로 생체 내에서 전달된 후에 고효율의 유전자 전달을 이루는 것으로 밝혀졌다. 재조합 아데노바이러스는 특이한 세포표면 수용체에 결합함으로써 유전자 변환을 이루며, 그런 후 바이러스는 야생형 또는 복제-결핍성 아데노바이러스와 동일한 방식으로 수용체-중재된 세포 이물 흡수에 의해 내재화된다.
바이러스 벡터는 E1 유전자가 제거되어 있는 아데노바이러스를 토대로 한 것이며, 이들 비리온은 사람 293 세포주와 같은 세포주에서 생성된다. 한 측면으로 E1과 E3 유전자는 둘 다 아데노바이러스 게놈으로부터 제거된다.
다른 유형의 바이러스 벡터는 아데노-결합 바이러스(AAV)를 토대로 한다. 이 결핍성 파르보바이러스는 많은 세포 유형을 감염시킬 수 있지만 사람에게는 병을 일으키지 않는다. AAV, 유형의 벡터는 약 4 내지 5 kbp를 수송할 수 있고, 야생형 AAV는 염색체 19 안으로 안정하게 삽입하는 것으로 알려진다. 실례로서, 이런 벡터는 Avigen(San Francisco, CA)에 의해 제조된 P4.1 C 벡터일 수 있고, 그것은 단순 포진 바이러스 티미딘 키나제 유전자, HSV-tk, 및/또는 마커 유전자, 예컨대 그린 형광 단백질, GFP를 암호화하는 유전자를 함유할 수 있다.
AAV 바이러스의 다른 유형으로, AAV는 프로모터를 함유하는 최소한 하나의 카세트의 양 옆에 한 쌍의 역전된 말단 반복부(ITR)을 함유하고 있는데, 그것은 이종성 유전자에 작동가능하게 연결된 세포-특이적 발현을 지시한다. 이런 맥락에서 이종성은 AAV 또는 B19 파르보바이러스에 고유하지 않은 임의의 뉴클레오티드 서열 또는 유전자를 말한다.
전형적으로 AAV 및 B19 코딩 영역은 결실되었고, 그 결과 안전하고 비세포독성인 벡터가 생성된다. AAV ITR 또는 그것의 변형은 감염성 및 부위-특이적 통합을 부여하지만 세포독성은 나타내지 않으며, 프로모터는 세포-특이적 발현을 지시한다.
상기 개시된 벡터는 실질적인 독성없이 포유류 염색체 안에 통합될 수 있는 DNA 분자를 제공할 수 있다.
바이러스 및 레트로바이러스에 삽입된 유전자는 보통 원하는 유전자 생성물의 발현을 조절하는 것을 보조하기 위해 프로모터, 및/또는 인핸서를 함유한다. 프로모터는 일반적으로 전사 출발 부위와 관련하여 상대적으로 고정된 위치에 있을 때 기능을 하는 DNA의 서열 또는 서열들이다. 프로모터는 RNA 중합효소 및 전사 인자들의 기본적인 상호작용에 필요한 코어 요소를 함유하며, 상류 쪽 요소들과 반응 요소들을 함유할 수 있다.
커다란 사람 포진 바이러스를 사용하여 수행한 분자유전학 실험들은 커다란 이종성 DNA 단편이 포진 바이러스로 감염되기 쉬운 세포에서 클론되고, 증식되며 수립될 수 있는 수단을 제공하였다. 이들 커다란 DNA 바이러스들(단순 포진 바이러스, HSV; 엡스타인-바르 바이러스, EBV)은 특이한 세포에 대하여 150 kbp보다 큰 사람 이종성 DNA의 단편들을 전달할 수 있는 잠재력이 있다. EBV 재조합체는 에피솜성 DNA와 같은 감염된 B-세포에서 DNA의 큰 조각을 유지할 수 있다. 개별적인 클론들은 유전적으로 안정해 보이는 330 kbp까지의 사람 유전자 삽입물을 운반하였다. 이들 에피솜을 유지하기 위해서는 EBV로 감염되는 동안 구조적으로 발현되는 특이한 EBV 핵 단백질인 EBNA1이 필요하다. 추가로, 이들 벡터는 형질전환을 위해 사용될 수 있으며, 그때 다량의 단백질이 일시적으로 시험관 내에서 생성될 수 있다. 포진바이러스 암플리콘 시스템은 또한 220 kbp보다 큰 조각들을 패키지하고 에피솜으로서 DNA를 안정하게 유지할 수 있는 세포를 감염시키기 위하여 사용되기도 한다.
다른 유용한 시스템으로는 예를 들면 복제 및 숙주-제한된 비-복제 백시니아 바이러스 벡터가 있다.
포유류 숙주 세포의 벡터로부터 전사를 조절하는 프로모터는 다양한 공급원, 예를 들면 바이러스, 예컨대 폴리오마 바이러스, 유인원 바이러스 40(SV40), 아데노바이러스, 레트로바이러스, B형 간염 바이러스, 사이토메갈로바이러스의 게놈으로부터, 또는 이종성 포유류 프로모터, 예컨대 베타 액틴 프로모터로부터 얻어질 수 있다.
SV40 바이러스의 초기 및 후기 프로모터는 편리하게도 또한 SV40 바이러스 복제 기원을 함유하고 있는 SV40 제한 단편으로서 얻어진다. 사람 사이토메갈로바이러스의 즉시 초기 프로모터는 편리하게도 HindIII E 제한 단편으로서 얻어진다. 물론 숙주 세포 또는 관련된 종으로부터 얻어지는 프로모터 또한 본원에서는 유용하다.
프로모터는 또한 전사 조절을 중재하는 반응 요소들을 함유한다. 인핸서는 때로 유전자의 발현 조절을 결정한다. 많은 인핸서 서열이 포유류 유전자(글로빈, 엘라스타제, 알부민, -페토단백질 및 인슐린)로부터 공지되어 있는 한편, 전형적으로 누구든지 일반적인 발현을 위해 진핵세포 바이러스로부터의 인핸서를 사용할 것이다. 그것의 실례는 복제 기원의 후기에 작용하는 SV40 인핸서(100 ~ 270 bp), 사이토메갈로바이러스 초기 프로모터 인핸서, 복제 기원의 후기에 사용되는 폴리오마 바이러스 인핸서, 및 아데노바이러스 인핸서이다.
프로모터 및/또는 인핸서는 그것들의 기능을 야기하는 특이한 화학적 사건 또는 빛에 의해 특이하게 활성화된다. 시스템은 테트라사이클린 및 덱사메타손과 같은 시약들에 의해 조절될 수 있다. 또한 방사선, 예컨대 감마 방사선, 또는 알킬화 화학요법 약물에 노출함으로써 바이러스 벡터 유전자 발현을 증강시키는 방법들이 있다.
상기 프로모터 및/또는 인핸서 영역은 전사될 전사 유닛의 영역의 발현을 최대화하기 위하여 구조적 프로모터 및/또는 인핸서로서 작용할 수 있다. 어떤 구성물에서 프로모터 및/또는 인핸서 영역은 그것이 특별한 시간에 세포의 특별한 유형에서만 발현된다 할지라도, 모든 진핵세포 유형에서 활성이다. 이런 유형의 프로모터는 CMV 프로모터(650 bp)이다. 이러한 다른 프로모터는 SV49 프로모터, 사이토메갈로바이러스(전 길이의 프로모터), 및 레트로바이러스 벡터 LTR 등이 있다.
진핵 숙주세포(효모, 진균, 곤충, 식물, 동물, 사람 또는 핵화된 세포)에서 사용된 발현 벡터는 또한 mRNA 발현에 영향을 미칠 수 있는 전사의 종결에 필요한 서열들을 함유할 수 있다. 이들 영역은 조직 인자 단백질을 암호화하는 mRNA의 미번역 부분에서 폴리아데닐화된 절편으로서 전사된다. 3' 미번역 영역은 또한 전사 종결 부위를 포함한다. 전사 유닛은 또한 폴리아데닐화 영역을 함유할 수 있다. 이 영역의 한 가지 잇점은 그것이 전사된 유닛이 mRNA와 같이 프로세스되고 수송될 가능성을 증가시킨다는 것이다. 발현 구성물에서 폴리아데닐화 신호의 확인 및 사용에 대해서는 잘 정립되어 있다. 어떤 전사 유닛에서는, 폴리아데닐화 영역은 SV40 초기 폴리아데닐화 신호로부터 유도되고, 약 400 bp로 구성된다.
바이러스 벡터는 마커 생성물을 암호화하는 폴리뉴클레오티드 서열을 포함할 수 있다. 이 마커 생성물은 유전자가 세포에 전달되었는지, 또 일단 전달되면 발현되는 지를 측정하기 위해 사용된다. 포유류 세포에 대한 적당한 선택가능한 마커의 실례는 디히드로폴레이트 환원효소(DHFR), 티미딘 키나제, 네오마이신, 네오마이신 유사체 G418, 히드로마이신, 및 퓨로마이신이다. 선택가능한 마커가 포유류 숙주세포에 성공적으로 전달될 때 형질전환된 포유류 숙주세포는 선택적인 압력하에 놓인 것처럼 생존할 수 있다.
본 발명의 일구체예에서 사용한 벡터는 3개의 핵위치신호(nuclear localization signal, NLS; 서열번호 3), myc epitope(서열번호 4) 및 BRG-1 유전자의 BRG-1 유전자의 브로모도메인을 암호화하는 서열(bromodomain, BRD; 서열번호 1 또는 2)을 하나 이상을 포함한다. 예컨데, 도 1 내지 2의 개열지도를 가지는 재조합 벡터 pCMV-BRG1-BRD, pEGFP-myc-BRG1-BRD(-dimer 또는 -tetramer) 이다.
6. 약제학적으로 허용되는 담체
본 발명에 따른 방사선 민감제 조성물은 유효 약물의 투여, 전달 또는 이의 사용을 보조하기 위하여 담체를 더 포함할 수 있다. 담체는 예를 들면 작은 분자, 약제학적 약물, 지방산, 검출가능한 마커, 포함용 태그, 나노입자 또는 효소일 수 있다.
담체는 당업자에게 잘 알려져 있는 것과 같이, 자연적으로 활성 성분의 어떠한 분해를 최소화하고 피험자에게서 어떠한 해로운 부작용을 최소화하기 위하여 선택될 수 있다.
전형적으로 적절한 양의 약제학적으로 허용되는 염이 제형을 등장성으로 만들게 하기 위해 제형에 사용된다. 약제학적으로 허용되는 담체의 비제한 것인 예로는 식염수, 링거액 및 덱스트로오스 용액이 있다. 용액의 pH는 바람직하게는 약 5 내지 약 8이며, 보다 바람직하게는 약 7 내지 약 7.5이다. 또한 담체는 항체를 함유하고 있는 고체 소수성 중합체의 반투과성 매트릭스와 같은 방출 지속성 제제를 포함하는데, 이때 매트릭스는 어떤 형태를 갖춘 물품의 형태, 예를 들면 필름, 리포솜 또는 미소입자이다.
약제학적 담체들은 대부분 전형적으로 사람에 투여되는 약물용인 표준 담체, 이를테면 멸균수, 식염수, 및 생리적 pH의 완충 용액일 것이다.
본 발명에 따른 방사선 민감제 조성물은 선택된 분자 외에 담체, 농축제, 희석제, 완충제, 보존제, 표면 활성제 등을 포함할 수 있다. 또한 항균제, 항염증제, 마취제 등과 같은 하나 또는 그 이상의 활성 성분을 포함할 수 있다.
비경구 투여를 위한 제제는 멸균된 수성 또는 비-수성 용액, 현탁액, 및 에멀션을 포함한다. 비-수성 용매의 실례로는 프로필렌 글리콜, 폴리에틸렌 글리콜, 식물성 기름, 예컨대 올리브유, 및 주사가능한 유기 에스테르, 예컨대 에틸 올레에이트가 있다. 수성 담체는 물, 알코올성/수성 용액, 에멀션 또는 현탁액, 이를테면 식염수와 완충된 배지를 포함한다. 비경구용 비히클은 염화나트륨 용액, 링거용 덱스트로오스, 덱스트로오스 및 염화 나트륨, 락테이트화된 링거액, 또는 고정 오일을 포함한다. 정맥내 비히클로는 유체 및 영양분 보충제, 전해질 보충제 (예컨대 링거용 덱스트로오스를 토대로 하는 것), 등이 있다. 보존제 및 다른 첨가제들, 예를 들면 항미생물제, 항산화제, 킬레이트화제, 및 비활성 기체 등이 존재할 수 있다.
국소 투여용 제형은 연고, 로션, 크림, 겔, 점적액(drop), 좌제, 분무제, 액체 및 분말을 포함한다. 종래의 약제학적 담체, 수성, 분말 또는 유성 기제, 농축제 등도 바람직할 수 있다.
경구 투여를 위한 제형은 분말 또는 과립, 물 또는 비-수성 매질 중의 현탁액 또는 용액, 캡슐, 1회용 봉지, 또는 정제를 포함한다. 농축제, 풍미제, 희석제, 유화제, 분산 보조제 또는 결합제도 바람직하다.
본 발명에 따른 방사선 민감제 조성물은 잠재적으로 무기산, 예컨대 염산, 브롬화수소산, 과염소산, 질산, 티오시안산, 황산, 및 인산, 및 유기산, 예컨대 포름산, 아세트산, 프로피온산, 글리콜산, 락트산, 피루브산, 옥살산, 말론산, 숙신산, 말레산, 및 푸마르산과의 작용에 의해, 또는 수산화나트륨, 수산화암모늄, 수산화칼륨과 같은 무기 염기, 및 모노-, 디-, 트리알킬 및 아릴 아민과 치환된 에탄올아민과 같은 유기 염기와의 반응에 의해 형성된 약제학적으로 허용되는 산- 또는 염기-부가염으로서 투여될 수 있다.
본 발명에 따른 방사선 민감제 조성물은 용액, 현탁액(예를 들면 미소입자, 리포솜, 또는 셀에 통합된)의 형태일 수 있다. 이것들은 항체, 수용체, 또는 수용체 리간드를 경유하여 특별한 세포 유형을 표적으로 할 수 있다. 스텔스(stealth) 및 다른 항체 포합된 리포솜(콜로니성 암종에 대한 지질 중재된 약물 표적화를 포함하여)과 같은 비히클, 세포 특이적 리간드를 통한 DNA의 수용체 중재된 표적화, 림프구 지시된 종양 표적화, 및 생체 내에서의 쥐 교질세포의 매우 특이한 치료용 레트로바이러스 표적화가 일례이다. 일반적으로, 수용체는 세포 이물흡수작용의 경로에, 그것이 구조적이거나 리간드 유도될 수 있다. 이들 수용체는 클라트린(clathrin)-코팅된 씨 모양으로 밀집하여 클라트린-코팅된 소포체를 경유하여 세포로 들어가, 수용체가 분류되는 산성화된 엔도솜을 통과한 후, 세포표면으로 재순환하여 세포내에서 보관되거나, 또는 리소솜에서 분해된다.
내재화 경로는 다양한 기능, 예를 들면 영양분 흡수, 활성화된 단백질의 제거, 거대분자의 제거, 바이러스와 독소의 기회주의적인 유입, 리간드의 결합 및 분해, 및 수용체-수준의 조절을 수행한다. 많은 수용체가 세포유형, 수용체 농도, 리간드의 유형, 리간드 원자가, 및 리간드 농도에 따라 하나 이상의 세포내 경로를 따른다.
담체 분자는 BRG-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질에 공유결합으로 연결될 수 있다. 담체 분자는 개시된 펩티드의 아미노 말단부에 연결될 수 있다. 담체 분자는 브로모도메인을 둘 이상 포함하는 재조합 단백질의 카르복시 말단부에 연결될 수 있다. 담체 분자는 브로모도메인을 둘 이상 포함하는 재조합 단백질 내에 있는 아미노산에 연결될 수 있다. 본 발명에 따른 방사선 조성물은 나아가 담체 분자와 브로모도메인을 둘 이상 포함하는 재조합 단백질을 연결시키는 링커를 포함할 수 있다. 브로모도메인 또는 이를 둘 이상 포함하는 재조합단백질은 또한 미소입자, 나노쉘의 나노입자를 또는 이를 둘 이상 포함하는 재조합단백질로 코팅하는 데 사용될 수 있는 소 혈청 알부민(BSA; Tkachenko et al., (2003) J Am Chem Soc, 125, 4700-4701)과 같은 코팅 분자에 포합될 수 있다.
7. 투여 방법
본 발명에 따른 방사선 민감제 조성물은 포유동물에 투여될 수 있다. 본 발명에서 용어, "포유동물" 은 인간, 가축과 사육 동물, 및 동물원용, 경기용 또는 애완용 동물, 예를 들면, 개, 고양이, 소, 말, 양, 돼지, 염소, 토끼 등을 포함하는 포유동물로서 분류되는 모든 동물을 의미한다. 바람직하게는, 포유동물은 인간이다.
본 발명에 따른 방사선 민감제 조성물은 국소, 경구, 또는 비경구 경로에 의해 투여될 수 있다. 예를 들어, 방사선 민감제 조성물은 체외, 두개내, 질내, 항문내, 피하, 진피내, 심장내, 위내, 정맥내, 근육내, 복강내 주사, 경피, 비강내, 또는 흡입에 의해 투여될 수 있다. "두개내 투여"는 물질을 뇌로 직접 송달하는 것을 의미하며, 예를 들어 카테터나 바늘을 통한 수막공간내, 수조내, 뇌실내 또는 나비-경유 송달을 포함한다.
필요한 방사선 민감제 조성물의 정확한 양은 종, 나이, 체중 및 피험자의 일반적 상태, 치료될 알러지성 장애의 중증도, 사용된 특정 폴리뉴클레오티드 또는 벡터, 투여 방식 등에 따라서 피험자마다 다를 것이다. 따라서, 모든 방사선 민감제에 대해서 정확한 양을 특정하는 것은 불가능하다. 그러나, 본원에 교시된 통상적인 실험을 이용하여 당업자에 의해 적절한 양은 결정될 수 있다.
방사선 민감제 조성물은 용액 또는 현탁액(예를 들어, 마이크로입자, 리포솜, 또는 세포와 통합된) 형태일 수 있다. 이것들은 항체, 수용체, 또는 수용체 리간드에 의해 특정 세포 타입을 표적으로 할 수 있다. 부형제, 예를 들어 '스텔스' 및 다른 항체 포합체 리포솜(결장암종을 표적으로 하는 지질 매개 약물을 포함한다), 세포 특이적 리간드를 통한 DNA의 수용체 매개 표적화, 림프구 지정 종양 표적화, 및 뮤린 신경교종 세포의 고도 특이적 치료 레트로바이러스 표적화가 생체내에서 사용된다. 일반적으로, 수용체는 구성성 또는 리간드 유도성 엔도사이토시스의 경로에 연관된다.
이런 수용체들은 클라트린-코팅 오목부에서 클러스터를 이루고, 클라트린-코팅 소낭을 통해 세포로 진입하여, 수용체들이 정렬되는 산성화된 엔도솜을 통과한 다음, 세포 표면으로 재순환되거나, 세포내 저장되거나, 또는 리소좀에서 변성된다. 내재화 경로는 영양물 흡수, 활성화 단백질 제거, 거대분자 청소, 바이러스 및 독소의 기회감염적 진입, 리간드의 해리 및 변성, 그리고 수용체-레벨 조절과 같은 다양한 기능을 제공한다. 대부분의 수용체들은 세포 타입, 수용체 농도, 리간드 타입, 리간드 원자가, 및 리간드 농도에 따라서 하나 이상의 내재화 경로를 따른다.
방사선 민감제 조성물은 국소 치료가 바람직한지 아니면 전신 치료가 바람직한지에 따라서, 그리고 치료될 부위에 따라서 여러 방식으로 투여될 수 있다. 투여는 국소적으로(안구, 질, 직장, 비강내 경로), 경구적으로, 흡입에 의해, 또는 비경구적으로, 예를 들어 정맥내 드립, 피하, 복강내 또는 근육내 주사에 의해 이루어질 수 있다.
방사선 민감제 조성물의 효과적인 투여 용량 및 일정은 경험적으로 결정될 수 있으며, 이러한 결정은 당업자의 기술 범위 내이다. 방사선 민감제 조성물의 투여 용량 범위는 장애의 증상에 유효한 바람직한 효과를 야기하기에 충분히 넓은 범위이다.
예컨대, 방사선 민감제 조성물의 "치료 유효량" 은 (1) 종양 생장을 늦추는 효과와 완전히 정지시키는 효과를 포함하는, 어느 정도까지 종양 생장을 억제하는 효과; (2) 종양 세포의 수를 감소시키는 효과; (3) 종양 크기를 감소시키는 효과; (4) 종양세포가 말초 기관으로 침윤하는 것을 억제하는 효과 (즉, 종양세포가 말초 기관으로 침윤하는 것을 감소시키거나, 늦추거나 완전히 정지시키는 효과); (5) 전이의 억제 효과(즉, 전이의 감소, 완화 또는 완전한 정지 효과); (6) 반드시는 아니지만 종양을 억제시키거나 거부할 수 있는 항-종양 면역반응의 강화 효과; 및(또는) (7) 종양과 관련된 하나 이상의 증상을 어느 정도까지 완화시키는 효과 중에서 하나 이상의 효과를 나타낼 수 있는 양을 의미한다.
용량은 원치 않는 교차-반응, 과민성 반응 등의 부작용을 일으킬 만큼 크지는 않아야 한다. 일반적으로, 용량은 나이, 상태, 성별 및 환자의 질환 정도, 투여 경로, 또는 다른 약물이 섭생에 포함되는지의 여부에 따라 다르며, 당업자에 의해 결정될 수 있다. 용량은 어떤 대응처방의 결과로서 의사에 따라 조정될 수 있다. 용량은 변할 수 있으며, 1일 또는 수일 동안 하루 1회 이상의 용량 투여 방식으로 투여될 수 있다. 용량 범위는 방사선 민감제 조성물의 용도, 상태의 중증도, 및 투여 경로에 크게 의존한다.
예를 들어, 조사를 위한 연구 도구로서의 용도에서, 방사선 민감제 조성물은 0.01%(w/v) 정도의 낮은 용량으로 사용될 수 있다. 이 용량은 0.02%(w/v) 정도로 낮을 수 있으며, 아마 국소 치료에서는 2%(w/v) 정도로 높을 수도 있을 것이다. 암/종양 치료요법과 같은 용도에서는 또는 급성 조직 손상 직후에 조기 농축 볼루스로서 사용되는 경우에는 그 자체만으로 또는 다른 화합물과 조합하여 상당히 높은 조성물 농도가 사용될 수 있다. 이에 따라서, 제공된 폴리펩티드의 상한은, 예를 들어 종양 덩어리에 직접 초기 볼루스로서 송달되는 경우에는, 2 ~ 5%(w/v 또는 v/v)까지일 수 있다. 근육내, 대뇌내, 심장내 및 척추관내 등의 비경구 투여 경로에서 권장되는 용량 상한은 손상의 중증도에 따라서 1%(w/v 또는 v/v)일 수 있다. 이런 용량 상한은, 예를 들어 폴리펩티드(들)가 폴리펩티드의 작용을 촉진하거나 또는 폴리펩티드(들)와 합동해서 작용하는 다른 제제들과 어떻게 조합되느냐에 따라서 제제마다 다를 수 있다.
제공된 폴리펩티드의 연속 송달을 위하여, 예를 들어 정맥내 드립과 조합된 경우, 상태의 개선에 기초하여 의사에 의해 결정되는 시간 과정에 따라서 0.01 g/ 체중의 상한이 사용될 수 있다. 다른 예로서, 국소 송달되는 제공된 폴리뉴클레오티드 농도의 상한은, 예를 들어 폴리뉴클레오티드가 폴리뉴클레오티드의 작용을 촉진하거나 또는 폴리뉴클레오티드와 합동해서 작용하는 다른 제제들과 어떻게 조합되느냐에 따라서, 5 ~ 10 /일 것이다. 이것은 개선 상황에 기초하여 의사에 의해 결정되는 빈도로 반복될 수 있다. 다른 예로서, 근육내, 대뇌내, 심장내 및 척추관내 등, 내부적으로 송달되는 제공된 폴리뉴클레오티드 농도의 상한은 50 ~ 100 /이다. 이 경우에도 빈도는 개선 상황에 기초하여 의사에 의해 결정될 것이다.
또한, 수술 전에 제공된 폴리펩티드로 수술 부위를 예비-컨디셔닝할 수 있다. 폴리펩티드의 농도는 10 ~ 200 M일 수 있으며, 해당 부위 내에 펩티드(들)의 침투를 가능하게 하는 10 ~ 30% Pluronic 겔 또는 어떤 이러한 담체와 혼합하여 수술 전 적어도 3 ~ 6시간 동안 놓아둔다. 이런 예비-절차로서의 컨디셔닝은 염증 반응 감소를 비롯한 후속되는 수술에 대한 치유 반응을 개선할 수 있다.
8. 방사선요법
본 발명에 따른 암세포 방사선 치료용 방사선 민감제 조성물은 방사선 요법과 병용하여 사용될 수 있다.
방사선요법은 악성 세포의 DNA를 손상시키는 국소 치료 방법이다. 정상 세포는 종양 세포에 비해 이런 손상을 수선하는 능력이 더 크다. 방사선요법은 이런 차이를 이용한다.
방사선 요법은 국소 요법의 형태이므로, 일반적으로 부작용은 치료된 부위에 제한된다. 그러나, 공통된 전신 증상으로서 피로감이 있다. 많은 유전적 요인들이 일부 환자에서 2차 암의 소인이 되는 것이 사실이지만, 방사선 또한 관련 위험의 증가에 기여한다. 본 발명에 따른 방사선 민감제 조성물은 방사선의 필요량을 감소시킴으로써 이러한 부작용을 줄일 수 있다. 또한, 방사선에 민감한 암세포뿐만아니라, 방사선에 저항성이 있는 암세포에서도 방사선 민감도를 증가시킬 수 있다.
치료 처방은 치료 목표와 가능한 부작용을 기준으로 한다. 치료 과정은 1일 정도의 단기 과정과 10주 정도의 장기 과정이 있을 수 있으며, 전형적인 기간은 2 내지 7주이고, 일반적으로 매주 5일의 치료로 구성된다. 환자는 가장 일반적으로 치료 빔으로서 사용되거나 또는 치료 빔으로서 사용되는 x-선을 생성하는 전자를 가속하는 선형 가속장치를 통해 방사선을 받는다. 치료는 통증이 없고, 주로 5분 미만으로 지속된다.
치료 목표는 치유 또는 완화일 수 있다. 방사선요법이 잠재적으로 치유를 목표로 하는 경우, 치료기간이 대체로 더 길고, 일반적으로 장기간의 치료기간에 걸쳐서 소량의 일일 용량으로 구성된다. 이 접근법은 후기 부작용을 최소화한다. 치료가 엄밀히 완화를 목표로 하는 경우, 짧은 기간에 걸쳐서 다량의 일일 치료 용량으로 구성된 단기간의 치료 일정이 사용된다. 이러한 경우, 환자의 일생 동안 후기 부작용이 일어나지 않을 수 있다.
방사선요법은 많은 가능한 구체적인 처방을 가진다. 이것은 1차적 종양 치료로서, 수술 전 또는 수술 후 요법으로서, 또는 조합요법이나 병용요법의 성분으로서 주어질 수 있다.
방사선요법은 암 환자의 거의 2/3에서 적합하며, 치유 및 완화 목적으로 사용된다. 전립선암, 유방암, 두부와 경부암, 폐암, 뇌종양, 위장관 종양, 간암, 연조직육종, 자궁경부암, 림프종 등과 같은 많은 종양에서 치료 섭생의 일부로서 방사선요법을 수용할 것이다.
본 발명에서, 방사선 선원은 137Cs인 감마 방사선인 것이 바람직하나 이에 한정되지 않는다.
방사선요법은 외부 빔 방사선(x-선, -선, 양성자 및 중성자), 근접요법 및 방사선 활성 물질 이식을 포함한다. 방사선요법은 2-D, 3-D, 공초점, 강도-변조(IMRT) 및 이미지-가이드(IGRT) 접근법에 의해 투여될 수 있다. 대부분의 고형 종양에 적합한 표준 방사선요법은 약 60 Gys(50 ~ 70 Gys)의 총 용량으로 2 Gy/일로 제공된다. 그러나, 특정 피험자, 장치, 및 종양 타입에 기초하여 당업자가 바람직한 방사선 용량을 선택하는 것이 일반적이다. 본 발명에 따른 방사선 민감제 조성물은 방사선에 대한 암세포의 민감도를 증가시킴으로써 기존의 방사선 요법에 대한 개선을 구성한다. 예를 들어, 제공된 방법은 암세포로 하여금 방사선에 대해 적어도 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% 또는 이 이상의 민감도를 가지게 한다. 본원에서 사용된 용어 "민감도" 및 "방사선 민감도"는 방사선 용량에 기초한 생존하는 세포수를 말한다. 따라서, 방사선 민감도의 증가는 어떤 방사선 용량에서 생존하는 세포수의 감소, 치사량에 필요한 방사선 용량의 감소, 또는 이들의 조합을 야기할 수 있다.
밀봉 선원 방사선요법 또는 근접방사선요법(endocurietherapy)이라고도 알려진 근접요법은 방사선 활성 선원을 치료가 필요한 영역 내부에 또는 그 옆에 배치하는 방사선요법의 형태이다. 반대로, 외부 빔 방사선요법, 또는 원격요법은 선형 가속장치에 의해 외부에 생성된 방사선이 적용된다. 근접요법은 국소 전립선암 및 두부와 경부 암의 치료에 일반적으로 사용된다.
근접요법은 몰드 근접요법, 스트론튬 판 요법, 간극내 근접요법, 공동내 근접요법, 및 혈관내 근접요법을 포함한다. 몰드 근접요법에서, 표피에 가까운 종양이 피부 가까이 배치된 밀봉된 선원을 사용하여 치료될 수 있다.
표적 체적의 전체 부분에 대한 용량이 처방 용량의 10% 이내가 되도록 설계된 규칙-기반 접근법인 맨체스터 시스템과 관련하여 선량측정이 주로 수행된다. 일반적으로 스트론튬 판 요법이라고 하는 표면 적용장치는 1 두께 미만의 매우 표피에 매우 가까운 병소에 사용된다. 판은 중공의 얇은 은 케이싱으로서, 방사선 활성인 스트론튬-90 분말 염을 밀봉한다. 스트론튬의 방사선 활성 붕괴로 인해 생성된 베타(전자) 입자는 매우 얕게 침투한다.
전형적으로, Sr90 판은 절제된 익상편 층 위에 놓인다. 약 10 ~ 12 Gy의 일정 용량이 접촉 타이밍에 송달된다. 전자는 단지 공기 중 수 를 침투하므로, 방사선 보호 문제가 약간 줄어들며, 이것은 다른 방사선 선원과 매우 큰 차이이다. 간극내 근접요법에서, 선원은 조직에 삽입된다. 또한, 요오드-125 종을 사용한 전립선암 치료가 간극내 근접요법으로 분류된다. 감마 방사체의 상세한 사항은 일반적으로 사용되는 감마선 방출 동위원소를 참조한다. 공동내 근접요법은 기존의 체내 공동 안에 선원을 배치한다. 혈관내 근접요법은 공급원을 가진 카테터를 혈관 내부에 배치한다. 이 방법의 가장 일반적인 적용은 관상동맥 스텐트내 재협착의 치료이지만, 이 요법은 또한 말초혈관 협착의 치료에 사용될 수 있다.
고선량율(HDR) 근접요법은 일반적인 근접요법이다. 카테터 형태의 적용장치가, 일반적으로 맨체스터 또는 파리 시스템에 따라서, 또는 환자 내에 배치된다. 다음에, 고선량율 선원(주로 이리듐 192, Ir-192)이 기계에 의해 와이어 끝의 카테터를 따라서 조종된다. 선원을 미리 계획된 위치에 미리 설정된 시간 동안 체류시킨 다음, 카테터를 따라 앞으로 나아가고, 필요한 용량 분포가 달성되도록 이것을 반복한다.
고선량율(HDR)과 마찬가지로, 저선량율(LDR)은 방사선 활성 물질의 이식을 포함하며, 이것은 일시적으로 또는 영구적으로 이식될 수 있다. 기계를 사용한 LDR 근접요법은 유사한 방식으로 작동한다. 또 다른 변형은 선원이 활성 및 불활성 볼 형태인 것으로서, 이것 역시 기계를 사용하여 환자에서 조종된다.
일 측면에서, 방사선 민감제 투여시 피험자의 건강한 조직에 방사선 보호제를 투여할 수 있다. 일반적으로, 방사선 보호제는 자유 라디칼을 포획하여 산화성 손상을 방지하는 조성물을 포함할 것이다.
9. 스크리닝 방법
본 발명에 따라 BRG-1 유래 브로모도메인, 상기 브로모도메인을 둘 이상 포함하는 재조합 단백질 또는 이들의 단편을 포함하는 암세포는 후보 제제가 방사선 민감성 제제인지를 스크리닝할 때 양성 대조군으로 사용될 수 있다.
일반적으로, 후보 제제는 본 분야에 공지된 방법에 따라서 천연 산물 또는 합성(또는 반-합성) 추출물의 대량 라이브러리 또는 화학 라이브러리로부터 확인될 수 있다. 이러한 추출물 또는 화합물의 예는, 제한은 없지만, 식물-, 진균-, 원핵생물-, 또는 동물-베이스 추출물, 발효 육즙, 및 합성 화합물, 뿐만 아니라 기존 화합물의 변형을 포함한다. 또한, 당류-, 지질-, 펩티드-, 폴리펩티드-, 및 폴리뉴클레오티드-베이스 화합물을 포함하는 많은 화학 화합물의 무작위 또는 지정 합성(예를 들어, 반-합성 또는 총 합성)에 이용될 수 있다. 합성 화합물 라이브러리는, 예를 들어 Brandon Associates(Merrimack, NH) 및 Aldrich Chemical(Milwaukee, WI)로부터 상업적으로 입수될 수 있다. 또는 달리, Biotics(Sussex, UK), Xenova(Slough, UK), Harbor Branch Oceangraphics Institute(Ft. Pierce, FIa.), 및 PharmaMar, U.S.A.(Cambridge, Mass.)를 포함하는 많은 출처로부터 박테리아, 진균, 식물, 및 동물 추출물 형태의 천연 화합물 라이브러리가 상업적으로 입수될 수 있다. 이에 더하여, 천연 및 합성 생산 라이브러리는 원한다면 본 분야에 공지된 방법에 따라서, 예를 들어 표준 추출 및 분별법에 의해서 생산된다. 더욱이, 원한다면, 어떤 라이브러리 또는 화합물은 표준 화학, 물리, 또는 생화학적 방법을 이용하여 쉽게 변성된다.
이하, 본 발명에 따르는 실시예 및 본 발명에 따르지 않는 비교예를 통하여 본 발명을 보다 상세히 설명하나, 본 발명의 범위가 하기 제시된 실시예에 의해 제한되는 것은 아니다.
실시예 1: 세포 배양 조건 및 DNA 조작
10% fetal bovine serum을 포함하는 McCoys 5a 배지(WelGene 사 제조)를 이용하여 대장암세포 HT-29(R) 및 HCT116(S)을 배양하였으며, F-12K 배지(WelGene 사 제조)를 이용하여 폐암세포 A549(R) 및 NCI-H446(S)을 배양하였고, Minimum Essential Medium Eagle 배지(ATCC 사 제조)을 이용하여 정상세포 293T(S), 유방암세포 MDA-MB-231(R) 및 SK-BR3(S)을 각각 37, 5% CO2하에서 배양하였다.
실시예 2: 브로모도메인 단량체 발현 벡터의 제조 및 세포내 도입
브로모도메인 단량체 발현 벡터(pCMV-BRG1-BRD)를 제조하기 위하여, 발현률이 높은 GFP-N1 벡터에 3개의 핵위치신호(nuclear localization signal : NLS) 와 myc epitope 부분을 융합시켜 클로닝된 유전자가 핵 속으로 들어가서 기능을 할 수 있게 제작하였다. 이때, 3개의 핵위치신호와 myc epitope 부분은 pCMV/myc/nuc 벡터의 693 ~ 833 염기 부분을 사용하였다. BRG-1 유전자의 브로모도메인(bromodomain, BRD) 부분은 중합효소연쇄반응 (polymerase chain reation, PCR)을 통해 서열번호 5 및 6을 프라이머로 사용하여 단편을 얻었다. 얻어진 단편을 3개의 핵위치신호와 myc epitope 부분을 융합시킨 GFP-N1 벡터에 클로닝하였다(도 1). 클로닝되어진 pCMV-BRG1-BRD 벡터를 상기의 배양 방법을 통해 배양되어진 정상세포 293T(S), 대장암세포 HT-29(R), 대장암세포 HCT116(S), 폐암세포 A549(R), 폐암세포 NCI-H446(S), 유방암세포 MDA-MB-231(R), 유방암세포 SK-BR3(S)들에 칼슘포스페이트 방법을 사용하여 형질도입시켜 형질전환체들을 제조하였다.
서열번호 5 (forward): 5'- gctcctcgagatggccgagaaactctcccct -3'
서열번호 6 (reverse): 5'- gctcaagcttctcctcgccttcactgtc -3'
실시예 3: 브로모도메인 다량체 재조합단백질 발현 벡터의 제조 및 세포내 도입
브로모도메인 다량체 재조합단백질 발현 벡터를 제조하기 위하여, 효소 인지부위가 없는 서열번호 7 및 8의 프라이머를 이용하여 상기와 같이 만들어진 BRG1-BRD의 단량체의 말단부위 단일가닥 제거 후 연결반응을 수행(blunt end ligation)하였다. 연결반응을 통해 얻어진 결과물 중에서 제한효소 인지부위가 없는 이량체만을 얻고자 예상되는 사이즈의 젤(gel)을 절단한 후, 젤 상에서 DNA를 정제하였다. 그 후 얻어진 DNA를 주형으로 하여 각각 Xho1 및 Hind3 제한효소 인지부위를 갖는 서열번호 5 및 6의 프라이머를 이용하여 중합효소연쇄반응을 통해 브로모도메인 이량체를 암호화하는 DNA 단편을 얻었다. 얻어진 DNA 단편은 상기 실시예 2의 방법에 따라 pEGFP-myc 벡터에 클로닝하여 브로모도메인 이량체 발현 벡터(pEGFP-myc-BRG1-BRD-dimer)를 제조하였다. 클로닝되어진 pEGFP-myc-BRG1-BRD-dimer 벡터를 상기의 배양 방법을 통해 배양되어진 정상세포 293T(S), 대장암세포 HT-29(R), 대장암세포 HCT116(S), 폐암세포 A549(R), 유방암세포 MDA-MB-231(R), 유방암세포 SK-BR3(S)들에 형질도입하여 형질전환체를 얻었다.
서열번호 7 (forward): 5'- gccgagaaactctcccct -3'
서열번호 8 (reverse): 5'- ctcctcgccttcactgtc -3'
또한, 상기와 같이 제조되어진 브로모도메인 이량체를 암호화하는 DNA 단편을 주형으로 하여 각각 Sal1 및 BamH1 제한효소 인지부위를 갖는 서열번호 9 및 10의 프라이머를 이용하여 중합효소연쇄반응을 통해 다른 제한효소 인지부위를 갖는 브로모도메인 이량체를 암호화하는 DNA 단편을 얻었다. 얻어진 DNA 단편은 상기 제조되어진 브로모도메인 이량체 발현 벡터의 다른 제한효소 인지부위 내로 삽입하여 클로닝하여 브로모도메인 사량체 발현 벡터(pEGFP-myc-BRG1-BRD-tetramer) 를 제조하였다(도 2). 제조된 벡터를 상기 실시예 2의 방법에 따라 정상 간세포 HEK 293T(S), 대장암세포 HCT116(S), 폐암세포 A549(R), 폐암세포 NCI-H446(S)들에 형질도입하여 형질전환체를 얻었다.
서열번호 9 (forward): 5'- gctcgtcgacaagccgagaaactctcccct -3'
서열번호 10 (reverse): 5'- gctcggatcccctcctcgccttcactgtc -3'
실시예 4: 감마방사선 조사에 따른 생존율 조사
실시예 4-1: 정상세포에서의 감마선 조사에 따른 생존율 조사
감마방사선 조사에 따른 형질전환 정상세포의 생존율을 확인하기 위해서, 형질전환된 293T 세포(S)를 100 배양 접시(culture dish)에 2 x 105세포로 분주하여 그 다음날 방사선을 조사하였다. 선원은 -ray (137Cs; Cell Irradiation System, GC 3000 Elan-Model b; MDS Nordion, Ontario, Canada)를 이용하였고 총선량 0 내지 5 Gy를 조사한 후 10일 뒤 세포의 생존률을 확인하여 도 3에 나타내었다.
정상 간세포 HEK 293T(S)에 있어서 브로모도메인 발현 벡터(pEGFP-myc-BRG1-BRD) 또는 브로모도메인 다량체 발현 벡터(pEGFP-myc-BRG1-BRD-dimer 및 pEGFP-myc-BRG1-BRD-tetramer)로 형질 전환한 세포에서 BRG1 브로모도메인 또는 BRG1 브로모도메인 다량체 재조합단백질이 발현되는 것을 확인하였다(도 3의 B) 또한, 이 경우에 3 Gy 세기의 방사선 조사에서 10% 이하의 생존율을 나타내어 브로모도메인을 발현하지 않는 대조군으로서 pEGFP-myc 벡터로 형질전환한 세포가 4 Gy 에서 약 10%의 생존율 결과보다 약한 방사선 세기에서도 암세포가 사멸되며(도 3의 A), 이들의 IC50 값이 각각 1.60, 1.20 및 0.97로 BRG1 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 3의 C).
이러한 결과는, 본 발명에 따른 브로모도메인 발현 벡터들을 이용한 브로모도메인의 발현이 방사선 민감도를 증가시킬 수 있음을 나타내며, 발현되는 브로모도메인이 다량체화되어질수록 그 효과가 증가될 수 있음을 의미한다.
실시예 4-2: 암세포에서 BRG1 브로모도메인 및 이의 이량체 발현에 의한 감마선 조사에 따른 생존율 조사
감마방사선 조사에 따른 BRG1 브로모도메인 또는 이의 이량체를 발현하도록 형질전환된 암세포들의 생존율을 확인하기 위해서, 상기의 실시예 4-1의 방법을 사용하여 형질전환된 암세포들의 생존율을 확인하여 도 4 내지 8에 나타내었다.
정상세포인 293T 세포와는 달리 일반적인 칼슘포스페이트 방법으로 세포내에 형질도입의 과정이 잘 이루어지지 않는 세포들도 존재하기에, 각각의 암세포에 브로모도메인 또는 이의 이량체를 발현하기 용이한 바이러스 벡터를 제작하여 실험을 시행하였다.
대장암세포 HT29(R)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 이량체 발현 벡터(pMX-myc-BRG1-BRD-dimer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체 또는 이량체 형태로 발현되는 것이 확인되었다(도 4의 B). 또한, 이 경우에 동일한 세기의 감마방사선을 조사하였을 때, 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포의 생존율 결과보다 낮은 생존율을 나타내는 것을 확인하였고(도 4의 A), 이들의 IC50 값이 각각 2.81, 2.40 및 2.01로 BRG1 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 4의 C).
대장암세포 HCT116(S)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 이량체 발현 벡터(pMX-myc-BRG1-BRD-dimer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체 또는 이량체 형태로 발현되는 것이 확인되었다(도 5의 B). 또한, 이 경우에 3 Gy 세기의 방사선 조사에서 약 10%의 생존율을 나타내어 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포가 4 Gy 에서 약 10%의 생존율 결과보다 약한 방사선 세기에서도 암세포가 사멸되며(도 5의 A), 이들의 IC50 값이 각각 1.88, 1.12 및 1.02로 BRG1 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 5의 C).
폐암세포 A549(R)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 이량체 발현 벡터(pMX-myc-BRG1-BRD-dimer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체 또는 이량체 형태로 발현되는 것이 확인되었다(도 6의 B). 또한, 이 경우에 6 Gy 세기의 방사선 조사에서 약 10%의 생존율을 나타내어 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포가 8 Gy 에서 약 10%의 생존율 결과보다 약한 방사선 세기에서도 암세포가 사멸되며(도 6의 A), 이들의 IC50 값이 각각 2.88, 2.49 및 2.00로 BRG1 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 6의 C).
유방암세포 MDA-MB-231(R)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 이량체 발현 벡터(pMX-myc-BRG1-BRD-dimer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체 또는 이량체 형태로 발현되는 것이 확인되었다(도 7의 B). 또한, 이 경우에 동일한 세기의 감마방사선을 조사하였을 때, 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포의 생존율 결과보다 낮은 생존율을 나타내는 것을 확인하였고(도 7의 A), 이들의 IC50 값이 각각 3.01, 2.61 및 2.46으로 BRG1 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 7의 C).
유방암세포 SK-BR3(S)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 이량체 발현 벡터(pMX-myc-BRG1-BRD-dimer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체 또는 이량체 형태로 발현되는 것이 확인되었다(도 8의 B). 또한, 이 경우에 동일한 세기의 감마방사선을 조사하였을 때, 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포의 생존율 결과보다 낮은 생존율을 나타내는 것을 확인하였고(도 8의 A), 이들의 IC50 값이 각각 1.11, 0.88 및 0.83으로 BRG1 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 8의 C).
이러한 결과는, 과발현된 브로모도메인이 방사선 민감도를 증가시켜 암세포를 효과적으로 사멸시킬 수 있음을 나타내며, 그 효과가 대장, 폐, 유방 등의 다양한 암세포에서 안정적으로 유지될 수 있음을 의미한다. 또한, 발현되는 브로모도메인이 다량체화되어질수록 그 효과가 증가될 수 있음을 의미한다.
실시예 4-3: 암세포에서 BRG1 브로모도메인 사량체 발현에 의한 감마선 조사에 따른 생존율 조사
감마방사선 조사에 따른 BRG1 브로모도메인 이량체 및 사량체를 각각 발현하도록 형질전환된 암세포들의 생존율을 확인하기 위해서, 상기의 4-1의 방법을 사용하여 형질전환된 암세포들의 생존율을 확인하여 도 9 내지 11에 나타내었다.
대장암세포 HCT116(S)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 다량체 발현 벡터(pMX-myc-BRG1-BRD-dimer 및 pMX-myc-BRG1-BRD-tetramer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체, 이량체 또는 사량체 형태로 발현되는 것이 확인되었다(도 9의 B). 또한, 이 경우에 동일한 세기의 감마방사선을 조사하였을 때, 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포의 생존율 결과보다 낮은 생존율을 나타내는 것을 통해 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 9의 A).
폐암세포 A549(R)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 다량체 발현 벡터(pMX-myc-BRG1-BRD-dimer 및 pMX-myc-BRG1-BRD-tetramer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체, 이량체 또는 사량체 형태로 발현되는 것이 확인되었다(도 10의 B). 또한, 이 경우에 동일한 세기의 감마방사선을 조사하였을 때, 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc 벡터로 형질전환한 세포의 생존율 결과보다 낮은 생존율을 나타내는 것을 통해 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 10의 A).
폐암세포 NCI-H446(R)에 있어서 브로모도메인 발현 벡터(pMX-myc-BRG1-BRD) 또는 브로모도메인 다량체 발현 벡터(pMX-myc-BRG1-BRD-dimer 및 pMX-myc-BRG1-BRD-tetramer)로 형질 전환한 세포에서 BRG-1 브로모도메인이 단량체, 이량체 또는 사량체 형태로 발현되는 것이 확인되었다(도 11의 B). 또한, 이 경우에 동일한 세기의 감마방사선을 조사하였을 때, 브로모도메인을 발현하지 않는 대조군으로서 pMX-myc벡터로 형질전환한 세포의 생존율 결과보다 낮은 생존율을 나타내는 것을 통해 브로모도메인이 다량체화 될수록 세포의 방사선 민감도가 증가되는 것을 확인하였다(도 11의 A).
이러한 결과는, 브로모도메인의 발현 및 이들의 다량체화를 통해 암세포의 방사선 민감도를 증가시켜 암세포를 효과적으로 사멸시킬 수 있음을 다시 한번 나타내며, 그 효과가 다양한 암세포에서 안정적으로 유지될 수 있음을 의미한다.

Claims (20)

  1. BRG-1 유래 브로모도메인을 둘 이상 포함하는 재조합 단백질.
  2. 제1항에 있어서,
    상기 브로모도메인은 서열번호 1의 아미노산 서열을 포함하는 것인 재조합 단백질.
  3. 제1항에 있어서,
    상기 재조합 단백질은 세포의 방사선 민감도를 증가시키는 것인 재조합 단백질.
  4. 제1항에 있어서,
    상기 재조합 단백질은 세포 내재화 서열을 추가로 포함하는 것인 재조합 단백질.
  5. 제4항에 있어서,
    상기 세포 내재화 서열은 폴리아르기닌, 안테나페디아, TAT, HIV-Tat, 페네트라틴, Antp-3A (Antp 돌연변이), Buforin II, 트란스포탄, MAP (모델 양친매성 펩티드), K-FGF, Ku70, 프리온, pVEC, Pep-1, SynB1, Pep-7, HN-1, BGSC (비스-구아니디늄-스퍼미딘-콜레스테롤) 및 BGTC (비스-구아니디늄-트렌-콜레스테롤)로 이루어지는 군으로부터 선택되는 1종 이상의 단백질의 아미노산을 포함하는 것인 재조합 단백질.
  6. 제1항에 있어서,
    상기 재조합 단백질은 종양 특이적 표적화 서열을 추가로 포함하는 것인 재조합 단백질.
  7. 제6항에 있어서,
    상기 종양 특이적 표적화 서열은 RGD, NGR, 또는 GSL 모티프를 포함하는 아미노산 서열인 것인 재조합 단백질.
  8. 제1항 내지 제7항 중 어느 한 항의 재조합 단백을 암호화하는 폴리뉴클레오티드.
  9. 제8항의 폴리뉴클레오티드를 포함하는 재조합 벡터.
  10. BRG-1 유래 브로모도메인, 제1항 내지 제7항 중 어느 한 항의 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 유효성분으로 포함하는, 암세포 방사선 치료용 방사선 민감제 조성물.
  11. 제10항에 있어서,
    상기 암세포는 BRG-1을 발현하는 것인 방사선 민감제 조성물.
  12. 제10항에 있어서,
    상기 암세포는 방사선 저항성 세포인 것인 방사선 민감제 조성물.
  13. 제10항에 있어서,
    상기 방사선은 감마방사선인 것인 방사선 민감제 조성물.
  14. BRG-1 유래 브로모도메인, 제1항 내지 제7항 중 어느 한 항의 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 유효성분으로 포함하는, 암세포 방사선 치료용 방사선 민감제 조성물.
  15. 제14항에 있어서,
    상기 암세포는 BRG-1을 발현하는 것인 방사선 민감제 조성물.
  16. 제14항에 있어서,
    상기 암세포는 방사선 저항성 세포인 것인 방사선 민감제 조성물.
  17. 제14항에 있어서,
    상기 방사선은 감마방사선인 것인 방사선 민감제 조성물.
  18. BRG-1 유래 브로모도메인, 제1항 내지 제7항 중 어느 한 항의 재조합 단백질 또는 아세틸화 히스톤에 결합 활성을 갖는 이들의 단편을 포함하는 암세포.
  19. 제18항에 있어서,
    상기 암세포는 후보 제제가 방사선 민감성 제제인지를 확인하기 위해 대조군으로 사용되는 것인 암세포.
  20. 제18항에 있어서,
    상기 암세포는 방사선 저항성 세포인 것인 암세포.
PCT/KR2012/002773 2011-04-11 2012-04-12 Brg-1 유래의 브로모도메인 및 이의 용도 Ceased WO2012141504A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2011-0033502 2011-04-11
KR1020110033502A KR20120115913A (ko) 2011-04-11 2011-04-11 Ｂｒｇ－１ 유래의 브로모도메인 또는 이의 단편, 또는 이를 코드화하는 핵산을 유효성분으로 포함하는, 암세포 방사선 치료용 방사선 민감제 조성물
KR10-2011-0081688 2011-08-17
KR1020110081688A KR101308288B1 (ko) 2011-08-17 2011-08-17 Ｂｒｇ-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질 및 이의 용도

Publications (2)

Publication Number Publication Date
WO2012141504A2 true WO2012141504A2 (ko) 2012-10-18
WO2012141504A3 WO2012141504A3 (ko) 2013-01-03

Family

ID=47009841

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/002773 Ceased WO2012141504A2 (ko) 2011-04-11 2012-04-12 Brg-1 유래의 브로모도메인 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2012141504A2 (ko)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LEE ET AL.: 'A cooperative activation loop among SWI/SNF, gamma-H2AX and H3 acetylation for DNA double-strand break repair' THE EMBO JOURNAL vol. 29, 11 March 2010, pages 1434 - 1445 *
LEE, HAN-SAE: 'Molecular dissection of the function of BRG-1 in gamma-H2AX induction and DNA double strand break repair' MASTER'S THESIS, THE GRADUATE SCHOOL, EWHA WOMANS UNIVERSITY, DIVISION OF LIFE AND PHARMACEUTICAL SCIENCES 2007, *
PARK ET AL.: 'Mammalian SWI/SNF complexes facilitate DNA double-strand break repair by promoting gamma-H2AX induction' THE EMBO JOURNAL vol. 25, 24 August 2006, pages 3986 - 3997 *
PARK, JI-HYE: 'Role of the SWI/SNF chromatin remodeling complexes in DNA double strand break repair and damage responses' PH.D. DISSERTATION, THE GRADUATE SCHOOL, EWHA WOMANS UNIVERSITY, DIVISION OF LIFE AND PHARMACEUTICAL SCIENCES 2008, *

Also Published As

Publication number Publication date
WO2012141504A3 (ko) 2013-01-03

Similar Documents

Publication Publication Date Title
Lu et al. Targeting p53 for enhanced radio-and chemo-sensitivity
CA2232985C (en) Methods for treating cancers and restenosis with p21
EP1811033B1 (en) Cell-permeable peptide inhibitors of the JNK signal transduction pathway
US8247531B2 (en) Mutant epidermal growth factor polypeptides, nucleic acids, and uses therefor
Horibe et al. Designed hybrid TPR peptide targeting Hsp90 as a novel anticancer agent
KR100682666B1 (ko) 항혈관형성 단백질 및 이들을 사용하는 방법
JP6009360B2 (ja) 分子の膜通過送達のためのｐｔｅｎロングリーダー配列の使用
US20120039861A1 (en) Identification of extracellular form of pten that can be used to treat tumors
KR20010015867A (ko) 항-혈관형성 활성을 지니고 있는, 엔도스타틴의 변이체인＂ｅｍ 1＂ 및 이것을 사용하는 방법
WO2023033481A1 (ko) 항암 활성을 가지는 adp-리보오스 결합 펩티드 및 이의 용도
US20060292157A1 (en) MDA-7 protein variants having antiproliferative activity
KR102820907B1 (ko) Vgll1 펩타이드를 포함하는 암 치료용 조성물
Leskov et al. CRM1 protein-mediated regulation of nuclear clusterin (nCLU), an ionizing radiation-stimulated, Bax-dependent pro-death factor
WO2008103762A1 (en) Targeting of herpes simplex virus to specific receptors
KR20000038040A (ko) 전립선 암을 치료하기 위한 ｔｎｆ-베타-형 단백질, 및 관련 핵산 분자, 약제학적 조성물 및 방법
Li et al. Toosendanin restrains idiopathic pulmonary fibrosis by inhibiting ZEB1/CTBP1 Interaction
US10046022B2 (en) Synthetic peptide that increases radiosensitivity of tumor cells and use of same
WO2012141504A2 (ko) Brg-1 유래의 브로모도메인 및 이의 용도
KR20120115913A (ko) Ｂｒｇ－１ 유래의 브로모도메인 또는 이의 단편, 또는 이를 코드화하는 핵산을 유효성분으로 포함하는, 암세포 방사선 치료용 방사선 민감제 조성물
Hu et al. Investigation of a plasmid containing a novel immunotoxin VEGF165‐PE38 gene for antiangiogenic therapy in a malignant glioma model
Shiau et al. Retrovirus-mediated transfer of prothymosin gene inhibits tumor growth and prolongs survival in murine bladder cancer
KR101308288B1 (ko) Ｂｒｇ-1 유래의 브로모도메인을 둘 이상 포함하는 재조합 단백질 및 이의 용도
JP2006519614A (ja) 悪性かつ形質転換した哺乳動物細胞を選択的に殺すペプチド
KR100760320B1 (ko) 임포틴 α유전자 및 재조합 ｐ５３ 유전자를 발현하는 재조합 벡터를 포함하는 항암 조성물
KR102410556B1 (ko) 미토콘드리아 타겟팅용 펩타이드

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12770804

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12770804

Country of ref document: EP

Kind code of ref document: A2