WO2012135981A1

WO2012135981A1 - Method for knocking out bovine beta-lactoglobulin gene by using zinc finger nucleases

Info

Publication number: WO2012135981A1
Application number: PCT/CN2011/000689
Authority: WO
Inventors: 于胜利; 罗俊杰; 丁方荣; 李松; 汤波; 李宁
Original assignee: 北京济福霖生物技术有限公司
Priority date: 2011-04-07
Filing date: 2011-04-20
Publication date: 2012-10-11
Also published as: CN102212545A; CN102212545B

Abstract

A method for knocking out bovine beta-lactoglobulin gene by using zinc finger nucleases is provided, in which zinc finger nucleases (ZFNs) specific binding domains targeting the specific sequences in bovine beta-lactoglobulin gene are designed according to the sequence of the gene and the expression vector comprising the nucleotides encoding these ZFNs are transducted into bovine fibroblast, thus the cell with beta-lactoglobulin gene knocked out is obtained.

Description

Method for knocking out bovine β-lactoglobulin gene by zinc finger nuclease

The present invention relates to the field of genetic engineering technology, and in particular to a method for knocking out a bovine beta-lactoglobulin gene using a zinc finger nuclease. Background technique

Gene targeting technology is a technology to change the orientation of the genetic information of organisms, the two major limiting factors of conventional gene targeting animal production are: a first, animal somatic gene targeting efficiency is very low, 10 to 10 · ⁶ · ^7; second, Animals producing biallelic knockouts have a long time period and low cloning efficiency. Along with the continuous development of molecular biology, many new techniques and methods have emerged to improve the efficiency of gene targeting, such as gene targeting strategy using promoterless screening, isolation and induction of stem cells in animals. However, these improvements have not significantly promoted the production of gene-targeted animals, so the production of gene-targeted animals has been in a slow development stage. In recent years, the emergence of zinc finger protein nucleases (ZFNs) has greatly increased the efficiency of gene targeting, and it will become an important breakthrough in the production of knockout animals.

Cow's milk allergy is one of the most common types of food allergies in children. In many developed countries in Europe and America, the incidence of infant milk allergy is about 2% to 3%. Milk Allergy refers to the body's high reactivity to milk protein (hypersensitivity) milk contains a variety of proteins, of which α-Sl casein and β-lactoglobulin are the main sources of allergies to milk allergy.

Ρ-Lactoglobulin is the major whey protein in ruminants such as cattle, sheep and monogastric animals such as pigs, horses, and cat milk. This protein is absent in humans and rodents ( Kontopidis et al., 2004, LDairy Sci. 87). : 785-796 β-lactoglobulin has cohesive and hydrophobic properties and can be used as a food additive in desserts, seasonings and spreads; on the other hand, Ρ-lactoglobulin has a strong yellow Alcohol binding ability and fatty acid binding ability, can be used to contain fat-soluble vitamins for dairy products, baked goods, sports drinks and nutritional supplements. With the thermal reduction of β-lactoglobulin, it can also simulate and replace fat-free foods. The animal oil, or the modified β-lactoglobulin in yogurt, can improve the gelation of ordinary yogurt by 6-10 times.

However, there are few reports on the function of 3-lactoglobulin, especially in the study of nutritional function in milk. In addition, the low expression of this protein in milk or not Expression is a beneficial remedy for milk allergy. Inactivation of this gene by gene targeting technology is an ideal means to study its function and alleviate milk allergy.

Zinc finger protein nucleases (ZFNs) fuse the DNA-binding properties specific to DNA regulatory elements and the catalytic activity of endonucleases. The N-terminal zinc finger protein can specifically bind to DNA sequences through the C-terminal endonuclease Fokl. The catalysis causes DNA double-stranded molecules to break (DSB), and then DSB initiates intracellular self-repair mechanisms. At present, there are two main repair mechanisms: one is the end-ligation repair mechanism for non-homologous recombination, and the other is the homologous recombination repair mechanism. The former repair mechanism is an error-prone repair that often produces genetic information changes, and the use of homologous recombination repair mechanisms to repair DSB is a high-fidelity repair method, usually with another sister chromosome as a template for accurate repair. In mammalian cells, the former repair mechanism predominates, producing DSB specifically by ZFNs, triggering end-ligation repair of non-homologous recombination of cells, introducing small fragment deletions at DSB sites, or inserting, resulting in frameshift mutations, Or the deletion of the key sequence of the protein reaches the goal of gene knockout (Fig. 1).

The use of ZFNs-mediated gene knockout or modification has been successfully achieved in zebrafish, Arabidopsis and other model organisms, and the efficiency is 10 - 50% higher (Doyon, Y et al, Nat. Biotech. 2008, 26: 702-708; Lloyd, A, et al, PNAS 2005, 102: 2232-2237). The present invention demonstrates that the use of ZFNs for gene deletion or fine modification in animal somatic cells is an effective method for successfully obtaining gene knockout cloned cattle.

The production process of conventional gene targeting cloned cattle includes construction of gene targeting vector, vector transfection, cell drug screening, cell monoclonal identification, somatic cell nuclear transfer, and identification of cloned cattle. If the second allele needs to be knocked out, the same process as above is required, that is, two cell cloning is required, and the resulting cloned bovine contains the resistance gene necessary for drug screening, and finally it is necessary to obtain no Individuals of animals with resistance genes also undergo a somatic cell clone. The time required to complete the above process using cattle as an example is: vector construction for 3 months, cell screening for 1 month, somatic cell nuclear transfer, embryo development for 1 month, embryo transfer pregnancy and calf birth for 10 months. Thus, a clone takes at least 14 months. And in the cell screening process, some even could not get positive single cell clones. If a knockout of a non-resistant gene requires three clones, the time required will be at least 42 months, with a long cycle and high risk. However, this study demonstrates that using ZFNs technology, cloned cattle with complete biallelic knockout and no resistance gene can be obtained within 12 months. Summary of the invention

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for knocking out a bovine (3-lactoglobulin gene) using a zinc finger nuclease.

In order to achieve the object of the present invention, a method for knocking out a bovine P-lactoglobulin gene using a zinc finger nuclease comprises the following steps:

1) According to the bovine β-lactoglobulin gene sequence, ZFNs-Set l and ZFNs-Set 2 were designed, and their DNA sequences were:

ZFNs-Set 1: CCCAGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGA: ZFNs-Set 2: AGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGATATo

2) constructing a eukaryotic expression vector of ZFNs-Set l and ZFNs-Set 2, the eukaryotic expression vector is pBudCE-ZFNl-2, and its base sequence is shown as SEQ ID ΝΟ: 1; The ZFN eukaryotic expression vector can also be a co-expression vector.

Construction of co-expression vector: A pair of ZFNs (PZFNl/PZFN2 -set 1 ) that have been identified to efficiently mediated BLG gene knockout in bovine fibroblast cell lines were constructed into the co-expression vector pBudCE4.1 (Invitrogen), respectively PZFN1/PZFN2 -set 1 was used as a template to amplify the zinc finger protein nuclease expression element on PZFN1/PZFN2 -set 1 with primers 1, 2 and 3, and primer 1 contained a Not I restriction site, with primers 1 and 3 ZFN1 was amplified, and the PCR product TA clone was ligated into the simple-T (TaKaRa) vector, and the cloned clone was verified by sequencing. The restriction enzyme was digested with Not l and Xho l, and the digested product was ligated to the pBudCE4.1 vector to obtain pBudCE. -ZFNl o Primer 2 contains a Sal I restriction site, and primers 2 and 3 amplify ZFN2. The PCR product TA clone was ligated into a simple-T (TaKaRa) vector, and the cloned clone was verified to be non-mutated, through Sai l and Xba l The restriction enzyme was ligated to the pBudCE-ZFN1 vector to obtain pBudCE-ZFNl-2, the base sequence of which is shown in SEQ ID NO: 1, and the vector construction is shown in Fig. 2. The constructed zinc finger protein nuclease co-expression vector can simultaneously express a pair of zinc finger protein nucleases, and the two zinc finger protein nucleases are downstream of the CMV and EF-1 oc strong promoters, respectively, and can rapidly and efficiently express the zinc. Refers to a protein nuclease that mediates knockdown of the BLG gene.

Primer 1: 5 '-ATAAGAATGCGGCCGCTAATACGACTCACTATAGGG-3 ' Primer 2: 5 '-ACGCGTCGACTAATACGACTCACTATAGGG-3 ' Primer 3: 5 '-AAACGATCCTCATCCTGTCTCTT-3 ' 3) The above expression vector is separately transferred into bovine fibroblasts, and the PCR product sequencing method detects cells in which the P-lactoglobulin gene is knocked out.

The present invention also provides a knockout cell obtained by the above method.

The present invention also provides a method for producing a P-lactoglobulin gene knockout cloned bovine using a zinc finger nuclease.

The invention also provides a method for preparing a P-lactoglobulin gene knockout bovine cloned embryo, wherein the excised oocyte is a nuclear transfer recipient cell, and the excised oocyte is a nuclear transfer recipient cell. Bovine cloned embryos are obtained by nuclear transfer techniques.

The present invention further provides a method for preparing a transgenic cow by transferring a cloned embryo prepared by the foregoing method into a bovine uterus by a non-surgical method for pregnancy to obtain a transgenic cow.

The present invention utilizes zinc finger nuclease (ZFNs) for the first time to successfully knock out the P-lactoglobulin (BLG) gene in bovine fibroblasts, thereby obtaining a gene knockout cloned bovine, and obtaining a cloned bovine phase by conventional gene targeting technology. ratio, using knockout ZFNs mediated knockdown efficiency of single cell clones in the 15% to 40%, while the conventional gene targeting efficiency of only 10 · ⁶ to 10 · ^7, efficiency is improved ¹⁰⁴ ~ 10 ⁵ , provides great convenience for the production of genetically knockout animals.

In addition, ZFNs-mediated gene knockout can achieve one-time transfection, resulting in biallelic knockout cell clones, which is difficult to achieve in the conventional gene targeting process, eliminating the drug screening process, which is beneficial to cells. The formation of monoclonal cells avoids the need for cells to fight drug toxicity, plays a key role in subsequent somatic cell nuclear transfer and embryonic developmental quality, and does not contain resistance genes, greatly simplifying the biosafety evaluation process. DRAWINGS

Figure 1 is a schematic diagram of ZNFs-mediated BLG gene knockout.

-... Figure 2 is a schematic representation of the construction of the pBudCE-ZFNl-2 expression vector.

Figure 3 shows the ZFNs-mediated BLG gene knockout mutation types, in which wt is a wild-type control, the underlined base is an insert, and the base is a missing base, and the number of parentheses represents the number of deleted or inserted bases. This mutation type is repeated for the number of occurrences.

Figure 4 is a peak image of a knockout single cell clone sequencing result in which a double peak (underlined portion) appears near the site of action indicating that a gene knockout occurs, otherwise it is a wild type sequence. Figure 5 shows the results of sequencing of knockout cattle, including wild-type BLG control; B: sequencing of cloned bovine BLG gene, 15 bp deletion; C: sequencing of cloned bovine BLG gene, 9 bp deletion; B and C are the same cattle sequencing results, Does not contain a wild type sequence and is a biallelic knockout.

Figure 6 shows the homology comparison between ZFNs-Set 1 sites in different species, in which the ZFNs cleavage site is located. detailed description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

In the following examples, the ZFNs design was completed by Sigma, the primer synthesis was completed by Shanghai Biotech, and the sequence determination was completed by Beijing Huada. Taq enzyme, T4 DNA ligase and endonuclease were all obtained from Dalian TaKaRa Co., Ltd. The in vitro transcription kit and mRNA purification kit were purchased from Applied Biosystems, and the reagents for somatic cell cloning were purchased from Sigma. For routine experimental procedures such as digestion, ligation, recovery, transformation, and PCR amplification, see Molecular Closure (Third Edition).

Example 1 Screening and knockout efficiency of ZFN expression vector

1. Screening of ZFN

The BLG (NC-007309.4) gene sequence information was obtained from the NCBI website, and the ZFNs design was completed by Sigma. The ZFNs site was designed to be located on exons 1 and 2. ZFNs-Set 1 and ZFNs-Set 2 act on the first exon and ZFNs-Set 3 acts on the second exon. The DNA sequences they act on are:

ZFNs-Set 1: CCCAGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGA: ZFNs-Set 2: AGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGATAT; ZFNs-Set 3: CCCAGAGTGCCCCCCTGAGAGTGTATGTGGAGGAGCTGAAGC.

The underlined portion is the zinc finger protein binding sequence, and the middle portion is the Fokl endonuclease cleavage site. The corresponding three ZFNs expression vectors are: PZFN1/PZFN2 -set 1, PZFN1/PZFN2 -set 2 and PZFN1/PZFN2 -set 3. Three expression vectors can function in yeast, see Doyon et al, Nat Biotechnol, (2008) 26(6):702.

Whether three pairs of expression vectors can cleave in the corresponding cellular genomic DNA sequence is detected in the bovine fibroblast cell line. Primers were designed on both sides of the ZFNs site, setl/2-F: 5'-AGGCCTCCTATTGTCCTCGT-3';setl/2-R: 5 '-GCAAAGGACACA GGGAGAAG-3';set3-F: 5 '-CAGCCTCACGTAACCTTTGT-3 ';set3-R: 5 '-CCTGCCTTACTGTATGTATC-3 \

Electrotransfer (AMAXA) mR A of three pairs of ZFNs, the electrical parameter is T-016, the transfection dose is 4μ _§ mRNA per 10 ⁶ cells, the total cell genome is extracted after 24 hours of electrophoresis; the PCR product is recovered and purified, and the purified product is purified. Sequencing. If the ZFNs play a cleavage role, the cells will initiate a self-repairing mechanism, and deletion or insertion of small fragments will occur at the cleavage site. The peak of the PCR product sequencing results is a heterozygous peak map, that is, the ZFNs can be used for subsequent gene knockout.

The CEL-I enzyme is the main basis for detecting whether ZFNs play a role. The CEL-I assay requires a certain proportion of mutation types, otherwise it cannot be detected. The present invention confirmed that when the knockout efficiency is 6% (TA clone statistical sequencing results) , CEL-I test results were negative.

2, ZFN knockout efficiency

The knockout efficiency statistics were calculated by TA clone sequencing. The total cell genome was extracted after 24 hours of electrophoresis; cell PCR product recovery and purification, T vector ligation, sequencing, sequence alignment analysis, mutation type and total effective sequencing total (wild The ratio of the type to the sum of the mutant clones is the knockout efficiency. Among the three pairs of ZFNs, the first pair had higher knockout efficiency (6.9% ~ 31.24%), and multiple knockout gene types were sequenced (Fig. 3). The second pair is less efficient (0 - 6%) and the third pair does not work.

3. Construction of ZFN eukaryotic expression vector

ZFNs-Set 1 and ZFNs-Set 2 Two zinc finger enzymes need to be expressed simultaneously to play the role of knocking out the BLG gene, so the eukaryotic expression vector of ZFNs-Set 1 and ZFNs-Set 2 can be constructed separately when constructing the vector. Simultaneously transfecting two vectors into cells to achieve simultaneous expression of two zinc finger enzymes, ZFNs-Set 1 and ZFNs-Set 2 can also be constructed into a co-expression vector, transfected into cells and simultaneously expressed two zinc fingers. Enzymes, co-expression vectors have the advantage of reducing subsequent cell transfection, detection and other operational procedures, ensuring the simultaneous expression of two zinc finger enzymes.

The following is the construction principle of the co-expression vector: pBudCE-ZFNl-2 co-expression vector, and the base sequence is shown in SEQ ID NO: 1. The zinc finger protein nuclease coding portion consists of two parts: a zinc finger protein binding domain that binds to a specific chromosomal sequence; a non-restricted endonuclease I cleavage domain. The design and construction of zinc finger protein binding domains can be found in US No. 6,453,242 and 6,534,261. The ZFNs of the present invention are designed to contain five zinc finger protein monomers, which specifically bind 15 base pairs. The mechanism of action of zinc finger proteins can be found in Miller et al. (1985) Μ^·/ 4: 1609; Rhodes (1993) Scientific American Feb.: 56-65. The non-restriction endonuclease Fok I cleavage domain consists of IIS type Fok I endonuclease, and its action mode and mechanism can be referred to Li et al. (1992) Proc. Natl. Acad. Sci. UAS 89: 4375-4279; Li et al. (1993) Proc. Natl. Acad. Sci. UAS 90: 2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. UAS 91: 883-887; binding domain and cleavage domain constitute fusion expression The protein is ligated to the expression vector by restriction enzyme ligation.

The following is a construction process of a co-expression vector: a pair of ZFNs (PZFN1/PZFN2 - set 1 ) that have been identified to efficiently mediated BLG gene knockout in bovine fibroblast cell lines were constructed into the co-expression vector pBudCE4.1 (Invitrogen). , using PZFN1/PZFN2 -set 1 as a template, primers 1, 2 and 3 amplify the zinc finger protein nuclease expression element on PZFN1/PZFN2 - set l, and primer 1 contains a Not I restriction site, with primers 1 and 3 were amplified ZFN1, and the PCR product TA clone was ligated into the simple-T (TaKaRa) vector, and the mutantless clone was verified by sequencing. The digested product was ligated into the pBudCE4.1 vector by double digestion with Not l and Xho l. , obtaining pBudCE-ZFNl o primer 2 containing Sal I restriction site, primer 2, 3 amplification ZFN2, PCR product TA clone was ligated into simple-T (TaKaRa) vector, sequencing confirmed no mutant clone, through Sai l and Xba l double digestion, the digestion product was ligated to pBudCE-ZFNl vector to obtain pBudCE-ZFNl-2, the construction process is shown in Figure 2. The constructed zinc finger protein nuclease co-expression vector can simultaneously express a pair of zinc finger protein nucleases, and the two zinc finger protein nucleases are downstream of the CMV and EF-l strong strong promoters, respectively, and can rapidly and efficiently express the zinc. Refers to a protein nuclease that mediates knockdown of the BLG gene.

Primer 1: 5 '-ATAAGAATGCGGCCGCTAATACGACTCACTATAGGG-3 ' Primer 2: 5 '-ACGCGTCGACTAATACGACTCACTATAGGG-3 ' Deficient I 3 : 5 '-AAACGATCCT CATCCTGTCT CTT-3 '

Example 2 Acquisition of single cell clones and identification of gene knockout clones

1. Obtaining single cell clones

Using the AMAXA electro-rotation instrument to electrically transfer bovine fibroblasts, using the optimized electrotransformation parameter T-016, the transfection efficiency can reach more than 90%. The transfected genetic material is mR A, and the half-life in cells is about 8 hours. There is no random insertion of cellular genes when transfecting DNA. In the case of the group, there is a good guarantee for the genetic stability of the animal. At the same time, there will be no random integration of resistance genes, which meets the requirements of biosafety.

Specific method: The plasmid pBudCE-ZFNl -2 was used as a template, and the in vitro transcribed mRNA was recovered and purified by the Applied B iosy stems kit. The DEPC water was eluted and dissolved to a final concentration of 500 ng/μΐ. MRNA for each corresponding pair of ZFNs 2μ _β, the total amount of mRNA is 4μ _8, the number of transfected cells is 1 x 10 ^6, the electrical after transfection cells were seeded in T25 cell culture dishes, cultured for 24 hours, cell counts, The cells were seeded in 10 cm culture J at a density of 500 cells per 10 cm, supplemented with 10 ml of DMEM medium containing 15% FBS, and cultured for 6-7 days in a 37 ° C cell incubator containing 5% CO ₂ . A single cell clone was formed on the surface of the bottle. Under the microscope, single cell clones with many cell divisions, clear cell outlines, tight cells and good gloss were selected and expanded into 48-well plates, and the culture conditions were unchanged. After 3-4 days, the cells are covered with the whole well, the cells are digested, and 1/10 of the cells are taken for cell PCR to identify whether the cell monoclonal has a gene knockout; the remaining cells are seeded in a 6-well plate for subsequent positive cloned cells. Freeze.

2. Identification of single knockout single cell clones

The identification of single-cell cloning molecules uses sequencing technology to accurately determine the DNA sequence of a gene. Specific method of operation: After the single-cell clone is filled in the 48-well plate, the cells are digested, and 1/10 of the cells are taken for PCR, and the PCR product is recovered and purified, and divided into two parts for detection, and a part of the PCR product is directly sequenced. If the clone has a gene knockout, the PCR product sequencing peak shows the result of a double peak after the cleavage site, as shown in Figure 4. For cell clones containing specific bimodal results, another portion of the PCR product was TA cloned, pinpointing the gene knockout site and detailed sequence information.

The molecular detection of conventional ZFNs-mediated gene knockout is CEL-I detection, and the present invention demonstrates that the results obtained by the sequencing method are more direct, easy to operate, and the accuracy can reach 100%.

Example 3 Gene knockout single cell cloned embryos and preparation of cloned cattle

1. Preparation of knockout cattle

The specific process includes:

(1) Holstein cow fetal fibroblast culture

Take 40-day-old Holstein cow's fetal ear tissue, primary culture, subculture, and freezing The bovine fetal fibroblast cell line was established by an in vitro culture operation.

( 2 ) gene knockout single cell clone

The knockout single cell clone was obtained as in Example 2.

(3) Transgenic cloned embryo preparation and embryo transfer

The ovary of the adult cattle is collected from the slaughterhouse, and the follicles of 2 to 8 mm in diameter are taken to recover the cumulus-oocyte-complex with uniform morphology and dense structure, and the cumulus-oocyte-complex is 50-60 pieces. / well placed in a four-well plate containing mature solution (M199 + 10% fetal bovine serum + 0.01 U / ml bovine follicle stimulating hormone + 0.01 U / ml bovine luteinizing hormone + lg / ml estradiol) at 38.5 ° C, mature culture for 18~20h in 5% CO2 incubator, shake the mature oocytes into the tube containing 0.1% hyaluronidase for 2~3min, then gently blow with glass tube to make cumulus cells Completely detached from the oocyte, the oocyte which is intact in morphology, uniform in cytoplasm and excreted from the first polar body is used as a somatic cell nuclear transfer recipient.

The oocyte with the first polar body was transferred into an operating solution containing M199+10% FBS+7.5 g/ml cytochalasin B, and the transparent strip was cut with a glass needle above the polar body under a 200-fold microscope. A small mouth, then use the glass tube with an inner diameter of 20μπι to absorb the chromosomes in the first polar body and the oocytes below it, then put them into the solution of M199+20% FBS and wash them three times. Alternate in the box.

The donor cells starved for 2 to 4 days in serum (and the transgenic cells transfected with the antibody double-stranded gene and the marker vector) were digested with 0.25% trypsin for 2 to 4 minutes, and the somatic cells having a diameter of 10 to 12 μm were selected to be 20 μηι diameter glass tubes. The cells were transferred into an enucleated oocyte zona pellucida, which was then placed in a Zimmerman solution (Brophy B et al., 2003. Nat Biotechnol 21(2): 157-162) for 3 to 5 min and placed in a fusion cell. Rotating the egg cell makes the contact surface of the donor cell and the oocyte perpendicular to the electric field, and the condition of the DC pulse is 2.5 kV/cm, the pulse time is 10 μ3, the number of pulses is 2, and the pulse interval is Is-condition-down-fusion (-The fusion instrument is B-T-X's EQVK00T) and then quickly reconstructed into a M199+10% FBS solution. The reconstructed embryos were placed in 5 mol/L ionomycin solution, and after 4 min, they were transferred to 1.9 mmol/L 6-DMAP solution. After 4 hours, they were transferred to CRlaa + 5% FBS solution at 38.5 V, 5% C0 ₂ Incubate for 2 days in an incubator.

The cloned blastocyst of the 7th day of excellent morphology was transferred into the uterine horn of the recipient cow. Recipient cows were selected for cows, and rectal examination was performed on the 60th day after transplantation. Determine the pregnancy rate.

2. Molecular identification of knockout cattle

The molecular identification of knockout cattle is as follows: taking the size of the soy bean in the ear tissue and digesting and extracting the genomic DNA of the ear tissue. For the experimental procedure, see Molecular Cloning (3rd Edition). Primers were amplified using the upstream and downstream primers F: 5'-AGGCCTCCTATTGTCCTCGT-3' and R: 5,-GCAAAGGACACAGGGAGAAG-3. The PCR product was purified and recovered, and TA clone was performed and the colony was sequenced and analyzed.

The results showed that the six burdocks born were clonal allele knockout clones, and the BLG knockout type was 9bp and 15bp deletion (Fig. 5), which was consistent with the identification at the cellular level. Example 4 Detection of off-targeting effect of ZFNs knockout cells

The off-targeting effect of ZFNs knockout cells means that ZFNs, in addition to the specific binding of the target sequence, also acts on other similar sequences, which may result in unwanted knockout types and may also affect individual Growth and development have a large negative impact on the credibility of the test results. A large number of off-targeting sites have been excluded from the target site selection process. In Table 1, set 1 is used as an example. Except for a specific target site in the whole genome of cattle, the similar sequence is relatively small. Only occurs when there are 6 bases different, so the off-targeting effect of ZFNs is reduced to some extent.

Table 1 ZFNs action sites and corresponding off-targeting sites The number of sequence sites with unmatched bases in the genome range

ZFNs binding site sequence (line sequence)

0 1 2 3 4 5 6

Set 1 CCCAGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGA 1 0 0 0 0 0 12 47

Set 2 AGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGATAT 1 0 0 0 0 1 7 66

Set 3 CCCAGAGTGCCCCCCTGAGAGTGTATGTGGAGGAGCTGAAGC 1 0 0 0 1 0 0 9 In order to better detect the off-targeting effect of ZFNs, the present invention also compares Similarity between BLG gene sequences in the same species, we found that ZFNs have similar sites of similarity in pigs and sheep (Fig. 6), and only three base differences in the sequence of sheep, ZFNs sites The similarity is as high as 91.7%, and the pig contains 7 bases. Therefore, the same conditions are used to detect the role of ZFNs in these two cells. A large number of sequencing results show that ZFNs-Set l plays a role in bovine cells. None of the cell lines of pigs and sheep played a role, which indirectly proved the specificity of the action of ZFNs.

Although the present invention has been described in detail with reference to the preferred embodiments of the present invention, it will be apparent to those skilled in the art. Therefore, such modifications or improvements made without departing from the spirit of the invention are intended to be within the scope of the invention. Industrial Applicability The present invention utilizes ZFNs-mediated gene knockout to achieve one-time transfection, and obtain double-allelic knockout cell clones, which is difficult to achieve in the conventional gene targeting process, eliminating the drug screening process. It is beneficial to the formation of monoclonal cells, avoids the need for cells to fight the drug toxicity, plays a key role in the subsequent somatic cell nuclear transfer efficiency and the developmental quality of the embryo, and does not contain resistance genes, greatly simplifying biosafety. Evaluation process.

Claims

L A method for knocking out a bovine β-lactoglobulin gene using a zinc finger nuclease, comprising the steps of:

1) According to the bovine β-lactoglobulin gene sequence, ZFNs-Set 1 and ZFNs-Set 2 were designed, and their DNA sequences were:

ZFNs-Set 1: CCCAGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGA-. ZFNs-Set 2: AGGCCCTCATTGTCACCCAGACCATGAAGGGCCTGGATAT;

2) constructing a eukaryotic expression vector of ZFNs-Set 1 and ZFNs-Set 2;

3) Transfer the above eukaryotic expression vector into bovine fibroblasts, PCR-amplify, and sequence-detect the cells in which the P-lactoglobulin gene is knocked out.

The method according to claim 1, wherein the eukaryotic expression vector in step 2) is pBudCE-ZFNl-2, and its base sequence is as shown in SEQ ID NO: 1.

3. A knockout cell obtained by the method of claim 1 or 2.

4. Use of the method of claim 1 or 2 in the production of knockout cloned cattle.

A method for preparing a bovine cloning embryo of a lactoglobulin gene knock-out, wherein the gene knockout cell according to claim 3 is a nuclear transfer donor cell, and the isolated oocyte is a nuclear transfer recipient cell. Bovine cloned embryos are obtained by nuclear transfer techniques.

A method for producing a transgenic cow, which comprises transplanting a cloned embryo prepared by the method of claim 5 into a bovine uterus by a non-surgical method to obtain a transgenic cow.