CN101979523A - Cbfalpha1 gene knockout agent - Google Patents
Cbfalpha1 gene knockout agent Download PDFInfo
- Publication number
- CN101979523A CN101979523A CN2010105031559A CN201010503155A CN101979523A CN 101979523 A CN101979523 A CN 101979523A CN 2010105031559 A CN2010105031559 A CN 2010105031559A CN 201010503155 A CN201010503155 A CN 201010503155A CN 101979523 A CN101979523 A CN 101979523A
- Authority
- CN
- China
- Prior art keywords
- cbf
- zinc finger
- gene knockout
- finger nuclease
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cbfalpha1 (core binding factor alpha 1) gene knockout agent, which comprises ZFNA (zinc finger nuclease A) and ZFNB (zinc finger nuclease B), wherein the amino acid sequence of the ZFNA is expressed as SEQ ID No. 1, and the amino acid sequence of the ZFNB is expressed as SEQ ID No. 2. The cbfalpha1 gene knockout agent can quickly, simply and specifically knock out cbfalpha1 genes, and is mainly applied in knocking out the cbfalpha1 genes of animals such as zebra fishes, mice, birds and the like and further researching the functions of the cbfalpha1 genes of different species and related signal channels.
Description
Technical field
The present invention relates to the agent that knocks out of a kind of core binding factor (core binding factor alpha 1, cbf α 1) gene, relate in particular to the gene knockout agent of a kind of dna sequence dna GACTGTACGGGGTCGCCAGCCGCC at cbf α 1 gene.
Background technology
A kind of core transcription factor of cbf α 1 genetic expression, this transcription factor further participates in the growth course of osteoblastic differentiation and bone by regulating somatomedin and the proteic expression of bone specific cell epimatrix.Its abnormal expression can hinder intramembranous ossification and entochondrostosis, influences the growth of osseous tissue after embryonic stage, fetus period and the birth.The sudden change of cbf α 1 gene can cause clavicle skull heteroplasia.Cbf α 1 gene all has homologous gene in animals such as the mankind, mouse, zebra fish.The function of research cbf α 1 gene and signal path are significant for the growth and the design bone photo related disorders treatment plan of research scleroblast and osteoclast.
The function and the signal path of research gene mainly are to learn a skill by reverse genetic at present, and described reverse genetic learns a skill and mainly contains: traditional gene targeting, and the Tilling technology, RNAi crosses expression technology etc.Traditional gene knockout technology has had the history in more than 20 year, in mouse, set up very proven technique system, the gene of can fixing a point to knock out, but this technology is applied in the different species, need set up the embryonic stem cell line of different plant species, complicated operation because nonmammalians such as zebra fish, fruit bat are difficult to set up embryonic stem cell line, is difficult to implement this technology in addition.The Tilling technology is a kind of technology that can make gene produce sudden change, but this technology is time-consuming, effort and be difficult in fixed position and suddenly change.The RNAi technology is a kind of common reduction or the technology of retardance genetic expression, but there are following two shortcomings in this technology: the one, and the time of effect is very short, and the RNA degraded is very fast; The 2nd, the phenotype that produces can not heredity.Cross expression technology also just at certain gene, change the expression of gene level, can not obtain the mutant of goal gene disappearance in translation skill.
Given this, research and develop simple and practical gene knockout agent, fix a point to knock out cbf α 1 gene fast and have great application value.
Summary of the invention
At the deficiencies in the prior art, the problem to be solved in the present invention provides a kind of cbf α 1 gene knockout agent, promptly at the gene knockout agent of the dna sequence dna GACTGTACGGGGTCGCCAGCCGCC of cbf α 1 gene.Described cbf α 1 gene knockout agent practicality easy and simple to handle can fix a point to knock out cbf α 1 gene fast in the GACTGTACGGGGTCGCCAGCCGCC site.
Above-mentioned Zinc finger nuclease ZFNA comprises zinc fingers ZFa, Nco I restriction enzyme site (CCATGG) and non-specific cutting structure territory Fok I-RV, and wherein the aminoacid sequence of ZFa is shown in SEQ ID No.3, and ZFa specificity binding sequence is CCAGCCGCC.
Above-mentioned Zinc finger nuclease ZFNB comprises zinc fingers ZFb, Nco I restriction enzyme site (CCATGG) and non-specific cutting structure territory Fok I-DA, wherein the aminoacid sequence of ZFb is shown in SEQ ID No.4, and the complementary sequence of ZFb specific recognition sequence GACTGTACG is CGTACAGTC.
ZFNA and ZFNB structure are roughly the same, all comprise zinc fingers (Zinc finger, ZF) and a non-specific cutting structure territory, the cutting structure territory Fok I-RV of ZFNA and the cutting structure territory Fok I-DA of ZFNB are combined into 6 the bases G GGTCGs of different first dimer specific action between the recognition sequence of two ends, cut out sticky end, in the repair process of organism, produce permanent sudden change in this site by the non-homogeneous terminal mode of repairing that connects.
The preparation of cbf α 1 gene knockout agent of the present invention mainly comprises following three steps:
[1] passes through zinc fingers ZFa and the ZFb that two-step approach PCR synthesizes Zinc finger nuclease ZFNA and ZFNB;
[2] make up two expression plasmids, comprise the nucleotide sequence of Zinc finger nuclease ZFNA and ZFNB respectively;
[3] vivoexpression Zinc finger nuclease ZFNA and ZFNB, and these two kinds of albumen of purifying.
The application of cbf α 1 gene knockout agent of the present invention in the cbf of various biologies α 1 gene site-directed knocking out:
The advantage that cbf α 1 gene knockout agent of the present invention possesses is:
(1) applied range can carry out in cell, embryonic cell, the individual level of vitro culture.
(2) locus specificity of gene knockout is strong, at the 795th-818 base pairs (GACTGTACGGGGTCGCCAGCCGCC) of the mRNA sequence of mouse cbf α 1 gene, also can be at the evolution conservative site TTTGACTCTTATCAAAGACCTGAT of human cell system.
(3) operating process is simple, only needs a technician.
(4) the operating process required time is short, and the theoretical execution cycle only is 2 months.
Description of drawings
The zinc fingers nucleotide sequence synthetic result of Fig. 1 cbf α 1 gene knockout agent.Numeral swimming lane among the figure, the 1st swimming lane are DNA marker, and band is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp from top to bottom.2nd, 3 swimming lanes are zinc fingers ZFa, and the 4th, 5 swimming lanes are zinc fingers ZFb.This figure explanation is correct by the size of two sections zinc fingers sequences of two-step approach synthetic.
The sequencing result of the zinc fingers ZFa of Fig. 2 cbf α 1 gene knockout agent.First sequence is a sequencing result, and second sequence refers to sequence for the zinc that designs.According to the sequencing result comparison, be accurately by two-step approach synthetic zinc fingers ZFa sequence.
The sequencing result of the zinc fingers ZFb of Fig. 3 cbf α 1 gene knockout agent.First sequence is a sequencing result, and second sequence refers to sequence for the zinc that designs.According to the sequencing result comparison, be accurately by two-step approach synthetic zinc fingers ZFb sequence.
The amplification of the cutting structure territory Fok I sequence of Fig. 4 cbf α 1 gene knockout agent.Numeral swimming lane among the figure, the 1st swimming lane are DNA marker, and band is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp from top to bottom.The 2nd swimming lane is the amplification of FOK I-DA, and the 3rd swimming lane is the amplification of FOK I-RV.
The proteic expression and purification of the Zinc finger nuclease ZFNA of Fig. 5 cbf α 1 gene knockout agent and ZFNB detects.Numeral swimming lane among the figure, the 1st swimming lane are that Protein marker is followed successively by 80KD, 60KD, 30KD, 20KD from top to bottom.The 2nd swimming lane is the ZFNA albumen behind the purifying, and the 3rd swimming lane is the ZFNB albumen behind the purifying.This figure explanation contains the coli strain of plasmid PET-ZFNA-30a and contains the coli strain of plasmid PET-ZFNB-30a, and behind the supernatant protein purification after inducing, target protein is about the 30KD place, and the result of purifying can be used for further experiment.
The vitro detection result of Fig. 6 cbf α 1 gene knockout agent.Numeral swimming lane among the figure, the 1st swimming lane are DNA marker, are followed successively by 15000bp, 10000bp, 7500bp, 5000bp, 3000bp, 1500bp, 1000bp, 500bp from top to bottom.The 2nd swimming lane is a control group, and the 3rd swimming lane is that enzyme and substrate ratio are 2: 1 vitro detection result, and the 4th swimming lane is that enzyme and substrate ratio are 1: 1 vitro detection result.Through the analysis revealed of agarose electrophoresis, when the reaction ratio of Zinc finger nuclease and substrate is 1: 1 the optimum proportion of reaction.Under this reaction ratio, the effect of Zinc finger nuclease is best, almost all superhelixes of substrate plasmid has all been cut.
Embodiment
The present invention is further described below in conjunction with embodiment:
The synthetic method of cbf α 1 gene knockout agent mainly is divided into following a few step:
[1] utilizes the U.S. state-run bioinformation center (National center for Biotechnology Information, NCBI) Nucleotide database search obtains the evolution conservative site of dna sequence dna, mRNA sequence and the cbf α 1 of cbf α 1, the mRNA sequence of input cbf α 1 obtains target site GACTGTACGGGGTCGCCAGCCGCC according to conserved domain Runt distributed areas in all sites that searches in zinc finger tools website;
[2] according to the target site that obtains in the zinc finger tools website, obtain the aminoacid sequence of the corresponding special zinc fingers of this target site, the concrete aminoacid sequence of ZFa is seen SEQ ID No.3, the concrete aminoacid sequence of ZFb is seen SEQ ID No.4;
[3] obtain the nucleotide sequence of corresponding zinc fingers according to the codon-bias of zebra fish, the nucleotide sequence of ZFa is seen SEQID No.5, and the nucleotide sequence of ZFb is seen SEQ ID No.6;
[4] nucleotide sequence of the synthetic zinc fingers of two-step approach, in resulting zinc fingers aminoacid sequence input website DNAWorks, parameter is mixed up, the primer sequence that obtains exporting, obtain goal gene through two-step approach PCR, agarose electrophoresis detects as Fig. 1, and the zinc of the ZFa that obtains refers to sequencing result such as Fig. 2 of sequence, the sequencing result of ZFb sequence such as Fig. 3;
[5] respectively from plasmid PCMV-FOK I-RV and plasmid PCMV-FOK I-DA (available from Fermentas company) through the sequence of pcr amplification Fok I-RV and Fok I-DA and add NcoI and two restriction enzyme sites of Xho I separately, concrete detected result is seen Fig. 4;
[6] ZFa and Fok I-RV are cut by enzyme be connected among the expression vector PET-30a (available from Fermentas company) construction of expression vector PET-ZFNA-30a;
[7] ZFb and Fok I-DA are cut by enzyme be connected among the expression vector PET-30a (available from Fermentas company) construction of expression vector PET-ZFNB-30a;
[8] plasmid PET-ZFNA-30a and the PET-ZFNB-30a that builds changed in the expression strain, under the inducing of 22 ℃ and 0.3mMIPTG (sec.-propyl-β-D-sulfo-galactopyranoside), through after the ultrasonication, to go up white protein and cross ni-sepharose purification albumen at 4 ℃, and with SDS (polyacrylamide gel electrophoresis) detect induce before and after protein sample behind the purifying, concrete outcome is seen Fig. 5;
[9] with the Zinc finger nuclease ZFNA of purifying and ZFNB mixed, obtain cbf α 1 gene knockout agent according to 1: 1.
The vitro detection of cbf α 1 gene knockout agent cutting efficiency:
[1], obtains cbf α 1 gene knockout agent according to the method for embodiment 1;
[2] go out target site sequence GACTGTACGGGGTCGCCAGCCGCC by pcr amplification, target site is connected in the PEASY-Blunt plasmid (available from the full Shi Jin in Beijing biotech firm), construct PEASY-target1-Blunt as reaction substrate;
[3] cbf α 1 gene knockout agent and the substrate ratio according to 1: 1 is added in the vitro reactions system,, utilize the outer reaction result of agarose electrophoresis detection bodies, see Fig. 6 25 ℃ of reactions 2 hours down.
The cutting efficiency of cbf α 1 gene knockout agent is in the detection of zebra fish individual level:
[1] according to the method for embodiment 1, obtain cbf α 1 gene knockout agent, add an amount of glycerine, constitute the Zinc finger nuclease mixture;
[2], be expelled among the unicellular embryo of zebra fish every ovum injection 2pmol with the method for Zinc finger nuclease mixture by microinjection;
[3] embryonal vaccination is formed adult fish;
[4] genomic dna of extraction adult fish carries out PCR to cbf α 1 gene target site place and detects;
[5] selfing produces filial generation between the adult fish of cbf α 1 gene knockout, observes the filial generation phenotype, extracts progeny genome DNA, detects cbf α 1 transgenation situation.
The application of nucleotide sequence in zebra fish of cbf α 1 gene knockout agent:
[1] according to preceding 7 step in the method for embodiment 1, obtain expression vector PET-ZFNA-30a and PET-ZFNB-30a, from plasmid amplification ZFNA and ZFNB, method by PCR adds the distinctive nuclear localization signal of zebra fish at the 5 ' end of ZFNA and ZFNB, constructs NLS-ZFNA and NLS-ZFNB sequence;
[2] NLS-ZFNA and NLS-ZFNB complete sequence enzyme are cut be connected among the plasmid PEGFP-N1 (available from Fermentas company), construct injection plasmid PEGFP-NLS-ZFNA-N1 and PEGFP-NLS-ZFNB-N1;
[3] will inject plasmid PEGFP-NLS-ZFNA-N1 and PEGFP-NLS-ZFNB-N1 linearizing respectively, according to these two kinds of plasmids of 1: 1 mixed;
[4] will mix the method for plasmid by microinjection and be expelled among the unicellular embryo of zebra fish, each embryo's injection 2n1 mixing plasmid;
[5] form adult fish with the development condition of the embryo after the fluorescent microscope record injection, and with embryonal vaccination;
[6] genomic dna of extraction adult fish carries out PCR to cbf α 1 gene target site place and detects;
[7] selfing produces filial generation between the adult fish of cbf α 1 gene knockout, observes the filial generation phenotype, extracts progeny genome DNA, detects cbf α 1 transgenation situation.
Embodiment 5
[1] according to the method for embodiment 1, obtain cbf α 1 gene knockout agent, add an amount of glycerine, constitute the Zinc finger nuclease mixture;
[2] with the Zinc finger nuclease mixture with sperm injection in the ovum of mouse;
[3] mouse fertilized egg after will injecting is cultivated 8 cell stages, changes in the false pregnancy mouse;
[4] the first filial generation mouse is raised into the mouse stage, get mouse tail tissue extraction genomic dna, detect the sudden change situation of cbf α 1 gene target site;
[5] selfing produces second filial between the first filial generation mouse of cbf α 1 gene knockout, observes the second filial phenotype, extracts the second filial genomic dna, detects cbf α 1 transgenation situation.
Claims (3)
1. cbf α 1 a gene knockout agent comprises two kinds of Zinc finger nucleases; It is characterized in that: described Zinc finger nuclease is Zinc finger nuclease ZFNA and Zinc finger nuclease ZFNB; Wherein, the aminoacid sequence of Zinc finger nuclease ZFNA is shown in SEQ ID No.1, and the aminoacid sequence of Zinc finger nuclease ZFNB is shown in SEQ ID No.2.
2. cbf α 1 gene knockout agent as claimed in claim 1, it is characterized in that: described Zinc finger nuclease ZFNA comprises zinc fingers ZFa, Nco I restriction enzyme site and non-specific cutting structure territory Fok I-RV, wherein the aminoacid sequence of ZFa is shown in SEQID No.3, and ZFa specificity binding sequence is CCAGCCGCC.
3. cbf α 1 gene knockout agent as claimed in claim 1, it is characterized in that: described Zinc finger nuclease ZFNB comprises zinc fingers ZFb, Nco I restriction enzyme site and non-specific cutting structure territory Fok I-DA, wherein the aminoacid sequence of ZFb is shown in SEQID No.4, and the complementary sequence of ZFb specific recognition sequence GACTGTACG is CGTACAGTC.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105031559A CN101979523A (en) | 2010-10-12 | 2010-10-12 | Cbfalpha1 gene knockout agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105031559A CN101979523A (en) | 2010-10-12 | 2010-10-12 | Cbfalpha1 gene knockout agent |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101979523A true CN101979523A (en) | 2011-02-23 |
Family
ID=43600064
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105031559A Pending CN101979523A (en) | 2010-10-12 | 2010-10-12 | Cbfalpha1 gene knockout agent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101979523A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212545A (en) * | 2011-04-07 | 2011-10-12 | 北京济福霖生物技术有限公司 | Method for knocking out cattle beta-lactoglobulin gene by using zinc finger nucleases (ZFNs) |
-
2010
- 2010-10-12 CN CN2010105031559A patent/CN101979523A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212545A (en) * | 2011-04-07 | 2011-10-12 | 北京济福霖生物技术有限公司 | Method for knocking out cattle beta-lactoglobulin gene by using zinc finger nucleases (ZFNs) |
| CN102212545B (en) * | 2011-04-07 | 2013-05-08 | 北京济福霖生物技术有限公司 | Method for knocking out cattle beta-lactoglobulin gene by using zinc finger nucleases (ZFNs) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108753783A (en) | The construction method of Sqstm1 full genome knock-out mice animal models and application | |
| CN103343120A (en) | Wheat genome site-specific modification method | |
| CN101939437A (en) | Soybean plant and seed corresponding to transgenic event MON87769 and methods for detection thereof | |
| CN110129453B (en) | Method for identifying genotype of fast and slow feathers of chicken | |
| CN108103108A (en) | Preparation and application of Cebpa gene-deleted zebra fish mutant | |
| Harnelly et al. | Phylogenetic analysis of Dipterocarpaceae in ketambe research station, gunung leuser national park (Sumatra, Indonesia) based on rbcL and matK genes | |
| CN101624636A (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
| CN106282231A (en) | The construction method of mucopolysaccharidosis II type animal model and application | |
| CN101921849B (en) | Method for assisting to authenticate milk cows with different milk producing characteristics and special primer pairs used by same | |
| CN101979523A (en) | Cbfalpha1 gene knockout agent | |
| CN108588091A (en) | A kind of okra reference gene and its application | |
| CN101979524A (en) | Microphthalmia-associate transcription factor (mitf) gene knockout agent | |
| CN101954075B (en) | Method for preparing oral avian influenza vaccine from transgenic dunaliella | |
| CN110331223A (en) | It is a kind of for identifying molecular labeling, primer pair, kit and the method for different wild rice stem types | |
| CN114921460B (en) | Functional marker primer of nitrogen efficient gene NRT1.1B and application thereof | |
| CN104894255A (en) | Method for detecting low-efficiency genome editing based on polyacrylamide gel electrophoresis and application of method | |
| CN108728569A (en) | A kind of okra reference gene and its application | |
| CN108384839A (en) | A kind of method of fluorescent quantitative PCR technique detection apis mellifera 6- pyruvoyl tetrahydro pterin synthase PTS gene expressions | |
| Takabayashi et al. | Sex identification using the ZFX and ZFY genes in common marmosets (Callithrix jacchus) | |
| Xu et al. | DEtail-seq is an ultra-efficient and convenient method for meiotic DNA break profiling in multiple organisms | |
| CN103725777A (en) | Real-time fluorescence PCR (Polymerase Chain Reaction) method for rapidly detecting transgenic soybean MON89788 | |
| Robertson et al. | Characterization of a cDNA encoding glutamine synthetase from the marine diatom Skeletonema costatum (Bacillariophyceae) | |
| CN102492777B (en) | Standard plasmid molecule for transgenic maize Mon810 detection and construction method thereof | |
| CN115232882B (en) | SNP (Single nucleotide polymorphism) marker linked with genetic sex of Chinese softshell turtles as well as primers and application of SNP marker | |
| CN105440111A (en) | Pair of transcription activator-like effector nucleases (CTFs), coding sequences and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20110223 |