WO2012134234A2 - Utilisation d'hades comme modulateur négatif de l'akt - Google Patents

Utilisation d'hades comme modulateur négatif de l'akt Download PDF

Info

Publication number
WO2012134234A2
WO2012134234A2 PCT/KR2012/002408 KR2012002408W WO2012134234A2 WO 2012134234 A2 WO2012134234 A2 WO 2012134234A2 KR 2012002408 W KR2012002408 W KR 2012002408W WO 2012134234 A2 WO2012134234 A2 WO 2012134234A2
Authority
WO
WIPO (PCT)
Prior art keywords
akt
hades
protein kinase
cells
protein
Prior art date
Application number
PCT/KR2012/002408
Other languages
English (en)
Korean (ko)
Other versions
WO2012134234A3 (fr
Inventor
안성관
배승희
Original Assignee
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 건국대학교 산학협력단 filed Critical 건국대학교 산학협력단
Publication of WO2012134234A2 publication Critical patent/WO2012134234A2/fr
Publication of WO2012134234A3 publication Critical patent/WO2012134234A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Definitions

  • the present invention relates to the use of Hades as an Akt negative regulator, and more particularly, to an Akt (protein kinase B) negative regulator or anticancer agent containing a Hades protein or a gene encoding the same as an active ingredient.
  • Akt protein kinase B
  • Akt protein kinase B
  • Akt activation regulates a variety of biological responses, including cell proliferation, protein synthesis, cell growth, cell cycle progression, and inhibition of apoptosis [3].
  • Akt is activated through platelet-derived growth factor, insulin, epidermal growth factor, basic fibroblast growth factor, and insulin-like growth factor I [2, 4, 5].
  • Downstream substrates of Akt have been identified at the cellular and molecular level.
  • Glycogen synthase kinase 3 (GSK3) the first identified substrate of Akt, is negatively regulated through direct phosphorylation by Akt [6].
  • GSK3 especially GSK3 (3) activity
  • Phosphatidilinosyl 3-kinase (PI3K) and phosphatase and tensine homologs (PTEN) are regulators of Akt [10].
  • PI3K induces Akt phosphorylation / activation, while PTEN activates Akt via dephosphorylation of phosphatidylinocyte-3,4,5—triphosphate, which is produced from phosphatidylinosyl by -3 and 5-bisphosphate by PI3K. Inhibits [2, 4, 11].
  • C1 domain-containing phosphatase and tencin homologs, carboxy-terminal regulatory proteins, Trb3, And negative regulators such as Keratin KIO have also been reported to inactivate Akt [12-15].
  • the proteolytic activity of the ubiquitin-proteasome system is important in many cellular processes [16].
  • the formation of polyubiquitin-protein conjugates recognized and disrupted by the 26S proteasome involves three components that participate in the cascade of ubiquitin transfer reactions: ubiquitin ⁇ activating enzyme (E1), ubiquitin-conjugating enzyme (E2) And specificity factor (E3) called ubiquitin ligase.
  • E3 ligase controls the specificity of target protein selection and controls the abundance of individual target proteins [16].
  • Hades as a new E3 ligase from Akt.
  • Hades as a new negative regulator of Akt that functions in a variety of cellular processes, including cell proliferation, survival and tumor development, and completed the present invention.
  • Another object of the present invention is to provide an Akt negative regulator containing a Hades protein or a gene encoding the same as an active ingredient.
  • Another object of the present invention is to provide an anticancer agent containing a Hades protein or a gene encoding the same as an active ingredient.
  • Another object of the present invention is to provide a method for screening an Akt negative or positive modulator using the interaction of Akt and Hades.
  • the invention has an amino acid sequence of SEQ ID NO: Provided is an Akt (protein kinase B) negative modulator containing a Hades protein or a gene encoding the same as an active ingredient.
  • Akt protein kinase B
  • the Hades protein was identified among cDNA library proteins capable of interacting with Akt and named after Greek subordinates.
  • Hades protein has been deposited with UniProtKB accession number Q969V5 and has the amino acid sequence of SEQ ID NO: 2.
  • the Akt protein kinase B
  • Aktl is known to be involved in cell survival pathways by inhibiting apoptosis
  • Akt2 is known as an important signaling molecule in the insulin signaling pathway.
  • Hades of the present invention have been found to effectively interact with both Aktl and Akt2.
  • a negative regulator refers to a regulator that inhibits the expression of the Akt or inhibits the downstream signaling pathway of the Akt.
  • the gene encoding Hades may have any nucleotide sequence capable of encoding the amino acid sequence of SEQ ID NO: 2, preferably Akt (protein kinase) characterized by having a nucleotide sequence of SEQ ID NO: 1 B) provides negative modulators.
  • Akt protein kinase
  • the term "gene” refers to a nucleic acid (eg, DNA, RNA) sequence comprising a coding sequence necessary to produce a protein or polypeptide, wherein the protein or polypeptide is defined by a full length coding sequence. Or may be encoded by a portion of a coding sequence so long as the desired active or functional property is maintained. The term also refers to the coding region of a structural gene and the terminus such that the gene conforms to the length of a full-length mRNA. At 5 'and over a distance of about 1 kb
  • sequence located adjacent to the coding region at the 3 'end are referred to as 5′-nontranslated sequences. Sequences located 3 'or below the coding region and present in the mRNA are referred to as 3'-untranslated sequences.
  • Gene includes both the cDNA and genomic form of a gene.
  • a genomic form or clone of a gene is a non-coding called an "intron” or “insertion region” or “insertion sequence” It includes a coding region that is interrupted by the sequence.
  • Introns are segments of genes that are transcribed into nuclear RNA (hnRNA); Introns can include regulatory elements, eg, enhancers, introns are removed or “spliced” from the nucleus or initial transcript; Thus, introns are not present in mRN transcripts.
  • the mRNA functions during translation to specify the sequence or sequence of amino acids of the initial polypeptide.
  • Gene expression converts genetic information encoded in a gene into RNA (e.g., mRNA rRNA, tRNA or sn NA) through transcription of the gene (e.g., by enzymatic action of RNA polymerase), and protein coding gene
  • RNA e.g., mRNA rRNA, tRNA or sn NA
  • Gene expression can be regulated at many stages in the process; “up-regulation” or “activation increases production of gene expression products.
  • up-regulation” or “activation” increases production of gene expression products.
  • down-regulation or “inhibition” refers to regulation that reduces the product.
  • Molecules involved in up-regulation or down-regulation are often referred to as “activators” and “inhibitors” respectively.
  • the 5 'flanking region may comprise regulatory sequences, eg, promoters and enhancers that regulate or influence the transcription of the gene. May comprise sequences directing termination of transcription, post-transcriptional cleavage and polyadenylation.
  • the Hades gene provides an Akt (protein kinase B) negative regulator, which is inserted into a recombinant expression vector.
  • the Hades gene is operably linked and inserted into the regulatory elements of the recombinant expression vector.
  • vector is used for a nucleic acid molecule that transfers DNA fragments from one cell to another, which is often derived from plasmids, bacteriophages or plant or animal viruses.
  • expression vector refers to a suitable nucleic acid sequence necessary for the expression of the coding sequence of interest and the coding sequence operably linked in a particular host organism. Reference to recombinant DNA is included. Nucleic acid sequences required for expression in prokaryotic cells generally include promoters, operators (optional), and ribosomal binding sites, along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.
  • the term "recombinant expression vector” is a vector capable of expressing a target protein in a suitable host cell, and in the present invention, a Hades protein, a gene comprising an essential regulatory element operably linked to express a gene insert. Say the construct.
  • operably linked refers to a functional link between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function.
  • a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence.
  • Operational linkage with recombinant vectors can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation employs enzymes commonly known in the art.
  • Suitable expression vectors include promoters, initiation codons, termination codons, expression control elements such as polyadenylation signals and enhancers, and the like, and can be prepared in various ways.
  • the start codon and the stop codon must be functional in the subject when the gene construct is administered and must be in frame with the coding sequence.
  • Hades provides an Akt (protein kinase B) negative modulator, characterized in that it has a RING finger domain and E3-ubiquitin ligase activity. In the examples of the present invention, it was demonstrated that Hades has RING finger-domain and has E3—ubiquitin ligase activity.
  • the Akt provides an Akt (protein kinase B) negative modulator, characterized in that it directly interacts with Hades and is ubiquitinated by Hades.
  • the Akt directly interacts with Hades and is ubiquiUnateed by Hades. Proved
  • Akt protein kinase B negative modulator
  • Akt protein kinase B negative modulator
  • Akt protein kinase B negative regulator
  • Akt is decomposed by ubiquitination by Hades to inhibit Akt expression.
  • Akt was decomposed by ubiquitination by Hades to inhibit Akt expression.
  • Hades provides an Akt (protein kinase B) negative modulator, characterized in that only Akt activated by phosphorylation specifically ubiquitizes. In the embodiment of the present invention, it was demonstrated that Hades specifically ubiquitizes only Akt activated by phosphorylation.
  • Akt protein kinase B
  • Akt protein kinase B negative modulator
  • Akt protein kinase B negative modulator
  • lysine 284 of Akt is the main site of ubiquitination by Hades.
  • lysine 284 of Akt is a major site of ubiquitination by Hades.
  • the Akt is Akt (protein kinase B) negative, characterized by inducing cell proliferation, inhibition of apoptosis and cell migration by downstream signaling ( negative) provides a regulator. It is well known in the literature that Akt induces cell proliferation, inhibition of apoptosis and cell migration by downstream signaling.
  • Hades provides an Akt (protein kinase B) negative modulator, characterized in that it inhibits the proliferation, survival and cell migration of cancer cells.
  • Akt protein kinase B
  • Embodiments of the present invention demonstrated that Hades inhibits the proliferation, survival and cell migration of cancer cells by negatively regulating downstream signaling of Akt.
  • HeLa cells which are cervical cancer cells
  • HCT116 which is colon cancer cells.
  • the present invention is characterized in that it functions as an Akt (protein kinase B) negative regulator, containing a Hades protein having the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same as an active ingredient.
  • Akt protein kinase B
  • Hades inhibits the proliferation, survival and cell migration of cancer cells by negatively regulating downstream signaling of Akt.
  • HeLa cells which are cervical cancer cells
  • HCT116 which is colon cancer cells.
  • the anticancer agent of the present invention may additionally include one or more pharmaceutically acceptable carriers or excipients (see Remington's Pharmaceutical Sciences and US Pharmacopoeia. 1984, Mack Publishing Company, Easton, PA, USA). .
  • pharmaceutically acceptable generally means suitable for administration to a mammal, including humans, from a toxicity or stability standpoint.
  • Carriers include diluents, excipients, layers, adhesives, wetting agents, Disintegrants, absorption enhancers, surfactants, absorbent carriers, brighteners commonly used in the pharmaceutical art. If necessary, flavors, sweeteners and the like may be added.
  • the carrier may also contain other pharmaceutically acceptable excipients to modify other conditions such as pH, osmotic pressure, viscosity, asepticity, lipidity, solubility, and the like. Pharmaceutically acceptable excipients which allow sustained or delayed release after administration may also be included.
  • Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol and the like.
  • the pharmaceutical composition administered may contain a small amount of a nontoxic adjuvant such as, for example, a wetting or emulsifying agent such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, triethanamine sodium acetate, pH buffer, and the like. May contain substances.
  • the anticancer agent composition of the present invention can be administered, for example, by systemic or oral route. Can be injected via the route. Preferred forms of systemic administration include injection, generally intravenous injection. Other injection routes may be used, for example, subcutaneously, intramuscularly or intraperitoneally. Alternative means of systemic administration include transmucosal and transdermal administration using penetrants such as bile acids or fusidic acids or other surfactants. Moreover, the anticancer composition of this invention can also be formulated with an enteric agent, a capsolization agent, or an oral administration agent. Administration of these anticancer agents may be local and / or partial in the form of ointments, pastes, gels and the like.
  • the nucleic acid may be included in the vector.
  • the vector can be a viral vector.
  • the viral vector is an adenovirus vector.
  • the adenovirus is formulated with protamine. Any number of viral particles can be administered to the patient. In certain embodiments, about 10 8 to about 10 14 virus particles are administered to the patient per administration.
  • the nucleic acid composition may comprise one or more lipids. Any of the lipids described above can be included in such lipid—nucleic acid compositions. Examples of such lipids include D0TAP and cholesterol, or derivatives thereof.
  • the term “therapeutically effective amount” means the amount of active agent, such as the Hades protein of the present invention, that when administered according to a desired therapeutic regimen produces a desired therapeutic effect or response or provides a desired benefit.
  • the amount of the composition administered may be determined by the physician, based on the severity of the condition, the composition age administered, the body weight, and the condition of the patient to be treated, such as the reaction of each patient, the chosen route of administration, but for medications that are Hades proteins,
  • a pharmaceutically or prophylactically effective amount to be administered to a cancer patient is preferably about 0.01 to 10 rag / kg / day.
  • the invention comprises an Akt comprising the following steps
  • Protein Kinase B Provides a method for screening negative modulators: (a) cotransfection of Akt and Hades to animal cells; (b) treating any of the agents on the transfected animal cells; And, (c) said Determining whether the interaction of Akt and Hades in animal cells is facilitated.
  • the present invention provides a method for screening an Akt (protein kinase B) positive modulator comprising the following steps: (a) cotransfection of Akt and Hades to an animal cell; ); (b) treating the transformed animal cell with any agent; And, (c) determining whether the interaction of Akt and Hades in the animal cell is inhibited.
  • Akt protein kinase B
  • Akt a serine / threonine kinase
  • Hades which is a negative regulator of Akt, having a RING finger domain and E3 ubiquitin ligase activity.
  • Akt interacts directly with Hades, in vitro and by Hades. It has been found to be ubiquitinated in vivo.
  • Other molecular assays have demonstrated that phosphorylated Akt is a practical target for both interaction and ubiquitination by Hades.
  • the results of these functional studies suggest that the degradation of Akt by Hades can inhibit the proliferation and survival of cancer cells.
  • the present invention demonstrates the function of Hades in the negative regulation of Akt cell signaling. Hades is directly bound to Akt in vivo and in vitro,
  • Hades It was not bound by ' Hades ' or ubiquitized by Hades (FIG. 2D). In addition, Hades confirmed that it was not phosphorylated by Akt kinase.
  • the relationship between Hades and Akt is very dependent on the phosphorylation state of Akt. It was found that it was dependent, and thereby found that Akt protein stability was tightly regulated. Serum stimulation to induce phosphorylation of Akt increased the binding capacity between Akt and Hades, thus increasing Akt ubiquitination and Akt degradation. This phosphorylation-dependent Akt proteolysis was re-validated by constructing and using Akt (Myc / His-Akt-myr), which is artificially genetically engineered to remain active at all times. By immunoprecipitation, Hades bound to Akt-myr but not to unphosphorylated dominant negative mutant Akt (Akt-DN).
  • Akt is phosphorylated at the 473 th serine at the C-terminus, which is a phosphorylated and non-enzymatic domain at the amino acid 308 th thronine in the T-loop present in its enzyme activity domain. Complete activity [40].
  • a bond is formed between the PH domain and the kinase domain in Akt, thereby inhibiting the in-loop phosphorylation of Akt by the upper phosphate-independent-kinase kinase-1 [37, 41].
  • the exact structural mechanism is not fully known, it can be concluded that the phosphorylation of Akt exposes a portion capable of binding Hades in the kinase domain of Akt.
  • Akt enzymes play an important role in promoting various intracellular processes involved in cell growth and cell migration through phosphorylation of several downstream targets [36].
  • the overexpression of Hades in cancer cells demonstrated that the cell growth and growth capacity were dependent on Hades' E3 ligase activity.
  • GSK-3 (3 and TSC2 are well known
  • results of the present invention demonstrated that Hades can negatively regulate Akt and regulate many related cellular processes.
  • the results of the present invention may also offer the possibility of having clinical significance as a future new target as a modulator of Akt.
  • Akt interacts with Hades E3 ubiquitin ligase in vitro and in vivo.
  • FIG. 2 shows that the ubiquitination and degradation of Akt is mediated by Hades.
  • FIG. 3 shows that pAkt is a preferred substrate of ubiquitination by Hades.
  • FIG. 5 shows that lysine 284 of Akt is a site for Hades-mediated polyubiquitination.
  • FIG. 6 shows that the cell growth function of Akt is inhibited by Hades.
  • FIG. 7 shows that siRNA-mediated Hades expression clearance stabilizes endogenous Aktl and Akt2 proteins.
  • 8 shows that Hades induces Aktl degradation and co-locates with Aktl in the mitochondria.
  • FIG. 9 shows that serum reduces Akt protein stability.
  • FIG. 10 shows that geldanamycin induces Akt degradation in both control cells and Hades-deficient cells.
  • FIG. 11 shows that Hades-mediated Akt proteolysis is restored by wortmannin.
  • FIG. 13 shows that the depletion of Hades in HeLa cells by shRNA increases cell growth.
  • FIG. 14 shows that Akt-mediated cell survival increase is reduced by Hades in a RING domain-dependent manner.
  • FIG. 15 shows that endogenous Hades deficiency inhibits cell migration.
  • Figure 16 shows that Hades-induced NF- ⁇ activation is independent of its E3 ligase activity, and Akt-induced NF- ⁇ activation is in an E3 ligase activity-dependent manner.
  • FIG. 17 shows that isotopically expressed Akt is degraded by Hades in HeLa cells in the presence of a caspase inhibitor Z-VAD.
  • FIG. 18 shows that Hades reduces colony formation in HCT116 colon cancer cell line.
  • Akt and Hades were amplified and isolated by PCR of cDNA derived from cervical cancer cell line HeLa.
  • Amplified human Aktl cDNA was cloned into pcDNA3.1-Myc / His (Invitrogen, Carlsbad, Calif.), PGEX6p (Pr omega, Madison, Wis.) And pET28 (Novagen, EMD Chemicals Inc. Merck, Darmstat, Germany) vectors. .
  • HadescDNA was cloned into the pEGFP-C (Clontech, Mountain View , CA) , and P GEX6p vector. Functional divisions of the Akt gene were cloned into the pcDNA3.1 (Invitrogen) vector.
  • Akt genes The dominant negative mutated Akt genes (DN-Akt, T308A and S473A), mutants of lysine residues in the Akt amino acid sequence, and Hades' RING domain-mutations (Hades MT-C302S and C305S) were QuikChange site-directed Using the product of the mutagenesis kit (Stratagene, Santa Clara, CA), following the instructions for the product, HA-ubiquitin (HA-Ub) plasmid ⁇ 23 was provided by Dr. Dirk Bohmann (University of Rochester, Rochester, NY). . HA-Ub mutant genes (HA-Ub-K48R and HA_Ub-K63R) were provided by Dr. Zhijian Chen (University of Texas Southwestern Medical Center, Dallas, TX). Primer sequences used for PCR are listed in Table 1 below.
  • Hades-C302S_3 cagggagagtctgaagagcgcctctgtagtgEgtctgagcagcttca
  • GST- and GST-labeled Hades (GST-Hades) proteins are known as Escherichia coli coli) BL21 strain was used to treat 0.1 mM IPTG at 37 ° C. for 1 hour.
  • NPk 40 lysis buffer 50 mMTris-HCl, pH 7.5, 150 mMNaCl) , 1% NP-40, 1 mM DTT, 1 mM EDTA, lysozyme and protease inhibitors).
  • the recombinant proteins were extracted using glutathione-sepharose 4B bead following the instructions of the product, and the extract was dialyzed using the product of Slide-A-Lyzer dialysis cassette (Pierce, Rockford IL). Concentrated using an Ultra-15 device (Millipore, Billerica, Mass.), His-Akt was purchased from Millipore.
  • Example 3 Antibodies and reagents
  • the antibodies used for this study are as follows. Antibodies of EFGP, Myc-tag, Phosphorylated Akt (pAkt) (S308), pAkt (T473), Akt, pGSK-3, TSC2, pTSC2 (TW62)
  • Example 4 In vitro binding assay assay 35S-labeled proteins and protein assemblies were obtained through in vitro transcription / translation reactions. With this, 3 GST or GST-Akt The total protein 0.5% NP-40 buffer containing glutathione-Sepharose 4B beads was mixed and reacted for 3 hours at 37 ° C. After washing three times, the sample was boiled in the SDS sample buffer. Analysis of bound proteins was done by developing using autoradiography via SDS-PAGE.
  • Example 5 immunoprecipitat ion
  • Example 7 In vivo ubiquit inat ion assay After transfection, MG132 treated cells were washed with PBS and vortexed by adding 200 ⁇ denaturing lysis buffer (50 mMTris-HCl, pH 7.4, 0.5% SDS and 70 mM ⁇ -mercaptoethanol). The phase completely lysed the cells by boiling at 95 degrees for 15 minutes. The lysed cell solution was added in 800 ⁇ of CHAPS buffer. The lysed cell solution was immunoprecipitated with the addition of Akt antibody and protein agarose A / G PLUS-Agarose beads. After the reaction, the beads were washed with CHAPS lysis buffer five times and then boiled.
  • 200 ⁇ denaturing lysis buffer 50 mMTris-HCl, pH 7.4, 0.5% SDS and 70 mM ⁇ -mercaptoethanol.
  • the phase completely lysed the cells by boiling at 95 degrees for 15 minutes.
  • the lysed cell solution was added in 800 ⁇ of CHAPS buffer.
  • Ubiquitinated Akt was developed through immunoblotting with anti-HA antibodies. His-pull down assay was performed by diluting the denatured cell solution with 800 ⁇ buffer A (50 mM NaH2P04, 300 mMNaCland 10 mM imidazole pH 8.0), and then adding Ni-NTA bead to room temperature. I rebounded overnight at 4 degrees. The beads were washed five times using buffer B (50 mM NaH 2 P04, 300 mM NaCl and 20 mM imidazole, pH 8.0), and the proteins bound to the beads were eluted by boiling with SDS-PAGE sample buffer. The eluted proteins were immunoblotted using anti-HA antibody, Example 8: RNA interference (RA interference)
  • Hades si RNA 100 pmol was added to LipofectamineR AiMAX (Invitrogen) in serum-free medium.
  • HEK293 cells (5x105 cells) were transduced, then exchanged for normal medium and finished with durban manure for 48 hours.
  • Example 9 Cell Viability Assay
  • a control group encoded with green fluorescent protein (EGFP) in HeLa cells, a cervical cancer cell line Plasmids, EGFP-labeled Hades, or Hades MT gene were transduced. After 2 weeks, the resulting colonies (colonies) were fixed and stained with 0.1% crystal violet to analyze the results.
  • Anchorage-independent soft-agar assay was performed on 3 ml of DMEM medium containing .45% low-melting agarose and 10% fetal bovine serum. After addition, 2 ml of DMEM containing 9% agarose and 10% fetal bovine serum was added to cover the surface, and colonies were observed by incubation for 2 weeks.
  • Example 11 luciferase reporter gene assay
  • This experiment used the TCF-banung luciferase plasmid pTOPFLASH (upstate). There are six TCF-banung sites in the pTOPFLASH vector. After transfection of the vector and reaction for 48 hours, the luciferase activity was analyzed by how many times the ⁇ -galactosidase was increased as a control. The result is the average of three independent experiments.
  • Example 12 Construction of a Full-Length Human cDNA Library
  • RA total RA was first extracted from cervical cancer HeLa cells and liver Chang cells using TRIzol reagent (Invitrogen, Carlsbad, CA) based on the manufacturer's instructions.
  • the full length cDNA library was constructed using the SMART cDNA library construction kit (Clontech, Mountain View, CA) and TRIfflER-cDNA normalization kit (Evrogen, Russia) based on the manufacturer's instructions.
  • the normalized cDNA was fractionated by size using CHROMA SPIN-400 column (Clontech) and modified to insert Sfil restriction enzyme reaction site for all cDNA of 500 bp or more through genetic method. It was then cloned into pcDNA3.1 (+) vector (Invitrogen) and transformed into TOP10 Escherichia coli.
  • Example 13 Novel Akt-binable protein screening experiment
  • Cervix cancer HeLa cells were grown to a population of about 70% on 100-mm plates, and then 5 EGFP-MULAN-WT black EGFP-MULAN-MT with Myc / His-Aktl-myr (2 g) Lipofectamine 2000 (Invitrogen) was used to transduce cells into cells based on the manufacturer's instructions. The cells were then incubated for 24 hours. Cultured cells were harvested and resuspended in NKM buffer (1 mM Tris-HCl, pH 7.4), 130 mM NaCl, 5 mM KC1, 7.5 mM MgC12).
  • the cells were lysed using a Dounce homogenizer and centrifuged for 5 min at 12,000 x g at room temperature with 2 M sucrose (final concentration: 0.25M). After centrifugation, the supernatant was transferred to a new tube and again centrifuged for 15 min at 4 ° C. at a strength of 7,000 X g. Mitochondrial pellets were resuspended in suspension buffer (10 mM Tris-HCl (pH 6.7), 0.15 mM MgC12, 0.25 mM sucrose, protease inhibitor cocktail) and centrifuged at 4 ° C for 10 minutes at 9,500 xg. . After centrifugation the pellet is the mitochondrial fraction and the supernatant is the cytoplasmic fraction. The cytoplasm and mitochondrial proteins were analyzed via immunoblotting using 10-15% SDS-PAGE and corresponding antibodies.
  • the transduced cells were incubated in glass coverslips and then fixed by reaction with 4% formaldehyde at room temperature for 5 minutes, and washed with PBS twice to remove the remaining solution, followed by pemeabilization buffer (0.53 ⁇ 4> Triton X-100 in PBS) for 3 minutes. Immobilized cells in PBS with 5% BSA and 2% goat serum After the reaction, the reaction was blocked for 30 minutes, and the anti-myc antibody (1: 200 in PBS) was reacted at room temperature at 4 ° C. overnight. After washing with PBS three times, the remaining ones were removed and reacted for an additional hour using a secondary antibody (1: 500 in PBS) labeled with fluorescein Texas red.
  • a Hades shRNA-coded pLKO vector (Sigma) was obtained by injecting the microorganism, and the vector was purely isolated from the microorganism. .2) and VSVG plasmids were produced by transducing into 293T cells. 48 hours after transfection, the virus-containing medium was collected and concentrated through a filter having 0.45- ⁇ pores. After culturing cervical cancer HeLa cells on a 6-well plate, the virus was treated with polybrene, and after 6 hours, the medium was changed anew and finally, 72 hours with 1 g / ml puromycin added medium. Incubated. Finally, puromycin-resistant HeLa cells expressing control shRNA and Hades shRNA were selected and used in the experiment.
  • Example 17 Statistical Analysis
  • Statistical analyzes include the ⁇ 2 test, Fisher's exact test and
  • [Experiment result] 1 shows Akt interacts with Hades E3 ubiquitin ligase in vitro and in vivo.
  • A 35S ⁇ methionine-labeled Akt was tested for interaction with GST-tagged Hades (GST-Hades) using an in vitro interaction between Akt and Hades, a full-announce assay.
  • B In vivo association between Akt and Hades. After transfection with the plasmid as indicated, HEK293 cells were treated with MG132, followed by immunoprecipitation with anti-Akt antibody and immunoblotting with anti-EGFP. Immunoglobulin G was used as a negative control.
  • C Endogenous interactions between Hades and Akt soothes.
  • MG132-pretreated HeLa cells were immunoprecipitated with Akt isosome-specific antibodies and immunoblotting using anti-Hades antibodies.
  • D Functional domain structure and guidance of plasmids of Akt deletion mutants.
  • E Akt's KD interacts with Hades. 35S-methionine-labeled Akt deletion mutants were tested for interaction with GST-Hades using a pull-down assay.
  • FIG. 2 shows that the ubiquitination and degradation of Akt is mediated by Hades.
  • A Akt protein levels in cells were reduced by Hades via proteasome degradation pathways in a RING-dependent manner. After transfection with plasmid as indicated, HEK293 cells were treated with MG132 and immunoblotted with the indicated antibodies.
  • Akt was ubiquitized by Hades in vitro, In vitro ubiquitination assay was performed as described in the Examples.
  • C Akt was ubiquitized by Hades in vivo. After transfection with the plasmid as indicated, HEK293 cells were treated with MG132 and then subjected to an in vivo ubiquitination assay as described in the Examples.
  • D Ubiquitination of Akt was eliminated by Hades siRNA transfection.
  • HEK293 cells were treated with 1 ⁇ MG132 for 12 hours and then subjected to in vivo ubiquitination assay.
  • ⁇ ⁇ 48-linked polyubiquitination is responsible for Hades-dependent Akt ubiquitination.
  • HeLa cells were transfected with plasmids as indicated, followed by in vivo ubiquitination.
  • FIG. 3 shows that pAkt is a preferred substrate of ubiquitination by Hades.
  • A The interaction between Hades and Akt is dependent on phosphorylated Akt. Serum-deficient HeLa cells were treated with 10% serum or insulin and MG132 for 6 hours.
  • pAkt levels in cells were reduced by Hades. HeLa cells were transfected with plasmids as described in the Example. After 24 hours of incubation, the medium was replaced with serum free medium and the cells were then stimulated with 10% serum for 2 hours. Cells were lysed and immunoblotted with antibodies as indicated, (C) the pAkt protein of the cells was ubiquitinated by Hades ⁇ transfected with plasmid as indicated, and then HeLa cells were incubated in serum free medium for 18 hours. I was. Cells were treated with 10 ⁇ LY294002 and then 10 ⁇
  • Akt and pAkt were detected by immunoblotting with the indicated antibodies.
  • Hades siRNA treatment increased Akt protein stability. HeLa cells were transfected with control and Hades siRNA and treated with 40 Mg / ml cyclonucleoside for the indicated time, and then
  • Akt protein turnover was investigated via immunoblotting. 4 shows that activated Akt is the preferential target of the ubiquitin E3 ligase Hades.
  • Hades is const itutively active in vivo
  • Akt Interacted with Akt.
  • HEK293 cells were treated with MG132 and then immunoprecipitated with anti-myc antibody and immunoblotted with the indicated antibodies, (B) Activated Akt was in vivo by Hades. It was efficiently ubiquitated. After transfection with the plasmid as indicated, HEK293 cells were removed.
  • FIG. 5 shows that lysine 284 of Akt is a site for Hades-mediated polyubiquitination.
  • A KD of Akt is ubiquitized by Hades. A series of Akt deletion constructs were transcribed and translated in the presence of 35S-methionine. The 35S-labeled Akt mutations were ubiquitized by Hades via an in vitro ubiquitination assay.
  • B Lysine 284 of Akt is the polyubiquitination site.
  • HEK293 cells were cotransfected with plasmids as indicated. 24 hours after transfection, cells were treated with 10 ⁇ MG132 and subjected to an in vivo ubiquitination assay as described in the Examples.
  • FIG. 6 shows that the cell growth function of Akt is inhibited by Hades.
  • A Cell growth was alleviated by Hades. After transfection with plasmids as indicated in HeLa cells, the number of viable cells was counted every 24 hours using a hemocytometer. The result is representative of three independent experiments.
  • B Hades inhibits cell survival in a dose-dependent manner. HeLa cells were transfected with plasmids as indicated. After 24 hours of incubation, cell viability was determined by MTS assay.
  • Hades inhibits clonal growth.
  • E, F, G Akt downstream signaling is regulated by Hades.
  • HeLa cells were transfected with the indicated Hades plasmid (E) and Hades siRNA (F). After 24 hours incubation, the cells were lysed and immunoblotted with the indicated antibodies.
  • HeLa cells were cotransfected with TCF / LEF1 reporter plasmid, pTOPFLASH and the other plasmids indicated. After 24 hours of incubation, the cells were lysed and the reporter luciferase activity driven by the TCF response element was determined (G).
  • H, I Hades inhibited Akt-induced cell migration (H), but did not inhibit K284R ⁇ Akt-induced cell migration (I).
  • HeLa cells were cotransfected with plasmids as indicated. After 48 hours transfection, 10OT confluent cells were scratched to form wounds. 72 hours after the induction of the wound, cell migration was visualized on a phase contrast microscope.
  • J Cell growth of K284R-A-expressing cells is not inhibited by Hades. After HeLa cells were transfected with the plasmid as indicated, the number of viable cells was counted every 24 hours using a hemocytometer.
  • FIG. 7 shows that siRNA-mediated Hades expression clearance stabilizes endogenous Aktl and Akt2 proteins. Transfection of HeLa serotypes with Hades specific siRNA The effect of Hades clearance on Akt isoforms was determined by immunoblotting with Akt isoform-specific antibodies.
  • FIG. 8 shows that Hades induces Aktl degradation and co-locates with Aktl in the mitochondria.
  • A Hades induced Aktl degradation in both the cytosol and mitochondria. HeLa cells were cotransfected with the indicated plasmids and the cytoplasmic and mitochondrial fractions were isolated. Immunoblotting with the indicated antibodies determined the effect of Aktl degradation by Hades in the cytoplasm and mitochondrial fraction. Tubulin and Bcl-xL were used as cytoplasmic and mitochondrial markers, respectively.
  • B Colocation of Hades with Aktl-WT (top) and Aktl-myr (bottom) was investigated in HeLa cells.
  • FIG. 9 shows that serum decreases Akt protein stability, HeLa cells were serum-deficient for 20 hours, and a set of cells were stimulated with 10% fetal calf serum. Cells were then treated with 40 g / ml cyclonuximide for 0, 3, 6, 12, and 24 hours and endogenous Akt protein stability was examined using immunoblotting.
  • FIG. 10 shows that geldanamycin induces Akt degradation in both control cells and Hades-deficient cells.
  • HeLa cells were transfected with negative control siRNA or Hades siRNA and then treated with geldanamycin (50 nM) overnight. Protein levels of Hades and Akt were detected by immunoblotting.
  • FIG. 11 shows that Hades® mediated Akt proteolysis is recovered by wortmannin.
  • HEK293 cells were cotransfected with plasmids as indicated. After 24 hours of incubation, cells were treated with 10 ⁇ wortmannin for 4 hours. Cells were lysed and immunoblotted with the indicated antibodies.
  • 12 shows that mutation of lysine 284 prevents proteolytic degradation of isotopically expressed Akt by Hades.
  • HEK293 cells were cotransfected with plasmids for wild type or lysine mutations of Akt in combination with plasmids for EGFP-Hades or control EGFP. 24 hours after transfection, Cells were lysed and immunoblotted with the indicated antibodies.
  • FIG. 13 shows that the depletion of Hades in HeLa cells by shRNA increases cell growth. HeLa cells were infected with lentivirus expressing negative control shRNA or Hades shRNA. Cells for 2 weeks
  • FIG. 14 shows that Akt-mediated cell survival increase is reduced by Hades in a RING domain-dependent manner.
  • HeLa cells were transfected with plasmids for control EGFP, EGFP-tagged wild type Hades (EGFPHADES-WT) or RING domain mutant Hades (EGFP-HADES-MT) in combination with Myc / His-Akt-myr. Twenty four hours after transfection, cell viability was determined using MTS assay.
  • HeLa cells were EGFP control,
  • FIG. 17 shows that isotopically expressed Akt is degraded by Hades in He cells in the presence of a caspase inhibitor Z-VAD.
  • HEK293 cells were transfected with a plasmid for EGFP—HADES-WT or EGFP-HADES-MT with a combination of Myc / His-Akt-WT. 24 hours after transfection, cells were treated with Z-VAD (10 ⁇ ) and incubated for another 4 hours. Cell extracts were immunoblotted with the indicated antibodies.
  • FIG. 18 shows that Hades reduces colony formation in HCT116 colon cancer cell line.
  • Cancer cells are characterized by growing morphologically to form colonies.
  • the EGFP vector, the EGFP-Hades WT vector, and the EGFP-Hades MT vector were first transfected into colon cancer cell HCT116 through Lipofectamin 2000 according to the manufacturer's instructions. . Afterwards, the colony was cultured in a medium containing the antibiotic puromycin for 2 weeks to generate colonies. After that, the cells were immobilized and finally stained with 0.1% crystal violet. This is a graph of the colony numbers shown in (B)).
  • Human full-length cDNA libraries derived from HeLa and Chang cells were prepared to identify proteins that interact with Akt (Supplementary Materials and Methods).
  • Akt 1-binding protein In vitro transcription and translated protein pools from the cDNA library were screened for human Akt 1-binding protein with a modified SMART technique.
  • all experiments were conducted using human Aktl, which is denoted 'Akt' unless otherwise specified. remind From the library, several positive cDNA clones were isolated and one of the clones identified as the main Akt—binding partner (data not shown).
  • This clone contained several putative functional domains: a transmembrane (TM) domain or signal peptide at the N terminus, a 2 TM domain at the middle of the protein, and a RING finger domain at the C terminus (ie, a label of the E3 ligase domain).
  • TM transmembrane
  • the present invention focuses on functional communication between this clone and Akt, while Li et al. [23] named this protein MILAN, meaning mitochondrial ubiquitin ligase activator of NF- ⁇ .
  • FIG. 1A In vitro pull-down studies have shown that Akt physically interacts with Hades (FIG. 1A). The intermolecular association between endogenous Akt and Hades was investigated using coi ⁇ unoprecipitation assay (FIG. 1B). Human Akt has three isoforms: Aktl, Akt 2 and Akt3. Akt isosome-specific immunoprecipitation assays showed that Hades interacts with AI and Akt2 but not with Akt3 (FIG. 1C). Also, Hades deficiency increases protein levels of Aktl and Akt2 but not Akt3. (FIG. 7), it was reported that Akt2 was translocated to mitochondria, but not Akt3 [24]. Aktl's mitochondrial transposition is controversial [24-26].
  • Hades functions as an E3 ligase for Akt.
  • Hades expression resulted in a decrease in Akt protein levels in an E3 ligase activity-dependent manner.
  • proteasome inhibitor MG132 completely restored this decrease in intracellular Akt protein levels (FIG. 2A, lane 5).
  • FIG. 2B and 2C The assay demonstrated that recombinant and endogenous Akt proteins were ubiquitinated by Hades in an E3 ligase activity-dependent manner. The opposite was observed in Hades siRNA-induced knockdown cells.
  • FIG. 3B In vivo ubiquitination assays also demonstrated that serum stimulation induced endogenous Akt ubiquitination by Hades (FIG. 3C). In addition, it is a PI3K inhibitor that inhibits phosphorylation of Akt.
  • LY294002 inhibits Hades-induced Akt ubiquitination in serum-stimulated HEK293 cells Inhibition (Fig. X, lanes 5-8). These observations suggest an association between Akt activation status and Hades-mediated degradation. To demonstrate this hypothesis, an in vitro ubiquitination assay was performed in the presence of ⁇ -PPase [30, 31] having activity with phosphorylated serine, threonine and tyrosine residues. Treatment with ⁇ -PPase effectively eliminated phosphorylation of Akt residues to inhibit Akt ubiquitination (FIG. 3D), which led to testing whether serum or growth factors reduce the stability of endogenous Akt.
  • Akt activation is induced by cross-domain morphologically-mediated phosphorylation [32, 33].
  • Myristoylation signal-attached Akt (Akt-myr) is a constitutively active form of Akt [34].
  • Coimmunoprecipitation experiments showed that Hades interacted with ectopically expressed functionally active Akt (Myc / His-Akt-WT and Myc / His-Akt-myr), but dominant-negative Akt (Myc) in HEK293 cells. / His-Akt- DN) did not interact with (Fig. 4A).
  • Akt consists of an N-terminal flextrin homology (PH) domain, a central catalytic kinase domain (KD) and a C-terminal short regulatory hydrophobic motif [36]. Phosphorylation of Akt induces a structural change, separating the PH and HM domains from the KD domain [37].
  • Hades specifically ubiquitizes Akt WT as well as Akt-KD (FIG. 5A). We then determined which lysine residues of Akt-KD are required for protein stabilization and ubiquitination.
  • Akt plays an important role in regulating cell cycle progression, cell survival and cell growth [38].
  • EGFP-Hades-WT EGFP-Hades-
  • FIG. 6A Hades-deficient cells ⁇ grew faster than control cells (FIG. 13). Hades is responsible for the proliferation of HeLa cells in a concentration-dependent manner. Inhibition (FIG. 6B). MTS assay also showed that the increase in Akt-mediated cell viability is reduced by Hades overexpression in HeLa cells (FIG. 14). Cell growth inhibition by Hades was confirmed by clonality and anchorage-independent soft agar assays (FIG. 6D).
  • HeLa cells expressing EGFP-Hades-WT showed a 50% reduction in colony formation compared to colony formation of cells expressing EGFP-Hades-MT or control EGFP (FIG. 6C). These results indicate that Hades modulates the Akt downstream signaling pathway.
  • FIG. 6E we showed that both phosphorylation of Akt downstream target proteins GSK-3P and TSC2 are inhibited by Hades in a RING ligase activity-dependent manner (FIG. 6E).
  • FIG. 6F the opposite phenomenon was observed in a Hades siRNA-dependent manner (FIG. 6F).
  • pTOPFLASH reporter activity was measured to confirm inhibition of Akt downstream signaling by Hades (FIG. 6G).
  • Akt is known to activate NF- ⁇ and Hades is known to be an NF- ⁇ activator Reported [23,45]. Therefore, it is unclear whether Hades induces NF- ⁇ activity or inhibits NF- ⁇ activity by inhibiting Akt.
  • NF- ⁇ activity was tested using a reporter plasmid containing an NF- ⁇ —binding site (NF- ⁇ luciferase reporter). HeLa cells were treated with EGFP control, EGFP-
  • Hades WT and Hades MT increased NF- ⁇ activity (up to 3 fold), but upregulation of NF- ⁇ activity by Akt WT (up to 7 fold) was Hades E3 ligase-dependent Reduced in a manner (FIG. 16). These results indicate that Hades can upregulate F- ⁇ activity, but the effect is independent of Akt-mediated NF- ⁇ pathway,
  • Hades a negative regulator of Akt, with a RING finger domain and E3 ubiquitin ligase activity.
  • Akt interacts directly with Hades and is ubiquitized by Hades in vitro and in vivo. Therefore, Hades according to the present invention can inhibit the proliferation and survival of cancer cells by decomposing Akt and negatively controlling its downstream signaling, and thus can be usefully used as an anticancer agent.
  • CI ⁇ TEN is a negative regulator of the Akt / PKB signal transduction pathway and inhibits cell survival, proliferation, and migration. FASEB J 2005; 19: 971-973.
  • Zhang B, Huang J, Li HL, et al. GIDE is a mitochondrial E3 ubiquit in 1 igase that induces apoptosis and slows growth. Cell Res 2008; 18: 900-910.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne l'utilisation d'Hades comme modulateur négatif de l'Akt et, plus précisément, comme modulateur négatif de l'Akt (protéine kinase B) ou agent anticancéreux contenant, comme principe actif, la protéine Hades ou un gène codant pour la protéine Hades. L'Akt, qui est une protéine kinase spécifique de la sérine/thréonine, prend part à des processus cellulaires variés comprenant la prolifération cellulaire, la survie cellulaire et le développement tumoral. Les inventeurs de la présente invention ont montré qu'Hades agit comme modulateur négatif de l'Akt et présente un domaine à doigts RING et une activité ubiquitine-ligase E3. Selon la présente invention, l'Akt peut interagir directement avec l'Hades, et être ubiquitinée in vitro et in vivo par le biais de l'Hades. Par conséquent, l'Hades de la présente invention peut décomposer l'Akt et moduler à la baisse sa signalisation aval afin d'inhiber la prolifération et la survie des cellules cancéreuses, et peut ainsi être utilisé de manière efficace comme agent anticancéreux.
PCT/KR2012/002408 2011-03-31 2012-03-30 Utilisation d'hades comme modulateur négatif de l'akt WO2012134234A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161469814P 2011-03-31 2011-03-31
US61/469,814 2011-03-31

Publications (2)

Publication Number Publication Date
WO2012134234A2 true WO2012134234A2 (fr) 2012-10-04
WO2012134234A3 WO2012134234A3 (fr) 2013-01-03

Family

ID=46932176

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/002408 WO2012134234A2 (fr) 2011-03-31 2012-03-30 Utilisation d'hades comme modulateur négatif de l'akt

Country Status (2)

Country Link
KR (1) KR101419999B1 (fr)
WO (1) WO2012134234A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102026142B1 (ko) 2017-03-21 2019-09-27 충남대학교산학협력단 Crif1 억제제를 함유하는 항암 및 암전이 억제용 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005056594A1 (fr) * 2003-12-15 2005-06-23 Japan Science And Technology Agency Polypeptide inhibant specifiquement l'activite d'akt
KR20060066714A (ko) * 2003-07-29 2006-06-16 스미스클라인 비참 코포레이션 Ａｋｔ 활성 억제제
US20080131526A1 (en) * 2006-10-04 2008-06-05 University Of South Florida Akt sensitization of cancer cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060066714A (ko) * 2003-07-29 2006-06-16 스미스클라인 비참 코포레이션 Ａｋｔ 활성 억제제
WO2005056594A1 (fr) * 2003-12-15 2005-06-23 Japan Science And Technology Agency Polypeptide inhibant specifiquement l'activite d'akt
US20080131526A1 (en) * 2006-10-04 2008-06-05 University Of South Florida Akt sensitization of cancer cells

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JUNG, JIN HYUK: 'Hades is a Novel p53-interacting and-ubiquitinating Protein That Negatively Regulates the Exonuclear Function ofp53' KONKUK GRADUATE SCHOOL, DOCTOR'S THESIS June 2010, pages 1 - 99 *

Also Published As

Publication number Publication date
KR101419999B1 (ko) 2014-08-12
KR20120112196A (ko) 2012-10-11
WO2012134234A3 (fr) 2013-01-03

Similar Documents

Publication Publication Date Title
Oh et al. Role of the tumor suppressor RASSF1A in Mst1-mediated apoptosis
Platta et al. Nedd4-dependent lysine-11-linked polyubiquitination of the tumour suppressor Beclin 1
Al-Hakim et al. Control of AMPK-related kinases by USP9X and atypical Lys29/Lys33-linked polyubiquitin chains
Zhong et al. Regulation of SR protein phosphorylation and alternative splicing by modulating kinetic interactions of SRPK1 with molecular chaperones
Zheng et al. Protein tyrosine kinase 6 directly phosphorylates AKT and promotes AKT activation in response to epidermal growth factor
Pérez et al. Mutual regulation between SIAH2 and DYRK2 controls hypoxic and genotoxic signaling pathways
US20090304663A1 (en) Use of gsk-3 inhibitors for the treatment of prostate cancer
Fu et al. USP3 stabilizes p53 protein through its deubiquitinase activity
Islam et al. Pin1 regulates osteoclast fusion through suppression of the master regulator of cell fusion DC‐STAMP
Lukong et al. BRK phosphorylates PSF promoting its cytoplasmic localization and cell cycle arrest
Goel et al. The unique N‐terminal region of SRMS regulates enzymatic activity and phosphorylation of its novel substrate docking protein 1
Manoharan et al. Thioredoxin inhibits MPK38-induced ASK1, TGF‐β, and p53 function in a phosphorylation-dependent manner
Fan et al. FAM122A, a new endogenous inhibitor of protein phosphatase 2A
Han et al. New role of human ribosomal protein S3: Regulation of cell cycle via phosphorylation by cyclin‑dependent kinase 2
Loftus et al. A novel interaction between Pyk2 and MAP4K4 is integrated with glioma cell migration
Roh et al. TRAF2 functions as an activator switch in the reactive oxygen species-induced stimulation of MST1
Mahul-Mellier et al. De-ubiquitinating proteases USP2a and USP2c cause apoptosis by stabilising RIP1
Feola et al. Transglutaminase 2 modulation of NF-κB signaling in astrocytes is independent of its ability to mediate astrocytic viability in ischemic injury
Bollaert et al. HBP1 phosphorylation by AKT regulates its transcriptional activity and glioblastoma cell proliferation
Paniagua et al. KSR induces RAS‐independent MAPK pathway activation and modulates the efficacy of KRAS inhibitors
Cholay et al. Functional interaction between the ubiquitin-specific protease 25 and the SYK tyrosine kinase
Fletcher et al. Abolishment of the Tyr-15 inhibitory phosphorylation site on cdc2 reduces the radiation-induced G2 delay, revealing a potential checkpoint in early mitosis
Zanca et al. PED interacts with Rac1 and regulates cell migration/invasion processes in human non‐small cell lung cancer cells
Tripathi et al. SRC and ERK cooperatively phosphorylate DLC1 and attenuate its Rho-GAP and tumor suppressor functions
Wu et al. Nrdp1S, short variant of Nrdp1, inhibits human glioma progression by increasing Nrdp1‐mediated ErbB3 ubiquitination and degradation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12764742

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12764742

Country of ref document: EP

Kind code of ref document: A2