WO2012134234A2 - Use of hades as a negative modulator of akt - Google Patents

Abstract

The present invention relates to the use of Hades as a negative modulator of Akt, and more particularly, to a negative modulator of Akt (protein kinase B) or anticancer agent containing, as an active ingredient, the Hades protein or a gene that encodes Hades protein. Akt, which is a serine/threonine-specific protein kinase, functions in a variety of cell processes including cell proliferation, cell survival, and tumor development. The inventors of the present invention have identified Hades as being a negative modulator of Akt and having a RING finger domain and E3 ubiquitin ligase activity. According to the present invention, Akt may directly interact with Hades, and may be ubiquitinated by Hades in vitro and in vivo. Therefore, the Hades of the present invention may decompose Akt and negatively modulate the downstream signaling thereof to inhibit the proliferation and survival of cancer cells, and therefore may be effectively used as an anticancer agent.

Description

 【Specification】

[Name of invention]

 Use of Hades as Akt negative regulator

 The present invention relates to the use of Hades as an Akt negative regulator, and more particularly, to an Akt (protein kinase B) negative regulator or anticancer agent containing a Hades protein or a gene encoding the same as an active ingredient.

Background Art

 Akt (protein kinase B), a serine / threonine kinase, is involved in the response to essential cellular stimuli such as growth factors and insulin [1, 2]. Akt activation regulates a variety of biological responses, including cell proliferation, protein synthesis, cell growth, cell cycle progression, and inhibition of apoptosis [3]. Akt is activated through platelet-derived growth factor, insulin, epidermal growth factor, basic fibroblast growth factor, and insulin-like growth factor I [2, 4, 5]. Downstream substrates of Akt have been identified at the cellular and molecular level. Glycogen synthase kinase 3 (GSK3), the first identified substrate of Akt, is negatively regulated through direct phosphorylation by Akt [6]. When Akt inhibits GSK3 (especially GSK3 (3) activity), it induces β-catenin stabilization, nuclear localization and gene activation [7—9].

Several modulators of Akt activation were identified and provided important information on Akt regulatory signaling pathways. Phosphatidilinosyl 3-kinase (PI3K) and phosphatase and tensine homologs (PTEN) are regulators of Akt [10]. PI3K induces Akt phosphorylation / activation, while PTEN activates Akt via dephosphorylation of phosphatidylinocyte-3,4,5—triphosphate, which is produced from phosphatidylinosyl by -3 and 5-bisphosphate by PI3K. Inhibits [2, 4, 11]. C1 domain-containing phosphatase and tencin homologs, carboxy-terminal regulatory proteins, Trb3, And negative regulators such as Keratin KIO have also been reported to inactivate Akt [12-15].

 The proteolytic activity of the ubiquitin-proteasome system (UPS) is important in many cellular processes [16]. The formation of polyubiquitin-protein conjugates recognized and disrupted by the 26S proteasome involves three components that participate in the cascade of ubiquitin transfer reactions: ubiquitin ᅳ activating enzyme (E1), ubiquitin-conjugating enzyme (E2) And specificity factor (E3) called ubiquitin ligase. E3 ligase controls the specificity of target protein selection and controls the abundance of individual target proteins [16]. Although the molecular pathways and physiological roles of Akt ubiquitination have been recently studied [17-22], much of Akt ubiquitination remains unclear.

 Here we identified Hades as a new E3 ligase from Akt. We identified Hades as a new negative regulator of Akt that functions in a variety of cellular processes, including cell proliferation, survival and tumor development, and completed the present invention.

[Detailed Description of the Invention]

 [Technical problem]

 It is therefore a primary object of the present invention to provide the use of Hades as an Akt negative modulator.

 Another object of the present invention is to provide an Akt negative regulator containing a Hades protein or a gene encoding the same as an active ingredient.

 Another object of the present invention is to provide an anticancer agent containing a Hades protein or a gene encoding the same as an active ingredient.

 Another object of the present invention is to provide a method for screening an Akt negative or positive modulator using the interaction of Akt and Hades.

【Technical Solution】

According to one aspect of the invention, the invention has an amino acid sequence of SEQ ID NO: Provided is an Akt (protein kinase B) negative modulator containing a Hades protein or a gene encoding the same as an active ingredient.

 The Hades protein was identified among cDNA library proteins capable of interacting with Akt and named after Greek subordinates. Hades protein has been deposited with UniProtKB accession number Q969V5 and has the amino acid sequence of SEQ ID NO: 2. The Akt (protein kinase B) is a serine / threonine kinase known to be involved in a variety of biological processes, including cell proliferation, cell growth, cell cycle progression and inhibition of apoptosis. In particular, Aktl is known to be involved in cell survival pathways by inhibiting apoptosis, and Akt2 is known as an important signaling molecule in the insulin signaling pathway. Hades of the present invention have been found to effectively interact with both Aktl and Akt2. Here, a negative regulator refers to a regulator that inhibits the expression of the Akt or inhibits the downstream signaling pathway of the Akt.

 In the present invention, the gene encoding Hades may have any nucleotide sequence capable of encoding the amino acid sequence of SEQ ID NO: 2, preferably Akt (protein kinase) characterized by having a nucleotide sequence of SEQ ID NO: 1 B) provides negative modulators.

 As used herein, the term "gene" refers to a nucleic acid (eg, DNA, RNA) sequence comprising a coding sequence necessary to produce a protein or polypeptide, wherein the protein or polypeptide is defined by a full length coding sequence. Or may be encoded by a portion of a coding sequence so long as the desired active or functional property is maintained.The term also refers to the coding region of a structural gene and the terminus such that the gene conforms to the length of a full-length mRNA. At 5 'and over a distance of about 1 kb

A sequence located adjacent to the coding region at the 3 'end. Sequences located 5 ′ of the coding region and present in the mRNA are referred to as 5′-nontranslated sequences. Sequences located 3 'or below the coding region and present in the mRNA are referred to as 3'-untranslated sequences. Terms

"Gene"'includes both the cDNA and genomic form of a gene. A genomic form or clone of a gene is a non-coding called an "intron" or "insertion region" or "insertion sequence" It includes a coding region that is interrupted by the sequence. Introns are segments of genes that are transcribed into nuclear RNA (hnRNA); Introns can include regulatory elements, eg, enhancers, introns are removed or “spliced” from the nucleus or initial transcript; Thus, introns are not present in mRN transcripts. The mRNA functions during translation to specify the sequence or sequence of amino acids of the initial polypeptide.

 Gene expression converts genetic information encoded in a gene into RNA (e.g., mRNA rRNA, tRNA or sn NA) through transcription of the gene (e.g., by enzymatic action of RNA polymerase), and protein coding gene For example, it refers to the process of converting into a protein through the "detoxification" of mRNA. Gene expression can be regulated at many stages in the process; "up-regulation" or "activation increases production of gene expression products. Refers to regulation, and "down-regulation" or "inhibition" refers to regulation that reduces the product. Molecules involved in up-regulation or down-regulation (e.g., transcription factors) are often referred to as "activators" and "inhibitors" respectively. May comprise sequences located at both the 5 'and 3' ends of an existing sequence, these sequences are referred to as "flanking" sequences or regions (these flanking sequences are non-existent in RNA transcripts). The 5 'flanking region may comprise regulatory sequences, eg, promoters and enhancers that regulate or influence the transcription of the gene. May comprise sequences directing termination of transcription, post-transcriptional cleavage and polyadenylation.

 In the present invention, the Hades gene provides an Akt (protein kinase B) negative regulator, which is inserted into a recombinant expression vector. In this case, the Hades gene is operably linked and inserted into the regulatory elements of the recombinant expression vector.

 As used herein, the term “vector” is used for a nucleic acid molecule that transfers DNA fragments from one cell to another, which is often derived from plasmids, bacteriophages or plant or animal viruses.

As used herein, the term “expression vector” refers to a suitable nucleic acid sequence necessary for the expression of the coding sequence of interest and the coding sequence operably linked in a particular host organism. Reference to recombinant DNA is included. Nucleic acid sequences required for expression in prokaryotic cells generally include promoters, operators (optional), and ribosomal binding sites, along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.

 As used herein, the term "recombinant expression vector" is a vector capable of expressing a target protein in a suitable host cell, and in the present invention, a Hades protein, a gene comprising an essential regulatory element operably linked to express a gene insert. Say the construct.

 As used herein, the term “operably linked” refers to a functional link between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. Operational linkage with recombinant vectors can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation employs enzymes commonly known in the art.

 Suitable expression vectors include promoters, initiation codons, termination codons, expression control elements such as polyadenylation signals and enhancers, and the like, and can be prepared in various ways. The start codon and the stop codon must be functional in the subject when the gene construct is administered and must be in frame with the coding sequence. In the present invention, Hades provides an Akt (protein kinase B) negative modulator, characterized in that it has a RING finger domain and E3-ubiquitin ligase activity. In the examples of the present invention, it was demonstrated that Hades has RING finger-domain and has E3—ubiquitin ligase activity.

In the present invention, the Akt provides an Akt (protein kinase B) negative modulator, characterized in that it directly interacts with Hades and is ubiquitinated by Hades. In the embodiment of the present invention, the Akt directly interacts with Hades and is ubiquiUnateed by Hades. Proved

 In the present invention, it provides an Akt (protein kinase B) negative modulator, characterized in that the kinase domain (KD) of the Akt interacts mainly in association with Hades. In the examples of the present invention it was demonstrated that the kinase domain (KD) of the Akt interacts mainly in association with Hades. In the present invention, Akt (protein kinase B) negative regulator is characterized in that Akt is decomposed by ubiquitination by Hades to inhibit Akt expression. In the examples of the present invention, it was demonstrated that Akt was decomposed by ubiquitination by Hades to inhibit Akt expression. In the present invention, Hades provides an Akt (protein kinase B) negative modulator, characterized in that only Akt activated by phosphorylation specifically ubiquitizes. In the embodiment of the present invention, it was demonstrated that Hades specifically ubiquitizes only Akt activated by phosphorylation.

 In the present invention, Akt (protein kinase B) negative modulator, characterized in that the lysine 284 of Akt is the main site of ubiquitination by Hades. In the present invention, it was demonstrated that lysine 284 of Akt is a major site of ubiquitination by Hades. 에 In the present invention, the Akt is Akt (protein kinase B) negative, characterized by inducing cell proliferation, inhibition of apoptosis and cell migration by downstream signaling ( negative) provides a regulator. It is well known in the literature that Akt induces cell proliferation, inhibition of apoptosis and cell migration by downstream signaling.

In the present invention, Hades provides an Akt (protein kinase B) negative modulator, characterized in that it inhibits the proliferation, survival and cell migration of cancer cells. Embodiments of the present invention demonstrated that Hades inhibits the proliferation, survival and cell migration of cancer cells by negatively regulating downstream signaling of Akt. In the embodiment of the present invention, as a representative example of cancer cells, The effect of the present invention was tested on HeLa cells, which are cervical cancer cells, and HCT116, which is colon cancer cells.

 According to another aspect of the present invention, the present invention is characterized in that it functions as an Akt (protein kinase B) negative regulator, containing a Hades protein having the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same as an active ingredient. To provide an anticancer agent. Examples of the present invention demonstrated that Hades inhibits the proliferation, survival and cell migration of cancer cells by negatively regulating downstream signaling of Akt. In the embodiment of the present invention, as a representative example of cancer cells, the effect of the present invention was tested on HeLa cells, which are cervical cancer cells, and HCT116, which is colon cancer cells.

 In addition, preferably, the anticancer agent of the present invention may additionally include one or more pharmaceutically acceptable carriers or excipients (see Remington's Pharmaceutical Sciences and US Pharmacopoeia. 1984, Mack Publishing Company, Easton, PA, USA). .

 As used herein, "pharmaceutically acceptable" generally means suitable for administration to a mammal, including humans, from a toxicity or stability standpoint. Carriers include diluents, excipients, layers, adhesives, wetting agents, Disintegrants, absorption enhancers, surfactants, absorbent carriers, brighteners commonly used in the pharmaceutical art. If necessary, flavors, sweeteners and the like may be added. The carrier may also contain other pharmaceutically acceptable excipients to modify other conditions such as pH, osmotic pressure, viscosity, asepticity, lipidity, solubility, and the like. Pharmaceutically acceptable excipients which allow sustained or delayed release after administration may also be included.

 Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol and the like. In addition, if desired, the pharmaceutical composition administered may contain a small amount of a nontoxic adjuvant such as, for example, a wetting or emulsifying agent such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, triethanamine sodium acetate, pH buffer, and the like. May contain substances.

The anticancer agent composition of the present invention can be administered, for example, by systemic or oral route. Can be injected via the route. Preferred forms of systemic administration include injection, generally intravenous injection. Other injection routes may be used, for example, subcutaneously, intramuscularly or intraperitoneally. Alternative means of systemic administration include transmucosal and transdermal administration using penetrants such as bile acids or fusidic acids or other surfactants. Moreover, the anticancer composition of this invention can also be formulated with an enteric agent, a capsolization agent, or an oral administration agent. Administration of these anticancer agents may be local and / or partial in the form of ointments, pastes, gels and the like.

In embodiments in which the anticancer agent composition of the present invention comprises a nucleic acid, the nucleic acid may be included in the vector. For example, the vector can be a viral vector. In certain embodiments, the viral vector is an adenovirus vector. In some embodiments, the adenovirus is formulated with protamine. Any number of viral particles can be administered to the patient. In certain embodiments, about 10 ⁸ to about 10 ¹⁴ virus particles are administered to the patient per administration.

 In some embodiments of the invention in which the nucleic acid composition is administered, the nucleic acid composition may comprise one or more lipids. Any of the lipids described above can be included in such lipid—nucleic acid compositions. Examples of such lipids include D0TAP and cholesterol, or derivatives thereof.

 As used herein, the term “therapeutically effective amount” means the amount of active agent, such as the Hades protein of the present invention, that when administered according to a desired therapeutic regimen produces a desired therapeutic effect or response or provides a desired benefit. The amount of the composition administered may be determined by the physician, based on the severity of the condition, the composition age administered, the body weight, and the condition of the patient to be treated, such as the reaction of each patient, the chosen route of administration, but for medications that are Hades proteins, A pharmaceutically or prophylactically effective amount to be administered to a cancer patient is preferably about 0.01 to 10 rag / kg / day.

 According to another aspect of the invention, the invention comprises an Akt comprising the following steps

(Protein Kinase B) Provides a method for screening negative modulators: (a) cotransfection of Akt and Hades to animal cells; (b) treating any of the agents on the transfected animal cells; And, (c) said Determining whether the interaction of Akt and Hades in animal cells is facilitated.

 According to another aspect of the present invention, the present invention provides a method for screening an Akt (protein kinase B) positive modulator comprising the following steps: (a) cotransfection of Akt and Hades to an animal cell; ); (b) treating the transformed animal cell with any agent; And, (c) determining whether the interaction of Akt and Hades in the animal cell is inhibited. Hereinafter, the present invention will be described in more detail.

 Akt, a serine / threonine kinase, functions in a variety of cellular processes, including cell proliferation, cell survival, and tumor development. In the meantime, the study of the mechanisms that negatively regulate Akt has focused on dephosphorylation-mediated inactivation. In the present invention, we identified Hades, which is a negative regulator of Akt, having a RING finger domain and E3 ubiquitin ligase activity. Akt interacts directly with Hades, in vitro and by Hades. It has been found to be ubiquitinated in vivo. Other molecular assays have demonstrated that phosphorylated Akt is a practical target for both interaction and ubiquitination by Hades. The results of these functional studies suggest that the degradation of Akt by Hades can inhibit the proliferation and survival of cancer cells. These data provide a clarification for the Akt-ubiquitination signaling network.

 The present invention demonstrates the function of Hades in the negative regulation of Akt cell signaling. Hades is directly bound to Akt in vivo and in vitro,

It was found to bind Hades through the kinase domain of Akt. Although

There are three isoforms in Akt, and the kinase domains between these isoforms

90-95% amino acid sequence is the same, but Hades binds to Aktl and Akt2,

It did not bind to Akt3. And SGK1, the same amino acid sequence as Akt,

It was not bound by ^' Hades ^' or ubiquitized by Hades (FIG. 2D). In addition, Hades confirmed that it was not phosphorylated by Akt kinase.

In the present invention, the relationship between Hades and Akt is very dependent on the phosphorylation state of Akt. It was found that it was dependent, and thereby found that Akt protein stability was tightly regulated. Serum stimulation to induce phosphorylation of Akt increased the binding capacity between Akt and Hades, thus increasing Akt ubiquitination and Akt degradation. This phosphorylation-dependent Akt proteolysis was re-validated by constructing and using Akt (Myc / His-Akt-myr), which is artificially genetically engineered to remain active at all times. By immunoprecipitation, Hades bound to Akt-myr but not to unphosphorylated dominant negative mutant Akt (Akt-DN). In addition, treatment with ALY phosphorylation drugs LY294002 and wortmannin showed that the degradation of Akt through Hades was inhibited. Conversely, low expression of Hades via siRNA increased Akt protein stability and increased p-Akt levels. Taken together, the data suggest that Hades prefers to bind p-Akt, thereby promoting the degradation of p-Akt.

 Structurally, Akt is phosphorylated at the 473 th serine at the C-terminus, which is a phosphorylated and non-enzymatic domain at the amino acid 308 th thronine in the T-loop present in its enzyme activity domain. Complete activity [40]. In the inactivated state of Akt, a bond is formed between the PH domain and the kinase domain in Akt, thereby inhibiting the in-loop phosphorylation of Akt by the upper phosphate-independent-kinase kinase-1 [37, 41]. Although the exact structural mechanism is not fully known, it can be concluded that the phosphorylation of Akt exposes a portion capable of binding Hades in the kinase domain of Akt. First, in the pull-down analysis data

It was found that a bond was formed between the kinase domain of Akt and Hades. Second, as a result of the synthesis of small peptides corresponding to the phosphorylated moiety of Akt, the competitive eye binding assay showed no difference in Hades' binding ability between phosphorylated and non-phosphorylated peptides (Mishiddata). Third, Akt (T308D / S473D), which mimics the form of phosphorylation mimically, also had a binding ability with Hades. Therefore, these results indicate that the phosphorylation residues of Akt are not important for binding with Hades, but the structural deformation that appears as phosphorylation is important. Proteolysis by the ubiquitin-proteome system (UPS) can regulate various intracellular reactions [16]. First, several papers reported that the breakdown of Akt by UPS is not a specific phenomenon but a wide range of events occurring in many different cells [42]. Akt protein is stabilized in the presence of Hsp90, and therefore Hsp90 inhibitors induce Akt degradation [18]. However, in the present invention, it was found that the degradation of Akt by Hades was not related to the degradation of Hsp inhibitor-induced Akt. Riesterer et al. Reported that inhibition of VEGF signaling by VEGF inhibitor PTK787 / ZK222584 induced degradation of Akt by UPS [20, 42, 43]. In addition, treatment with rapamycin, an inhibitor of protein mTOR discovered as a target for the drug rapamycin, has been reported to eliminate the protective mechanism of VEGF against Akt degradation by UPS-. Yan et al reported that the degradation of dendritic Akt by the UPS in the hippocampal nerve occurs selectively [43]. They found that Akt destabilization of the dendritic portion was necessary to form neuropolarity. Although the breakdown of Akt by UPS has been reported under different cellular conditions, it is still unclear about the specific E3 ligase that causes Akt degradation by UPS. Recently, tetratricopeptide repeat domain 3 is an Akt-specific E3 ligase and has been reported to induce ubiquitination and degradation of Akt in the nucleus [20]. However, activated Akt can exist not only in the nucleus but also in the cytoplasm and the cell membrane. Therefore, the meaning of the present invention is that Hades [23] in the mitochondria negatively regulates p-Akt in the cytoplasm.

 In a previous report, Hades' intracellular location was mitochondria, and Hades activated apoptosis signaling [45]. In addition, another study group reported that the degradation of Akt during apoptosis is caspase dependent [46]. Although the present invention did not address the possibility that caspase activation by Hades affects the Akt signaling system, the degradation of Hades-dependent Akt did not seem to be associated with caspase cell signaling. This is because Akt continues to be decomposed by Hades even when cells were treated with Z-VAD, a caspase inhibitor (FIG. 17).

To date, no amino acid residues in Akt corresponding to polyubiquitin-dependent proteolysis have been reported. Although Akt-KD and Hades combine, The possibility of ubiquitination in the Akt-PH and Akt-HM moieties is not excluded. As shown in FIG. 5A, ubiquitination occurred by Hades in the kinase domain of Akt but not Akt-PH and Akt- 丽. In order to find out the residues in Akt that ubiquitin is bound by Hades, eleven lysine residues in Akt-D were used for the experiment. As a result, the point mutation of the 284th lysine residue in Akt was difficult to inhibit Akt ubiquitination. However, our experiments do not rule out the possibility that the involvement of Akt protein stability may be other than the 284 residue.

 Akt enzymes play an important role in promoting various intracellular processes involved in cell growth and cell migration through phosphorylation of several downstream targets [36]. In the present invention, the overexpression of Hades in cancer cells demonstrated that the cell growth and growth capacity were dependent on Hades' E3 ligase activity. GSK-3 (3 and TSC2 are well known

As a sub-target protein of Akt, it is known to regulate protein synthesis, cell proliferation, differentiation, migration and cell death inhibition [47,48]. According to reports,

The apoptosis-promoting capacity of GSK-3 (3) was inhibited by Akt by phosphorylation of GSK-3 (serine), the ninth amino acid in 3 [6].

Phosphorylation of the 1462 threonine residues by Akt has been reported to promote cell growth signals for insulin signaling [49]. therefore

Inhibition of apoptosis and survival by Hades proved to be the result of degradation of Akt and thus inhibition of Akt phosphorylation target protein GSK-3 (3 and TSC2 phosphorylation levels. In addition, inhibition of Akt signaling by Hades The pTOPFLASH reporter and wound healing assay resulted in Hades being able to modulate this cellular process by negatively regulating Akt signaling, and we also found that NF-κΒ activation through Hades was independent of Hades' E3 ligase activity. Activation of NF-κΒ via Akt is dependent on Hades' E3 ligase activity, and recently Zhang et al. Reported that both Hades / GIDE and RING domains without Hades were NF-κΒ. It was reported that the activity was slightly increased, and overexpression of ΙΚΚβ—KA and ΙκΒα (SS / M) inhibited NF-κΒ activity by Hades, but did not inhibit the effect of inhibiting cell growth through Hades / GIDE. . Thus, although the mechanism of activation of NF-κΒ by Hades is still unclear, the activation of NF-κΒ does not seem to be related to Hades' ability to inhibit cell growth. Therefore, although Hades increases the activity of NF-κΒ, this phenomenon can be understood to be different from the NF-κΒ mechanism by Akt.

 The results of the present invention demonstrated that Hades can negatively regulate Akt and regulate many related cellular processes. The results of the present invention may also offer the possibility of having clinical significance as a future new target as a modulator of Akt.

[Brief Description of Drawings]

 1 shows Akt interacts with Hades E3 ubiquitin ligase in vitro and in vivo.

 FIG. 2 shows that the ubiquitination and degradation of Akt is mediated by Hades.

 FIG. 3 shows that pAkt is a preferred substrate of ubiquitination by Hades.

 4 shows that activated Akt is the preferential target of the ubiquitin E3 ligase Hades.

 FIG. 5 shows that lysine 284 of Akt is a site for Hades-mediated polyubiquitination.

 FIG. 6 shows that the cell growth function of Akt is inhibited by Hades.

FIG. 7 shows that siRNA-mediated Hades expression clearance stabilizes endogenous Aktl and Akt2 proteins. 8 shows that Hades induces Aktl degradation and co-locates with Aktl in the mitochondria.

 FIG. 9 shows that serum reduces Akt protein stability. FIG. 10 shows that geldanamycin induces Akt degradation in both control cells and Hades-deficient cells.

 FIG. 11 shows that Hades-mediated Akt proteolysis is restored by wortmannin.

 12 shows that mutation of lysine 284 prevents proteolytic degradation of isotopically expressed Akt by Hades.

 FIG. 13 shows that the depletion of Hades in HeLa cells by shRNA increases cell growth.

 FIG. 14 shows that Akt-mediated cell survival increase is reduced by Hades in a RING domain-dependent manner.

 FIG. 15 shows that endogenous Hades deficiency inhibits cell migration.

 Figure 16 shows that Hades-induced NF-κΒ activation is independent of its E3 ligase activity, and Akt-induced NF-κΒ activation is in an E3 ligase activity-dependent manner.

Figure showing that it is reduced by Hades.

 FIG. 17 shows that isotopically expressed Akt is degraded by Hades in HeLa cells in the presence of a caspase inhibitor Z-VAD.

 FIG. 18 shows that Hades reduces colony formation in HCT116 colon cancer cell line.

[Mode for carrying out the invention]

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only intended to illustrate the invention, and the scope of the invention is not to be construed as limited by these examples. Example 1 Plasmids

The coding sequences of Akt and Hades were amplified and isolated by PCR of cDNA derived from cervical cancer cell line HeLa. Amplified human Aktl cDNA was cloned into pcDNA3.1-Myc / His (Invitrogen, Carlsbad, Calif.), PGEX6p (Pr omega, Madison, Wis.) And pET28 (Novagen, EMD Chemicals Inc. Merck, Darmstat, Germany) vectors. . HadescDNA was cloned into the pEGFP-C (Clontech, Mountain View , CA) , and _P GEX6p vector. Functional divisions of the Akt gene were cloned into the pcDNA3.1 (Invitrogen) vector. The dominant negative mutated Akt genes (DN-Akt, T308A and S473A), mutants of lysine residues in the Akt amino acid sequence, and Hades' RING domain-mutations (Hades MT-C302S and C305S) were QuikChange site-directed Using the product of the mutagenesis kit (Stratagene, Santa Clara, CA), following the instructions for the product, HA-ubiquitin (HA-Ub) plasmid ρΜΊΊ23 was provided by Dr. Dirk Bohmann (University of Rochester, Rochester, NY). . HA-Ub mutant genes (HA-Ub-K48R and HA_Ub-K63R) were provided by Dr. Zhijian Chen (University of Texas Southwestern Medical Center, Dallas, TX). Primer sequences used for PCR are listed in Table 1 below.

TABLE 1 Primer sequences used to generate constructs of Akt and Hades

Primer Sequence ⁸

 Myc / His-Akt_S GGAATTCC accatggcaatgagcgacgtgetattg

 Myc / His-Akt_3 CCGCTCGAG cgggccgigccgctggccgag

 GST-Hades_5 GGAATTCC atggagagcggagggcggc

 GST-Hades-3 GGAATTCC ttagctgttgtacaggggEatc

 EGFI »-Hades_5 GGAATTCC atggagagcggagggcggc

 EGFP-Hades_3 CGCGGATCCGCGttagctgttgtacag

 Akt-PH_5 GGAATTCC ac catggcaatgagc gacgtgctattg

 Akt-PH-3 CCGCTCGAG c gcac gcggtgcttgggc

 Akt- D_5 GGAATTCC accatggcaaccatgaacgagtttg

 血 -KD 一 3 CCGCTCGAG cgaaagaagcgatgcigcatg

 Akt-HM_5 GGAATTCC accatggcagc c ggtatcgtgtggc

 Akt-HMJ CCGCTCGAG c gggc cgtgcc gctggc cgag

 Myc / His-Aktmyi_5 GGAATTCC accatggggagcagcaagagcaagcccaagatgagcgacgtggctattg

Akt-T30SA_5 ggtgccaccatgaaggccttttgcggcaca

 Akt-T30SA_3 gtgEgccgcaaaaggccttcatg tggcacc

 Akt-S473A_5 cacttc c c c ca gttc gcctactc ggc c age g

 Akt-S473A_3 GgctggccgagtaggGgaactgggggaagt

 Hades-C302S_5 tgaagctgctcagaeacactacagaggcgctcttcagactctccctg

 Hades-C302S_3 cagggagagtctgaagagcgcctctgtagtgEgtctgagcagcttca

 Hades-C30SS-5 ctaaagagc gc ctctgtag gtctctgagcagcttcaagtcctgc

 Had s-C305S-3 gcaggacttgaagctgctGagagacagtacagaggcgctcttcag

 ^ Uppercase letters represent restriction enzyme sites for cloning. Example 2: Recombinant Proteins

GST- and GST-labeled Hades (GST-Hades) proteins are known as Escherichia coli coli) BL21 strain was used to treat 0.1 mM IPTG at 37 ° C. for 1 hour. NPk 40 lysis buffer (50 mMTris-HCl, pH 7.5, 150 mMNaCl) , 1% NP-40, 1 mM DTT, 1 mM EDTA, lysozyme and protease inhibitors). The recombinant proteins were extracted using glutathione-sepharose 4B bead following the instructions of the product, and the extract was dialyzed using the product of Slide-A-Lyzer dialysis cassette (Pierce, Rockford IL). Concentrated using an Ultra-15 device (Millipore, Billerica, Mass.), His-Akt was purchased from Millipore. Example 3: Antibodies and reagents

 The antibodies used for this study are as follows. Antibodies of EFGP, Myc-tag, Phosphorylated Akt (pAkt) (S308), pAkt (T473), Akt, pGSK-3, TSC2, pTSC2 (TW62)

Purchased from Signaling Technology (Danvers, MA), and the HA-tag, GSK_3 (antibody of 3

It was purchased from Santa Cruz Biotechnology, (Santa Cruz, CA), and was purchased from Millipore under SGK1. Hades polyclonal antibodies were injected into rabbits using peptides consisting of the amino acid sequences N-SGERPKGIQETEEM-C and N-SRAKPEDRESLKSAO (:) and immunized to extract the antibodies. transfection) was performed using Lipofectai ne 2000 reagent (Invitrogen) Z-VAD and MG132 were purchased from Sigma—Aldrich (St. Louis, M0) and purchased from LY294002 and wortmannin Cell Signaling Technology. — (4,5-dimethylthiazol-2-yl) -5- (3 ᅳ c ar boxyme t hoxypheny 1) -2- (4-su 1 f opheny 1) -2H-1 1 etr azo 1 i urn, inner salt ( MTS) assay kit was purchased from Pr omega, Inc. Example 4: In vitro binding assay assay 35S-labeled proteins and protein assemblies were obtained through in vitro transcription / translation reactions. With this, 3 GST or GST-Akt The total protein 0.5% NP-40 buffer containing glutathione-Sepharose 4B beads was mixed and reacted for 3 hours at 37 ° C. After washing three times, the sample was boiled in the SDS sample buffer. Analysis of bound proteins was done by developing using autoradiography via SDS-PAGE. Example 5: immunoprecipitat ion

 Immunoprecipitation experiments were performed with CHAPS buffer (0.5% CHAPS, 10 mMTris-HCl, pH 7.5, 1 mM

Cell disruption suspended in MgC12, 1 mM EGTA, 5 mM β-mercaptoethanol and 10% glycerol) was carried out by reacting with the corresponding antibody at 4 degrees. Afterwards Protein A / G PLUS-Agarose beads (Santa Cruz Biotechnology) was added, followed by further reaction for 2 hours and washed with water. Example 6 in vitro ubiquit inat ion assay His-Akt or λ-protein dephosphatase (λ-PPase, New)

His-Akt treated with England Biolabs, Ipswich, MA), 150 ng of recombinant EKBoston Biochem, Cambridge, MA) enzyme, 250 ng of recombinant UbcH5C (Boston Biochem), 500 ng of GST-Hades and 5 ug His-ubiquitin (Boston) Biochem) with ubiquitination buffer (50 mMTris-HCl, pH 7.4, 5 mM MgC12, 15 μΜ ZnC12, 0.3 mM DTT, 0.006% DTT

Room temperature in 2 mM ATP, 10 U creatine phosphokinase and 10 mM phosphocreatine

The reaction of ubiquitination reaction with λ-protein dephosphatase treated with His-Akt and λ-PPase was repeated for 1 hour at room temperature at 30 degrees in ubiquitination buffer. Dephosphatase inhibitors were added. The reaction mixture was then reacted with El, E2, GST-Hades and ubiquitin. Banung products were analyzed by immunoblotting (i 隱 unoblotting) using anti-Akt antibodies via 8% SDS-PAGE. Example 7: In vivo ubiquit inat ion assay After transfection, MG132 treated cells were washed with PBS and vortexed by adding 200 μΐ denaturing lysis buffer (50 mMTris-HCl, pH 7.4, 0.5% SDS and 70 mM β-mercaptoethanol). The phase completely lysed the cells by boiling at 95 degrees for 15 minutes. The lysed cell solution was added in 800 μΐ of CHAPS buffer. The lysed cell solution was immunoprecipitated with the addition of Akt antibody and protein agarose A / G PLUS-Agarose beads. After the reaction, the beads were washed with CHAPS lysis buffer five times and then boiled. Ubiquitinated Akt was developed through immunoblotting with anti-HA antibodies. His-pull down assay was performed by diluting the denatured cell solution with 800 μΐ buffer A (50 mM NaH2P04, 300 mMNaCland 10 mM imidazole pH 8.0), and then adding Ni-NTA bead to room temperature. I rebounded overnight at 4 degrees. The beads were washed five times using buffer B (50 mM NaH 2 P04, 300 mM NaCl and 20 mM imidazole, pH 8.0), and the proteins bound to the beads were eluted by boiling with SDS-PAGE sample buffer. The eluted proteins were immunoblotted using anti-HA antibody, Example 8: RNA interference (RA interference)

 Sides targeting Hades were purchased from Ambion. First, Hades si RNA (100 pmol) was added to LipofectamineR AiMAX (Invitrogen) in serum-free medium.

HEK293 cells (5x105 cells) were transduced, then exchanged for normal medium and finished with durban manure for 48 hours. Example 9: Cell Viability Assay

 Cell viability was observed through a general MTS experiment. The results are presented graphically and compared in percentages with the control. Example 10: Colonogenjc survival assay

First, a control group encoded with green fluorescent protein (EGFP) in HeLa cells, a cervical cancer cell line Plasmids, EGFP-labeled Hades, or Hades MT gene were transduced. After 2 weeks, the resulting colonies (colonies) were fixed and stained with 0.1% crystal violet to analyze the results. Anchorage-independent soft-agar assay was performed on 3 ml of DMEM medium containing .45% low-melting agarose and 10% fetal bovine serum. After addition, 2 ml of DMEM containing 9% agarose and 10% fetal bovine serum was added to cover the surface, and colonies were observed by incubation for 2 weeks. Example 11: luciferase reporter gene assay

 This experiment used the TCF-banung luciferase plasmid pTOPFLASH (upstate). There are six TCF-banung sites in the pTOPFLASH vector. After transfection of the vector and reaction for 48 hours, the luciferase activity was analyzed by how many times the β-galactosidase was increased as a control. The result is the average of three independent experiments. Example 12 Construction of a Full-Length Human cDNA Library

To construct a full-length human cDNA library, total RA was first extracted from cervical cancer HeLa cells and liver Chang cells using TRIzol reagent (Invitrogen, Carlsbad, CA) based on the manufacturer's instructions. The full length cDNA library was constructed using the SMART cDNA library construction kit (Clontech, Mountain View, CA) and TRIfflER-cDNA normalization kit (Evrogen, Russia) based on the manufacturer's instructions. The normalized cDNA was fractionated by size using CHROMA SPIN-400 column (Clontech) and modified to insert Sfil restriction enzyme reaction site for all cDNA of 500 bp or more through genetic method. It was then cloned into pcDNA3.1 (+) vector (Invitrogen) and transformed into TOP10 Escherichia coli. Example 13: Novel Akt-binable protein screening experiment

 If binding positive protein aggregates were found by in vitro binding assays, the cDNA aggregates were further subdivided and continued until one positive cDNA clone was isolated. The information presented was confirmed through the NCBI gene database. Example 14 Subcellular Fractionation

 Cervix cancer HeLa cells were grown to a population of about 70% on 100-mm plates, and then 5 EGFP-MULAN-WT black EGFP-MULAN-MT with Myc / His-Aktl-myr (2 g) Lipofectamine 2000 (Invitrogen) was used to transduce cells into cells based on the manufacturer's instructions. The cells were then incubated for 24 hours. Cultured cells were harvested and resuspended in NKM buffer (1 mM Tris-HCl, pH 7.4), 130 mM NaCl, 5 mM KC1, 7.5 mM MgC12). The cells were lysed using a Dounce homogenizer and centrifuged for 5 min at 12,000 x g at room temperature with 2 M sucrose (final concentration: 0.25M). After centrifugation, the supernatant was transferred to a new tube and again centrifuged for 15 min at 4 ° C. at a strength of 7,000 X g. Mitochondrial pellets were resuspended in suspension buffer (10 mM Tris-HCl (pH 6.7), 0.15 mM MgC12, 0.25 mM sucrose, protease inhibitor cocktail) and centrifuged at 4 ° C for 10 minutes at 9,500 xg. . After centrifugation the pellet is the mitochondrial fraction and the supernatant is the cytoplasmic fraction. The cytoplasm and mitochondrial proteins were analyzed via immunoblotting using 10-15% SDS-PAGE and corresponding antibodies. Example 15 Immunofluorescence Assay

The transduced cells were incubated in glass coverslips and then fixed by reaction with 4% formaldehyde at room temperature for 5 minutes, and washed with PBS twice to remove the remaining solution, followed by pemeabilization buffer (0.5¾> Triton X-100 in PBS) for 3 minutes. Immobilized cells in PBS with 5% BSA and 2% goat serum After the reaction, the reaction was blocked for 30 minutes, and the anti-myc antibody (1: 200 in PBS) was reacted at room temperature at 4 ° C. overnight. After washing with PBS three times, the remaining ones were removed and reacted for an additional hour using a secondary antibody (1: 500 in PBS) labeled with fluorescein Texas red. The coverslips were turned upside down and firmly immobilized in Vectashield (Vector Laboratories, USA) and subjected to fluorescence analysis using a confocal laser-scanning microscope (FV-1000 Spectral, Olympus, Japan). Example 16: Lentivirus Synthesis and Infection

 First, a Hades shRNA-coded pLKO vector (Sigma) was obtained by injecting the microorganism, and the vector was purely isolated from the microorganism. .2) and VSVG plasmids were produced by transducing into 293T cells. 48 hours after transfection, the virus-containing medium was collected and concentrated through a filter having 0.45-μηι pores. After culturing cervical cancer HeLa cells on a 6-well plate, the virus was treated with polybrene, and after 6 hours, the medium was changed anew and finally, 72 hours with 1 g / ml puromycin added medium. Incubated. Finally, puromycin-resistant HeLa cells expressing control shRNA and Hades shRNA were selected and used in the experiment. Example 17 Statistical Analysis

 Statistical analyzes include the χ2 test, Fisher's exact test and

This was done through Spearman et al. It can be said that PO.05 is statistically significant.

[Experiment result] 1 shows Akt interacts with Hades E3 ubiquitin ligase in vitro and in vivo. (A) 35S 상호 methionine-labeled Akt was tested for interaction with GST-tagged Hades (GST-Hades) using an in vitro interaction between Akt and Hades, a full-announce assay. (B) In vivo association between Akt and Hades. After transfection with the plasmid as indicated, HEK293 cells were treated with MG132, followed by immunoprecipitation with anti-Akt antibody and immunoblotting with anti-EGFP. Immunoglobulin G was used as a negative control. (C) Endogenous interactions between Hades and Akt soothes. MG132-pretreated HeLa cells were immunoprecipitated with Akt isosome-specific antibodies and immunoblotting using anti-Hades antibodies. (D) Functional domain structure and guidance of plasmids of Akt deletion mutants. (E) Akt's KD interacts with Hades. 35S-methionine-labeled Akt deletion mutants were tested for interaction with GST-Hades using a pull-down assay. FIG. 2 shows that the ubiquitination and degradation of Akt is mediated by Hades. (A) Akt protein levels in cells were reduced by Hades via proteasome degradation pathways in a RING-dependent manner. After transfection with plasmid as indicated, HEK293 cells were treated with MG132 and immunoblotted with the indicated antibodies. Isotopic expression levels of GST were normalized to the transfection control. (B) Akt was ubiquitized by Hades in vitro, In vitro ubiquitination assay was performed as described in the Examples. (C) Akt was ubiquitized by Hades in vivo. After transfection with the plasmid as indicated, HEK293 cells were treated with MG132 and then subjected to an in vivo ubiquitination assay as described in the Examples. (D) Ubiquitination of Akt was eliminated by Hades siRNA transfection. After transfection with siRNAs and HA_Ub plasmid as indicated, HEK293 cells were treated with 1 μΜ MG132 for 12 hours and then subjected to in vivo ubiquitination assay. (Ε) Κ48-linked polyubiquitination is responsible for Hades-dependent Akt ubiquitination. HeLa cells were transfected with plasmids as indicated, followed by in vivo ubiquitination. FIG. 3 shows that pAkt is a preferred substrate of ubiquitination by Hades. (A) The interaction between Hades and Akt is dependent on phosphorylated Akt. Serum-deficient HeLa cells were treated with 10% serum or insulin and MG132 for 6 hours. Following immunoprecipitation assay with Akt antibody, immunoblotting with anti-Hades antibody was performed. (B) pAkt levels in cells were reduced by Hades. HeLa cells were transfected with plasmids as described in the Example. After 24 hours of incubation, the medium was replaced with serum free medium and the cells were then stimulated with 10% serum for 2 hours. Cells were lysed and immunoblotted with antibodies as indicated, (C) the pAkt protein of the cells was ubiquitinated by Hades ᅳ transfected with plasmid as indicated, and then HeLa cells were incubated in serum free medium for 18 hours. I was. Cells were treated with 10 μΜ LY294002 and then 10 μΜ

Stimulated with 10% serum in the presence of MG132. Cell lysates were immunoprecipitated and immunoblotted with the indicated antibodies. (D) Dephosphorylation of pAkt reduced Hades-mediated Akt ubiquitination in vitro. In vitro ubiquitination assays were performed with purified human Akt protein derived from Sf9 cells and λ-PPase. Ubiquitinated

Akt and pAkt were detected by immunoblotting with the indicated antibodies. (E) Hades siRNA treatment increased Akt protein stability. HeLa cells were transfected with control and Hades siRNA and treated with 40 Mg / ml cyclonucleoside for the indicated time, and then

Akt protein turnover was investigated via immunoblotting. 4 shows that activated Akt is the preferential target of the ubiquitin E3 ligase Hades. (A) Hades is const itutively active in vivo

Interacted with Akt. After transfection with the plasmid as indicated, HEK293 cells were treated with MG132 and then immunoprecipitated with anti-myc antibody and immunoblotted with the indicated antibodies, (B) Activated Akt was in vivo by Hades. It was efficiently ubiquitated. After transfection with the plasmid as indicated, HEK293 cells were removed.

Treatment with MG132 followed by an in vivo ubiquitination assay as described in the Examples. Was carried out. (C) Proteolysis of Hades-mediated Akt was inhibited by LY294002. HEK293 cells were cotransfected with plasmids as indicated. After 24 hours incubation, cells were treated with 10 μΜ LY29402 for 4 hours. Cells were lysed and immunoblotted with the indicated antibodies. Isotopic expression levels of GST were normalized to transfection control. The graph shows the mean ± SD of the relative intensities of Akt from three experiments.

FIG. 5 shows that lysine 284 of Akt is a site for Hades-mediated polyubiquitination. (A) KD of Akt is ubiquitized by Hades. A series of Akt deletion constructs were transcribed and translated in the presence of 35S-methionine. The 35S-labeled Akt mutations were ubiquitized by Hades via an in vitro ubiquitination assay. (B) Lysine 284 of Akt is the polyubiquitination site. HEK293 cells were cotransfected with plasmids as indicated. 24 hours after transfection, cells were treated with 10 μΜ MG132 and subjected to an in vivo ubiquitination assay as described in the Examples. Total cell lysates were analyzed by immunoblotting with the indicated antibodies. (C) K284R-Akt was more stable than WT Akt. HeLa cells were cotransfected with the indicated plasmids and then treated with 40 Mg / ml cyclonucleosides. Cells were immunoblotted with the indicated antibodies. FIG. 6 shows that the cell growth function of Akt is inhibited by Hades. (A) Cell growth was alleviated by Hades. After transfection with plasmids as indicated in HeLa cells, the number of viable cells was counted every 24 hours using a hemocytometer. The result is representative of three independent experiments. (B) Hades inhibits cell survival in a dose-dependent manner. HeLa cells were transfected with plasmids as indicated. After 24 hours of incubation, cell viability was determined by MTS assay. (C) Hades inhibits clonal growth.

G418 (500 g / ml) for 2 weeks after HeLa cells were transfected with plasmid as indicated Incubated in containing medium and stained with crystal violet. (D) Hades inhibits anchorage-independent growth. Soft-agar assays were performed with HeLa cells transfected with the indicated plasmids. Colonies were counted two weeks after seeding. The results represent three independent experiments (mean 土 SD city). Student's t-test was used for statistical significance (* P <

0.05). (E, F, G) Akt downstream signaling is regulated by Hades. HeLa cells were transfected with the indicated Hades plasmid (E) and Hades siRNA (F). After 24 hours incubation, the cells were lysed and immunoblotted with the indicated antibodies. HeLa cells were cotransfected with TCF / LEF1 reporter plasmid, pTOPFLASH and the other plasmids indicated. After 24 hours of incubation, the cells were lysed and the reporter luciferase activity driven by the TCF response element was determined (G). (H, I) Hades inhibited Akt-induced cell migration (H), but did not inhibit K284R ᅳ Akt-induced cell migration (I). HeLa cells were cotransfected with plasmids as indicated. After 48 hours transfection, 10OT confluent cells were scratched to form wounds. 72 hours after the induction of the wound, cell migration was visualized on a phase contrast microscope. (J) Cell growth of K284R-A-expressing cells is not inhibited by Hades. After HeLa cells were transfected with the plasmid as indicated, the number of viable cells was counted every 24 hours using a hemocytometer. FIG. 7 shows that siRNA-mediated Hades expression clearance stabilizes endogenous Aktl and Akt2 proteins. Transfection of HeLa serotypes with Hades specific siRNA The effect of Hades clearance on Akt isoforms was determined by immunoblotting with Akt isoform-specific antibodies. 8 shows that Hades induces Aktl degradation and co-locates with Aktl in the mitochondria. (A) Hades induced Aktl degradation in both the cytosol and mitochondria. HeLa cells were cotransfected with the indicated plasmids and the cytoplasmic and mitochondrial fractions were isolated. Immunoblotting with the indicated antibodies determined the effect of Aktl degradation by Hades in the cytoplasm and mitochondrial fraction. Tubulin and Bcl-xL were used as cytoplasmic and mitochondrial markers, respectively. (B) Colocation of Hades with Aktl-WT (top) and Aktl-myr (bottom) was investigated in HeLa cells. HeLa cells were cotransfected with the indicated plasmids and the cells were incubated in the presence of MG132 (10 μΜ) for 4 hours, immobilized and visualized by confocal microscopy. DAPI staining was used to make nuclei visible. Abbreviations: cyto, cytoplasm 1; mi to, mitochondria FIG. 9 shows that serum decreases Akt protein stability, HeLa cells were serum-deficient for 20 hours, and a set of cells were stimulated with 10% fetal calf serum. Cells were then treated with 40 g / ml cyclonuximide for 0, 3, 6, 12, and 24 hours and endogenous Akt protein stability was examined using immunoblotting. FIG. 10 shows that geldanamycin induces Akt degradation in both control cells and Hades-deficient cells. HeLa cells were transfected with negative control siRNA or Hades siRNA and then treated with geldanamycin (50 nM) overnight. Protein levels of Hades and Akt were detected by immunoblotting. FIG. 11 shows that Hades® mediated Akt proteolysis is recovered by wortmannin. HEK293 cells were cotransfected with plasmids as indicated. After 24 hours of incubation, cells were treated with 10 μΜ wortmannin for 4 hours. Cells were lysed and immunoblotted with the indicated antibodies. 12 shows that mutation of lysine 284 prevents proteolytic degradation of isotopically expressed Akt by Hades. HEK293 cells were cotransfected with plasmids for wild type or lysine mutations of Akt in combination with plasmids for EGFP-Hades or control EGFP. 24 hours after transfection, Cells were lysed and immunoblotted with the indicated antibodies. FIG. 13 shows that the depletion of Hades in HeLa cells by shRNA increases cell growth. HeLa cells were infected with lentivirus expressing negative control shRNA or Hades shRNA. Cells for 2 weeks

5 Mg / ml puromycin was selected. Cell growth was determined by counting using a hemosatometer every 24 hours. Data is shown as mean of 3 independent experiments (mean ± SD plot). FIG. 14 shows that Akt-mediated cell survival increase is reduced by Hades in a RING domain-dependent manner. HeLa cells were transfected with plasmids for control EGFP, EGFP-tagged wild type Hades (EGFPHADES-WT) or RING domain mutant Hades (EGFP-HADES-MT) in combination with Myc / His-Akt-myr. Twenty four hours after transfection, cell viability was determined using MTS assay.

Three independent experiments were conducted. The results represent three independent experiments (mean 土 SD city). Student's t-test was used to determine statistical significance (* P <0.05). 15 shows that endogenous Hades deficiency inhibits cell migration, incubating lentiviral-mediated Hades-deficient cells and control cells and scratching 100% confluent cells to form a wound. Cell migration was visualized by phase contrast microscopy 72 hours after scratching to form a wound. Figure 16 shows that Hades-induced NF-κΒ activation is independent of its E3 ligase activity, and Akt-induced NF—κΒ activation is in a Ε3 ligase activity-dependent manner.

Figure showing that it is reduced by Hades. HeLa cells were EGFP control,

Transfected with EGFP-HADES-WT, or EGFP-HADES-MT, or NF—κΒ luciferase Cotransfected with plasmid for Myc / His-Akt-WT together with the reporter plasmid and β-galactosidase plasmid. After 24 hours of incubation, cells were lysed and reporter luciferase activity was determined. FIG. 17 shows that isotopically expressed Akt is degraded by Hades in He cells in the presence of a caspase inhibitor Z-VAD. HEK293 cells were transfected with a plasmid for EGFP—HADES-WT or EGFP-HADES-MT with a combination of Myc / His-Akt-WT. 24 hours after transfection, cells were treated with Z-VAD (10 μΜ) and incubated for another 4 hours. Cell extracts were immunoblotted with the indicated antibodies. FIG. 18 shows that Hades reduces colony formation in HCT116 colon cancer cell line. (a) Cancer cells are characterized by growing morphologically to form colonies. In order to confirm how much colonies were generated, the EGFP vector, the EGFP-Hades WT vector, and the EGFP-Hades MT vector were first transfected into colon cancer cell HCT116 through Lipofectamin 2000 according to the manufacturer's instructions. . Afterwards, the colony was cultured in a medium containing the antibiotic puromycin for 2 weeks to generate colonies. After that, the cells were immobilized and finally stained with 0.1% crystal violet. This is a graph of the colony numbers shown in (B)). Outcome 1: Akt interacts with Hades E3 ubiquitin ligase

Human full-length cDNA libraries derived from HeLa and Chang cells were prepared to identify proteins that interact with Akt (Supplementary Materials and Methods). In vitro transcription and translated protein pools from the cDNA library were screened for human Akt 1-binding protein with a modified SMART technique. In the present invention, all experiments were conducted using human Aktl, which is denoted 'Akt' unless otherwise specified. remind From the library, several positive cDNA clones were isolated and one of the clones identified as the main Akt—binding partner (data not shown). This clone contained several putative functional domains: a transmembrane (TM) domain or signal peptide at the N terminus, a 2 TM domain at the middle of the protein, and a RING finger domain at the C terminus (ie, a label of the E3 ligase domain). The present invention focuses on functional communication between this clone and Akt, while Li et al. [23] named this protein MILAN, meaning mitochondrial ubiquitin ligase activator of NF-κΒ.

 In vitro pull-down studies have shown that Akt physically interacts with Hades (FIG. 1A). The intermolecular association between endogenous Akt and Hades was investigated using coi 讓 unoprecipitation assay (FIG. 1B). Human Akt has three isoforms: Aktl, Akt 2 and Akt3. Akt isosome-specific immunoprecipitation assays showed that Hades interacts with AI and Akt2 but not with Akt3 (FIG. 1C). Also, Hades deficiency increases protein levels of Aktl and Akt2 but not Akt3. (FIG. 7), it was reported that Akt2 was translocated to mitochondria, but not Akt3 [24]. Aktl's mitochondrial transposition is controversial [24-26]. However, the experiments of the present invention revealed that Aktl could be translocated to mitochondria (FIG. 8A). Confocal microscopy also revealed that Aktl colocalized with Hades (FIG. 8B). In vitro binding assays using a series of Akt lacking mutants revealed that the kinase domain of Akt associates mainly with Hades (FIGS. 1D and 1E). Outcome 2: Akt ubiquitination and degradation are directly regulated by Hades

To determine the functional role of the interaction between Akt and Hades, we investigated whether Hades functions as an E3 ligase for Akt. Hades expression resulted in a decrease in Akt protein levels in an E3 ligase activity-dependent manner. In addition, proteasome inhibitor MG132 completely restored this decrease in intracellular Akt protein levels (FIG. 2A, lane 5). Next, in vitro and in vivo ubiquitination The assay demonstrated that recombinant and endogenous Akt proteins were ubiquitinated by Hades in an E3 ligase activity-dependent manner (FIGS. 2B and 2C). The opposite was observed in Hades siRNA-induced knockdown cells. Hades siRNA transfection resulted in inhibition of Akt ubiquitination in HEK293 cells (FIG. 2D, left panel). Incidentally, serum / glucocorticoid regulatory kinase 1 (SGK1) [27] with high homology with Akt was not affected by endogenous Hades deficiency (FIG. 2D, right panel).

 The ability to generate diverse substrate and ubiquitin structures is important for targeting proteins with different fates [28]. To this end, in vivo ubiquitination assays were performed in HeLa cells expressing HA-tagged ubiquitin (HA-Ub WT, HA-Ub K48R, and HA—Ub K63R) in which lysine 48 or 63 were mutated to arginine. As shown in FIG. 2E, Ub K48R completely abolished Hades-mediated Akt ubiquitination, while Ub WT and Ub K63R did not. This indicates that K48-linked ubiquitination chains are formed during Hades-mediated ubiquitination of Akt. These results indicate that Hades E3 ligase specifically targets Akt to induce its ubiquitination and subsequent degradation. Shows. Result 3: pAkt is a Preferential Target of Hades E3 Ubiquitin Ligase

 Since upregulation of Akt kinase activity is tightly controlled by the phosphorylation of serine 308 and threonine 473, it was tested whether the activity / inactivation state of Akt affected Akt degradation by Hades. To test this hypothesis, we first tested the interaction between endogenous Hades and Akt under the stimulus of growth factors. Interestingly, the interaction between endogenous Hades and Akt was detected in the presence of serum and insulin in HeLa cells (FIG. 3A). Similarly, Hades-induced Akt degradation was serum-stimulated

It was preferentially induced in HEK293 cells (FIG. 3B). In vivo ubiquitination assays also demonstrated that serum stimulation induced endogenous Akt ubiquitination by Hades (FIG. 3C). In addition, it is a PI3K inhibitor that inhibits phosphorylation of Akt.

LY294002 inhibits Hades-induced Akt ubiquitination in serum-stimulated HEK293 cells Inhibition (Fig. X, lanes 5-8). These observations suggest an association between Akt activation status and Hades-mediated degradation. To demonstrate this hypothesis, an in vitro ubiquitination assay was performed in the presence of λ-PPase [30, 31] having activity with phosphorylated serine, threonine and tyrosine residues. Treatment with λ-PPase effectively eliminated phosphorylation of Akt residues to inhibit Akt ubiquitination (FIG. 3D), which led to testing whether serum or growth factors reduce the stability of endogenous Akt. Interestingly, it was found that Akt protein levels were slightly decreased in serum-deficient cells and significantly increased in serum-stimulated cells, indicating that phosphorylated Akt degrades more efficiently than non-phosphorylated Akt (FIG. 9). . It was also found that serum-induced Akt degradation was inhibited by Hades deficiency (FIG. 3E) and that siRNA-induced Hades deficiency increased the protein levels of Akt and pAkt in a dose-dependent manner (FIG. 6F). . In addition, geldanamycin induced Akt degradation in both control and Hades-deficient cells, suggesting that Hades-induced Akt degradation is independent of Hsp90 inhibitor-induced Akt degradation (FIG. 10). . Overall, these results indicate that Hades preferentially targets pAkt for ubiquitination. Result 4: Activated Akt is a polyubiquitination target of Hades

Akt activation is induced by cross-domain morphologically-mediated phosphorylation [32, 33]. We then tested the intracellular regulation of permanently active Akt by Hades by coimmunoprecipitation assay, Myristoylation signal-attached Akt (Akt-myr) is a constitutively active form of Akt [34]. Coimmunoprecipitation experiments showed that Hades interacted with ectopically expressed functionally active Akt (Myc / His-Akt-WT and Myc / His-Akt-myr), but dominant-negative Akt (Myc) in HEK293 cells. / His-Akt- DN) did not interact with (Fig. 4A). We confirmed using ubiquitination experiments in vivo that ubiquitination of Akt was dependent on Akt activation in transfected HEK293 cells (FIG. 4B). Similarly, LY294002 completely inhibited Akt phosphorylation and mostly blocked Hades-mediated Akt degradation. (Figure 4C, lanes 4, 5, and 6). Another PI3K / Akt inhibitor, wortmannin [35] also blocked Hades-mediated Akt degradation (FIG. 11). These results indicate that Hades preferentially binds to pAkt and promotes its degradation, which is consistent with our results that Hades negatively regulates active pAkt. Outcome 5: Lysine 284 in Akt is a major site of ubiquitination by Hades

Akt consists of an N-terminal flextrin homology (PH) domain, a central catalytic kinase domain (KD) and a C-terminal short regulatory hydrophobic motif [36]. Phosphorylation of Akt induces a structural change, separating the PH and HM domains from the KD domain [37]. In vitro binding assays demonstrated that Hades specifically ubiquitizes Akt WT as well as Akt-KD (FIG. 5A). We then determined which lysine residues of Akt-KD are required for protein stabilization and ubiquitination. To evaluate the relationship between mutations in the Akt protein stability, and a lysine residue, a ^"part-of conjugation residues (K158, K163, K170, K183, K189, K214, K276, K284, K289-estimate the ubiquitin by specifying mutations Mutations from Akt lysine 00 to arginine (R), K297 and K307). As shown in FIG. 12, degradation of Akt K284R was inhibited compared to Akt WT and other Akt mutations. In addition, we confirmed in vivo ubiquitination assay that Akt K284R showed significantly reduced ubiquitination (FIG. 5B). In addition, cyclonucleoside chase assays showed that Hades did not reduce the stability of Akt K284R compared to Akt WT (FIG. 5C). The results indicate that lysine 284 in Akt is a specific residue of Hades-mediated Akt ubiquitination. Outcome 6: negative control of Akt signaling by Hades

 Akt plays an important role in regulating cell cycle progression, cell survival and cell growth [38]. We believe that the growth of cells expressing EGFP-Hades-WT is EGFP-Hades-

It was found to be significantly inhibited compared to the growth of cells expressing MT or control EGFP (FIG. 6A). Hades-deficient cells ^■ grew faster than control cells (FIG. 13). Hades is responsible for the proliferation of HeLa cells in a concentration-dependent manner. Inhibition (FIG. 6B). MTS assay also showed that the increase in Akt-mediated cell viability is reduced by Hades overexpression in HeLa cells (FIG. 14). Cell growth inhibition by Hades was confirmed by clonality and anchorage-independent soft agar assays (FIG. 6D). HeLa cells expressing EGFP-Hades-WT showed a 50% reduction in colony formation compared to colony formation of cells expressing EGFP-Hades-MT or control EGFP (FIG. 6C). These results indicate that Hades modulates the Akt downstream signaling pathway. GSK— 3 / β-catenin / TCF signaling

PI3K / Akt-mediated downstream pathway of cell survival and proliferation [6, 39]. In FIG. 6E we showed that both phosphorylation of Akt downstream target proteins GSK-3P and TSC2 are inhibited by Hades in a RING ligase activity-dependent manner (FIG. 6E). In addition, the opposite phenomenon was observed in a Hades siRNA-dependent manner (FIG. 6F). In the TCF / LEF1 response element-driven luciferase system, pTOPFLASH reporter activity was measured to confirm inhibition of Akt downstream signaling by Hades (FIG. 6G). Taken together, these results indicate that Hades inhibits cell growth by regulating the Akt signaling pathway. We assessed the effect of Hades on Akt-induced cell migration using the following in vivo wound healing assay. Isoexpressed ¥ [Hades inhibited HeLa cell migration better than RING ligase MT Hades (FIG. 6H) and Hades siRNA transfection increased HeLa cell migration (FIG. 15). This indicates that Hades E3 ligase efficiently inhibits Akt and its downstream signaling. In addition, we tested the effect of Akt K284R on cell growth and cell migration, regulated by Hades. Hades inhibited Akt-induced cell growth more efficiently than it inhibited Akt_K284R-induced cell growth (FIG. 6J). Similarly, Akt-K284R-induced cell migration was not inhibited by Hades in contrast to Akt WT-induced cell migration (FIG. 61). These results indicate that Hades E3 ligase efficiently inhibits Akt function by ubiquitination of Akt in lysine 284.

Akt is known to activate NF-κΒ and Hades is known to be an NF-κΒ activator Reported [23,45]. Therefore, it is unclear whether Hades induces NF-κΒ activity or inhibits NF-κΒ activity by inhibiting Akt. To solve this problem, we tested NF-κΒ activity using a reporter plasmid containing an NF-κΒ—binding site (NF-κΒ luciferase reporter). HeLa cells were treated with EGFP control, EGFP-

Transfection with Hades-WT and EGFP-Hades-MT or cotransfected with plasmids for Myc / His-Akt WT. In these transfected HeLa cells, Hades WT and Hades MT increased NF-κΒ activity (up to 3 fold), but upregulation of NF-κΒ activity by Akt WT (up to 7 fold) was Hades E3 ligase-dependent Reduced in a manner (FIG. 16). These results indicate that Hades can upregulate F-κΒ activity, but the effect is independent of Akt-mediated NF-κΒ pathway,

Industrial Applicability

 The inventors have identified Hades, a negative regulator of Akt, with a RING finger domain and E3 ubiquitin ligase activity. According to the present invention, Akt interacts directly with Hades and is ubiquitized by Hades in vitro and in vivo. Therefore, Hades according to the present invention can inhibit the proliferation and survival of cancer cells by decomposing Akt and negatively controlling its downstream signaling, and thus can be usefully used as an anticancer agent.

[References]

 Jones PF, Jakubowicz T, Pitossi FJ, Maurer F, Hemmings BA. Molecular cloning and identification of a serine / threonine protein kinase of the second-messenger subfamily. Proc Natl Acad Sci U S A 1991; 88: 4171-4175.

Burger ing BM, Coffer PJ. Protein kinase B (c-Akt) in phosphat i dy 1 i nos ito 1 -3-OH kinase signal transduction. Nature 1995; 376: 599—602. 3. Franke TF. PI3K / Akt ： getting it right matters. Oncogene 2008; 27: 6473-6488.

 4. Franke TF, Yang SI, Chan TO, et al. The protein kinase encoded by the Akt proto-oncogene is a target of the PDGF ᅳ activated phosphatidyl inositol 3-kinase. Cell 1995; 81: 72 He 736.

 5. Kohn AD, Kovacina KS, Roth RA. Insulin stimulates the kinase activity of RAC-PK, a pleckstr in homology domain containing ser / thr kinase. EMBO J 1995; 14: 4288-4295.

 6. Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase ᅳ 3 by insulin mediated by protein kinase B. Nature 1995; 378: 785-789.

 7. Lustig B, Behrens J. The Wnt signaling pathway and its role in tumor development. J Cancer Res Clin Oncol 2003; 129: 199-221.

 8. Behrens J, von Kries JP, Kuhl M, et al. Functional interact ion of beta-catenin with the transcription factor LEF-1. Nature 1996; 382: 638-642.

 9. Huber 0, Korn R, McLaughlin J, et al. Nuclear local ization of beta- catenin by interact ion with transcript ion factor LEF-1. Mech Dev 1996; 59: 3-10.

 10. Brazil DP, Hemmings BA. Ten years of protein kinase B signaling: a hard Akt to follow. Trends Biochem Sci 2001; 26: 657-664.

 11. Luo J, Manning BD, Cant ley LC. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 2003; 4: 257-262.

 12.Hafizi S, Ibraimi F, Dahlback B. CI ᅳ TEN is a negative regulator of the Akt / PKB signal transduction pathway and inhibits cell survival, proliferation, and migration. FASEB J 2005; 19: 971-973.

 13. Maira SM, Galetic I, Brazil DP, et al. Carboxyl 一 terminal modulator protein (CTMP), a negative regulator of PKB / Akt and v-Akt at the plasma membrane. Science 2001; 294: 374-380.

Du K, Herzig S, Kulkarni RN, Montminy M. TRB3: a tribbles

as _; . k ⁱ e. Scence99767570n B _i 12775 _: -

.res ^ti r ^27-

Cad ^; 996.r ⁱ o0096912 ^l 24 ^: —

Ce ^l oc o ⁱ wtv¾ ^l m ^it; o ⁱ w ^l x ^{i <i} hrr ⁱ

o ^t ass ^fl nocwt ^lli: -, gg ,, es stua ^t k ^t easu ⁱ m ^l Aa Jh Hades L ⁱ n K Wn PH. ^I n ^li n. YnY Y 26

p ^j / Sa .oe. ^I. oun ¹ n31037r 00075211 ^:

pgy e coS Oe ^; 73.eeoeo. ^l n0095 ^ll ccrrssn P 242 ^li:

¾p¾oduato os ^t re treredo ^li n ⁱ nts ^t ocoda c ^li ns w ^li h rx m ^fI n ⁱ hn ^{Iil i} n ..

,, PcoC e a.ttcocu Ga S Fa Mt ^l Ak.n ⁱ Ar ⁱ c V ^lli rn 25 Ahl y sus ^; CC.bceaocaton.es ⁱ 009858059ur ^li Am JC ^ll ph 212 ^lll 1 ^: I 33. Huang BX, Kim Hades. Inter domain conformational changes in Akt activation revealed by chemical cross ᅳ linking and tandem mass spectrometry. Mol Cell Proteomics 2006; 5: 1045-1053.

 34. Majumder PK, Yeh JJ, George DJ, et al. Prostate intraepithelial neo lasia induced by prostate restricted Akt activation: the MPAKT model. Proc Natl Acad Sci U S A 2003; 100: 7841-7846.

 35. Arcaro A, Wymann MP. Wortmannin is a potent phosphatidyl inositol 3 一 kinase inhibitor ： the role of phosphat idyl inositol 3, 4, 5-t r i sphosphat e in neutrophil responses. Biochera J 1993; 296 (Pt 2): 297-301.

 36. Hanada M, Feng J, Hemmings BA. Structure, regulation and function of PKB / AKT-- a major therapeutic target. Biochim Biophys Acta 2004; 1697: 3-16.

37. Stephens L, Anderson K, Stokoe D, et al. Protein kinase B kinases that mediate phosphat idyl inositol 3, 4, 5 ^to tri sphosphat e-dependent activation of protein kinase B. Science 1998; 279: 710-714.

 38. Whiteman EL, Cho Hades, Birnbaum MJ. Role of Akt / protein kinase B in metabol ism. Trends Endocrinol Metab 2002; 13: 444-451.

 39. Weston CR, Davis RJ. Signal transduction: signaling specificity- a complex affair. Science 2001; 292: 2439-2440.

 40. Meier R, Hemmings BA. Regulation of protein kinase B. J ecept Signal Transduct Res 1999; 19: 121-128.

 41. Alessi DR, Deak M, Casamayor A, et al. 3-Phospho i no i t i de-dependent protein kinase ᅳ 1 (PDR1) '· structural and functional homology with the Drosophila DSTPK61 kinase. Curr Biol 1997; 7: 776-789.

 42. Riesterer 0, Zingg D, Hummer johann J, Bod is S, Pruschy M. Degradation of PKB / Akt protein by inhibition of the VEGF receptor / mTOR pathway in endothelial cells. Oncogene 2004; 23: 4624-4635.

43. Yan D, Guo L, Wang Hades. Requirement of dendritic Akt degradat ion by the ub i qui ti n-prot easome system for neuronal polarity. J Cell Biol 2006; 174: 415-424.

 44. Sasaki K, Sato M, Umezawa Hades. Fluorescent indicators for Akt / protein kinase B and dynamics of Akt activity visual ized in living cells. J Biol Chem 2003; 278: 30945-30951.

 45. Zhang B, Huang J, Li HL, et al. GIDE is a mitochondrial E3 ubiquit in 1 igase that induces apoptosis and slows growth. Cell Res 2008; 18: 900-910.

 46.Rokudai S, Fuj ita N, Hashimoto Hades, Tsuruo T. Cleavage and inactivation of ant iapopt otic Akt / PKB by caspases during apoptosis. J Cell Physiol 2000; 182: 290-296.

 47. Jope RS, Yuskaitis CJ, Beurel E. Glycogen synthase kinase-3 (GS 3): inflammation, diseases, and therapeutics. Neurochem Res 2007; 32: 577-595.

 48. Guertin DA, Sabatini DM. Defining the role of mTOR in cancer. Cancer Cell 2007; 12: 9-22.

 49. Potter CJ, Pedraza LG, Xu T. Akt regulates growth by direct ly phosphorylating Tsc2. Nat Cell Biol 2002; 4: 658-665.

Claims

[Range of request]

 [Claim 1]

 Akt (protein kinase B) negative modulator containing Hades protein having the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same as an active ingredient,

 [Claim 2]

 The Akt (protein kinase B) negative modulator according to claim 1, wherein the Hades-encoding gene has a nucleotide sequence of SEQ ID NO: 1.

 [Claim 3]

 The Akt (protein kinase B) negative modulator according to claim 2, wherein the Hades-encoding gene is inserted into a recombinant expression vector.

 [Claim 4]

 The Akt (protein kinase B) negative modulator according to claim 1, wherein the Hades has a RING finger-domain and has E3-ubiquitin ligase activity.

 [Claim 5]

 The Akt (protein kinase B) negative modulator according to claim 1, wherein the Akt interacts directly with Hades and is ubiquitinated by Hades.

 [Claim 6]

 6. Akt (protein kinase B) negative modulator according to claim 5, characterized in that the kinase domain (KD) of Akt interacts mainly in association with Hades.

 [Claim 7]

 The Akt (protein kinase B) negative modulator according to claim 5, wherein Akt is decomposed by ubiquitination by Hades to inhibit Akt expression.

[Claim 8] The method according to claim 15, wherein the Hades Akt (protein kinase B) negative modulator, characterized in that the specific ubiquitination of only Akt activated by phosphorylation,

 [Claim 9]

 6. Akt (protein kinase B) negative modulator according to claim 5, characterized in that lysine 284 of Akt is a major site of ubiquitination by Hades.

[Claim 10]

 The method of claim 1, wherein the Akt is Akt (protein kinase B) negative (1) characterized by inducing cell proliferation, inhibition of apoptosis and cell migration by downstream signaling ( negative) modifier.

[Claim 11]

 The Akt (protein kinase B) negative modulator according to claim 1, wherein the Hades inhibits the proliferation, survival and cell migration of cancer cells.

[Claim 12]

 An anticancer agent comprising a Hades protein having the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same as an active ingredient, which acts as an Akt (protein kinase B) negative regulator.

 [Claim 13]

 Screening method for Akt (protein kinase B) negative modulator comprising the following steps:

 (a) cotransfection of Akt and Hades to animal cells;

(b) treating any of the agents on the transfected animal cells; And

 (c) determining whether the interaction of Akt and Hades is promoted in said animal cell.

 [Claim 14]

 Screening method for Akt (protein kinase B) positive modulator comprising the following steps:

 (a) cotransfection of Akt and Hades to animal cells;

(b) treating the transformed animal cell with any agent; And (c) determining whether the interaction of Akt and Hades is inhibited in said animal cell.