WO2012061814A1 - Pcr primers and methods for rapid and specific genotyping - Google Patents

Abstract

Described herein are compositions and methods for performing PCR-based amplification of a target nucleic acid for the specific, efficient, reproducible, and accurate genotyping of single nucleotide polymorphisms in DNA.

Description

PCR PRIMERS AND METHODS FOR RAPID AND SPECIFIC GENOTYPING

RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application Serial No. 61/410,735, filed November 5, 20Ί0, the entire contents of which are expressly incorporated herein by reference.

BACKGROUND OF THE INVENTION

Cells often signal an infection by expressing, on their surface, foreign proteins that are recognized by antibodies. Fc IgG receptors (FcyR) on the surface of cytotoxic cells, e.g., natural killer cells (NK cells), neutrophils, macrophages, and others, recognize the antibody-coated infected cell, which step subsequently leads to cell destruction. FcyRs are membrane bound glycoproteins that have been shown to be involved in a variety of processes such as phagocytosis, endocytosis, antibody- dependent cellular cytotoxicity (ADCC), release of inflammatory mediators, and enhancement of antigen presentation. See, Van de Winkel et al. (1993) Immunol Today 14(5):215-21.

Two FcyRHI genes, FCGR3A (gene A or CD16) and FCGR3B (gene B), have been identified. Ravetch and Perussia (1989) J. Exp Med 170:481. FcyRIII receptor genes have been mapped to the long arm of chromosome 1. Van de Winkel et al. (1993) Immunol Today 14(5):215-21. Furthermore, various functional polymorphisms have been identified in FCGR3A including a bi-allelic functional polymorphism of FCGR3A (T to G at nucleotide 559; position 101,41 1 GenBank Accession NO:

AL590385 (SEQ ID NO: 46) (T is present on antisense strand)), which encodes a valine (V) to phenylalanine (F) substitution at amino acid position 158 (Table 1). Koene et al. (1997) Blood 90: 1109-1114. The polymorphism alters receptor function by affecting its affinity for immunoglobulin Gl (IgGl), thereby altering the level of natural killer cell activation after FcyRHIa engagement. TABLE 1. FCGR3A Polvmorohism inolvmomhic nucleotide is hold and

underlined).

Genetic links between the low-affinity allele of FCGR3A (158F) and autoimmune diseases such as systemic lupus erythematosus (SLE) have been

A : l i n r.. ~* .-. l / 1 c n\ j r^l : i . l on. i ncn nr\ o ι * . - J : - .. „ι„_Λ

UCS-.11UCU. vv u ci ai . y^ iiri. in vest , l Y jy- ocvci ai siuuics ciisu

suggested association between 158F/V polymo hism and susceptibility to rheumatoid arthritis. Nieto et al. (2000) Arthritis Rheum. 43:735-39; Chen et al. (2006) Clin. Exp. Immunol. 144: 10-16; Morgan et al. (2000) Arthritis Rheum. 43:2328-34).

The FCGR3A 158V allele has been shown to bind human IgGl with higher affinity than the 158F allele, and the increased binding of the 158V allele results in enhanced activation of effector cells and increased cell lysis via ADCC. Shields et al. (2001) J. Biol. Chem. 176:6591-6604; Vance et al. (1993) J. Immunol. 151 :6429-6439. Treatment outcomes have also been shown to be affected by the 158F/V

response to therapeutic antibodies such as rituximab, an anti-CD20 antibody used to treat some autoimmune diseases as well as B cell lymphomas. Individuals homozygous for the high-affinity FCGR3A allele (158V) typically have higher response rates to rituximab as compared to homozygotes for the low-affinity allele (158F). Cartron et al. (2002) Blood 99J54-75S; van Sorge et al. (2002) Tissue Antigens 61 : 189-202; Weng and Levy (2003) J. Clin. Oncol. 21 : 1-8; Anolik et al. (2003) Arthritis Rheum. 48:455-59; Ghielmini et al (2005) Annals of Oncology, 16: 1675- 1682; Treon et al. (2005) Clin. Oncol. 23: 474-481.

The FCGR3A gene has proven to be a challenging region to amplify, especially in terms of the specificity, robustness, and repeatability required for accurate genotyping of single nucleotide polymorphisms (SNPs) with clinical samples. The primer designs are the key component to successful amplification in this complex duplicon region. An allelic discrimination plot, which graphically represents genotyping sample data from sequencing or real-time PCR probe based assays, normally results in 3 distinct clusters for a biallelic polymorphism: the homozygous wild type genotype (ex. F/F) on the X axis, the homozygous mutant genotype (ex.

VA on the Y axis, and the heterozygote genotype containing one copy of each allele (ex. FA⁷) an approximately equal distance apart from and in between the wild type and mutant genotype clusters.

The co-amplification of duplicons via improper annealing of non-specific primers can result in at least two extra clusters making accurate genotyping calls impossible with associated phenotypes unknown. Duplicons are genetic duplications (i.e., repeated sequence elements within genomic segmental duplications) that result in regions having, for example, >90% sequence homology with the gene segment of interest. Duplicons can be functional genes, pseudogenes or merely repeated

sequences. In particular, FCGR3B contains a region with 98% sequence homology to the polymorphic region of FCGR3A, which can result in false or ambiguous genotype calls and more than 3 clusters. In addition, FCGR3A resides in a known copy number variation (CNV) region, which can similarly result in false or ambiguous genotype calls for SNPs. Copy Number Variation (CNV) is defined as a one kilobase or greater change in copy number in a genome compared to a reference sequence (Feuk et al (2006) Nat. Rev. Genet. 7:85-97). Humans normally have two copies (diploid) of each autosomal region, one per chromosome. It is now known that CNVs within the human genome contribute more to nucleotide diversity than SNPs.

CNV regions in the human genome have been identified by a variety of methods, as summarized in the Database of Genomic Variants

(http://projects.tcag.ca/variationy). The CNV region comprising the FCGR3A gene is registered as with the Database of Genomic Variants as the region spanning position 159610879- 160346951 of chromosome 1 (Table 2).

TABLE 2. Summary of Reported Copy Number Variation in the FCGR3A Region from the Database of Genomic Variants

PubMed Method/

Landmark Reference Gain Loss Sample Size

ID platform

chrl:1596 Redon et Affymetrix 500K EA 270 control samples

17122850 28 23 10879..15 al. (2006) SNP Mapping Array (HapMap) 9948176

chrl:1596

Redon et 270 control samples 72939..15 17122850 BAC Array CGH

al. (2006) (HapMap) 9890629

P11- Wong et

17160897 BAC Array CGH 2 1 95 control samples 488 1 al. (2007)

chrl:1597 de Smith Agilent 185k CGH

50 control samples 45305..16 et al. 17666407 Arrays/Agilent 1 34

(French)

0346951 (2007) Custom CGH Arrays

chrl:1597 776 control samples

Pinto et Affymetrix 500K SNP

30122..15 17911159 3 (506 Germans, 270 al. (2007) Mapping Array

9940306 HapMap) chrl:1597 lllumina

Wang et 112 control samples 61664..15 17921354 HumanHap550 1

al. (2007) (HapMap) 9913448 BeadChip

chrl:1597 lllumina

Wang et 112 control samples 77717..15 17921354 HumanHap550 1

al. (2007) (HapMap) 9884140 BeadChip

chrl:1597 2 control samples 49902..15 17901297 Paired End Mapping 0 1 (NA18505 and al. (2007)

9832916 NA15510) c rl:1597 2 control samples

Korbel et

61845..15 17901297 Paired End Mapping 0 1 (NA18505 and al. (2007)

9845486 NA15510) chrl:1597

Perry et Agilent Custom CGH 30 control samples 45304..15 18304495 0 16

al. (2008) Arrays (HapMap) 9912627

chrl:1597 cCarroll

Affymetrix Human 270 control samples 78034..15 et al. 18776908 NA NA

SNP Array 6.0 (HapMap) 9906183 (2008)

Like other types of genetic variation, CNVs have been associated with

susceptibility or resistance to disease, and drug response. CNVs are studied extensively because of their close association with drug metabolism, cancer, immune diseases, and neurological disorders, as well as to further understand the spectrum of human genetic variation, and to assess the significance of such variation in disease association studies.

False heterozygous individuals with suspected CNV tend to fall into a 4^th or 5^th cluster that lies between the heterozygous cluster and one of the homozygous clusters because of a gain in gene copy number associated with either the wild type allele or the mutant allele. This is evident only when FCGR3A is amplified with high specificity (see example 3 and Figure 2). On genotyping allelic discrimination cluster plots heterozygous sample outliers can be suspected of CNV (once a SNP under a primer or probe has been ruled out), and samples clustering with no template controls (NTCs) can be suspected as being caused by a null allele. Homozygote CNVs are not seen as outliers in a genotyping cluster plot because they are homozygous for either the wild type or mutant allele, and so are hidden within those clusters. Likewise, samples with one copy also are hidden within one of the two homozygous clusters.

Given the functional and clinical implications of the FCGR3A 158F/V polymorphism, PCR-based methods for genotyping a particular individual have been pursued. See, e.g., Koene et al. (1997) Blood 90(3):1 109-1 114; Lepperts et al. (2000) J. Immuno Methods 242: 127- 132; Jiang et al. (1996) J. Immunol. Methods 199:55-59; Morgan et al. (2003) Rheumatology 42:528-533; Dall'Ozzo et al (2003) J. Immunol. Methods 277: 185-192; and U.S. Patent Nos. 5,830,652 and 5,985,561. However, currently available assays have error rates of at least about 10% with respect to

Hf»tprminincj nnlvmnmhisms thf»v Hn nnl nr Hi etm cmich between FCGR3A (gene A) and FCGR3B (gene B). The assay design is complicated by the close homology between FCGR3A and FCGR3B gene (i.e., 97% sequence identity) because the assay must allow specific gene amplification and genotyping. Therefore, there remains a need for compositions and methods for accurate, efficient, and reproducible genotyping for polymorphisms associated with genetic diseases and/or differential responses to therapies, for example, a subject's FCGR3A genotype. Such methods can aid in disease diagnosis, disease risk assessment, and design of individualized treatment.

SUMMARY

Described herein is a strategy for the specific PCR amplification of a target nucleic acid sequence, specifically for amplifying gene amplicons to aid in, e.g., genotyping and CNV applications. In certain aspects, described herein are compositions and methods for the specific, efficient, reproducible, and accurate detection of single nucleotide polymorphism alleles, for example, in genomic DNA. In particular, methods described herein provide for the specific amplification of a target nucleic acid that has high sequence similarity to another gene(s), pseudogene(s) or duplicon region. The resulting amplicon is useful, for example, in genotyping at least one polymorphism in the target gene of interest. For example, the compositions and methods described herein can specifically, accurately, and reproducibly amplify a target nucleic acid that lies within a duplicon region.

Accordingly, in one aspect, the application describes a method for designing a target-specific primer pair for specific and accurate amplification of a target nucleic acid region, for example a gene-specific amplicon. In an exemplary embodiment of this aspect, the application describes a primer pair for the specific, efficient, reproducible, and accurate amplification of a region within the Fc-gamma receptor Ilia gene

(FCGR3A). The specific amplification using the primers described herein allows for accurate genotyping of the FCGR3A polymorphisms within the targeted region. In an exemplary embodiment of this aspect, the application describes a method for amplifying an FCGR3A nucleic acid region using a primer pair comprising, for example, the nucleic acid sequences as set forth in SEQ H) NO: l and SEQ ID NO:2, respectively, to allow for accurate genotyping of clinically relevant polymorphisms in FCGR3A, e.g., the FCGR3A 158F/V polymorphism. In another embodiment, the primer pair comprises the nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, the primer pair comprises a primer with a nucleic acid sequence as set forth in SEQ ID NO:4 or SEQ ID NO:5 and a nucleic acid sequence as set forth in SEQ ID NO: l In another embodiment, the primer pair comprises the nucleic acid sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 4. In yet another embodiment, the primer pair comprises the nucleic acid sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 5.

In still another aspect, the application describes methods of assessing whether a subject has, or is at risk for, a polymorphic disease, and/or a refractory drug response, and/or an adverse drug reaction comprising genotyping at least one polymorphism existing in a nucleic acid region targeted for amplification with a primer pair as described herein. In an exemplary embodiment of this aspect, the application describes a method of assessing the treatment outcome in a patient by genotyping the FCGR3A 158F V polymorphism, the method comprising: amplifying a FCGR3A region in a PCR reaction with a primer pair, for example, the primers as set forth in SEQ ED NO: 1 and SEQ ID NO:2, to generate an FCGRJA-specific amplicon containing a 158F/V polymorphic site; and performing a genotyping reaction to identify the nucleic acids present at the 158F/V polymorphic site. In still another aspect, the application describes kits comprising a primer pair useful for the specific and accurate amplification of a target nucleic acid. In an exemplary embodiment of this aspect, the application describes a kit comprising the primer pair as set forth in SEQ ID NO: l and SEQ ID NO:2 In another embodiment, a kit comprises a primer with the nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, a kit comprises the primer pair as set forth in SEQ ED NO:4 or SEQ ID NO: 5 and a nucleic acid sequence as set forth in SEQ ID NO: 1 In another embodiment, a kit comprises the primer pair as set forth in SEQ ID NO: 1 and SEQ ID NO: 4. In another embodiment, a kit comprises the primer pair as set forth in SEQ ID NO: 1 and SEQ ED NO: 5. In any embodiments of this aspect, the kits may additionally comprise reagents useful for performing a PCR reaction using the provided primer pair, and/or specific instructions for their use according to any of the methods as described herein, either explicitly, implicitly or inherently.

The preceding aspects and embodiments are given by way of example only and are not intended to be limiting on the scope of the present disclosure and appended claims. Additional objects and advantages of the present invention will be appreciated by one of ordinary skill in the art in light of the instant claims, description, and examples. For example, the various aspects and embodiments of the invention may be utilized in numerous combinations, all of which are expressly contemplated by the present description. These additional objects and advantages are expressly included within the scope of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Allelic discrimination plot generated using the Applied Biosystems TaqMan assay for FCGR3A rs396991 (4985T>G). DNA was extracted from 93 whole blood samples and genotyped in duplicate using Applied Biosystems assay ID:

C_25815666_10. Data were plotted using the absolute fluorescence of each reported dye probe. NTC - no template control.

Figure 2. Allelic discrimination plot generated using the TaqMan assay for FCGR3A rs396991 (4985T>G) described herein. DNA was extracted from 93 whole blood samples and genotyped in duplicate using the CGRJA-specific primers, SEQ ED NO: 1 and SEQ ID NO:2. Data were plotted using the absolute fluorescence of each reported dye probe. NTC - no template control.

Figure 3. BlastN Megablast alignment of FCGR3A and FCGR3B nucleotide sequences (Query= FCGR3A NM_000569 3 A SNP rs3969 1 (SEQ ID NO: 6); Subject= FCGR3B NM_000570 (SEQ ID NO: 7)). Grey boxes indicate nucleotide mismatches between FCGR3A and FCGR3B. Bold/underline indicates the nucleotide corresponding to the FCGR3A 158F/V polymorphism.

Figure 4. The table shows concordance of genotyping calls obtained via Sanger sequencing, and TaqMan allelic discrimation using the specific primers disclosed herein. Samples with "undetermined" calls in the TaqMan assay were later confirmed to contain copy number variation (Figure 5).

Figure 5 Detection of CNV was confirmed using the A»BT TaqK an assay (assay ID: Hs00139300_cn). The assay was carried out according to the manufacturer's instructions. The dark blue bar indicates the "calibrator" control sample (sample 2-057) which is known to carry two copies. Red range bars represent the ΜΓΝ and MAX copy number for each sample. Five of the 93 samples showed a gain in copy number. Four of these samples, 1-033, 2-004, 2-043, and 2-067 had previously been identified as cluster outliers on the TaqMan allelic discrimination plot, with genotype calls assigned as "Undetermined" (see Figure 2); Sanger sequencing also identified these samples as false heterozygotes. The CNV assay confirmed gain of copy number in each of these samples.

Sample 1 -030 was identified as a homozygous "T" allele via sequencing and TaqMan genotyping. The CNV assay showed gain in copy number for 1-030. This sample was not an outlier on the allelic discrimination plot (using the PGx FCGR3A TaqMan genotyping assay i.e. using the method described herein) because it was hidden within the associated homozygote cluster.

While the above-identified figures set forth presently disclosed embodiments, other embodiments are also contemplated, as noted in the discussion. This disclosure presents illustrative embodiments by way of representation and not limitation. Numerous other modifications and embodiments can be devised by those skilled in the art which fall within the scope and spirit of the principles of the presently disclosed embodiments.

DETAILED DESCRIPTION

Described herein are compositions and methods that allow specific, accurate, and reproducible amplification of a target nucleic acid sequence, e.g., a gene. The amplified segment of the target nucleic acid; i.e., the "amplicon," is useful in a number of applications, including, e.g., genotyping analysis. Primers designed according to the methods described herein, are able to differentiate between highly homologous nucleic acid sequences, such as those that occur as a result of genetic segmental duplication events. As such, the present disclosure allows for high-fidelity allelic genotyping calls.

Unless otherwise indicated, the methods described herein can be performed using conventional chemistry, biochemistry, recombinant DNA techniques, which would be within the skill of the art. Such techniques are explained fully in the literature. See, e.g., A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In

Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Oligonucleotide Synthesis (N. Gait, ed., 1984); A Practical Guide to Molecular Cloning (1984). All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

It must be noted that, as used in this specification and the appended claims, the singular forms "a", "an" and "the" include piurai references unless the content cieariy dictates otherwise. Thus, for example, reference to "an oligonucleotide" includes a mixture of two or more oligonucleotides, and the like. The following amino acid abbreviations 'are used throughout the text: Alanine: Ala (A) Arginine: Arg (R) Asparagine: Asn (N) Aspartic acid: Asp (D) Cysteine: Cys (C) Glutamine: Gin (Q) Glutamic acid: GIu (E) Glycine: Gly (G) Histidine: His (H) Isoleucine: De (I) Leucine: Leu (L) Lysine: Lys (K) Methionine: Met (M) Phenylalanine: Phe (F) Proline: Pro (P) Serine: Ser (S) Threonine: Thr (T) Tryptophan: Tip (W) Tyrosine: Tyr (Y) Valine: Val (V). Unless otherwise indicated, technical terms are intended to have their ordinary meaning that would be understood by those of skill in the art.

As used herein, the terms "genotyping," "haplotyping," and "DNA typing" are used interchangeably to refer to the determination of the alleles of a selected chromosome or portion of a chromosome of an individual. By "isolated" is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro- molecules of the same type. The term "isolated" with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.

As used herein, the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" are used herein to include a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, and derivatives thereof. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single- stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide. More particularly, the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" include

polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides

(containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, Oregon, as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. There is no intended distinction in length between the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule," and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include, for example, 3'- deoxy-2', 5'-DNA, oligodeoxyribonucleotide N31 P5' phosphoramidates, 2'-0-alkyl- substituted RNA, double- and single-stranded DNA, as well as double- and single- stranded RNA, DNA:RNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, "caps," substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., .

aminoalklyphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or

oligonucleotide. In particular, DNA is deoxyribonucleic acid. A polynucleotide "derived

comprises a contiguous sequence of approximately at least about 6 nucleotides, at least about 8 nucleotides, at least about 10-50 nucleotides, and at least about 15-35 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence. The derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.

As used herein, "copy number variation" (CNV), refers to a segment of DNA that is 1 kb or larger and is present at a variable copy number in comparison with a reference genome.

As used herein, "homology" refers to the percent similarity or identity between two polynucleotide or two polypeptide moieties. Two polynucleotide, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% , at least about 75%, at least about 80%-85%, at least about 90%, and at least about 95%-98% sequence similarity or identity over a defined length

r amino acid- to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100.

Readily available computer programs can be used to aid in the analysis of homology and identity, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O. Dayhoff ed., 5 Suppl. 3_:353-358, National biomedical Research Foundation, Washington, DC, which adapts the local homology algorithm of Smith and Waterman Advances in Appl. Math. 2:482-489, 1981 for peptide analysis. Programs for determining nucleotide sequence homology are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent homology of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions. Another method of establishing percent homology in the context of the disclosure herein is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence homology." Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. Alternatively, homology can be determined by hybridization of polynucleotides under conditions that form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra;

Nucleic Acid Hybridization, supra. "Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin, which, by virtue of its origin or manipulation, is not associated with all or a portion of the polynucleotide with which it is associated in nature.

The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. In general, the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions. A "DNA-dependent DNA polymerase" is an enzyme that synthesizes a complementary DNA copy from a DNA template. Examples are DNA polymerase I from E. coli and bacteriophage T7 DNA polymerase. All known DNA- dependent DNA polymerases require a complementary primer to initiate synthesis. Under suitable conditions, a DNA-dependent DNA polymerase may synthesize a complementary DNA copy from an RNA template. A "DNA-dependent RNA polymerase" or a "transcriptase" is an enzyme that synthesizes multiple RNA copies from a double-stranded or partially-double stranded DNA molecule having a (usually double-stranded) promoter sequence. The RNA molecules ("transcripts") are synthesized in the 5' to 3' direction beginning at a specific position just downstream of the promoter. Examples of transcriptases are the DNA-dependent RNA polymerase from E. coli and bacteriophages T7, T3, and SP6.

An "RNA-dependent DNA polymerase" or "reverse transcriptase" is an enzyme that synthesizes a complementary DNA copy from an RNA template. All known reverse transcriptases also have the ability to make a complementary DNA copy from a DNA template; thus, they are both RNA- and DNA-dependent DNA polymerases. A primer is required to initiate synthesis with both RNA and DNA templates. As used herein, the term "target nucleic acid region," "target nucleic acid," "target nucleic acid segment," "target gene," or the like, denotes a nucleic acid molecule with a "target sequence" to be amplified. The target nucleic acid may be either single- stranded or double-stranded and may include other sequences besides the target sequence, which may not be amplified. The term "target sequence" refers to the particular nucleotide sequence of the target nucleic acid that is to be amplified. The target sequence may include a probe-hybridizing region contained within the target molecule with which a probe will form a stable hybrid under desired conditions. The "target sequence" may also include the sequences to which the oligonucleotide primers complex and extend using the target sequence as a template. Where the target nucleic acid is originally single-stranded, the term "target sequence" also refers to the sequence complementary to the "target sequence" as present in the target nucleic acid. If the "target nucleic acid" is originally double-stranded, the term "target sequence" refers to both the plus (+) and minus (-) strands.

As used herein, the term "primer" or "oligonucleotide primer" refers to an oligonucleotide which acts to initiate synthesis of a complementary nucleic acid strand when placed under conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA or RNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration. The primer is single-stranded for maximum efficiency in amplification, but alternatively can be double-stranded. If double-stranded, the primer can first be treated to separate its strands before being used to prepare extension products. This denaturation step is typically affected by heat, but may alternatively be carried out using alkali, followed by neutralization. Thus, a "primer" is complementary to at least a portion of a target sequence template, and complexes by hydrogen bonding or hybridization with the template to give a primer/template complex for initiation of synthesis by a polymerase, which is extended by the addition of covalently bonded bases linked at its 3' end complementary to the template in the process of DNA or RNA synthesis.

As used herein, the term "probe" or "oligonucleotide probe" refers to a structure comprised of a polynucleotide, as defined above, that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte. The polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. When an "oligonucleotide probe" is to be used in a 5' nuclease assay, such as the TaqMan™ technique, the probe will contain at least one fluorescing moiety and at least one quencher that is digested by the 5' endonuclease activity of a polymerase used in the reaction in order to detect any amplified target oligonucleotide sequences. In this context, the oligonucleotide probe will have a sufficient number of phosphodiester linkages adjacent to its 5' end so that the 5' to 3' nuclease activity employed can efficiently degrade the bound probe to separate the fluorescers and quenchers. When an oligonucleotide probe is used in the TMA technique, it will be suitably labeled, as described below.

It will be appreciated that the hybridizing sequences need not have perfect complementarity to provide stable hybrids. In many situations, stable hybrids will form where fewer than about 10% of the bases are mismatches, ignoring loops of four or more nucleotides. Accordingly, as used herein the term "complementary" refers to an oligonucleotide that forms a stable duplex with its "complement" under assay conditions, generally where there is about 90% or greater homology. The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick base pairing.

Where a primer "hybridizes" with target (template), such complexes (or hybrids) should be sufficiently stable to serve the priming function required by, e.g., the DNA polymerase to initiate DNA synthesis.

As used herein, the term "binding pair" refers to first and second molecules that specifically bind to each other, such as complementary polynucleotide pairs capable of forming nucleic acid duplexes. "Specific binding" of the first member of the binding pair to the second member of the binding pair in a sample is evidenced by the binding of the first member to the second member, or vice versa, with greater affinity and specificity than to other components in the sample. The binding between the members of the binding pair is typically noncovalent. Unless the context clearly indicates otherwise, the terms "affinity molecule" and "target analyte" are used herein to refer to first and second members of a binding pair, respectively. The terms "specific-binding molecule" and "affinity molecule" are used interchangeably herein and refer to a molecule that will selectively bind, through chemical or physical means to a detectable substance present in a sample. By "selectively bind" is meant that the molecule binds preferentially to the target of interest or binds with greater affinity to the target than to other molecules. For example, a DNA molecule will bind to a substantially complementary sequence and not to unrelated sequences.

The "melting temperature" or "Tm" of double-stranded DNA is defined as the temperature at which half of the helical structure of DNA is lost due to heating or other dissociation of the hydrogen bonding between base pairs, for example, by acid or alkali treatment, or the like. The Tm of a DNA molecule depends on its length and on its base composition. DNA molecules rich in GC base pairs have a higher Tm, than those having an abundance of AT base pairs. Separated complementary strands of DNA

spontaneously reassociate or anneal to form duplex DNA when the temperature is lowered below the Tm. The highest rate of nucleic acid hybridization occurs approximately 25 °C below the Tm. The Tm, may be estimated using the following relationship: Tm, = 69.3 + 0.41 (GC)% (Marmur et al. (1962) J. Mol. Biol. 5: 109- 1 18).

One skilled in the art will recognize that primer(s) that overlap the mismatch nucleotides of the primer(s) described herein by at least one nucleotide, may also include a nucleotide sequence with a sufficient percentage of mismatch between FCGR3A and FCGR3B; thus, the primer(s) may specifically amplify the targeted nucleic acid, i.e., an • fcTfi "lf - - 'A -

r .i.m...p...rf c that mpptc the specifications of the primers described herein, but includes one or two base substitutions where the substituted base mismatches both FCGR3A and FCGR3B to an equal degree, may also specifically amplify the targeted nucleic acid. Accordingly, such a primer(s) is encompassed within the scope of the methods and compositions described herein.

"Amplicon" refers to the product of a PCR reaction, e.g., PCR reaction to amplify a fragment of the FCGR3A gene. In one embodiment, the amplicon is about 755 base pairs. In another embodiment, the amplicon is about 500-1000 base pairs. In another embodiment, the amplicon is less than 755 base pairs, or greater than 755 base pairs.

The terms "polymorphism," "genetic polymorphism," "polymorphic site" and the like refer to an occurrence of variable alleles in the same population, which may result in phenotypic difference among members of that population. For example, the FCGR3A gene contains a 158F/V polymorphic site, and the presence of valine at both chromosomes (V V) results in more efficient IgGI binding and increased NK cell activation compared to the F F genotype. Koene et al. (1997) Blood, 90:1109-14; Wu et al., supra.

A genotyping reaction is a reaction(s) that results in determination of the nucleic acid sequence of each copy of the gene of interest. The term "allele" refers to one version of the DNA at a variable sequence location. A number of genotyping and CNV reactions are known in the art, including but not limited to, e.g., pyrosequencing reaction, DNA sequencing reaction, e.g., Maxam-Gilbert, Sanger; MassARRAY MALDI-TOF; RFLP; allele-specific PCR; real-time allelic discrimination; real time quantitative PCR; microarray, MLPA, MAPH etc. In an embodiment of the methods described herein, the genotyping reaction comprises the RTQ-PCR and/or Sanger sequencing.

As used herein, "DNA sequencing analysis" refers to the steps of nucleic acid manipulation and sequence analysis, e.g., genotyping, pyrosequencing validation, etc., that, as one of the steps, uses a DNA sequencing reaction(s). In one embodiment, the DNA sequencing analysis comprises the steps of: amplifying a target sequence of interest in a PCR reaction with gene-specific primers to generate a target sequence of interest-specific amp!icon; optionally, amplifying the target sequence of interest-specific amplicon in a second round of PCR; and sequencing the PCR product in a DNA sequencing reaction.

Polymerase chain reaction (PCR) is a method for rapid nucleic acid amplification that is well known in the art (see, e.g., U.S. Pat. Nos. 4,683, 195; 4,683,202; and 4,965,188). PCR generally comprises mixing a sample, e.g., a sample comprising a gene of interest, e.g., FCGR3A gene, with PCR components such as DNA polymerase, dNTPs, buffer, and oligonucleotides to form a PCR mixture, and subjecting the PCR mixture to at least one cycle comprising the steps of denaturing, annealing (or hybridizing), and elongating (or extending). One skilled in the art will recognize that the denaturing, annealing, and elongating steps of PCR may be effectuated by altering the temperature of the PCR mixture. One of skill in the art will also recognize that the temperatures, the length of time at such temperatures and the number of PCR cycles that the PCR mixture must be subjected to will differ for different oligonucleotides. Additionally, a skilled artisan will recognize that "hot starts" often begin PCR methods, and that a final incubation at about 68° C or 72° C may optionally be added to the end of any PCR reaction.

As used herein, the terms "label" and "detectable label" refer to a molecule capable of being conveniently or quantifiably detected, including, but not limited to, radioactive isotopes, fluorescers, chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, semiconductor nanocrystals, ligands (e.g., biotin, avidin, strepavidin or haptens) and the like. The term "fluorescer" refers to a substance or a portion thereof that is capable of exhibiting fluorescence in the detectable range.

As used herein, a "solid support" refers to a solid surface such as a magnetic bead, latex bead, microliter plate well, glass plate, nylon, agarose, acrylamide, and the like.

As used herein, a "biological sample" refers to a sample of tissue or fluid isolated from a subject such as, but not limited to^', blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components. The samples detailed above need not necessarily be in the form obtained directly from the source. For example, the sample can be treated prior to use, such as, for example, by heating, centrifuging, etc. prior to analysis.

By "vertebrate subject" is meant any member of the subphylum cordata, including, without limitation, mammals such as horses, and humans, and avian species. The term does not denote a particular age. Thus, adult and newborn animals, as well as fetuses, are intended to be covered.

In one aspect, described herein is a method of genotyping at least one polymorphism in a target nucleic acid sequence of interest. In an exemplary embodiment, the method comprises amplifying a target nucleic acid sequence of interest in a PCR reaction with a pair of target nucleic acid sequence-specific primers (i.e., a "primer pair"), wherein each primer in the primer pair contains a "target-specific" nucleotide at the 3' end, and wherein the primer pair generates an amplicon containing a polymorphic site. The amplicon-specific nucleotide is selectively complementary to the target nucleic acid sequence of interest, which is useful for specific, accurate, and reproducible amplification of target regions of genomic segmental duplication (i.e., duplicons) or high copy number variant (CNV) regions, such as, for example, the FCGR3A region.

Therefore, in another embodiment, the method comprises amplifying an FCGR3A -region in a PCR reaction with a target nucleic acid containing an FCGR3A gene sequence (e.g., nucleic acid isolated from a biological sample, such as a fluid, tissue or cell of an individual) and a primer pair comprising a first primer having a nucleic acid sequence as set forth in SEQ ID NO: 1 , and a second primer having a nucleic acid sequence as set forth in SEQ ID NO: 2, wherein the primer pair is effective in producing an amplicon specific to FCGR3A, e.g., SEQ ID NO:3. (Figures 2 - 5 demonstrate that SEQ ID NOs: 1 and 2 are effective in specifically differentiating FCGR3A from FCGR3B.) The gene-specific amplicon is useful for high-fidelity genotyping of polymorphic sites residing within the target region. For example, the FCGR3A -amplicon produced using SEQ ID NOs: 1 and 2 is useful for accurately and reproducibly performing a genotyping reaction to identify the genotype at the 158F V FCGR3A polymorphic site. In an embodiment, the primer pair consists of SEQ ID NO: 1 and another primer that differs from SEQ ID NO: 2 by 1, 2, 3 or about 1-5 nucleotides. In an embodiment, the primer pair consists of SEQ ID NO: 1 and another primer that differs from SEQ ID NO: 2 by 1 or 2 nucleotides at the 3'-end of SEQ ID NO: 2. In another embodiment, the primer pair comprises the nucleic acid sequence as set forth in SEQ ID NO: 1. In another embodiment, the primer pair comprises the nucleic acid sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 4. In yet another embodiment, the primer pair comprises the nucleic acid sequences as set forth in SEQ ID NO: 1 and SEQ ID NO: 5.

In another aspect, described herein is a primer pair for the specific amplification of a target nucleic acid sequence, designed as described above. In an exemplary embodiment, the primer pair comprises a nucleic acid comprising the nucleic acid sequence as set forth in SEQ ID NOs: l and 2, respectively. As described above, SEQ ID NOs: 1 and 2 are effective in a PCR reaction for amplifying an FCGR3A-speciFic amplicon, which contains at least one polymorphic site. In another aspect, described herein is an isolated nucleic acid consisting essentially of the CGRJA-specific amplicon that results from a PCR reaction comprising SEQ ED NOs: 1 and 2, an FCGR3A gene, and a DNA polymerase. In another embodiment the isolated nucleic acid is 755 base pairs. In another embodiment, the isolated nucleic acid is about 500- 1000 base pairs. En another embodiment, the isolated nucleic acid is less than 755 base pairs or greater than 755 base pairs. In an embodiment of this aspect, the isolated nucleic acid consists essentially of the nucleic acid sequence as set forth in SEQ ID NO:3, including a nucleic acid sequence capable of hybridizing to or complementary to at least a portion of SEQ ED NO:3. En certain embodiments, the nucleic acid sequence capable of hybridizing to SEQ ED NO:3 is from about 6 to 100, 6 to 755, 10 to 500, 15 to 100, 20 to 100, 20 to 500, 20 to 800, 20 to 1000, 25 to 100, 25 to 500, 25 to 800, 25 to 1000, 50 to 100, 50 to 500, 50 to 800, or 50 to 1000 nucleotides in length. In yet another embodiment, the nucleic acid sequence is capable of hybridizing to SEQ ED NO:3 at, for example, a polymorphic site, under embodiments, the polymorphic site is selected from the group consisting of

polymorphisms identified in the NCBI Single Nucleotide Polymorphism database by SNP_ED NOs: 1042223 (SEQ ED NO: 8), 1042222 (SEQ ED NO: 9), 1042220 (SEQ ED NO: 47), 375794 (SEQ ED NO: 10), 445509 (SEQ ED NO: 11 ), 378618 (SEQ ED NO: 12), 448312 (SEQ ED NO: 13), 1042215 (SEQ ED NO: 14), 1042214 (SEQ ED NO: 15), 2499445 (SEQ ED NO: 16), 3181668 (SEQ ED NO: 17), 7539036 (SEQ ID NO: 18), 1042209 (SEQ ED NO: 19), 1 126552 (SEQ ED NO: 20), 1042207 (SEQ ID NO: 21 ), 1042206 (SEQ ED NO: 22), 17853189 (SEQ ED NO: 23), 10919555 (SEQ ID NO: 24), 10800579 (SEQ ID NO: 25), 10800580 (SEQ ED NO: 26), 10800581 (SEQ ED NO: 27), 4657062 (SEQ ED NO: 28), 397429 (SEQ ED NO: 29), 426615 (SEQ ED NO: 30), 10533383 (SEQ ED NO: 31), 10624618 (SEQ ED NO: 32), 36091086 (SEQ ED NO: 33), 449463 (SEQ ED NO: 34), 4657063 (SEQ ED NO: 35), 370077 (SEQ ED NO: 36), 371849 (SEQ ED NO: 37), 424288 (SEQ ED NO: 38), 3835614 (SEQ ED NO: 39), 394678 (SEQ ED NO: 40), 449443 (SEQ ED NO: 41 ), 396716 (SEQ ED NO: 42), 443082 (SEQ ED NO: 43), 5778214 (SEQ ED NO: 44), and 396991 (SEQ ED NO: 45). In an additional embodiment, the polymorphic site is the 158F/V polymorphism (NCBI Single Nucleotide Polymorphism database SNP_ED NO: 396991 (SEQ ED NO: 45)). When hvbridizine a rjolvnuclentide tn a tareet Dolvnucleotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing polynucleotide. When polynucleotides of known sequence are hybridized, the hybrid length can be determined by aligning the sequences of the polynucleotides and identifying the region or regions of optimal sequence complementarity. SSPE (IxSSPE is 0.15M NaCI, 10 mM NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (IxSSC is 0.15M NaCI and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5- 10° C less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm (°C) - 2(# of A + T bases) + 4(# of G + C bases). For hybrids between 18 and 49 base pairs in length, Tm (°C) = 81.5 + 16.6(log_!0Na⁺) + 0.41( G + C) - (600/N), where N is the number of bases in the hybrid, and Na⁺ is the concentration of sodium ions in the conditions for polynucleotide hybridization are provided in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Chs. 9 & 11 , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and Ausubel et al., Eds. (1995) Current Protocols in Molecular Biology, Sects. 2.10 & 6.3-6.4, John Wiley & Sons, Inc., herein incorporated by reference.

In another aspect, provided herein are methods for predicting therapeutic response to a pharmacological agent, for example, an IgG, e.g., IgGl or IgG2. Such methods have been described in U.S. Patent Application Serial No. 10/492, 183 (U.S. Patent No. 7,858,300), the entire contents of which are hereby expressly incorporated herein. In an exemplary embodiment, the method comprises a method for predicting therapeutic response to an IgG pharmacologic agent {e.g., IgGl or IgG2) in an individual comprising isolating a biological sample from an individual, performing a PCR reaction on the biological sample using a primer pair comprising a first primer comprising a nucleic acid sequence as set forth in SEQ ID NO: l, and a second primer comprising a nucleic acid sequence as set forth in SEQ ID NO:2, and detecting the allelic pattern for a polymorphic site of FCGR3A in the individual (i.e., genotyping), wherein the allelic pattern is indicative of the sensitivity of the individual to the IgG pharmacologic agent. In certain embodiments, the polymorphic site is selected from the group consisting of polymorphisms identified in the NCBI Single Nucleotide

Polymorphism database by SNP_ID NOs: 1042223 (SEQ ID NO: 8), 1042222 (SEQ ID NO: 9), 1042220 (SEQ ID NO: 47), 375794 (SEQ ID NO: 10), 445509 (SEQ ED NO: 1 1), 378618 (SEQ ID NO: 12), 448312 (SEQ ID NO: 13), 1042215 (SEQ ID NO: 14), 1042214 (SEQ ED NO: 15), 2499445 (SEQ ED NO: 16), 3181668 (SEQ ID NO: 17), 7539036 (SEQ ED NO: 18), 1042209 (SEQ ID NO: 19), 1 126552 (SEQ ID NO: 20), 1042207 (SEQ ED NO: 21 ), 1042206 (SEQ ID NO: 22), 17853189 (SEQ ED NO: 23), 10919555 (SEQ ID NO: 24), 10800579 (SEQ ID NO: 25), 10800580 (SEQ ID NO: 26), 10800581 (SEQ ED NO: 27), 4657062 (SEQ ID NO: 28), 397429 (SEQ ED NO: 29), 426615 (SEQ ED NO: 30), 10533383 (SEQ ED NO: 31 ), 10624618 (SEQ ID NO: 32), 36091086 (SEQ ED NO: 33), 449463 (SEQ ID NO: 34), 4657063 (SEQ ID NO: 35), 370077 (SEQ ED NO: 36), 371849 (SEQ ID NO: 37), 424288 (SEQ ID NO: 38), 3835614 (SEQ ED NO: 39), 394678 (SEQ ED NO: 40), 449443 (SEQ ED NO: 41), 396716 (SEQ ED NO: 42), 443082 (SEQ ID NO: 43), 5778214 (SEQ ID NO: 44), and

Nucleotide Polymo hism database SNP_ED NO: 396991 (SEQ ED NO: 45). Each of the foregoing sequences are expressly incorporated herein by reference.

In an embodiment of this aspect, the IgG pharmacologic agent is an

immunotherapeutic or an anti-cancer therapeutic or both. For example, the methods encompass anti-cancer therapeutics such as, for example, a treatment for at least one of B-cell lymphoma, breast cancer, ovarian cancer, cervical cancer, prostate cancer, colon cancer, melanoma, renal cell carcinoma, acute myeloid leukemia, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, autoimmune anemias, red · cell aplasia, thrombocytopenic purpura, Evan's syndrome, vasculitis, skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, chronic fatigue syndrome, rheumatoid arthritis, osteoarthritis, Inflammatory Bowel Disease, Crohn's disease, chronic inflammation, pain, Alzheimer's Disease.

In any of the embodiments described herein, the genotyping reaction can be, for example, a pyrosequencing reaction, DNA sequencing reaction, assAR AY MALDI- TOF, RFLP, allele-specific PCR, real-time allelic discrimination, or microarray.

In an additional aspect, described herein are methods of assessing whether a subject has, or is at risk for, a polymorphic disease comprising detecting at least one polymorphism according to the methods described herein, in an exemplary

embodiment, a method is provided for genotyping FCGR3A 158F/V polymorphism, which has been implicated in a variety of immunological and cancerous conditions. The method comprising amplifying a specific FCGR3A -amplicon in a PCR reaction with a primer pair comprising a first primer comprising a nucleic sequence as set forth in SEQ ID NO: 1 , and a second primer comprising a nucleic acid sequence as set forth in SEQ ID NO:2, wherein the PCR reaction amplifies an CG^iA-specific amplicon containing the 158F/V polymorphic site; and performing a genotyping reaction to identify a nucleic acid at the 158F V polymorphic site on each allele.

In certain embodiments described herein, genotyping is performed using a DNA sequencing reaction, e.g., the dideoxy chain termination DNA sequencing method developed by Fred Sanger or derivative thereof, which has been subsequently largely automated. A DNA sequencing reaction can be used as a step in DNA sequencing analysis, wherein the DNA sequencing analysis is used for validation of the accuracy of another genotyping technique, e.g., pyrosequencing analysis or any other genotyping method. For example, to confirm genotypes determined using FCGR3A 158F/V pyrosequencing analysis, PCR amplification can be performed to amplify a region of FCGR3A gene encompassing the 158F V polymorphic site for the purpose of DNA sequencing analysis. One skilled in the art will recognize that, if DNA sequencing analysis is used for pyrosequencing method validation, different sets of primers are used in DNA sequencing and pyrosequencing analyses. The use of different PCR strategies is useful since concordant genotyping results provide an additional level of confidence that the sequencing method is specific for the intended target.

A variety of compositions and methods are provided herein for determining the genotype of a subject, for example, for the FCGR3A 158F/V polymorphism. In particular, oligonucleotides (e.g., primers) are described that can be used to determine a subject's genotype at the 158F V site of FCGR3A (gene A), as well as the subject's CNV status for FCGR3A (gene A). The accuracy of the assays described herein derived, in part, from the fact that the compositions and methods described herein are able to clearly distinguish between gene A and gene B. Although both gene A and gene B map to chromosome t , the present disclosure establishes that gene B does not include the polymorphism corresponding to the 158F/V polymorphism of gene A, but rather the sequence at the corresponding position in gene B is V/V homozygous. Also described are methods for FCGR3A genotyping involving use of one or more of the

oligonucleotides described herein. FCGR3A genotype at the 158F/V site may be determined by a single PCR reaction (e.g., one set of primers); by evaluating multiple PCR reactions (e.g., different combinations of primers); and/or by single or multiple PCR reactions followed by sequencing or other nucleic acid based assay technique. Using the compositions and methods described herein, a particular individual can readily be genotyped, for example to better determine a treatment protocol. Thus,

pharmacogenetic analyses of any subject can be readily performed.

Described herein are nucleotide sequences that are useful in determining the FCGR3A haplotype of an individual. Furthermore, the primer sequences described herein have been used to accurately distinguish between FCGR3A (gene A) and FCGR3B (gene B). For convenience, the numbering and alignment of primers recognizing coding sequences (cDNA) of both genes A and B is done relative to Ravetch and Perussia (1989) J. Exp Med 170:481 and NCBI Accession No.

NM_000569.

The sequences described herein are generally useful as primers or as parts of primers, for example PCR primers and/or sequencing primers. The oligonucleotides will also amplify sequences that include one or more additional polymorphisms, for example as depicted in Table 3. Non-limiting examples of such sequences are shown in Table 3.

Therefore, the oligonucleotides described herein include one or more nucleotides defining polymorphisms (e.g., 158F/V polymorphism) and/or nucleotides that distinguish gene A from gene B. The primers used amplify a sequence including at least the 158F V polymorphism. In certain embodiments, the primers used amplify a sequence including multiple polymorphisms. For example, but not necessarily limited to, polymorphisms at nucleotide position 121 (G/A), 153 (T/C), 179 (C/T), 207 (G/T), and 313 (C/ A), as numbered relative to the first base in exon 4. The first four positions correspond to nucleotide positions 473 (G/A), 505 (T/C), 531 (C/T) and 559 (G/T), as numbered relative to NM_000569.

The present disclosure marks the surprising and unexpected discovery that a difference of a single nucleotide can result in an oligonucleotide that is highly specific for gene A or gene B. Thus, in certain embodiments, the primer will include this residue and, accordingly, be specific for gene A or gene B. In certain embodiments, the distinguishing base (e.g., polymorphism and/or gene A- or B-specific base) is the terminal base of the oligonucleotide (primer) sequence. For example, as depicted in Table 3, the 3' nucleotide in SEQ ID NO: 1 and SEQ ID NO:2 are specific only for FCGR3A. The introduction of a 3' nucleotide that matches gene A and mismatches gene B provides specificity for gene A. In an embodiment, mismatches are at the 3' end of the primer.

As explained above, the regions from which the oligonucleotides are derived generally include one or more polymorphisms. In addition, the oligonucleotides can be derivatized using methods well known in the art in order to improve the affinity of binding to the target nucleic acid. The particular length of the oligonucleotide primer is not critical and can be readily designed by those of skill in the art. The oligonucleotides can include from about 5 to about 500 nucleotides of the particular conserved region, about 10 to about 100 nucleotides, or about 10 to about 60 nucleotides, or any integer within these ranges, such as a sequence including 18, 19, 20, 21, 22, 23, 24, 25, 26...35...40, etc. nucleotides from the conserved region of interest. In an embodiment, the primer sequences are at least 10 nucleotides in length or about 15 and 30 nucleotides in length (including nucleotides of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length). Furthermore, the longer the primer hybridization region, the more tolerant the primer would be of having mismatches from the target and still work, especially at the more 5' end of the oligonucleotide. Therefore, other embodiments may also contain such mismatches (mismatching both FCGR3A and FCGR3B).

Oligonucleotides as described herein (e.g., primers and probes) are readily synthesized by standard techniques, e.g., solid phase synthesis via phosphoramidite chemistry, as disclosed in U.S. Patent Nos. 4,458,066 and 4,415,732, incorporated herein by reference in their entireties; Beaucage et al. (1992) Tetrahedron 48:2223- 2311; and Applied Biosystems User Bulletin No. 13 (1 April 1987). Other chemical synthesis methods include, for example, the phosphotriester method described by Narang et al., Meth. Enzymol. (1979) 68:90 and the phosphodiester method disclosed by Brown et al., Meth. Enzymol. (1979) 68: 109. Poly A or poly C, or other non- complementary nucleotide extensions may be incorporated into probes using these same methods. Hexaethylene oxide extensions may be coupled to probes by methods known in the art. Cload et al. (1991) J. Am. Chem. Soc. 113:6324-6326; U.S. Patent No. 4,914,210 to Levenson et al.; Durand et al. (1990) Nucleic Acids Res. .18:6353- 6359; and Horn et al. (1986) Tet. Lett. 27:4705-4708.

Moreover, the oligonucleotides may be coupled to labels for detection. There are several means known for denvatizing oligonucleotides with reactive functionalities that permit the addition of a label. For example, several approaches are available for biotinylating probes so that radioactive, fluorescent, chemiluminescent, enzymatic, or electron dense labels can be attached via avidin. See, e.g., Broken et al., Nucl. Acids Res. (1978) 5:363-384 that discloses the use of ferritin-avidin-biotin labels; and Chollet et al. Nucl. Acids Res. (1985) .13: 1529-1541 which discloses biotinylatidn of the 5' termini of oligonucleotides via an aminoalkylphosphoramide linker arm. Several methods are also available for synthesizing amino-derivatized oligonucleotides which are readily labeled by fluorescent or other types of compounds derivatized by amino- reactive groups, such as isothiocyanate, N-hydroxysuccinimide, or the like, see, e.g., Connolly (1987) Nucl. Acids Res. 15:3131-3139, Gibson et al. (1987) Nucl. Acids Res. 15:6455-6467 and U.S. Patent No. 4,605,735 to Miyoshi et al. Methods are also available for synthesizing sulfhydryl-derivatized oligonucleotides that can be reacted with thiol-specific labels, see, e.g., U.S. Patent No. 4,757,141 to Fung et al., Connolly et al. (1985) Nucl. Acids Res. 11 :4485-4502 and Spoat et al. (1987) Nucl. Acids Res. j_5:4837-4848.

A comprehensive review of methodologies for labeling DNA fragments is provided in Matthews et al., Anal. Biochem. (1988) 169: 1-25. For example, oligonucleotides may be fluorescently labeled by linking a fluorescent molecule to the non-ligating terminus of the probe. Guidance for selecting appropriate fluorescent labels can be found in Smith et al., Meth. Enzymol. (1987) 155:260-301 ; Karger et al., Nucl. Acids Res. (1991) 19:4955-4962; Haugland (1989) Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, OR). Non-limiting examples of fluorescent labels include fluorescein and derivatives thereof, such as disclosed in U.S.Patent No. 4,318,846 and Lee et al., Cytometry (1989) 10: 151-164, and 6-FAM, JOE, TAMRA, ROX, HEX-I, HEX-2, ZOE, TET-I or NAN-2, and the like. Additionally, oligonucleotides can be labeled with an acridinium ester (AE) using the techniques described below. Current technologies allow the AE label to be placed at any location within the probe. See, e.g., Nelson et al. (1995) "Detection of Acridinium Esters by Chemiluminescence" in Nonisotopic Probing, Blotting and Sequencing, ricka U. (ed) Academic Press. San Diego, CA; Nelson et al. (1994) "Application of the Hybridization Protection Assay (HP A) to PCR" in The Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, MA; Weeks et al., Clin. Chem. (1983) 29: 1474-1479; Berry et al., Clin. Chem. (1988) 34:2087-2090. An AE molecule can be directly attached to the probe using non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5, 185,439.

One or more of the oligonoucleotides described herein are then used in one or more nucleic acid based assays in order to determine FCGR3A genotype, for example FCGR3A genotype at the 158F V polymorphism. Genotyping can be performed on any suitable sample. For instance, nucleic acids can be readily isolated from cells expressing FcyRIH using by standard techniques such as guanidium thiocyanate-phenol-chloroform extraction (Chomocyznski et al. (1987) Anal. Biochem. 162: 156). RNA and/or genomic DNA can be isolated. The isolated nucleic acids (RNA or DNA) are then subjected to amplification. Amplifying a target nucleic acid typically uses a nucleic acid polymerase to produce multiple copies of the target nucleic acid or fragments thereof. Suitable amplification techniques are well known in the art, such as, for example transcription mediated amplification, polymerase chain reaction (PCR), replicase mediated amplification, and ligase chain reaction (LCR). A. Polymerase Chain Reaction (PCR). In certain embodiments, the amplification process comprises a polymerase chain reaction (PCR)-based technique, such as RT-PCR, to determine the FCGR3A genotype in any biological sample. PCR is a technique for amplifying a desired target nucleic acid sequence contained in a nucleic acid molecule or mixture of molecules. In PCR, a pair of primers is employed in excess to hybridize to the complementary strands of the target nucleic acid. The primers are each extended by a polymerase using the target nucleic acid as a template. The extension products become target sequences themselves after dissociation from the original target strand. New primers are then hybridized and extended by a polymerase, and the cycle is repeated to geometrically increase the number of target sequence molecules. The PCR method for amplifying target nucleic acid sequences in a sample is well known in the art and has been described in, e.g., Innis et al. (eds.) PCR Protocols (Academic Press, NY 1990); Taylor (1991) Polymerase chain reaction: basic principles and automation, in PCR: A Practical Approach, McPherson et al. (eds.) IRL Press, Oxford; Saiki et al. (1986) Nature 324: 163; as well as in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,889,818, all incorporated herein by reference in their entireties.

In particular, PCR uses relatively short oligonucleotide primers that flank the target nucleotide sequence to be amplified, oriented such that their 3' ends face each other, each primer extending toward the other. The polynucleotide sample is extracted and denatured, for example by heat, and hybridized with first and second primers that are present in molar excess. Polymerization is catalyzed in the presence of the four deoxyribonucleotide triphosphates (dNTPs - dATP, dGTP, dCTP and dTTP) using a primer- and template-dependent polynucleotide polymerizing agent, such as any enzyme capable of producing primer extension products, for example, E. coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA polymerase, thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis ("Vent" polymerase, New England Biolabs). This method results in two "long products" which contain the respective primers at their 5' ends covalently linked to the newly synthesized complements of the original strands. The reaction mixture is then returned to polymerizing conditions, e.g., by lowering the temperature, inactivating a denaturing agent, or adding more polymerase, and a second cycle is initiated. The second cycle provides the two original strands, the two long products from the first cycle, two new long products replicated from the original strands, and two "short products" replicated from the long products. The short products have the sequence of the target sequence with a primer at each end. On each additional cycle, an additional two long products are produced, and a number of short products equal to the number of long and short products remaining at the end of the previous cycle. Thus, the number of short products containing the target sequence grows exponentially with each cycle. PCR is commonly carried out with a commercially available thermal cycler, e.g., Perkin Elmer. RNAs may be amplified by reverse transcribing the mRNA into cDNA, and then performing PCR (RT-PCR), as described above. Alternatively, a single enzyme may be used for both steps as described in U.S. Patent No. 5,322,770. mRNA may also be reverse transcribed into cDNA, followed by asymmetric gap ligase chain reaction (RT-AGLCR) as described by Marshall et al. (1994) PCR Meth. App. 4:80- 84. Particular PCR conditions (e.g., temperature, cycling time, etc.) are not critical to the practice of disclosure herein can be readily determined by one skilled in the art. In certain embodiments, genotyping accuracy is achieved by a single PCR reaction, through the judicious design and selection of primers. For instance, the sequences resulting from PCR amplification using primers that amplify sequences including the polymorphism at position 559 and the gene specific polymorphism at position 313 (numbered relative to the first base of exon 4) typically provides sufficient information for determining 158F/V haplotype and for distinguishing gene A from gene B. For PCR-based techniques, in certain instances primers that include multiple polymorphisms can be used. The inclusion of multiple polymorphisms provides built-in internal controls. The primers selected may amplify gene A or gene B only, or alternatively, may amplify sequences from both genes.

Representative examples of a single pair of primer combinations that can be used are shown in Table 3 (SEQ ID NOs: 1-2).

Furthermore, although amplification of DNA samples obtained from the subject using one suitable pair of primers disclosed in Table 3 may itself be sufficient to determine genotype, the present disclosure also provides for additional assays that enhance genotyping accuracy, including additional PCR and/or sequencing. For instance, in certain embodiments, PCR amplification is performed using multiple combinations of primers and the resulting pattern of amplified bands obtained from each combination is evaluated to accurately determine the genotype of the subject.

Using primer pairs where one primer is gene A-specific, gene B-specific or generic to gene A and B and the other primer is 158V- or 158F-specific allows for efficient and accurate genotyping at this important site.

In still other embodiments, genotyping as described herein further comprises sequencing the products of PCR amplification. Any of the primers disclosed herein can be used as sequencing primers. In one embodiment, sequencing primers are those that bind at a polymorphism and when bound, allow sequencing of portion of the gene corresponding to polymorphism 158F V. Direct sequencing may be accomplished by chemical sequencing, for example, using the Maxam-Gilbert method, or by enzymatic sequencing, for example, using the Sanger method. In the latter case, specific oligonucleotides are synthesized using standard methods and used as primers for the dideoxynucleotide sequencing reaction. See, e.g., Sambrook, supra. TaqMan™. The fluorogenic 5' nuclease assay, known as the TaqMan™ assay (see, e.g., Holland et al., Proc. Natl. Acad.Sci. USA (1991) 88:7276-7280), is a powerful and versatile PCR-based detection system for nucleic acid targets. Hence, primers and probes described herein can also be used in TaqMan™ analyses to determine a subject's FCGR3A genotype and detect presence of suspected CNV. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals. The assay system dispenses with the need for gel electrophoretic analysis, and has the capability to generate quantitative data allowing the determination of target copy numbers. For example, standard curves can be produced using serial dilutions of previously analyzed samples. A standard graph can be produced with copy numbers of each of the panel members against which sample unknowns can be compared. The fluorogenic 5' nuclease assay is conveniently performed using, for example, AmpliTaq Gold™ DNA polymerase, which has endogenous 5' nuclease activity, to digest an internal oligonucleotide probe labeled with both a fluorescent reporter dye and a nnmrhpr Ccpp Hnll anH pt al Prr>r Matl T T¾ Δ Π QQ Π 88 -7 7ft.T98n · OTH I go et al., Nucl. Acids Res. ( 1993) 21 :3761-3766). Assay results are detected by measuring changes in fluorescence that occur during the amplification cycle as the fluorescent probe is digested, uncoupling the dye and quencher labels and causing an increase in the fluorescent signal that is proportional to the amplification of target nucleic acid. The amplification products can be detected in solution or using solid supports. In this method, the TaqMan™ probe is designed to hybridize to a target sequence within the desired PCR product. The 5' end of the TaqMan™ probe contains a fluorescent reporter dye. The 3' end of the probe is blocked to prevent probe extension and contains a dye that will quench the fluorescence of the 5' fluorophore. During subsequent amplification, the 5' fluorescent label is cleaved off if a polymerase with 5' exonuclease activity is present in the reaction. Excision of the 5' fluorophore results in an increase in fluorescence that can be detected. For a detailed description of the TaqMan™ assay, reagents and conditions for use therein, see, e.g., Holland et al., Proc. Natl. Acad. Sci, U.S.A. (1991) 88:7276- 7280; U.S. Patent Nos. 5,538,848, 5,723,591 , and 5,876,930, all incorporated herein by reference in their entireties.

The sequences described herein may also be used as a basis for transcription- mediated amplification (TMA) assays. TMA provides a method of identifying target nucleic acid sequences present in very small amounts in a biological sample. Such sequences may be difficult or impossible to detect using direct assay methods. In particular, TMA is an isothermal, autocatalytic nucleic acid target amplification system that can provide more than a billion RNA copies of a target sequence. The assay can be done qualitatively, to accurately detect the presence or absence of the target sequence in a biological sample. The assay can also provide a quantitative measure of the amount of target sequence over a concentration range of several orders of magnitude. TMA provides a method for autocatalytically synthesizing multiple copies of a target nucleic acid sequence without repetitive manipulation of reaction conditions such as temperature, ionic strength and pH. Generally, TMA includes the following steps: (a) isolating nucleic acid, including RNA, from the biological sample of interest to be haplotyped; and (b) combining into a reaction mixture (i) the isolated nucleic acid, (ii) first and second oligonucleotide primers, the first primer having a complexing sequence sufficiently complementary to the 3' terminal portion of an RNA target sequence, if present (for example the (+) strand), to complex therewith, and the second primer having mnlpv i ri cpmi^n p 111 i r- i r»n f 1 \; pnmnlpmpntani tr» thf» 'V ti»rminsil rjrirt i nf thp target sequence of its complement (for example, the (-) strand) to complex therewith, wherein the first oligonucleotide further comprises a sequence 5' to the complexing sequence which includes a promoter, (iii) a reverse transcriptase or RNA and DNA dependent DNA polymerases, (iv) an enzyme activity which selectively degrades the RNA strand of an RNA-DNA complex (such as an RNAse H) and (v) an RNA polymerase which recognizes the promoter. The components of the reaction mixture may be combined stepwise or at once. The reaction mixture is incubated under conditions whereby an oligonucleotide/target sequence is formed, including DNA priming and nucleic acid synthesizing conditions (including ribonucleotide triphosphates and deoxyribonucleotide triphosphates) for a period of time sufficient to provide multiple copies of the target sequence. The reaction advantageously takes place under conditions suitable for maintaining the stability of reaction components such as the component enzymes and without requiring modification or manipulation of reaction conditions during the course of the amplification reaction. Accordingly, the reaction may take place under conditions that are substantially isothermal and include substantially constant ionic strength and pH. The reaction conveniently does not require a denaturation step to separate the RNA-DNA complex produced by the first DNA extension reaction. Suitable DNA polymerases include reverse transcriptases, such as avian myeloblastosis virus (AMV) reverse transcriptase (available from, e.g., Seikagaku America, Inc.) and Moloney murine leukemia virus (MMLV) reverse transcriptase (available from, e.g., Bethesda Research Laboratories). Promoters or promoter sequences suitable for incorporation in the primers are nucleic acid sequences (either naturally occurring, produced synthetically or a product of a restriction digest) that are specifically recognized by an RNA polymerase that recognizes and binds to that sequence and initiates the process of transcription whereby RNA transcripts are produced. The sequence may optionally include nucleotide bases extending beyond the actual recognition site for the RNA polymerase that may impart added stability or susceptibility to degradation processes or increased transcription efficiency. Examples of useful promoters include those that are recognized by certain bacteriophage polymerases such as those from bacteriophage T3, T7 or SP6, or a promoter from E. coli. These RNA polymerases are readily available from commercial sources, such as New England Biolabs and Epicentre. Some of the reverse transcriptases suitable for use in the methods to add exogenous RNAse H, such as E. coli RNAse H, even when AMV reverse transcriptase is used. RNAse H is readily available from, e.g., Bethesda Research Laboratories. The RNA transcripts produced by these methods may serve as templates to produce additional copies of the target sequence through the above-described mechanisms. The system is autocatalytic and amplification occurs autocatalytically without the need for repeatedly modifying or changing reaction conditions such as temperature, pH, ionic strength or the like.

Detection may be done using a wide variety of methods, including direct sequencing, hybridization with sequence-specific oligomers, gel electrophoresis and mass spectrometry. These methods can use heterogeneous or homogeneous formats, isotopic or nonisotopic labels, as well as no labels at all. TMA is described in detail in, e.g., U.S. Patent No. 5,399,491, the disclosure of which is incorporated herein by reference in its entirety. In one example of a typical assay, an isolated nucleic acid sample from a subject to be genotyped, is mixed with a buffer concentrate containing the buffer, salts, magnesium, nucleotide triphosphates, primers, dithiothreitol, and spermidine. The reaction is optionally incubated at about 100° C for approximately two minutes to denature any secondary structure. After cooling to room temperature, reverse transcriptase, RNA polymerase, and RNase H are added and the mixture is incubated for two to four hours at 37° C. The reaction can then be assayed by denaturing the product, adding a probe solution, incubating 20 minutes at 60° C, adding a solution to selectively hydrolyze the unhybridized probe, incubating the reaction six minutes at 60° C, and measuring the remaining chemiluminescence in a luminometer. As noted above, two or more of the tests described above may be performed to confirm the genotype. For example, if the first test used the transcription mediated amplification (TMA) to amplify the nucleic acids for detection, then an alternative nucleic acid testing (NAT) assay is performed, for example, by using PCR amplification, RT PCR, and the like, as described herein. Thus, any sample from any patient can be specifically and selectively haplotyped. As is readily apparent, design of the assays described herein is subject to a great deal of variation, and many formats are known in the art. The above descriptions are merely provided as guidance and one of skill in the art can readily modify the described protocols, using techniques well known in the art.

The above-described assay reagents, including the primers, PCR buffers, sequencing reagents, etc., can be provided in kits, with suitable instructions and other necessary reagents, in order to conduct the assays as described above. The kit will normally contain in separate containers the combination of primers and probes (either already bound to a solid matrix or separate with reagents for binding them to the matrix), control formulations (positive and/or negative), labeled reagents when the assay format requires some and signal generating reagents (e.g., enzyme substrate) if the label does not generate a signal directly. Instructions (e.g., written, tape, VCR, CD-ROM, etc.) for carrying out the assay usually will be included in the kit. The kit can also contain, depending on the particular assay used, other packaged reagents and materials (i.e. wash buffers and the like). Standard assays, such as those described above, can be conducted using these kits.

As noted above, the present disclosure is based on compositions and assays for accurately determining the FcyRIH genotypes of a vertebrate subject (e.g., a human subject), particularly the genotype at the 158F/V site in FCGR3A. The ability to accurately determine FcyRIII genotype has many applications, including but not limited to, pharmacogenetics. Pharmacogenetics refers to the determination of a particular individual's genotype in order to determine a suitable treatment protocol. As noted above, subjects with the 158F F genotype, and in certain cases the 158F/V genotype, respond less well to antibody treatments (e.g., rituximab) than subjects with a 158V/V genotype. Furthermore, it has been demonstrated that response to antibody-mediated therapies such as rituximab can be enhanced by pre-treatment with cytokines (e.g., EL- 2). Thus, using the compositions and methods described herein individuals in need of treatment for an immune disorder and can be efficiently and accurately genotyped and, accordingly, designated as suitable candidates for intervention with one or more immunotherapeutics that mediate the FCG/?.¾ -triggered ADCC pathway (e.g., EL-2).

In certain applications, genotyping is performed on an individual suffering from an immune disorder, particularly a cancer, in order to determine the suitability of adjunct therapies (e.g., IL-2 immunotherapy alone) to be used in combination with an anticancer monoclonal antibody. Examples of cancers in which genotyping as described herein may aid in designing treatment protocols include, but are not limited to, B-cell lymphomas listed below, breast cancer, ovarian cancer, cervical cancer, prostate cancer, colon cancers, melanoma, renal cell carcinoma, acute myeloid leukemia (AML); and chronic lymphocytic leukemia (CLL).

One skilled in the art will recognize that the method of the present disclosure can generate genotyping data about several other potentially clinically relevant

polymorphisms, e.g., polymorphisms set forth in the NCBI Single Nucleotide

Polymorphism database (dbSNP Build 127) as SNP_IDS NOs: 1042223 (SEQ ID NO:

8 1 ΊΊΊΊ i?RO ΓΓ» M - Q\ 1 (\ΛΊΊΊ(Λ CQFn ΤΓ> ΝΠ· ΛΊ\ ΊΊ^ΊΟΛ fCT-TO ΤΠ ΜΠ· 1 Γ\

445509 (SEQ ID NO: 1 1), 378618 (SEQ ID NO: 12), 448312 (SEQ ID NO: 13), 1042215 (SEQ ID NO: 14), 1042214 (SEQ ID NO: 15), 2499445 (SEQ ID NO: 16), 3181668 (SEQ ED NO: 17), 7539036 (SEQ ID NO: 18), 1042209 (SEQ ID NO: 19), 1 126552 (SEQ ID NO: 20), 1042207 (SEQ ED NO: 21), 1042206 (SEQ ED NO: 22), 17853189 (SEQ ED NO: 23), 10919555 (SEQ ED NO: 24), 10800579 (SEQ ED NO: 25), 10800580 (SEQ ED NO: 26), 10800581 (SEQ ED NO: 27), 4657062 (SEQ ED NO: 28), 397429 (SEQ ED NO: 29), 426615 (SEQ ED NO: 30), 10533383 (SEQ ED NO: 31), 10624618 (SEQ ED NO: 32), 36091086 (SEQ ED NO: 33), 449463 (SEQ ED NO: 34), 4657063 (SEQ ED NO: 35), 370077 (SEQ ED NO: 36), 371849 (SEQ ID NO: 37), 424288 (SEQ ED NO: 38), 3835614 (SEQ ED NO: 39), 394678 (SEQ ID NO: 40), 449443 (SEQ ID NO: 41 ), 396716 (SEQ ED NO: 42), 443082 (SEQ ID NO: 43), 5778214 (SEQ ED NO: 44), and 396991 (SEQ ID NO: 45), etc. One skilled in the art will also recognize that the methods described herein may be used to generate genotyping data for any gene of interest where a gene with similar but slightly different nucleotide sequence exists in the same genome. Thus, the methods may be used to determine whether a polymorphism is associated with, e.g., a disease condition or abnormality. The methods can also be used to assess whether a subject is at risk for, or is afflicted with, a polymorphic disease, i.e., a disease associated with specific genotypes of a polymorphism, e.g., a disease associated with at least one amino acid change. The methods can also be used, e.g., to determine the course of disease progression, to predict drug efficacy, to design individualized therapy, etc.

It is understood that the detailed examples and embodiments described herein are given by way of example for illustrative purposes only, and are in no way considered to be limiting to the disclosure. Various modifications or changes in light thereof will be suggested to persons skilled in the art and are included within the spirit and purview of this application and are considered within the scope of the appended claims. For example, the relative quantities of the ingredients may be varied to optimize the desired effects, additional ingredients may be added, and/or similar ingredients may be substituted for one or more of the ingredients described. Additional advantageous features and functionalities associated with the systems, methods, and processes of the present disclosure will be apparent from the appended claims.

The entire contents of all references, patents, and patent applications cited throughout this application are hereby incorporated by reference herein. It should further be understood that the entire contents of each of U.S. Patent Application Serial No. 10/492, 183 (U.S. Patent No. 7,858,300), U.S. Patent Application Serial No, 12/958,887 and U.S. Patent Application Serial No. 1 1/629,808 are expressly incorporated herein by reference.

The Examples which follow are set forth to aid in the understanding of the various embodiments but are not intended to, and should not be construed to, limit its scope in any way. The Examples do not include detailed descriptions of conventional methods, e.g., PCR steps, PCR reagents, etc. Such methods are well known to those of ordinary skill in the art. EXAMPLES

Example 1: Primer Design

To overcome the FCGR3A assay design challenges outlined above, and to enhance genotyping accuracy for SNPs within the amplified region, nucleotides that match the sequence of FCGR3A exactly while mismatching the sequence of FCGR3B ( i.e., mismatches found via alignment of FCGR3A & FCGR3B with NCBI BlastN) at the 3' end of primers were incorporated into primer design strategies. The sequences of the following primers have proven to be capable of the specific and reproducible amplification of only FCGR3A in the intended target region

(chrl : 161514413+161515167).

The unique specificity of these primer designs provides the capability to make accurate genotype calls and identify false heterozygotes with suspected CNVs within the amplified target region; the presence of CNV can then be verified by other methods. These primers were designed specifically to genotype NCBI SNP ID 396991 (SEQ ID NO: 45) for the PGxPredict: RITUXIM AB test, but the utility is extended to any polymorphism or mutation located within the described target region.

TABLE 3. Exemplary Primers Designed According to the Methods disclosed herein, and Cognate FCGR3A Amplicon.

agcagfcgfctcttccagctgtgacacctcaggfcgaatagggtct tcctcct

tgaacacccaccgaggggcctggagcaacagccagcctgaaagacacaga caccccaggcccgggaggcctcagctctcagtgcagagctttgtgaaggg gccacgtaccacccagatcctgagacataagggaaagccagattgggagt caaccctgcatagctccctttggggaagagctgatggggccctgcaagag aactgaagtcataccaagacctttgtctaatggggaagagggacacacac acatgtgatcaacacacagggttagagcagagggactaagcaatgaggta agtgagaagcaacgatgagcatatctgcaggatccttaagtgctagactt agatttgctgtggcaggtgacaaggattcacagtaagttctagatcagag taaaaattgcatttgaaaatgatgaATTGCCCTATTAGAGGAAAAGGTAG ATTTC

SEQ ID NO:l and 2: Bold/Underlined nucleotides indicate 3' nucleotide mismatches from FCGR3B that allow specific recognition of FCGR3A. SEQ ID NO:3: Italicized/Underlined portion indicates Exon 4 of FCGR3A,

which contains the G/T single nucleotide polymorphism. Capitalized

portions indicate binding sites for forward and reverse primers.

Example 2: In Silico Determination of Alternate Primer Designs

In order to determine the degree of flexibility in the primer designs, in silico analysis based on PCR failure factors described by Qu, W et al [Bioinformatics (2009)

25(2):276-278] and Andreson, R et al [Nucleic Acids Res (2008) 36:e66] was carried out. Data on PCR failure factors were collected from the UCSC In-Silico PCR database

(http://www.genome.ucsc.edu/cgi- bin/hgPcr?org=Human&db=hgl 9&hgsid= 172089781 ) and the BMI MFEprimer analysis is shown in Table 4.

Results revealed that deletion of the 3 '-most target-specific nucleotides by removal of one (Seq ID NO: 4) or two (Seq ID NO: 5) nucleotides from the 3'-end of the reverse primer, is not predicted to result in PCR failure when the resulting primer is used together with the forward primer described herein (SEQ ID NO: 1). These results

demonstrate that the presence of at least one (or two) target-specific nucleotides at the 3' end of the reverse primer is sufficient for accurate PCR amplification of the FCGR3A region that contains the 158F V polymorphism, without co-amplification of FCGR3B.

TABLE 4. Alternate Primer Designs Identified by MFE primer.

Seq # Size

ID Sequence % Δ PPC 3' Predicted

No. Change (bp)

Primer Sequence Tm GC Tm (%) AG PCR Products

Forward Primer 60.9

1 None CCCAACTCAACTTCCCAGTGTGAT Pass 50 1.1 Pass Pass 1 755

Reverse Primer 59.8

2 None G AAATCTACCTTTTCCTCTAATAG GGCAAT Pass 36.7

Forward Primer 60.9

1 CCCAACTCAACTTCCCAGTGTGAT Pass 50 1.2 Pass Pass 1 755

Reverse Primer 59.7

4 3' (-1 nt) GAAATCTAC 1 1 1 1 CCTCTAATAG G G CAA Pass 37.9

Forward Primer 60.9

1 CCCAACTCAACTTCCCAGTGTGAT Pass 50 1.3 Pass Pass 1 755

Reverse Primer 59.6

5 3' (-2 nt) GAAATCTACC 1 1 1 1 CCTCTAATAGGGCA Pass 39.3

BoldAJnderlined nucleotides indicate 3' nucleotide mismatches between FCGR3B and FCGR3A that allow specific recognition of FCGR3A .

Example 3: TaqMan™ genotyping and detection of copy number variation (CNV).

In TaqMan allelic discrimination plots, the presence of diffuse, poorly defined clusters is indicative of co-amplification of FCGR3B. As shown in Figure 1, the

commercially available TaqMan SNP genotyping by allelic discrimination assay for the

FCGR3A rs396991 polymorphism (Applied Biosystems (a division of Life

FCGR3A and the highly homologous FCGR3B gene. In this assay, co-amplification of

FCGR3B led to the appearance of a large "undetermined" cluster (Figure 1 ). This

"undetermined" cluster is populated by both FCGR3A T T and G/T samples, which are shifted in the plot because co-amplification of the FCGR3B "G" allele diminishes the contribution of the FCGR3A "T" allele. In contrast, Figure 2 shows the results of a

TaqMan allelic discrimination assay using the forward (SEQ ID NO 1) and reverse

(SEQ ED NO 2) described in Example 1. This assay accurately distinguishes between

FCGR3A and FCGR3B, as illustrated by the appearance of tight, clearly delineated

clusters in the allelic discrimination plot (Figure 2).

A further challenge in successfully genotyping FCGR3A 158F V is the presence of

CNV. Importantly, CNV can affect the genotype interpretation, since high copy number samples may cluster with heterozygotes, while samples with low copy number

(hemizygotes) and samples with homozygous CNV will be hidden among the

homozygotes. In an allelic discrimination plot, the presence of CNV is suspected for samoles that fall outside of the clusters: if the clusters are not clearlv delineated. samDles with CNV will not necessarily be distinguished from samples lacking CNV (Figure 1). In Figure 2, discordant samples are easily distinguished and properly called as

"undetermined"; the presence of heterozygous CNV in these samples was subsequently confirmed with a specific CNV assay (ABI Taqman Copy Number assay; assay ID: Hs00139300_cn) (Figure 5).

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A primer pair for the specific amplification of a region within an FCGR3A gene comprising;

a first primer comprising the nucleic acid sequence of SEQ ID NO: l; and a second primer comprising the nucleic acid sequence of SEQ ID NO:2.

2. The primer pair of claim 1, which, when used in a PCR reaction with a DNA sample including the FCGR3A gene, effectuates the specific amplification of an FCGR3A region.

3. The primer pair of claim 2, wherein the FCGR3A region contains at least one polymorphic site.

4. An isolated nucleic acid consisting essentially of an FCGR3A gene region amplicon resulting from a PCR reaction comprising the primer pair of claim 1, a DNA sample including the FCGR3A gene, and a DNA polymerase.

5. The isolated nucleic acid of claim 4, wherein the amplicon comprises the nucleic acid sequence as set forth in SEQ ID NO:3.

6. An isolated nucleic acid capable of hybridizing to the nucleic acid of claim 5.

7. The nucleic acid of claim 6, wherein the nucleic acid comprises from 6 to 100 nucleotides.

8. The nucleic acid of claim 6, wherein the nucleic acid hybridizes under highly stringent conditions to an amplicon containing the polymorphic site within SEQ ID NO:3.

9. The nucleic acid of claim 8, wherein the polymorphic site is the 158F/V polymorphism, wherein the polymorphism corresponds to the nucleotide change 4985T>G.

10. A method for predicting therapeutic response to an IgG pharmacologic agent in an individual comprising: isolating a biological sample from an individual; performing a PCR reaction on the biological sample using the primer pair of claim 1 ; and detecting the allelic pattern for a polymorphic site of FCGR3A in the individual, wherein the allelic pattern is indicative of the sensitivity of the individual to the IgG pharmacologic agent.

11. The method of claim 10, wherein the polymorphic site is selected from the group consisting of polymorphisms identified in the NCBI Single Nucleotide Polymorphism database by SNP_ID NOs: 1042223 (SEQ ID NO: 8), 1042222 (SEQ ID NO: 9), 1042220 (SEQ ID NO: 47), 375794 (SEQ ID NO: 10), 445509 (SEQ ID NO: 11), 378618 (SEQ ID NO: 12), 448312 (SEQ ID NO: 13), 1042215 (SEQ ID NO: 14), 1042214 (SEQ ID NO: 15), 2499445 (SEQ ID NO: 16), 3181668 (SEQ ID NO: 17), 7539036 (SEQ ID NO: 18), 1042209 (SEQ ID NO: 19), 1126552 (SEQ ID NO: 20), 1042207 (SEQ ID NO: 21), 1042206 (SEQ ID NO: 22), 17853189 (SEQ ID NO: 23), 10919555 (SEQ ID NO: 24), 10800579 (SEQ ID NO: 25), 10800580 (SEQ ID NO: 26), 10800581 (SEQ ID NO: 27), 4657062 (SEQ ID NO: 28), 397429 (SEQ ID NO: 29), 426615 (SEQ ID NO: 30), 10533383 (SEQ ID NO: 31), 10624618 (SEQ ID NO: 32), 36091086 (SEQ ID NO: 33), 449463 (SEQ ID NO: 34), 4657063 (SEQ ID NO: 35), 370077 (SEQ ID NO: 36), 371849 (SEQ ID NO: 37), 424288 (SEQ ID NO: 38), 3835614 (SEQ ID NO: 39), 394678 (SEQ ID NO: 40), 449443 (SEQ ID NO: 41), 396716 (SEQ ID NO: 42), 443082 (SEQ ID NO: 43), 5778214 (SEQ ID NO: 44), and 396991 (SEQ ID NO: 45).

12. The method of claim 11, wherein the polymorphic site is NCBI Single

Nucleotide Polymorphism database SNP_ID NO. 396991 (SEQ ID NO: 45).

13. The method of claim 10, wherein the IgG pharmacologic agent is an

immunotherapeutic or an anti-cancer therapeutic or both.

14. The method of claim 13, wherein the anti-cancer therapeutic is a treatment for at least one of B-cell lymphoma, breast cancer, ovarian cancer, cervical cancer, prostate cancer, colon cancer, melanoma, renal cell carcinoma, acute myeloid leukemia, or chronic lymphocytic leukemia.

15. The method of claim 13, wherein the immunotherapeutic is a treatment for at least one of multiple sclerosis, systemic lupus erythematosus, autoimmune anemias, red cell aplasia, thrombocytopenic purpura, Evan's syndrome, vasculitis, skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, chronic fatigue syndrome, rheumatoid arthritis, osteoarthritis, Inflammatory Bowel Disease, Crohn's disease, chronic inflammation, pain, Alzheimer's Disease.

16. A method of genotyping at least one polymorphism in a target nucleic acid sequence of interest, the method comprising:

amplifying the target nucleic acid sequence of interest in a PCR reaction with a pair of target nucleic acid sequence- specific primers to generate an amplicon containing a polymorphic site, wherein the 3' end of each sequence- specific primer terminates with an target nucleic acid sequence- specific nucleotide that is complementary only to the target nucleic acid sequence of interest; and

performing a genotyping reaction to identify a nucleotide at the polymorphic site.

17. The method of clam 16, wherein at least one primer in the pair of target nucleic acid sequence- specific primers comprises from 1 to 3 additional target nucleic acid sequence-specific nucleotides that are complementary only to the target nucleic acid sequence of interest, and wherein the target- specific nucleotides are within 10 nucleotides of the 3' end of one of the primers.

18. The method of claim 17, wherein the primer pair comprises a first primer comprising the nucleic acid sequence of SEQ ID NO: l, and a second primer comprising the nucleic acid sequence of SEQ ID NO:2.

19. The method of claim 16, wherein the genotyping reaction is selected from the group consisting of pyrosequencing reaction, DNA sequencing reaction, MassARRAY MALDI-TOF, RFLP, allele- specific PCR, real-time allelic discrimination, and microarray.

20. The method of claim 16, wherein the target nucleic acid sequence of interest is part of the FCGR3A gene.

21. The method of claim 20, wherein the polymorphic site is NCBI Single

Nucleotide Polymorphism database SNP_ID NO. 396991 (SEQ ID NO: 45).

22. The method of claim 18, wherein the primer pair generates a 755 base pair amplicon of FCGR3A.

23. The method of claim 18, wherein the target nucleic acid sequence- specific primers will anneal to FCGR3A but not FCGR3B.

24. A method of assessing whether a subject has, or is at risk for, a polymorphic disease comprising detecting at least one polymorphism according to the method of claim 16 or 18.

25. A method of genotyping FCGR3A 158F/V polymorphism, the method comprising:

amplifying a target region in FCGR3A in a PCR reaction with a primer pair comprising a first primer comprising a nucleic sequence as set forth in SEQ ID NO: 1, and a second primer comprising a nucleic acid sequence as set forth in SEQ ID NO:2, wherein the PCR reaction produces an FCGR3A- specific amplicon containing the 158F/V polymorphic site; and

performing a genotyping reaction to identify the allelic pattern at the 158F/V polymorphic site.