WO2006008650A2

WO2006008650A2 - Dna methylation in the assessment of leukemia

Info

Publication number: WO2006008650A2
Application number: PCT/IB2005/002369
Authority: WO
Inventors: Martin Matthew Corcoran
Original assignee: Karolinska Innovations Ab
Priority date: 2004-07-16
Filing date: 2005-07-15
Publication date: 2006-01-26
Also published as: WO2006008650A3

Abstract

This invention relates to methods for assessing leukemia in a patient, in particular to methods in which leukemia is assessed by analysis of the methylation of the ZAP70 gene in a in a sample obtained from the patient. Methods and means of assessing leukaemia and providing a positive or negative prognosis are provided.

Description

DNA Methylation in the Assessment of Leukemia

This invention relates to methods for assessing leukemia in a patient, in particular to methods in which leukemia is assessed by analysis of DNA methylation.

There are several different types of leukemia, for example chronic lymphocytic leukemia (CLL) and acute lymphoblastic leukemia (ALL) . CLL is the most common leukemia in Europe and North America. The clinical course of CLL is heterogeneous and individual CLL cases can be sub-categorised into groups based on molecular differences underlying the disease, each group having different prognostic implications. Generally, there are two subgroups of CLL: an aggressive subgroup and a mild subgroup. Patients in the mild subgroup have a better prognosis than those in the aggressive subgroup.

Treatments for leukemia often have serious side effects and identifying the sub-group of the disease in an individual allows a medical practitioner to determine the optimal type and duration of treatment.

Currently, CLL is sub-categorised by assessing specific differences between subgroups at the molecular level. These differences are statistically linked to particular clinical outcomes of the disease and therefore allow inferences to be made about the sub-group of CLL and the patient's clinical outlook (e.g. chance of recovery or life expectancy) . For example, CLL can be sub-categorised by determining the extent of somatic mutation of the immunoglobulin heavy chain gene (IGVH) in the lymphocytes of the patient. Generally, patients whose CLL cells have greater than 98% identity to the germ line sequence have significantly worse prognosis than those cases where the IGVH gene has been hypermutated. Therefore, patients with somatic mutations of the IGVH gene fall into the mild subgroup, whereas patients without such mutations fall into the aggressive subgroup. The IGVH mutation test is usually performed using PCR but is a difficult, labour intensive and expensive technique and is therefore not used routinely, in spite of its potential usefulness.

CLL can also be sub-categorised by determining the expression level of the cell surface marker CD38. Generally, patients whose CLL cells express high levels of CD38 have significantly worse prognosis than those patients whose CLL cells do not express CD38 (or express CD38 at relatively low levels) .

The present inventors have established that methylation of the gene encoding the Zeta associated Kinase 70 kd protein (ZAP70) correlates with indicators of leukemia sub-groups, for example the extent of IGVH gene mutation, CD38 expression and the level of ZAP70 expression. Analysis of ZAP70 methylation therefore allows the probable clinical progression, or prognosis of leukemia in a patient to be assessed.

An aspect of the invention provides a method for assessing leukemia in an individual comprising: determining methylation of a ZAP70 nucleic acid in a sample obtained from the individual.

Methylation of the ZAP70 nucleic acid is indicative of the prognosis of the leukemia in the individual.

Nucleic acid methylation generally occurs in vertebrates at cytosine bases, especially where the cytosine is flanked by a guanine base ("CpG") .

A ZAP70 nucleic acid may include all or part of the ZAP70 gene (database ace number BK005537 (figure 8 herein) , which has the coding sequence of database ace number NM_001079; NM_001079.3; GI :46488942) . A ZAP70 nucleic acid preferably comprises or consists of genomic DNA. A ZAP70 nucleic acid may comprise the 5' region of the ZAP70 gene.

Methylation may be assessed within all or part of the region from base 1 to base 2858 of the ZAP70 sequence of database accession number BK005537, wherein the region from 1 to 2431 is the 5' upstream promoter and untranslated region, the region from 2432 to 2538 is exon 1, the region from 2539 to 2779 is intron 1, and the region from 2780 to 2858 is exon 2, the region from 2539 to 2779 is intron 1, and the region from 2859 to 12,880 is intron 2.

For example, a region assessed for methylation may comprise or consist of all or part of the region from base 1 to base 2431 and/or the region from base 2538 to base 3580 of the annotated sequence BK005537.

A region upstream of exon 1 (base 1 to base 2431) which is assessed for methylation may, for example, comprise one or more regulatory sequences such as the promoter, enhancer and/or other upstream regulatory sequences, and portions of these.

In some embodiments, a 5' region may comprise or consist of bases - 10970 bp to -9169 bp of the ZAP70 nucleic acid relative to the start of the coding region.

In some embodiments, all or part of the region from the start of exon 1 (base 2432 of BK005537) up to the end of intron 2 (base 128879 of BK005537) may be assessed for methylation. For example, methylation may be determined in all or part of exon 1 (2432 to 2538), intron 1 (2539 to 2779), exon 2 (2780 to 2858) and/or intron 2 (2859 to 128879) in particular the first 600bp of intron 2 (2859 to 3459) . Methylation in intron 1 may be determined, for example, at the CpG dinucleotide at position 227 bp of intron 1, which is 334 bases downstream of the transcription start site (i.e. C-334) . This dinucleotide falls within a Taql restriction site, when the methylated genomic DNA is bisulphite modified.

In some embodiments, methylation may be determined, for example, at one or more of positions C-319, C-334, C-352 and C-384 of the Zap70 gene relative to the transcription start site.

In some embodiments, methylation may be determined at one or more ZAP70 sequences which are evolutionarily conserved. Evolutionarily conserved sequences are located in intron 1 (close to exon 2), 200 bp upstream of exon 1 and about 2 kb upstream of exon 1 (as shown in BK005537) .

Conveniently, methylation may be determined within the 8 kb region which is flanked by EcoRl sites and which encompasses exon 1 of the ZAP70 gene.

In some embodiments, the 3^r untranslated region of the ZAP70 gene may be assessed for methylation.

Methylation of the ZAP70 nucleic acid may be determined using any convenient technique. A range of suitable techniques are known in the art, including, for example, Southern analysis.

In particular, methylation may be determined by determining the presence of one or more base changes in the ZAP70 nucleic acid sequence.

A base change may be the result of chemical modification of the ZAP70 nucleic acid to convert specifically one of an unmethylated or a methylated base, for example an unmethylated or a methylated cytosine base, to another base. The chemical modification may be achieving by treating the ZAP70 nucleic acid with a modifying agent that converts specifically one of an unmethylated or a methylated base to another base. The presence or absence of a base change at a site is indicative of methylation at that site. For example, when the modifying agent modifies methylated bases, a base change is indicative of methylation, and when the modifying agent modifies unmethylated bases, the absence of base change is indicative of methylation.

A method may comprise; treating the ZAP70 nucleic acid with a modifying agent that converts either an unmethylated base or a methylated base to another base, and; determining the presence or absence of one or more base changes in the ZAP70 nucleic acid sequence.

In some preferred embodiments, the modifying agent may convert an unmethylated base into a different base, for example an unmethylated cytosine base to a uracil base. Suitable modifying agents include bisulphite salts, such as sodium bisulphite, which converts an unmethylated cytosine base to a uracil base.

A method may comprise; treating the ZAP70 nucleic acid with a modifying agent that converts an unmethylated base to another base, and, determining the presence or absence of one or more base changes in the treated ZAP70 nucleic acid sequence, the absence of base change being indicative of methylation.

For example, the ZAP70 nucleic acid may be treated with a modifying agent, such as a bisulphite salt, which converts unmethylated cytosine bases to uracil bases and the presence or absence of one or more CpG dinucleotides in the treated nucleic acid determined. The presence of a CpG dinucleotide is indicative of methylation at the cytosine base, which protects the cytosine from the action of the modifying agent. A method may comprise; treating the ZAP70 nucleic acid with a modifying agent, such as a bisulfite salt, that converts an unmethylated cytosine to thymine, and, determining the presence of one or more cytosine residues in the treated ZAP70 nucleic acid sequence, the presence of the one or more cytosines being indicative of methylation of these residues.

In other embodiments, the modifying agent may convert the methylated base to another base. A method may comprise; treating the ZAP70 nucleic acid with a modifying agent that converts a methylated base to another base, and, determining the presence of one or more base changes in the treated ZAP70 nucleic acid sequence, the presence of a base change being indicative of methylation.

The presence of base change following treatment with the modifying agent may be determined using any convenient technique, for example, by one or more of: sequencing, hybridisation analysis, PCR and RFLP analysis.

In some embodiments, methylation of a ZAP70 nucleic acid may be determined by; contacting the ZAP70 nucleic acid with a restriction enzyme that cleaves a target sequence, and; detecting a change in the restriction pattern of the ZAP70 nucleic acid compared to the restriction pattern of unmethylated ZAP70 nucleic acid.

A change in the restriction pattern may occur as a result of methylation dependent base changes in the target sequence of a restriction enzyme, or as a result of the direct blocking by methylation of the target sequence of a restriction enzyme, which may prevent cleavage or reduce the rate of cleavage by the restriction enzyme at the target sequence. A base change in the sample ZAP70 nucleic acid relative to unπiethylated ZAP70 nucleic acid may be detected, for example, by; contacting the sample ZAP70 nucleic acid with a restriction enzyme that cleaves a target sequence, wherein the base change either;

1) disrupts the target sequence within the ZAP70 nucleic acid, or otherwise prevents cleavage at the target sequence in the ZAP70 nucleic acid; or, 2) generates the target sequence in the ZAP70 nucleic acid, and; determining cleavage of the ZAP70 nucleic acid.

The formation or disruption of the target sequence of a restriction enzyme may be used to distinguish methylated nucleic acid from unmethylated nucleic acid. For example, Taql (target sequence: TCGA), HPYCH4IV (target sequence: ACGT) or HinFl (target sequence: GANTC) sites in the ZAP70 nucleic acid may be formed by the base change and HpaII and/or Smal sites in the ZAP70 nucleic acid may be disrupted by the base change

The target sequence may be formed by: the conversion of an unmethylated cytosine to a thymine or a uracil by the modifying agent and/or the non-conversion of a methylated cytosine to a thymine or a uracil by the modifying agent.

In other embodiments, the target sequence may be formed by a base change from a methylated cytosine base to a thymine base. This may occur spontaneously in the absence of modifying agents.

The presence or absence of methylation at a methylation site can therefore be detected by determining whether cleavage has occurred at a restriction enzyme target sequence that is disrupted or created by a base change associated with methylation. Methylation may be determined, for example by restriction analysis of bisulphite modified DNA, at one or more CpG dinucleotides shown in Table 4.

For example, the 5'region comprising a promoter may be contacted with the restriction enzyme HpyCH4IV, following treatment with the modifying agent. Examples of other suitable restrictions enzymes are shown in Table 4.

Methylation may be determined at more than one site. For example, more than one restriction enzyme may be contacted with the ZAP70 nucleic acid.

Cleavage of the target sequence may be detected by any convenient technique. For example, the products of restriction enzyme cleavage may be run on a suitable gel to determine whether cleavage has occurred.

In some embodiments, a base change in the treated ZAP70 nucleic acid sequence may be detected by sequencing the treated ZAP70 nucleic acid sequence and identifying one or more base changes relative to the untreated sequence.

Numerous methods and means of sequencing nucleic acids are well- known in the art and may be used to detect base changes in the nucleic acid sequence as described herein.

The ZAP70 nucleic acid may be sequenced by solid phase techniques. For example, the treated ZAP70 nucleic acid sequence may be immobilised on a solid support, for example a magnetic bead, and then denatured and sequenced. Immobilisation may be achieved by any convenient technique. For example, the ZAP70 nucleic acid sequence may be amplified using an amplification primer which comprises an attachment moiety which binds to an attachment site on a solid support. The immobilised strand or the complementary strand thereof may be sequenced using any convenient technique, including, for example, chain-termination sequencing techniques, which are well known in the art.

Solid phase nucleic acid sequencing is well known in the art and is described, for example, in EP371437.

The ZAP70 nucleic acid may be sequenced by so called mini-sequencing techniques. This involves detecting the incorporation of a labeled nucleotide into a polymerization or primer extension product at a position in the ZAP70 nucleic acid sequence which is suspected of methylation, for example a cytosine residue, in particular a cytosine residue within a CpG motif. The labeled nucleotide is capable of forming base pairs with one of the unmodified nucleotide and the nucleotide which is generated by the modifying agent. Incorporation of the labeled nucleotide into a primer extension product is indicative of the presence or absence of methylation at that position in the ZAP70 nucleic acid sequence. The incorporation of a labeled nucleotide may be detected by hybridising a single- strand of the treated ZAP70 nucleic acid with an oligonucleotide primer that is complementary to the ZAP70 nucleotide sequence in a region which is 3' of the position which is suspected of of methylation. Preferably, there are no nucleotides identical to either the unmodified nucleotide or the nucleotide which is generated by the modifying agent between the position which is suspected of methylation and the 3' end of the primer. The primer is then extended along the ZAP70 nucleic acid template across the position suspected of methylation to produce a primer extension product. Incorporation of the labelled nucleoside triphosphate into the primer extension product at a site corresponding to the position suspected of methylation is indicative of methylation or non- methylation at that position, depending on the nucleoside triphosphate which is labelled. Techniques for the mini-sequencing of nucleic acid are well known in the art and are described, for example in EP648280.

In some embodiments, a base change in the treated ZAP70 nucleic acid sequence may be detected using Scorpion primers. This may involve contacting the treated ZAP70 nucleic acid may be contacted with a tailed nucleic acid (scorpion) primer which has a ZAP70 template binding region and a tail comprising a linker and a ZAP70 target binding region, under conditions such that the ZAP70 template binding region of the primer will hybridise to a complementary- sequence in the ZAP70 nucleic acid and be extended to form a primer extension product. The primer extension product is then separated from the ZAP70 nucleic acid, whereupon the ZAP70 target-binding region in the tail of the primer will hybridise to a sequence in the primer extension product. The presence of hybridisation is indicative of the presence of the ZAP70 target sequence in the ZAP70 nucleic acid sequence. The ZAP70 template binding region and/or ZAP70 target binding region of the primer are selected so that hybridisation of the region to a complementary sequence is dependent on either the presence or the absence of a base change induced by the modifying agent. Hybridisation of the ZAP70 target-binding region to the primer extension product may be detected using a signalling system, such as an intercalating dye, fluorophore or flurophore/quencher pair.

Techniques for the detection of base changes in a target nucleic acid using Scorpion primers are well known in the art and are described, for example in WO9966071.

It may be convenient, following treatment with the modifying agent and before determining the presence of a base change, to amplify the ZAP70 nucleic acid, or a portion that comprises a methylation site, using a suitable amplification technique.

A method may comprise: treating the ZAP70 nucleic acid with a modifying agent, amplifying the ZAP70 nucleic acid, and; determining the presence of a base change in the ZAP70 nucleic acid, for example using a method as described above.

Amplification of the ZAP70 nucleic acid may be performed by any convenient technique, for example using the polymerase chain reaction (PCR) .

PCR is a technique known in the art for specifically amplifying nucleic acids (reviewed for instance in "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, 1990, Academic Press, New York, Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed) , PCR technology, Stockton Press, NY, 1989, and Ehrlich et al, Science, 252:1643-1650, (1991)) . PCR comprises the steps of denaturation of template nucleic acid (if double-stranded) , annealing of primer to target, and polymerisation. The nucleic acid probed or used as template in the amplification reaction may be genomic DNA, cDNA or RNA, although genomic DNA is preferred in the present invention. Amplication usually converts uracil bases in the nucleic acid to thymine bases.

Other specific nucleic acid amplification techniques include strand displacement activation, the QB replicase system, the repair chain reaction, the ligase chain reaction and ligation activated transcription. For convenience, and because it is generally preferred, the term PCR is used herein in contexts where other nucleic acid amplification techniques may be applied by those skilled in the art. Unless the context requires otherwise, reference to PCR should be taken to cover use of any suitable nucleic amplification reaction available in the art. Selective amplification of methylated ZAP70 nucleic acid may also be performed using standard techniques including, for example, the MethyLight™ method (Eads CA et al Nucleic Acids Res. 2000 Apr 15;28 (8) :E32) . A base change may be determined in the amplified ZAP70 sequence using any convenient technique, for example a technique described above, including conventional sequencing, hybridisation or restriction enzyme-based analysis.

For example, a hybridisation-based method may comprise the steps: i) amplifying the ZAP70 nucleic acid; ii) contacting the amplified ZAP70 nucleic acid with a labelled oligonucleotide that is adapted to hybridise selectively to a sequence incorporating a base change caused by methylation or unmethylation; and, iii) determining hybridisation of the oligonucleotide.

Any suitable hybridisation-based approach may be employed, including, for example, light cycler fluorescent oligonucleotide techniques.

A restriction enzyme based method may comprise the steps : i) amplifying the ZAP70 nucleic acid; ii) contacting the amplified ZAP70 nucleic acid with a restriction enzyme that cleaves a target sequence, wherein a difference in base in the amplified ZAP70 nucleic acid compared to unmethylated ZAP70 nucleic acid either disrupts the target sequence within the amplified ZAP70 nucleic acid or creates the target sequence in the amplified ZAP70 nucleic acid; and, iii) detecting the presence or absence of cleavage of the amplified product, the presence or absence of cleavage being indicative of the methylation of the ZAP70 nucleic acid.

In some embodiments, the presence or absence of an amplified ZAP70 nucleic acid product is itself indicative of a methylation specific base change in the ZAP70 nucleic acid i.e. ZAP70 nucleic acids that have been modified with the modifying agent are selectively amplified. This may be achieved, for example, using amplification primers which comprise T residues (or A residues in the opposing strand) at positions which correspond to C residues in the non- bisulphite modified sequence, and which includes CpG dinucleotides in the wild type sequence. Only ZAP70 nucleic acid susceptible to bisulphite modification at these sites is amplified, and the absence of amplification product is therefore indicative of ZAP70 nucleic acid methylation. Alternatively, amplification primers which comprise cytosine residues at positions which correspond to C residues (or G residues in the opposing strand) in the non- bisulphite modified sequence at the CpG dinucleotide positions may be employed. Only ZAP70 nucleic acid which is not modified by bisulfite is amplified, and the presence of amplification product is therefore indicative of ZAP70 nucleic acid methylation.

In other embodiments, primers for amplification of ZAP70 nucleic acid may be designed to amplify both methylated and unmethylated target sequence, for example using bisulphite modified DNA specific primers. A primer specific for bisulphite modified DNA does not recognize non-bisulphite modified genomic DNA at this locus and is specific for bisulphate modified genomic DNA, i.e. DNA in which all the cytosines have been replaced with thymines.

Suitable primers may be designed from bisulfite-modified sequence (i.e. with T in place of C), avoiding potential methylation sites such as CpG dinucleotides.

Modified DNA specific primers allow for the amplification of both methylated and non-methylated bisulphate modified DNA. Further techniques must then be applied to the amplified product to distinguish the methylated from the non-methylated.

Suitable primers for ZAP70 amplification may comprise one or both of ZAPMF and ZAPMR, as shown in Table 1 or at least one of the ZAP primers shown in Table 2. For example, amplification primers may include one or more of primers ZAPupext, ZAPipint, ZAP-A, ZAP-B, ZAP-C, ZAP-D, ZAP-E and ZAP-H.

The skilled person may design other suitable primers suitable for amplifying parts of the ZAP70 sequence using standard techniques.

Leukemia suitable for assessment as described herein may be chronic lymphocytic (lymphoid) leukemia (CLL) , amyloid lymphoblastic (lymphoid) leukemia (ALL) , acute myeloid (myeloblastic) leukemia (AML) or chronic myeloid leukemia (CML) .

Determining the methylation of ZAP70 nucleic acid in a sample obtained from an individual allows the sub-type of the particular leukemia suffered by the patient to be determined. A method may further comprise identifying the leukemia of the individual as an aggressive or mild sub-type (e.g. the aggressive subtype of CLL) from the presence or absence of methylation of the ZAP70 nucleic acid.

A prognosis for the leukemia in the individual may be provided based on the presence or absence of methylation of the ZAP70 nucleic acid. A prognosis may include the predicted clinical outcome of the assessed leukemia, and may include a risk of relapse for a patient recovering from the leukemia. The present methods may therefore be used to assess leukemia in a patient suffering from leukemia, or to assess the risk of relapse for a patient with a history of leukemia. Prognosis may be measured by life expectancy, risk of relapse, and other factors, such as cytogenetic results, VH-gene mutational status and CD-38 surface marker status, in order to assess leukemia in an individual.

In some embodiments, chronic lymphocytic leukemia (CLL) may be assessed. A method may comprise the step of providing either a negative prognosis of CLL where the ZAP70 nucleic acid is unmethylated or a positive prognosis of CLL where the ZAP70 nucleic acid is methylated.

A negative prognosis is a prognosis associated with a poor clinical outcome, for example a prognosis characteristic of the aggressive subgroup of CLL. Conversely, a positive prognosis is associated with a good clinical outcome (such as, for example, a likely recovery from the disease) , for example a prognosis characteristic of the mild subgroup of CLL.

Other prognostic measures of CLL include cytogenetics, with deletion of Hq being a negative prognostic feature and normal karyotype being a positive prognostic feature.

A clinical finding of lymphocytosis only is a positive prognostic feature and is _^seen in 63% of CLL patients, who have a median survival of 12 years. In contrast, the presence of thrombocytopenia and anemia is a negative prognostic feature that is found in 2 to 7% of CLL patients, who have a median survival of 2 years (Montserrat E. Hematol J. 2004; 5 Suppl l:S2-9).

A method described herein may further comprise providing anti-cancer therapy for use in treating the individual and/or treating the individual with an anti-cancer therapy. An anti-cancer therapy may, for example, comprise one or more of chemotherapy, radiotherapy and interferon therapy. If a negative prognosis has been provided to the patient, the anti-cancer therapy may be of extended duration and/or high dose compared to a standard regime of the anti-cancer therapy. The cancer therapy may include a stem cell transplant.

Suitable anti-cancer therapies are well known in the art.

In other embodiments, amyloid lymphoblastic leukemia (ALL) may be assessed. A method may comprise the step of providing either a negative prognosis where the ZAP70 nucleic acid is methylated or a positive prognosis where the ZAP70 nucleic acid is unmethylated. Generally, in ALL, if the ZAP70 nucleic acid is unmethylated, the patient's risk of relapse is significantly lower than if the nucleic acid is methylated. A positive prognosis of ALL may be a low risk of relapse compared to average relapse rates for ALL. The negative prognosis may be a high risk of relapse compared to average relapse rates for ALL.

The risk of relapse may be measured as a probability of relapse e.g. % risk of relapse. The risk of relapse may be measured by the predicted time for reoccurrence of the disease following an initial treatment e.g. 1 year.

The methylation of ZAP70 may be correlated with other prognostic indicators, such as cytogenetic indicators, for the assessment of

ALL. For example, a high risk of ALL relapse might also be indicated by particular cytogenetic results such as a t (4;11) (q21;q23) and a low risk of relapse might be indicated by a patient with initial cytogenetic findings of high hyperdiploidy.

ALL may be derived from T cells or from B cells. B cell and T cell derived ALL are distinguished by the presence of T-cell or B-cell specific cell surface markers. B or T cell derived ALL may be identified, for example, using monoclonal antibodies specific for T or B cell specific antigens such as CD3 (T cells) or CD19 (B cells) .

The methods described herein may be particularly useful in assessing or determining the prognostic status of B cell derived ALL.

If the risk of relapse is determined to be high, an individual may be monitored for relapse. Additionally, or alternatively, medication may be administered to reduce the risk of relapse.

The sample obtained from the patient for use in the present methods may be any source of non-degraded genomic DNA, for example a blood sample or a bone marrow or tissue sample, for example from a clinical slide. In some embodiments, the sample may be a purified lymphocyte sample optionally enriched for B-lymphocytes.

A tissue or bone marrow sample may be a paraffin embedded tissue sample from a clinical slide.

As described above, methylation of the ZAP70 gene may be correlated to the results of other tests that assign a clinical outlook or prognosis to the patient that provided the sample. In some embodiments, ZAP70 methylation determined as described herein may be compared with subgroups of IgVH gene sequences, CD38 expression, Hq deletion and other known prognostic indicators (Degan M Br J Haematol. 2004 JuI; 126(1): 29-42, Montserrat E. Hematol J. 2004; 5 Suppl l:S2-9, Eclache V et al Cancer Genet Cytogenet. 2004 JuI 1; 152(1) : 72-6)

A method described herein may comprise correlating methylation of the ZAP70 nucleic acid to one or more of: the expression level of the ZAP70 gene; the amount of VH gene mutation; and the expression level of the cell surface marker CD38, in a sample from the same patient.

Other aspects of the invention relate to kits for performing methods described herein.

A kit may comprise: i) PCR primers for amplifying the ZAP70 nucleic acid; and ii) a restriction endonuclease that cleaves at a target sequence, wherein methylation in the ZAP70 nucleic acid either: disrupts or otherwise blocks said target sequence; or creates said target sequence in the ZAP70 nucleic acid. A further kit of the invention may comprise: i) PCR primers for amplifying the ZAP70 nucleic acid; and ii) a labelled oligonucleotide that is adapted to hybridise selectively to a sequence incorporating a base change caused by one of methylation or unmethylation.

A further kit of the invention may comprise:

(i) PCR primers for amplifying the ZAP70 nucleic acid; and

(ii) tailed nucleic acid primer which has a ZAP70 template binding region and a tail comprising a linker and a ZAP70 target binding region, said ZAP70 template binding region and/or said ZAP70 target binding region being adapted to hybridise selectively to a ZAP70 sequence incorporating a base change caused by one of methylation or unmethylation.

Examples of probes for detecting methylated ZAP70 genomic DNA include;

5' GTTTCGATTTTTTATTTAGAATCGGTTT 3'

Examples of probes for detecting non methylated ZAP70 genomic DNA include; 5' GTTTTGATTTTTTATTTAGAATTGGTTT 3'

Both of these examples are located at position 2761 to 2788 of the annotated ZAP70 sequence and from position 223 of intron 1 to position 11 of exon 2.

The kit may also comprise a modifying agent, for example a modifying agent that converts an unmethylated cytosine base to a uracil base, such as a bisulphite salt, for example sodium bisulphite.

A kit allows standardisation of the method protocol and reagents, and allows results to be compared across laboratories. Then kit allows rapid performance of the method at sites that may not be ^■ equipped with the necessary materials and skills to perform complex methods such as IGVH mutation analysis.

The kit may include reagents for detecting cleavage of the ZAP70 nucleic acid or cleavage of amplified products thereof.

The kit may include reagents in suitable container(s) , such as a vial in which the contents are protected from the external environment. The kit may include instructions for use e.g. PCR and/or a method for determining the presence of methylation in accordance with the present methods. The kit may include one or more reagents required for a PCR reaction, such as one or more of: nucleosides, buffer solution, or a heat resistant polymerase enzyme such as Taq polymerase. The kit may include the pZAP70 probe, or other probe that anneals to the amplified region. The probe may be labelled.

The kit may include means for providing the test sample itself, e.g. a syringe for removing a blood sample (such components generally being sterile) .

The amplification of the ZAP70 nucleic acid may be useful where only a relatively low quantity of DNA is provided by the patient's sample. As described above, the primers are used to amplify a ZAP70 nucleic acid that includes a methylation site.

In a further aspect of the invention, there are provided PCR primers suitable for amplifying a ZAP70 nucleic acid, wherein the PCR primers are set out in Table 1 or Table 2.

Aspects of the present invention will now be illustrated with reference to accompanying figures and the experimental exemplification below, by way of example and not limitation. Further aspects and embodiments will be apparent to those of ordinary skill in the art.

All documents mentioned anywhere in this text are herein incorporated by reference.

Figure 1 shows a schematic representation of the 5' portion of the ZAP70 gene, including the first exon, a ZAP70 probe ("pZAP70") that hybridises to a section of exon 1 and intron 1 of the gene, and several restriction enzyme sites.

Figure 2 shows bisulphite modification of the 5' portion of the ZAP70 gene to provide Taql and Hinfl restriction target sequences at methylated sites.

Figure 3 shows a graph of methylation status of the ZAP70 gene to expression of ZAP70 protein, where M = methylated and U = unmethylated.

Figure 4 shows a comparison of survival curves between methylated and unmethylated ZAP70 samples, indicating a clear delineation of positive and negative prognostic subtypes.

Figure 5 shows a protocol for the MethyLight™ technique.

Figure 6 shows a schematic diagram of the ZAP70 gene.

Figure 7 shows a diagram of the 5' region of the ZAP70 gene, with restriction sites indicated.

Figure 8 shows the Homo sapiens ZAP70 gene complete sequence and upstream promoter region which has the database accession number BK005537.

Figure 9 shows the amino acid sequence of the ZAP70 gene product. Figure 10 shows the amino acid sequence of the splice variant ZAP70b gene product.

Figure 11 shows the amino acid sequence of the splice variant ZAP70c gene product.

Figure 12 shows a schematic of the ZAP-70 Transcription Start Site (TSS) The position of exonl and exon2 of the ZAP-70 gene (gray boxes), the PCR primers ZAPDNl-F and ZAPDNl-R, CpG dinucleotides (vertical bars) , CpG loci within restriction digest sites (C+336, C+88, C-334), the Smal restriction site (C-243) and the promoter region predicted using the ElDorado extended genome annotation facility are shown. The BLAT analysis conservation score (CS) is displayed as a histogram indicating conservation of the human ZAP-70 5' region across all chimp, mouse, rat, dog, chicken, fugu, and zebrafish genomes. Conserved regions between the human ZAP-70 5' region and that of chimpanzee, dog, mouse and rat are also shown.

Figure 13 shows methylation status at the CpG loci 334 bases downstream of the ZAP-70 TSS (C-334) against ZAP-70 protein expression, in 2 groups of CLL patients with unmutated or mutated IgVH genes (Panel A) and the percentage of cytosine residues methylated in ficolled lymphocyte DNA samples from six CLL patients with methylated cytosine at the C-334 and nine CLL patients with unmethylated cytosine at C-334 (Panel B) .

Figure 14 shows Kaplan-Meier survival curves for 85 CLL Patients. Panel A shows C-334 methylated CLL patients verses C-334 unmethylated CLL patients with median survivals of 211 months and 85 months respectively (95% CI) . Panel B shows ZAP-70 negative verses ZAP-70 positive CLL patients with median survivals of 211 months and 110 months respectively. Panel C shows IgVH gene mutated CLL patients verses IgVH gene unmutated CLL patients with median survivals of 211 and 110 months respectively. Table 1 shows PCR primers suitable for amplifying ZAP70 nucleic acid in methods of the invention.

Table 2 shows additional PCR primers suitable for amplifying ZAP70 nucleic acid in methods of the invention.

Table 3 shows analysis of the methylation status of the promoter overlapping exon 1, intron 1 and exon 2 of ZAP70 in a total of 98 CLL cases

Table 4 shows a list of the nucleotide positions of the useful methylation detecting restriction sites

Table 5 shows the correlation between ZAP70 methylation and protein expression for 83 CLL cases.

Table 6 shows the correlation between calcitonin and ZAP70 methylation.

Table 7 shows results of analysis of 102 CLL patients, including mRNA expression values as shown by microarray analysis, flow cytometric analysis of ZAP70 protein expression, VH gene mutation status and CD38 expression levels.

Table 8 shows data collected from 93 ALL cases.

Table 9 shows a statistical analysis of the survival curves shown in Figure 4.

Table 10 shows the exons of ZAP70 sequence BK005537.

Table 11 shows the results of southern-based hybridisation analysis and methylation sensitive restriction analysis of .the intronl/exon2 boundary region of ZAB-10 gene at the CpG site 243bp downstream of the ZAP-70 transcription start site (TSS) in 11 CLL patients with known ZAP-70 protein expression. The hybridisation results indicate complete restriction (R) of patients 2, 4, 18 and 69 at the methylation sensitive Smal site spanning C-243, while patients 17, 43, 79, 81 and 87 are completely unrestricted (U) . Patients 32 and 37 gave an intermediate result (I) with approximately 50% restriction at this site.

Table 12 shows the results of methylation sensitive restriction analysis results of the CpG site 334bp downstream of the ZAP-70 TSS (C-334) for six CLL patients. The results of ZAP-70 protein expression are shown by flow cytometry and the fraction of the 213bp ZAPDNl-F - ZAPDNl-R PCR product restricted by Taqαl as calculated by densitometric analysis (RF) .

Table 13 shows the results of restriction analysis results of C-334 for pure T/NK cells, pure B cells and mixed B/T cell samples. Showing percentage B cells and the fraction of the 213bp ZAPDNl-F - ZAPDNl-R PCR product restricted by Taqαl as calculated by densitometric analysis (RF) .

Table 14 shows PCR based methylation sensitive restriction analysis target CpG loci within the 5' region of the ZAP-70 gene. Showing position of CpG loci in relation to the ZAP-70 transcription start site (TSS), restriction enzyme with recognition site spanning CpG loci, the primers used for amplification of loci and PCR amplicon size.

Table 15a shows bisulphite sequencing of the intronl/exon2 boundary region. Sequencing results for eight ZAPDN1-F/ZAPDN1-R PCR products, cloned from each of five ZAP-70 positive CLL patients. Showing the position of the CpG loci relative to the ZAP-70 transcription start site (TSS) and the methylation status of the CpG loci (M= Methylated, U= Unitiethylated) . Table 15b shows bisulphite Sequencing of the intronl/exon2 boundary region. Sequencing results for eight ZAPDN1-F/ZAPDN1-R PCR products, cloned from each of five ZAP-70 negative CLL patients. Showing the position of the CpG loci relative to the ZAP-70 transcription start site (TSS) and the methylation status of the CpG loci (M= Methylated, U= Unmethylated) .

Table 16 shows ZAP-70 methylation, expression, and IgVH gene mutational status in non-CLL cases. ZAP-70 protein expression as determined by flow cytometry and corresponding methylation status of the C-334 loci in 13 cases of common or pre B cell acute lymphoblastic leukaemia (B-ALL) , 5 cases of T cell acute lymphoblastic leukaemia (T-ALL) , 13 patients with mantle cell lymphoma (MCL) and 14 cases with splenic marginal zone lymphoma (SMZL) . M=methylated at C-334, U=unmethylated at C-334.

Experimental

Detection of Methylation An example of methylation detection in the ZAP70 nucleic acid is set out as follows:

The wild type ZAP70 sequence from base 2749 to base 2808 of the annotated ZAP70 sequence, accession number BK005537 (i.e. from base 211 of intron 1 to base 29 of exon 2 as defined within BK005537) is:

ccggctttgtaagccccgattcctcacccagaaccggctctccattggcattgggaccag

This sequence is modified with sodium bisulphite, which chemically converts unmethylated cytosines to uracils. Bisulphite treatment consists of denaturing the DNA in a NaOH solution and treating it overnight for up to 16 hours at 50 degrees C with sodium bisulphite, followed by a final NaOH treatment. During PCR amplification, the uracil bases are replaced with thymine bases. The sequence is now:

ttggttttgtaagttttgattttttatttagaattggttttttattggtattgggattag

Methylated cytosines, usually in CpG couplets, are protected from sodium bisulphite modification, and therefore remain unchanged after treatment with sodium bisulphite.

The sequence in methylated cases is thus

tcggttttgtaagtttcgattttttatttagaatcggttttttattggtattgggattag

Bisulphite modification of unmethylated cytosines creates restriction sites for the enzymes Taql (TCGA) and Hinfl (GANTC) which can be used to determine the methylation in the original sample. Contacting the amplified ZAP70 nucleic acids with Taql and/or Hinfl causes cleavage at a newly created restriction enzyme target sequence in the amplified ZAP70 nucleic acid.

The products of contact with the restriction enzyme (s) are run on a gel to determine whether cleavage has occurred. If cleavage has occurred, this indicates that the sample was methylated.

Patients and Methods

98 patients from a cohort of 245 previously reported CLL cases were studied. CLL was diagnosed based on standard morphological and immunopheonotypic criteria. Disease stability and disease related deaths were determined as previously described in Oscier DG et al. Blood. 2002 Aug 15; 100(4) : pp.1177-84.

In all cases, clinical diagnosis of CLL was based on standard morphologic and immunophenotypic criteria. Atypical lymphocyte morphology was defined as more than 10% prolymphocytes or more than 15% lymphoplasmacytoid or cleaved cells. Clinical follow-up for all patients ranged from 4 to 370 months, with a median follow-up of 74 months, and for live patients from 8 to 370 months with a median follow-up of 88 months. Ten patients have been followed for more than 20 years.

Patients were considered to have progressive disease if they had at least one of the following parameters: a lymphocyte doubling time of less than 1 year, progression to a more advanced Binet stage, development of systemic symptoms or Richter syndrome, or a downward trend of hemoglobin or platelet count to below the normal range.

Southern Hybridisational Methylation Analysis

7mg of purified lymphocyte DNA was digested with the restriction enzymes EcoRl, or EcoRl and Smal, and size fractionated on a 0.8% agarose gel, before transfer to Hybond N nitrocellulose membrane and subsequent hybridisation. A normal lymphocyte control DNA (lane 12) was digested with the restriction enzymes EcoRl or EcoRl and Smal (lanes 1 to 11) and fractionated on the gel. Probe pZAP which hybridises specifically to an 8kb EcoRl fragment encompassing exon 1 of ZAP70 was used in the analysis (see Figure 1) .

pZAP70 was produced by PCR using the primers: pZAPR5' GGTTAGTTTCAGACAAGCCTGCTTGC and pZAPR 5' CCCAGCAACTCCTGACTCCCA, producing a 526bp product.

Methylation Determination by PCR

Patient DNA samples, lmg from each case, were bisulphite modified according to standard protocols of Frommer, M. et al. (1992) Proc. Natl. Acad. Sci, USA. 89:1827-1831.

The DNA samples were suspended in 25 μl of water and 2.75 μl of 2M NaOH added before the DNA was denatured at 370C for 10 minutes. 15 μl of 1OmM hydroquinone and 260 μl of 3M sodium bisulphite solution, pH5.0, were then added and the reaction was incubated at 500 C for 16 hours. Next the reaction was purified through a DNA clean-up column and resuspended in 50 μl of H₂O, 2.75 μl of 3M NaOH was added and allowed to incubate for 10 minutes before the samples were ethanol precipitated and finally resuspended in 20 μl of H₂O. 1 μl of each sample was subsequently used in each methylation specific PCR reaction.

Primers ZAPMF and ZAPMR were used to amplify a 190bp fragment from the bisulphite treated DNA samples. Restriction digestion of the resulting products and size fractionation on 2% agarose gels allowed for the determination of the methylation status of ZAP70.

Methylated samples were identified by the presence of the restriction enzyme sites Taql or Hinfl, which were absent in unmethylated fragments (as described above) . In order to determine the sensitivity of the ZAP70 methylation assay, a control was performed on normal purified T- or B-lymphocytes, or mixtures of both. The cells were processed for bisulphite modification, PCR amplified and the ZAP70 gene digested with Taql. The digestion products were run on a gel.

In a sample of 100% T cells, there was a single 190bp band. In a sample of 75% T cells and 25% B cells, there was a bright 190bp band and a fainter 132bp band. In a sample of 50% T cells and 50% B cells, there were three bands, one at 190bp, one at 132bp and a faint band at 58 bp. In a sample of 25% T cells and 75% B cells, there was a faint 190bp band, a bright 132bp band and faint 58bp band. In a sample of 100% B cells, there were 132bp and 58bp bands.

The results of this control indicated that ZAP70 is unmethylated at this site in normal T cells but methylated in normal B cells (as cleavage of the 190bp amplification product shown in Figure 1 can be observed) . In addition, the results indicated that the technique may be applicable to identifying methylation within a mixed cellular population. A 25% contamination of non-methylated DNA in methylated DNA will still result in the majority of the sample showing a methylated result.

Primer ZAPMF is specific for bisulphite modified genomic DNA sequence from base 90 to base 115 of intron 1 of ZAP70. Primer ZAPMR is specific for bisulphite modified DNA from base 61 to base 37 of ZAP70 exon2 (Table 1) .

Primers ZAPupext, ZAPipint, ZAP-A, ZAP-B, ZAP-C and ZAP-D are used to amplify specifically the bisulphite modified 5' region of ZAP70, including exon 1 and the genomic region within 500 bp upstream of the start of transcription (Table 2) .

Primers ZAP-E and ZAP-H can be used to amplify a larger segment of bisulphite modified DNA which encompasses that amplified by primers ZAPMF and ZAPMR, downstream of exon 1 and encompassing at least part of intron 1 and exon 2 (Table 2) .

PCR Protocol 5 microlitres 10 x PCR buffer

5 microlitres NTP mix 2.5 itiM each of dATP dCTP, dGTP and dTTP.

5 microlitres of template containing 5o ng of bisulphite modified genomic DNA.

5 microlitres each of primers ZAPMF and ZAPMR at 10 pmol concentration.

29 microlitres H2O

1 microlitre Taq or other suitable PCR enzyme

The cycle conditions are denaturing at 96 degrees C for 1 minute followed by 30 cycles of amplification of: Denaturing at 94 degrees C for 30 seconds Annealing at 51 degrees C for 30 seconds Extension at 72 degrees C for 30 seconds

If nested PCR is required, for example to account for low initial sample levels, the primer combination ZAP-E and ZAP-H can be utilised (with the same amplification conditions as above) , followed by a nesting of 0.5 microlitres of the product into a nested reaction using primers ZAPMF and ZAPMR (same amplification conditions as above) .

Flow Cytometric Analysis of ZAP70

This method uses monoclonal antibodies specific for Zap70 protein. The leukaemic cells are fixed with a solvent solution and briefly allowed to hybridise with the monoclonal antibody which can enter the fixed cell membrane. The Zap70 specific antibody is detected using a fluorescently labelled secondary antibody in a flow cytometer. The cells which positively express Zap70 are thus visible by the emission of the secondary fluorescent signal under laser stimulation in the flow cytometer.

Lymphoid cells from peripheral blood were separated on lymphocyte separation medium and used either fresh or frozen in DMSO, and subsequently thawed. 5x106 cells were placed in 0-5% paraformaldehyde for 30 minutes, washed with phosphate buffered saline containing 0-05% Tween and 2% human serum albumin (PBSAT) and stored in 80% ethanol at -20⁰C for periods between 24 hours and 4 weeks. Cells were washed with PBSAT prior to staining, and then incubated with the primary antibody (ZAP-70, clone 2F3-2, Upstate Biotechnology) or isotype control (Mouse IgG2a, Dako) for 20 minutes. Subsequent staining with the secondary antibody (Sheep anti-mouse FITC, Novocastra) was for 15 minutes. A minimum of 5000 cells was acquired in the Cell Quest program on a Becton Dickinson FacsCalibur flow cytometer.

IGVH gene analysis

Immunoglobulin variable region genes were sequenced as previously described (Ossier et al. supra) .

The variable region was amplified by PCR using a mixture of: oligonucleotide 5' primers specific for each leader sequence of the VH families 1-7, together with a 3' constant region primer; or a 5' framework 1 (FWl) consensus primer and a 3' consensus JH primer.

PCR products were purified (Qiagen, West Sussex, UK) and sequenced directly using an automated DNA sequencer (ABI 377/310, Applied

Biosystems, Foster City, CA) . Nucleotide sequences were aligned to EMBL/GenBank and V-BASE (16), using MacVector 4.0 (International Biotechnologies, New Haven, CT), or Lasergene (DNASTAR, Madison, WI) sequencing analysis software. As previously determined, a cut-off of ≥98% germ-line homology was taken to define the unmutated subset. This was set to allow a possibility of a 2% deviation from the germline sequence due to polymorphisms rather than to somatic mutation.

Results

Southern Hybridisation and PCR of the ZAP70 gene

Analysis of the methylation status of the promoter overlapping exon 1, intron 1 and exon 2 of ZAP70 in a total of 98 CLL cases provided the results shown in Table 3. Of these 41 were found to be unmethylated at ZAP70 with 57 methylated. 9 cases showed a mixed pattern. In the case of the 41 unmethylated cases, 39 had non- mutated VH gene sequences. In contrast 47 out of the 57 cases methylated at ZAP70 contained mutated VH gene sequences (Table 3) .

After running the digestion products on a gel, samples that were unmethylated showed a single band (no Taql site present) . Samples showing two or more bands had been cleaved by Taql, and so appeared to be methylated. A minority of samples appeared to give an intermediate result in the form of a single band trailed by a smear, indicating approximately 50% methylation at the cleavage site.

Southern Hybridisation

The hybridisation results indicated that certain samples were cut at the Smal site close to exon 1, as two bands were visible. The other samples were not cut at this methylation sensitive site, as only a single band was visible. Some samples, where a smear was visible, appeared to give an intermediate result indicating variable cleavage at this site.

Flow cytometry

ZAP70 protein expression was determined by flow cytometry for 83 cases. Of these 32 were unmethylated at the ZAP70 locus, 29 of which were positive for ZAP70 expression. Of the remaining 51 methylated cases, 49 were negative for ZAP70 expression. The correlation between hypomethylation and ZAP70 expression and between hypomethylation and VH gene mutational status was statistically significant in both instances (P<0.001 Fisher's exact test) . The results are shown in table 5 and graphically in Figure 3.

Southern Hybridisation and PCR of the calcitonin gene

Analysis of the methylation status of a separate genomic region, the calcitonin locus, allowed us to determine whether a genomic wide hyper- or hypo-methylation process may underlie the differences in ZAP70 methylation status between the two subgroups. Results were obtained for 71 cases. Of the 21 cases which were unmethylated at ZAP70, 13 were also unmethylated at calcitonin, with 8 methylated. The remaining 50 cases, which were methylated at ZAP70, divided into 17 unmethylated and 33 methylated at the Calcitonin locus (Table 6) .

Results

Results for 102 patients are summarised in Table 7, below. This is a combined results table that includes mRNA expression values as shown by microarray analysis, flow cytometric analysis of ZAP70 protein expression, VH gene mutation status and CD38 expression levels.

The column headings for this table are as follows:

^λExpr Run' is the patient identification column. ^λExpr Value' is the πiRNA expression levels. A zero value means that the sample had an expression level equal to the control sample which was a mixture of lymphocyte and cell line RNA.

^ΛFlow' is the flow cytometric score for ZAP70. Zap70 protein expression is judged as positive if the value is 10 or over.

^METH' is the methylation status as determined by this PCR based assay. U means unmethylated or hypomethylated, M means methylated or hypermethylated and U/M means a mixed methylation result.

^Λ%H^f means the percentage similarity to wild type VH gene sequence. A value of 100 in this column means that the rearranged VH gene utilised in this leukaemic sample has no mutations. 92 on the other hand means that it has 8 mutations in every 100 bp in the region encompassed by the variable region segment.

^λCD38' is the CD38 cell surface marker score as determined by flow cytometry.

Table 7 shows a clear association between methylation of ZAP70 and the VH gene mutational status. The association was considerably more significant than the association with previously used markers, such as CD38 expression levels, and VH gene mutational status.

Figure 5 shows methylation detection using the Methylight technique. Methylation specific PCR (A) consists of two primers binding to sites with one or more CpGs. When the correct methylation pattern is present, in the diagram complete methylation, an amplicon is formed that can be detected on a gel. MethyLight (B) is similar to conventional MSP with the addition of a fluorogenic probe for real time detection. HM (heavymethyl) MethyLight (C) relies on blocker oligonucleotides to give the priming methylation specificity. The blockers bind to unmethylated DNA (unfilled circles) and prevent primer binding. The primers are therefore only able to bind and amplify methylated DNA. The amplification is detected with a methylation specific probe.

Relapse of acute lymphoblastic leukemia (ALL) Data was collected from a total of 93 ALL cases and the results shown in Table 8.

The results indicate a statistically significant association between relapse and ZAP70 methylation. P value = 0.000639

Methylation status of CpG loci within the 5' region of the ZAP-70 gene in CLL

COBRA of seven CpG loci across the 5' region of ZAP-70 was performed in five ZAP-70 positive patients (cases 2, 4, 18, 69 and 70) and five ZAP-70 negative CLL patients (cases 17, 32, 37, 43 and 79) .

Only PCR product amplified from genomic DNA with 5-Methyl cytosine at a CpG locus would retain the restriction site after bisulphite treatment and by cut. No restriction, and therefore no methylation, was observed in the any patient samples at the CpG sites +2122bp, +1610bp, +871bp, +336bp or +88bp to the TSS. Some restriction and therefore methylation was observed in four cases at the CpG site +631bp to the TSS, but no association was seen between the methylation status of this site and ZAP-70 expression status. At the CpG site located in intron 1, -334bp to the TSS (C-334), the restricted fraction (RF) ranged from 73-96% (mean, 83%+9%) for the five ZAP-70 negative patients and from 4-21% (mean, 13%±6%) for the five ZAP-70 positive cases. Using an unpaired two-tallied student T- test, the difference between the restricted fractions seen for the two groups of patients was significant (p<0.001) .

Southern analysis was performed to confirm the variable methylation seen at C-334 by a non-bisulphite treatment, non-PCR based technique. The CpG methylation sensitive Smal, restriction site spanning the CpG loci -243bp relative to the TSS (C-243) , was chosen for its close proximity to C-334. Analysis was performed on nine of the ten CLL patients previously studied (cases 2, 4, 17, 18, 32, 37, 43, 69 and 79), together with two additional ZAP-70 negative patients (cases 81 and 87) . The C-243 loci was unrestricted and therefore methylated in five of seven ZAP-70 negative patients and showed partial methylation in the other two cases. In contrast, all four ZAP-70 positive cases demonstrated complete restriction, indicating unmethylated cytosine at C-243 (Tables 11 to 13) .

As further confirmation of the variable methylation results seen at C-243 and C-334 and to assess the methylation status of the six other CpG sites in the intronl-exon2 boundary region of ZAP-70, bisulphite sequencing was performed on eight clones from each of the five ZAP-70 positive and five ZAP-70 negative CLL patients previously analysed by methylation sensitive restriction (Table 14) . Sequence analysis showed no cytosine residues at non-CpG loci, indicating complete bisulphite conversion. Analysis of all CpG loci (deleted CpG sites were excluded from analysis) , in all clones from each patient, showed that the percentage of cytosine residues methylated ranged from 52 - 97% (mean, 74+19%) for each of the ZAP- 70 negative patients and from 3 - 13% (mean, 7±4%) for each of the ZAP-70 positive patients. Using an unpaired two-tallied student T- test, the difference between the two groups of patients was significant (p<0.001) . Looking in turn at the percentage of clones methylated for each patient at each CpG loci, there was a significant difference between the ZAP-70 positive and ZAP-70 negative patients at C-319, C-334, C-352 and C-384 (p<0.001) .

Methylation status of CpG loci within the intron l-exon2 boundary- region of the ZAP-70 gene in normal T/NK and B cells Having shown differential methylation between ZAP-70 positive and

ZAP-70 negative CLL cases, we investigated the methylation status of the eight CpG intronl-exon 2 boundary sites in normal B cells that do not express ZAP-70 and normal T/NK cells that are ZAP-70 positive. Sixteen clones were sequenced from purified normal CDl9+ve B-cells and a further sixteen from CD2+ve T/NK cells. Again, complete bisulphite conversion was confirmed by the absence of cytosine residues at non-CpG loci. Considering the percentage of CpG loci methylated in each clone, there was interclonal variation amongst the B-cell clones (range 0-100%, mean 68%, SD 30%) and T/NK- cell clones (range 0-100%, mean 18%, SD 28%) and a significant difference between the two populations, using an unpaired two- tallied student T-test (p <0.001) . The sequencing results showed variable methylation of the C-334 loci between the normal B and T/NK cells allowing the use of mixed lymphocyte samples to assess the sensitivity of the C-334 restriction analysis assay. COBRA of >95% pure normal T/NK-cells showed an RF of 8% and for >95% pure normal B-cells the RF was 94%, mixed samples containing 26%, 51% and 75% B cells showed RF values of 30%, 59% and 77% respectively, as demonstrated in Table 13. Comparing the RF values to the percentage B-cells gave a correlation co-efficient greater than 0.99. These findings provide indication that in patient samples undergoing COBRA of C-334, the percentage of normal cell contamination would be directly reflected in the RF value.

COBRA of C-334 methylation status in CLL

Cut offs for the COBRA technique were set inline with the RF values seen at C-334 for the ten patients whose methylation status in the intronl-exon2 region had been confirmed by bisulphite sequencing. Patients with RF >70% were classed as methylated, those with RF < 30% were classed as unmethylated and values from 30 to 70% were classed as equivocal.

In all 87 CLL cases tested by COBRA, 53 were methylated at C-334 with RF ranging from 73 to 99% (mean, 89±10%) and 32 were unmethylated at C-334 with RF ranging from 2 to 23% (mean, 11±7%) . In two patients, cases 3 and 12, the restriction analysis was equivocal with RF values of 59% and 64% respectively (see Table 12) . It is of note that the 95% exact upper confidence bound for 2 in 87 is 0.071, suggesting that as many as 7% of patients analysed using these RF cut offs may have equivocal methylation results . The two equivocal patients were not included in the CLL patient cohort for statistical analysis but were investigated further by bisulphite sequencing. The results were similar to the previous sequencing results from the five ZAP-70 negative patients and looking specifically at the C-334 locus in the sequences for patients 2 and 12, the frequency of methylation was similar to the RF value obtained for both patients.

C-334 Methylation status is associated with ZAP-70 protein expression status and with IgVH gene mutational status in CLL The relationships between methylation status at C-334, ZAP-70 protein expression, and IgVH gene mutational status, are shown in figure 13A. Using a 10% cut off for ZAP-70 protein expression, 51 of 53 (96%) ZAP-70 negative patients were methylated at C-334 and 30 of 32 (94%) ZAP-70 positive patients were unmethylated at C-334

(Fisher's exact test, p<0.0001) . All four patients with discordance between ZAP-70 expression and C-334 methylation had unmutated IgVH genes; two were ZAP-70 negative and unmethylated at C-334 and two were ZAP-70 positive and methylated at C-334. Bisulphite sequencing of these four patients again showed that the RF values obtained by COBRA of C-334 were representative of the methylation status of the intronl-exon2 boundary region.

Using the established 98% homology to the germline sequence cut off for IgVH gene mutational status, 49 of 54 (91%) patients with mutated IgVH genes were methylated at C-334 and 27 of 31 (87%) patients with unmutated IgVH genes were unmethylated at C-334 (Fisher's exact test, p<0.0001). Of the nine patients showing discordance between ZAP-70 expression and IgVH gene mutational status, there was concordance between ZAP-70 expression and methylation status in seven (five unmutated and two mutated IgVH genes) . Patients 3 and 12 who displayed equivocal C-334 methylation results by restriction analysis but methylation of the 5' region by bisulphite sequencing were ZAP-70 negative and had mutated IgVH genes. C-334 Methylation status is associated with survival in CLL The median survival of patients methylated at C-334 was 211 months compared to 85 months for patients unmethylated at the same locus (p<0.0001) (Figure 14A) . Patients with unmutated IgVH genes also had a median survival of 211 months, compared to 110 months for those with mutated IgVH genes (p<0.0001) (Figure 14B), while patients who were either positive or negative for ZAP-70 expression had identical median survivals of 211 and 110 months respectively (p<0.0002) (Figure 14C)

C-334 Methylation and global genomic DNA methylation in CLL Global cytosine methylation was analysed in 15 of 87 CLL patients, six were ZAP-70 negative, with mutated IgVH genes and methylated C- 334, and nine were ZAP-70 positive, with unmutated IgVH genes and unmethylated C-334. The global cytosine methylation level for each patient ranged from 3.7 to 4.1 % (mean, 3.9+0.15%) in the C-334 methylated patients and from 3.9 - 4.3% (mean, 4.1+0.12%) in the C- 334 unmethylated patients, the difference between the two patient groups was significant (p=<0.001) . (Figure 13B)

ZAP-70 methylation, expression, and IgVH gene mutational status in non-CLL cases.

COBRA of C-334 was performed on all 40 non-CLL patients and results are shown in Table 16. Of eight B-ALL patients, five ZAP-70 positive cases were unmethylated at C-334 and of three ZAP-70 negative cases two were methylated and one was unmethylated. All five cases of T- ALL were ZAP-70 positive and of these four were unmethylated and one was methylated at C-334. In the 13 cases of MCL, all 12 ZAP-70 negative cases were methylated, while the one remaining ZAP-70 positive case was unmethylated. Of the SMZL cases, all 13 ZAP-70 negative cases were methylated but the 1 ZAP-70 positive case was also methylated. Considering the MCL and SMZL patients, all of the seven patients with unmutated IgVH genes and 16 of 17 patients with mutated IgVH genes were methylated at C-334.

Table 1

Table 2

Chi square analysis p < 0.00001

Table 3

Table 4

P<0.001 (Fishers exact test)

Table 5

Table 6

Table 7

Table 8

Table 10

Table 11

Table 12

O

Table 13

Table 14

U) N3 K) h-¹ cπ o O Ui cπ

i-3 σ

(D Cn

(Ji

o σ cπ cπ

Table 16

Claims

Claims :

1. A method for assessing leukemia in an individual comprising; determining the methylation of a ZAP70 nucleic acid in a sample obtained from the individual.

2. The method of claim 1, wherein methylation is determined by detecting a base change in the ZAP70 nucleic acid.

3. The method of claim 1 or claim 2 wherein the base change is caused by treating the ZAP70 nucleic acid with a modifying agent that converts either an unmethylated base or a methylated base to another base.

4. The method of claim 3, wherein the modifying agent converts an unmethylated base to another base.

5. The method of claim 4, wherein the modifying agent converts an unmethylated cytosine to a thymine or a uracil.

6. The method of claim 5 wherein the modifying agent is a bisulfite salt.

7. The method of claim 1 or claim 2 comprising; contacting the ZAP70 nucleic acid with a restriction enzyme that cleaves a nucleic acid to produce a restriction pattern; and, detecting a change in the restriction pattern of the ZAP70 nucleic acid compared to the restriction pattern of unmethylated ZAP70 nucleic acid.

8. The method of claim 7 wherein the restriction enzyme cleaves a target sequence, and a base change in the ZAP70 nucleic acid either disrupts the target sequence within the ZAP70 nucleic acid or creates the target sequence in the ZAP70 nucleic acid, and; determining cleavage of the ZAP70 nucleic acid by the restriction enzyme.

9. The method of claim 7 or 8, wherein the target sequence of a restriction enzyme is created in the ZAP70 nucleic acid by the base change.

10. The method of claim 9, wherein the restriction enzyme is one or more of: Taql, HPYCH4IV, or HinFl.

11. The method of claim 7 or 8, wherein the target sequence of a restriction enzyme is disrupted in the ZAP70 nucleic acid by the base change.

12. The method of claim 11, wherein the restriction enzyme is HpaII and/or Smal.

13. The method of claim 8 wherein cleavage of the ZAP70 nucleic acid is determined by electrophoresis.

14. The method of any one of claims 2 to 6 wherein the base change is detected by sequencing.

15. The method of claim 14 wherein the base change is detected by immobilising the ZAP70 nucleic acid on a solid support and determining the sequence of said nucleic acid.

16. The method of claim 14 wherein the base change is detected by- producing a primer extension product from a template strand of the ZAP70 nucleic acid and determining the incorporation of a labelled nucleotide into the primer extension product.

17. The method of claim 16 comprising; hybridising a primer to the template strand of the ZAP70 nucleic acid 3' of a position suspected of methylation, extending said primer by nucleic acid polymerisation to produce the primer extension product, and determining incorporation of said labelled nucleotide at the position suspected of methylation in the primer extension product.

18. A method according to any one of claims 2 to 6 wherein the base change is detected by; contacting the ZAP70 nucleic acid with a tailed nucleic acid primer having a ZAP70 template binding region and a tail comprising a linker and a ZAP70 target binding region, under conditions such that the ZAP70 template binding region of the primer will hybridise to a complementary sequence in the ZAP70 nucleic acid and be extended to form a primer extension product, separating any such primer extension product from the ZAP70 nucleic acid whereupon the ZAP70 target binding region in the tail of the primer will hybridise to a sequence in the primer extension product which corresponds to the ZAP70 target nucleic acid sequence, detecting said hybridisation, the presence of said hybridisation being indicative of the presence of the ZAP70 target sequence in the ZAP70 nucleic acid and the presence of said ZAP70 target sequence is indicative of the presence or absence of said base change.

19. The method of any preceding claim wherein the ZAP70 nucleic acid is amplified.

20. The method of claim 19 comprising the steps: i) amplifying the ZAP70 nucleic acid; ii) contacting the amplified ZAP70 nucleic acid with a labelled oligonucleotide that is adapted to hybridise selectively to a sequence incorporating a base change caused by one of methylation or unmethylation; iii) determining hybridisation of the oligonucleotide.

21. The method of claim 19 comprising the steps: i) amplifying the ZAP70 nucleic acid; ii) contacting the amplified ZAP70 nucleic acid with a restriction enzyme that cleaves a target sequence, wherein a base change in the ZAP70 nucleic acid either disrupts the target sequence within the ZAP70 nucleic acid or creates the target sequence in the ZAP70 nucleic acid; and, ii) determining the cleavage of the amplified product.-

22. The method of any one of claims 7 to 13 and 21 comprising the step of correlating the presence or amount of cleavage with methylation in the ZAP70 nucleic acid.

23. The method of any preceding claim wherein the leukemia is chronic lymphocytic leukemia (CLL) and the method comprises the step of providing either a negative prognosis of CLL where the ZAP70 nucleic acid is unmethylated or a positive prognosis of CLL where the ZAP70 nucleic acid is methylated.

24. The method of claim 18 further comprising the step of performing anti-cancer treatment on the patient if a negative prognosis has been provided.

25. The method of any one of claims 1 to 22 wherein the leukemia is acute lymphoblastic leukemia (ALL) and the method comprises the step of providing either a negative prognosis where the ZAP70 nucleic acid is methylated or a positive prognosis where the ZAP70 nucleic acid is unmethylated.

26. The method of claim 25 further comprising the step of monitoring the patient for signs of relapse the prognosis is negative.

27. The method of any one of the preceding claims wherein methylation is determined in intron 1 of the ZAP70 gene.

28. The method of claim 27 wherein methylation is determined at position 227bp of intron 1 of the ZAP70 gene.

29. The method of any one of the preceding claims wherein methylation is determined at one or more of positions C-319, C-334, C-352 and C-384 of the Zap70 gene relative to the transcription start site.

30. The method of any preceding claim, wherein the sample from the patient is a purified lymphocyte sample.

31. The method of claim 30 wherein the sample is enriched for B- lymphocytes.

32. The method of any preceding claim comprising correlating methylation of the ZAP70 nucleic acid to one or more of: the expression level of the ZAP70 gene; the amount of VH gene mutation; and the expression level of the cell surface marker CD38, in a sample from the same patient.

33. A kit comprising: i) PCR primers for amplifying the ZAP70 nucleic acid; and ii) means for detecting the presence of base changes in the amplified ZAP70 nucleic acid sequence.

34. A kit according to claim 33 wherein the means for detecting the presence of base changes comprises a restriction endonuclease that cleaves at a target sequence, wherein methylation in the ZAP70 nucleic acid either disrupts or otherwise blocks said target sequence or creates said target sequence in the ZAP70 nucleic acid.

35. A kit according to claim 33 wherein the means for detecting the presence of base changes comprises a labelled oligonucleotide that is adapted to hybridise selectively to a sequence incorporating a base change caused by one of methylation or unmethylation.

36. A kit according to claim 33 wherein the means for detecting the presence of base changes comprises a tailed nucleic acid primer having a ZAP70 template binding region and a tail comprising a linker and a ZAP70 target binding region.

37. A kit according to any one of claims 33 to 36 comprising a modifying agent that converts either an unmethylated or methylated base to another base.

38. A kit according to claim 37 wherein the modifying agent is a bisulphite salt.

39. A kit according to any one of claims 33 to 38 wherein the PCR primers are suitable for amplifying all or part of the sequence from base 1 to base 2858 of the ZAP70 sequence shown in Figure 8.

40. A PCR primer pair suitable for amplifying a ZAP70 nucleic acid, wherein the PCR primers are shown in Table 1 or Table 2.