WO2012050303A2

WO2012050303A2 - Pharmaceutical composition for cancer prevention and treatment containing the c12orf59 gene or protein as an active ingredient

Info

Publication number: WO2012050303A2
Application number: PCT/KR2011/006584
Authority: WO
Inventors: 김세미; 이윤희
Original assignee: 한국생명공학연구원
Priority date: 2010-10-15
Filing date: 2011-09-06
Publication date: 2012-04-19
Also published as: WO2012050303A3

Abstract

[Abstract] The present invention relates to a pharmaceutical composition for cancer prevention and treatment containing the C12orf59 (chromosome 12 open reading frame 59) gene or C12orf59 protein, or else a fragment thereof, as an active ingredient, and relates to a method for screening cancer-diagnosis or cancer-treatment agent candidate substances using the same, and, more specifically, it has been confirmed that when the C12orf59 protein or a fragment thereof is over-expressed in cancer cell lines, there is a reduction in the expression of ITGA5 which is involved in cancer cell invasion and hence there is a reduction in cancer-cell invasion ability, whereas when the expression of C12orf59 genes is inhibited in cancer cell lines, there is an increase in cancer cell invasion and there is an increase in cancer-cell survivability, and various cell signal transmission pathways are activated, and it has been confirmed that the C12orf59 gene has a function as a tumour suppressor through this. Consequently, the C12orf59 gene or C12orf59 protein, or else a fragment thereof can not only be used to advantage in a pharmaceutical composition for cancer prevention and treatment but can also be used to advantage in a method for screening cancer-diagnosis or cancer-treatment agent candidate substances using the same.

Description

【Specification】

[Name of invention]

C 1 2 0 r f 5 9 A pharmaceutical composition for the prevention and treatment of cancer containing the gene or protein as an active ingredient

Technical Field

The present invention relates to a pharmaceutical composition for preventing and treating cancer containing C12orf59 protein or fragment thereof, or polynucleotide encoding the same as an active ingredient.

Background Art

The C12orf59 (chromosome 12 open reading frame 59) gene is conserved in humans, chimpanzees, dogs, cows, rats, rats, and chickens, and isoforms have been reported in two sequences (BC131523, 183a. A. ; 530_153022, 163a.a.), although amino acid sequencing is expected to be a membrane protein, its function is not yet clear.

W0 2010/037859 and US 2009/0163435 describe the association of the C12orf59 gene with cancer, but it relates to the regulation of gene expression that is altered by the treatment of anticancer agents and drugs. To date, the expression and function of the C12orf59 gene in relation to cancer Has not been reported. Cancer, on the other hand, is one of the biggest diseases that threaten human health. It is a disease that occurs when cells multiply through a series of mutations and grow in an unlimited, unregulated fashion.

Various biochemical mechanisms related to cancer have been elucidated and therapeutic agents have been developed. However, there are no fundamental therapeutic methods for cancer, and therefore, various biomolecules related to cancer are identified and targeted. Efforts are being made to develop drugs, and efforts are being made to combine some of these drugs to improve cancer treatment. Therefore, efforts to further discover target molecules related to cancer are very important. Colorectal cancer is a refractory disease that causes 1 million patients worldwide and 530,000 deaths annually. All cancers develop in Korea due to aging and changes in dietary patterns. It is growing at a fast pace, ranking third at 12.7% of life. Current anti-cancer agents that are effective against colorectal cancer include fluropyrimidine-based drugs such as 5-F oil, UFT, and capecitabine (brand name: Zeloda), irinotecan (trade name: Gamputo), and oxaliplatin. In the seven major pharmaceutical markets in the US and Europe, the colorectal cancer drug market is expected to grow rapidly from $ 900 million to $ 7.7 billion in 2017. The constant use of such drugs has always been a problem of increased resistance and side effects, and it is time to study the development and diagnosis of new therapeutic agents.

Cancer Fetal Antigen (CEA), currently used as a diagnostic marker for colorectal cancer, is a type of glycoprotein that is normally produced during fetal period and is higher than that of newborns in adults because it stops producing it before it is born. If the level of the antigen (CEA) is present, this suggests that there may be colorectal cancer or other cancers, but this level may increase in patients with cirrhosis, liver disease, alcoholic pancreatitis, and smokers, and it is used as a supplement. . Accordingly, the present inventors confirmed the expression of the C12orf59 gene in cancer cell lines as a result of the study for the diagnosis of cancer or the development of a cancer treatment agent, and in the case of overexpressing the C12orf59 protein or fragment thereof in the cancer cell line, It was confirmed that the expression of ITGA5 was decreased and the invasion ability of cancer cells was decreased. When the expression of the C12orf59 gene was inhibited in the colorectal cancer cell lines, the cell infiltration was increased, the cell viability was increased, and various cell signaling was activated. ， Proving that the C12orf59 gene has a function as a tumor suppressor, through which the C12orf59 gene or protein may be used as a pharmaceutical composition for the prevention and treatment of cancer, and the screening of cancer diagnosis or cancer therapeutic candidates using the same. The present invention has been completed by revealing that it can be usefully used in the method.

[Detailed Description of the Invention]

[Technical problem]

An object of the present invention to provide a pharmaceutical composition for preventing and treating cancer containing C12orf59 ((chromosome 12 open reading frame 59) protein or a fragment thereof as an active ingredient.

Still another object of the present invention is to validate a vector comprising a polynucleotide encoding a C12orf59 protein or a fragment thereof or a cell comprising the vector. It is to provide a pharmaceutical composition for the prevention and treatment of cancer containing powder. In addition, another object of the present invention is to provide a pharmaceutical composition for preventing and treating cancer, which contains an expression or activity inducing agent of C12orf59 protein or fragment thereof as an active ingredient.

Still another object of the present invention is to provide a method for diagnosing or monitoring cancer using the C12orf59 gene as a marker.

It is still another object of the present invention to provide a method for screening a cancer drug candidate by measuring the activity of C12orf59 gene expression or C12orf59 protein or fragment thereof.

Another object of the present invention is to provide a method for treating cancer, comprising administering a pharmaceutically effective amount of C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof to a subject with cancer.

It is still another object of the present invention to provide a method for preventing cancer, comprising administering to a subject a pharmaceutically effective amount of C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof.

Still another object of the present invention is a vector comprising a polynucleotide encoding a pharmaceutically effective amount of a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or an individual suffering from cancer containing a cell containing the vector. It is to provide a method for treating cancer comprising the step of administering to.

Still another object of the present invention is to administer to a subject a vector comprising a polynucleotide encoding a pharmaceutically effective amount of a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or a cell comprising the vector. It is to provide a cancer prevention method comprising the step.

Still another object of the present invention is to provide a C12orf59 (chromosome 12 open reading frame 59) protein or a fragment thereof for use in the manufacture of a medicament for preventing and treating cancer.

In addition, another object of the present invention is a vector comprising a polynucleotide encoding a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof for use in the manufacture of a medicament for the prevention and treatment of cancer, or the vector It is to provide a cell containing.

Technical Solution In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing and treating cancer containing C12orf59 (chromosome 12 open reading frame 59) protein or a fragment thereof as an active ingredient.

The present invention also provides a vector comprising a polynucleotide encoding a C12orf59 protein or a fragment thereof or a pharmaceutical composition for cancer prevention and treatment containing the cells containing the vector as an active ingredient.

The present invention also provides a pharmaceutical composition for preventing and treating cancer, which contains an agent for inducing expression or activity of the C12orf59 protein or a fragment thereof.

In addition, the present invention provides a protein detection method for providing cancer diagnosis information comprising the following steps:

1) measuring the expression level of the C12orf59 protein or fragment thereof in a sample derived from a subject;

2) comparing the expression level of the C12orf59 protein or fragment thereof of step 1) with the expression level of the C12orf59 protein or fragment thereof of the normal individual-derived sample as a control;

3) Determining that there is a high risk of cancer if the expression level of the C12orf59 protein or fragment thereof is reduced compared to the control group.

The present invention also provides a method for screening a cancer drug candidate, comprising the following steps:

1) treating the test compound or composition to a cell line expressing C12orf59 protein or fragment thereof;

2) measuring the expression level of the C12orf59 protein or fragment thereof in the treated cell line of step 1); And

3) selecting a test compound or composition in which the expression level of the C12orf59 protein or fragment thereof of step 2) is increased compared to a control cell line that has not been treated with the test compound or composition.

1) treating the test compound or composition to a C12orf59 protein or fragment thereof;

2) measuring the activity of the C12orf59 protein or fragment thereof of step 1); And

3) the activity of the C12orf59 protein or fragment thereof of step 2) is a test compound or Selecting the increased test compound or composition compared to the activity of the C12orf59 protein or fragment thereof untreated with the composition.

The present invention also provides a method for treating cancer comprising administering to a subject with cancer an effective amount of C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof.

The present invention also provides a method for preventing cancer comprising administering to a subject an effective amount of a C12orf 59 (chromosome 12 open reading frame 59) protein or fragment thereof.

In addition, the present invention comprises the steps of administering a vector comprising a polynucleotide encoding a pharmaceutically effective amount of a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or a cell comprising the vector to a subject with cancer It provides a cancer treatment method comprising a.

The present invention also provides a method comprising administering to a subject a vector comprising a polynucleotide encoding a pharmaceutically effective amount of a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or a cell comprising the vector. Provides ways to prevent cancer

The present invention also provides a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof for use in the manufacture of a medicament for the prevention and treatment of cancer.

In addition, the present invention provides a vector comprising a polynucleotide encoding a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or a cell comprising the vector, for use in the manufacture of a medicament for the prevention and treatment of cancer. to provide.

Advantageous Effects

The C12orf59 gene of the present invention inhibits the invasion of cancer cells, inhibits cell survival under cell-non-adherent conditions, and overexpression of the C12orf59 protein or fragment thereof reduces cancer cell invasion, thereby reducing the C12orf59 gene, or protein or fragment thereof. Not only can be usefully used in cancer prevention and therapeutic pharmaceutical compositions, but also useful for screening cancer drug candidates or clinical markers for metastasis diagnosis or prediction of various cancers. In addition, the method for the prevention and treatment of cancer using the same, and the use of the pharmaceutical composition for the prevention and treatment of cancer It can be used as.

[Brief Description of Drawings]

La is a result of confirming the expression of C12orf59 in seven colon cancer cell lines by semiquantitative PCR.

Lb is the result of confirming the expression of C12orf59 by semiquantitative PCR in two ovarian cancer cell lines and one colorectal cancer cell line:

SK0V-3: ovarian cancer cell line;

IGR0V-1: ovarian cancer cell line; And

SW480: Colon cancer cell line.

Figure 2 shows the expression of C12orf59 in HEK293E, lung cancer cell line A549 and gastric cancer cell lines AGS, KATOIII, MKN28, MKN45, NCI-N87, SNU-216, SNU-638, SNU-668, SNU-719, TMKl by semiquantitative PCR. The result is.

3A is a sequence of a peptide epitope for the production of Poly-C12orf59 antibodies:

Peptide epitope wherein the third underlined amino acid sequence produced a polyclonal antibody.

Figure 3b is the result of verifying the antigen specific binding capacity of the prepared antibody:

HEK293E cells for transgenic cell lines transformed with pcDNA—myc, pcDNA-C12or f 59-i sof orml-myc, pcDNA-C12orf59- isoforml, pcDNA-C12orf59-isoform2-myc, and pcDNA-C12orf59-isoform2 vectors Cell lysates were used to determine whether the antibody recognized the C12orf59 protein;

Arrow: C12orf59 protein; And

peptide: The result of confirming the antigen specific binding ability of the antibody using the antigen peptide as a blocking reagent.

Figure 4 shows the results of overexpression of the C12orf59 protein in cancer cell lines and the location of intracellular C12orf59 protein under confocal microscopy:

Upper left: cells in which the pcDNA-myc vector was transformed into the SW480 cell line; Lower left and right: cells transformed with a p _C DNA-C12or f 59-i sof orml-myc vector into the SW480 cell line;

White areas near and inside the cell membrane: green: C12orf59;

Internal equivalent structures: DAPI: nucleus; Border around cell: red: F-actin; And

arrow: Results showing distinct cell surface localization examples of C12orf59. Figure 5a shows the transduction of C12orf59 protein with pcDNA-myc and C12orf59 protein overexpressing vectors pcDNA-C12orf59-isoforml-myc, pcDNA-C12or f 59-i sof orm2-myc, and pcDNA-C12orf59- isoformldel-myc vector in SW480 cell line After overexpressing, the invasiveness of the cancer cell line was examined.

Figure 5b is the result of overexpressing C12orf59 protein in SW480 cell line, counting the result of inhibiting cancer cell line invasion inhibition (* / <0.05, 0.001).

6A shows the result of confirming the change in the promoter activity of the AP-1 cis element after overexpression of the C12orf59 protein in the SW480 cell line Ο /? <0 · 05).

Figure 6b is a result of confirming the promoter activity change of ITGA5 after overexpressing the C12orf59 protein in SW480 cell line (* 5).

7a shows pcDNA- C12orf59-isoforml-myc, pcDNA-C 12or f 59-i so f or m2-myc, and pcDNA- overexpressing pcDNA-myc and C12orf59 proteins in HCT-15 cell lines.

The C12orf59isoformldel-myc vector was introduced to confirm the change of AP-1 activity due to overexpression of the C12orf59 protein (* /? <0.05).

Figure 7b is the result of Western blot analysis of the activity change of AP-1 activator after overexpression of C12orf59 protein in HCT-15 cell line.

Figure 7c is the result of densitometry showing the change in activity of AP-1 activator after overexpressing C12orf59 protein in HCT-15 cell line.

8A shows the results of gel suppression of C12orf59 gene inhibition after treatment with C12orf59 siRNA in SW480 cell line.

8b shows the results of confirming the change in cell morphology by introducing C12orf59 siRNA into SM80 cell line.

Figure 8c shows the results of the cell invasion after the introduction of C12orf59 siRNA in SW480 cell line (top: representative picture; bottom: comparison after repair).

Figure 9a is a result of examining the change in the degree of cancer cell invasion after introduction of C12orf59 siRNA in HCT-15 cell line.

Figure 9b is the result of counting by analyzing the invasion of cancer cells after suppressing the expression of C12orf59 in HCT-15 cell line (*? 0.05).

10 shows the results of confirming cell viability after the introduction of C12orf59 siRNA into the SW480 cell line. Figure 11 shows the results of Western blot analysis of changes in cell signaling after introduction of C12orf59 siRNA into S 80 cell line.

[Best form for implementation of the invention]

Hereinafter, the present invention will be described in detail. The present invention provides a pharmaceutical composition for preventing and treating cancer containing C12orf59 (chromosome 12 open reading frame 59) protein or a fragment thereof as an active ingredient. Preferably, the C12orf59 (chromosome 12 open reading frame 59) protein has one amino acid sequence selected from the amino acid sequences of 1) to 3), but is not limited thereto.

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2. The cancer is preferably any one selected from the group consisting of colorectal cancer, stomach cancer and lung cancer, but is not limited thereto.

The fragment preferably has an amino acid sequence set forth in SEQ ID NO: 27, but is not limited thereto. The present invention also provides a vector comprising a polynucleotide encoding a C12orf59 protein or a fragment thereof, or a pharmaceutical composition for cancer prevention and treatment containing the cell containing the vector as an active ingredient.

The C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof preferably has one amino acid sequence selected from the amino acid sequences of 1) to 3), but is not limited thereto:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence which shows at least 80% homology with SEQ ID NO: 1 or 2. The vector comprising the polynucleotide of the C12orf59 protein or fragment thereof is a vector comprising a linear DNA, a plasmid vector, a viral expression vector or a recombinant retrovirus vector, a recombinant ade, expressed in human or animal cells. It is preferably a recombinant virus vector comprising a nonovirus vector, a recombinant adeno-associated virus (AAV) vector, a recombinant herpes simplex virus vector or a recombinant lentivirus vector. However, the present invention is not limited thereto, and it is more preferably one selected from the group consisting of pSecTag-LK68, pLXSN—LK68, rAAV-LK68, and PMV-LK68.

Cells containing polynucleotides of the C12orf59 protein or fragments thereof are hematopoietic stem cells, dendritic cells, autologous tumor cells, and established tumor cells. It is preferably selected from the group consisting of, but is not limited thereto. The cancer is preferably any one selected from the group consisting of colorectal cancer, stomach cancer and lung cancer, but is not limited thereto.

The fragment preferably has an amino acid sequence set forth in SEQ ID NO: 27, but is not limited thereto. The present invention also provides a pharmaceutical composition for cancer prevention and treatment containing C12orf59 expression or activity inducing agent as an active ingredient.

The cancer is preferably any one selected from the group consisting of colorectal cancer, stomach cancer and lung cancer, but is not limited thereto. In a specific embodiment of the present invention, to confirm the expression of the C12orf59 gene in colorectal cancer, lung cancer and gastric cancer cell lines, total RNA was isolated from each cell line and RT-PCR was performed. As a result, the expression of Colo205, HCT-15, and SW480 cell lines was confirmed among colon cancer cell lines (see FIGS. La and lb), and the levels of gastric cancer cell lines ΚΑΤ0ΙΠ and NCI-N87 were similar to those of the colon cancer cell line SW480 cell line. It was expressed in the lung cancer cell line A549, gastric cancer cell lines AGS, MKN28, MKN45 was expressed at a relatively high level, it was confirmed that it is expressed at a very low level in gastric cancer cell line TMK1 (see Figure 2).

Through this, it was confirmed that the C12orf59 gene is expressed in two forms of isoforms in various cancer cell lines, and the expression level is different according to the cell lines.

Further, in another specific embodiment of the present invention, the pcDNA-C12orf59-isoforml-myc vector comprising the pcDNA-myc and the prepared C12orf59 construct is a SW480 cell. When transformed overexpressed and confirmed the position of the C12orf59 protein in the cell by i 睡 unofluorescence technique, it was confirmed that the C12orf59 is located on the surface of the cancer cells (see Fig. 4).

Further, in another specific embodiment of the present invention, the pcDNA-C12orf59-isoforiTil-myc, pcDNA-C12orf59-isoform2-myc, and pcDNA-C12orf59-isoformldel-myc vectors comprising the pcDNA-myc, C12orf59 expression constructs As a result of confirming the invasion capacity of cancer cells by transforming the SW480 cell line, it was confirmed that the invasion is reduced by overexpression of C12orf59 (see Figs. 5a and 5b), pcDNA-myc, pcDNA containing C12orf59 expression construct -C12orf59-isoforml-myc, pcDNA-C12or f 59-i sof orm2-myc, and pcDNA-C12or f 59-i sof ormlde 1-myc vectors were transformed into SW480 cell lines and measured for changes in promoter activity through luciferase assay. As a result, it was confirmed that the activity of the AP-1 cis element and the ITGA5 promoter was reduced by C12orf59 overexpression (see FIGS. 6A and 6B). In addition, pcDNA-C12orf59-isoforml-myc, pcDNA-C12orf59-isoform2-myc, pcDNA-C12orf59-i sof ormlde 1—myc vector containing the pcDNA-myc and C12orf59 expression constructs in the HCT-15 cell line, and AP — 1 cis— After transfecting the element reporter and confirming the activity of the AP-1 cis-element promoter through luciferase assay, it was confirmed that the activity of cis-element AP-1 was reduced by the C12orf59 protein (see FIG. 7A). The promoter region of ITGA5 contains the AP-1 site, and the transcription factor AP-1 has been reported to induce the expression of ITGA5 (Corbi et al., FEBS Letters (2000) 474: 201-207). It can be inferred that the expression of ITGA5 is decreased by decreasing the activity of AP-1, and it is reported that it is involved in cancer cell invasion and wound healing, and is highly expressed in cells with higher invasiveness than cells with low invasive capacity among colon cancer cells. Integrin a5, an integrin family, has been shown to contribute to cancer cell migration and invasiveness. Therefore, it was confirmed that the C12orf59 protein inhibits cancer cell invasion by inhibiting the transcription factor AP-1 activity and inhibiting the expression of integrin a5 (ITGA5) in colorectal cancer cells. In another specific embodiment of the present invention, C12orf59-specific siRNA was transformed into SM80, a colorectal cancer cell line, and the expression level and cell morphological change of C12orf59 in the cell were confirmed. As a result, C12orf59-specific siRNA was introduced into SW480 cell line. After 48 hours, it was confirmed that the expression of C12orf59 was inhibited (see FIG. 8A), and the cell morphology was spread and the formation of lamellipodia was increased (see FIG. 8B).

Through this, C12orf59 siRNA inhibited the expression of C12orf59 in cancer cell lines, and due to inhibition of C12orf59 expression, cancer cells were typically highly mobile. The shape was confirmed to change.

In addition, in another specific embodiment of the present invention, 48 hours after transforming the C12orf59-specific siRNA into the SW480 cell line, invasion and cancer cell viability analysis were performed. As a result, inhibition of expression of C12orf59 prevented cancer cell infiltration. Increase (see FIG. 8C) and induce anoikis (apoptosis in unattached) -resistance (see FIG. 10).

In another specific embodiment of the present invention, 48 hours after transforming the C12orf59-specific siRNA into the HCT-15 cell line, the invasion assay was performed. As a result, inhibition of the expression of C12orf59 increased cancer cell infiltration. Confirmation (see FIGS. 9A and 9B).

In addition, in another specific embodiment of the present invention, cancer cell signaling activation by C12orf59 specific siRNA was confirmed by Western blot analysis using cell lysate, and as a result, ERK1 / 2, p38 and It was confirmed that phosphorylation of JNK was increased (see FIG. 11). Through this, it was confirmed that MAPK activation contributed to invasion and cell survival of cancer cells induced by inhibition of C12orf59 expression. Through this, it was confirmed that the C12orf59 protein or fragment thereof of the present invention inhibits the invasive ability of cancer cells, and when the expression of C12orf59 is inhibited, the invasive ability of cancer cells is increased and the cell survival is inhibited under the non-cell adhesion conditions. . Therefore, a vector comprising a C12orf59 protein or a fragment thereof, or a polynucleotide encoding the same, or a cell including the vector may be usefully used for a pharmaceutical composition for preventing and treating cancer. The therapeutically effective amount of the composition of the present invention may vary depending on several factors, for example, the method of administration, the target site, the condition of the patient, and the like. Therefore, when used in humans, the dosage should be determined in an appropriate amount in consideration of safety and efficiency. It is also possible to estimate the quantities used in humans from effective amounts determined through animal testing. These considerations should be considered when determining the effective amount, for example in Hardman and Limbird, eds. , Goodman and Gi lman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.. Mart in ed. , Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

Compositions of the present invention may also include carriers, diluents, excipients or combinations of two or more of those commonly used in biological agents. Pharmaceutically acceptable Suitable carriers are not particularly limited as long as they are suitable for in vivo delivery of the composition, for example, Merck Index, 13 th ed. , Merck & Co. Inc. Compounds, saline, sterile water, Ringer's solution, complete saline solution, dextrose solution, maltodextrin solution, glycerol, ethane, and one or more of these components may be mixed and used. Other conventional additives such as bacteriostatic agents can be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate main formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Furthermore, it may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, East on PA, 18th, 1990).

The composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions. The composition of the present invention comprises 0.0001 to 10% by weight of the protein, preferably 0.001 to 1 weight ¾, based on the total weight of the composition. The compositions of the present invention can be administered parenterally (eg, intravenously, subcutaneously, intraperitoneally, or topically) or orally, depending on the desired method, and the dosage is determined by the patient's weight, age, sex, health, diet The range varies depending on the time of administration, the method of administration, the rate of excretion and the severity of the disease. The daily dose of the composition according to the present invention is 0.0001 to 10 mg /, preferably 0.0001 to 5 mg /, it is more preferably administered divided once to several times a day. In the case of a vector comprising a polynucleotide encoding the C12orf59 protein or fragment thereof of the present invention, it is preferable to contain 0.05 to 500 mg, more preferably 0.1 to 300 mg, and to encode the C12orf59 protein or fragment thereof. In the case of a recombinant virus containing a polynucleotide, it is preferable to contain 103 to 1012 111 (10 to 1010 PFU), more preferably 105 to 1010 IU, but is not limited thereto.

In addition, in the case of a cell containing a polynucleotide encoding the C12orf59 protein or fragment thereof of the present invention, it is preferable to contain 103 to 108, more preferably to contain 104 to 107, but is not limited thereto. It doesn't work.

In addition, an effective dose of a composition containing a vector or a cell comprising a polynucleotide encoding a C12orf59 protein or fragment thereof of the present invention as an active ingredient is 0.05 to 12,5 rag / kg, for recombinant viruses 107 to 1011 virus particles (105 to 109 IU) / kg, 103 to 106 cells / kg for cells, preferably 0.1 to 10 nig / kg for vectors and 108 to 1010 particles for recombinant viruses ( 106-108 IU) / kg, 102-105 cells / kg for cells, may be administered 2-3 times a day. The composition as described above is not necessarily limited thereto, and may vary depending on the condition of the patient and the degree of development of neurological diseases. In addition, the present invention provides a protein detection method for providing cancer diagnosis information comprising the following steps:

1) as an experimental group, the expression level of the C12orf59 protein or fragment thereof in the sample-derived sample;

3) Determining that there is a high risk of cancer when the expression level of C12orf59 protein or fragment thereof is reduced compared to the control group.

In the protein detection method for providing cancer diagnosis information, the expression level of C12orf59 in step 1) is Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining method. (i mmunoh ist ochem i ca i staining), immunoprecipitation (i 画 unoprecipitation) and immunofluorescence (immunofluorescence) is detected by any one method selected from the group consisting of, but not limited to.

The C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof preferably has any one amino acid sequence selected from the amino acid sequences of 1) to 3), but is not limited thereto:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence which shows at least 80% homology with SEQ ID NO: 1 or 2.

The fragment preferably has an amino acid sequence set forth in SEQ ID NO: 27, but is not limited thereto. In a specific embodiment of the invention, C12orf59 in colorectal cancer, lung cancer and gastric cancer cell lines The expression of C12orf59 vector in the SW480 cell line and the HCT-15 cell line was confirmed by overexpression, and the expression of ITGA5 involved in cancer cell invasion was reduced and cancer cell invasion was decreased. In addition, it was confirmed that treatment of C12orf59 siRNA with SW480 cell line inhibited its expression, thereby increasing the invasiveness of cancer cells, increasing cell viability under unattached conditions, and activating the intracellular signaling system. By inhibiting the expression of C12orf59 siRNA in the cell line, it was confirmed that cancer cell invasion ability is increased.

Therefore, the C12orf59 protein or fragment thereof has the activity of inhibiting cancer cell invasion ability, inhibiting cell survival under non-cell conditions, and functioning as a tumor suppressor. Fragments can be usefully used in protein detection methods to determine the risk of cancer by measuring changes in their expression levels to provide information for cancer diagnosis. The present invention also provides a method for screening a cancer drug candidate, comprising the following steps:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2.

The fragment preferably has an amino acid sequence set forth in SEQ ID NO: 27, but is not limited thereto. In a specific embodiment of the present invention, confirming that C12orf59 is expressed in cancer cell lines. In addition, by transforming and overexpressing a vector capable of expressing the C12orf59 protein or fragment thereof in the SW480 cell line and the HCT-15 cell line, it was confirmed that the expression of ITGA5, which is involved in cancer cell infiltration, was reduced and the cancer cell invasion ability was reduced. In addition, it was confirmed that treatment with C12orf59 siRNA in SW480 cell line inhibited its expression, thereby increasing the invasiveness of cancer cells, increasing cell viability under unattached conditions, and activating intracellular signaling system. HCT-15 By inhibiting the expression of C12orf59 siRNA in the cell line, it was confirmed that cancer cell invasion ability is increased.

Accordingly, the C12orf59 protein or fragment thereof has the activity of inhibiting cancer cell invasion ability, inhibiting cell survival under non-cell attachment conditions, and functioning as a tumor suppressor, thereby preventing C12orf59 protein or its fragments. The fragments can be usefully used in the method for screening cancer drug candidates. The present invention also provides a method for screening a cancer drug candidate, comprising the following steps:

3) selecting the test compound or composition in which the activity of the C12orf59 protein or fragment thereof of step 2) is increased compared to the activity of the C12orf59 protein or fragment thereof which has not been treated with the test compound or composition.

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2.

The fragment preferably has an amino acid sequence set forth in SEQ ID NO: 27, but is not limited thereto. In a specific embodiment of the present invention, it is confirmed that C12orf59 is expressed in cancer cell lines, and by transforming a vector capable of expressing C12orf59 protein or fragment thereof in SW480 cell line and HCT-15 cell line, it is involved in cancer cell invasion. ITGA5's It was confirmed that the expression decreased and the invasive capacity of cancer cells. In addition, it was confirmed that treatment of C12orf59 siRNA with SW480 cell line inhibited its expression, increased cancer cell invasiveness, increased cell viability under unattached conditions, and activated intracellular signaling system. HCT-15 cell line Treatment with C12orf59 siRNA inhibited its expression, thereby confirming the increased invasiveness of cancer cells.

Therefore, C12orf59 of the present invention inhibits the invasion of cancer cells, has the activity of inhibiting cell survival under the condition of no cell attachment, and has a function as a tumor suppressor, C12orf59 protein or fragment thereof is a cancer It can be usefully used for screening therapeutic candidates. The present invention also provides a method for treating cancer, comprising administering a pharmaceutically effective amount of C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof to a subject with cancer. The present invention also provides a method for preventing cancer, comprising administering to a subject a pharmaceutically effective amount of C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof. The present invention also provides a cancer comprising a vector comprising a polynucleotide encoding an effective amount of a C12orf59 (chromosotne 12 open reading frame 59) protein or fragment thereof, or a cell comprising said vector to a subject with cancer. Provide a method of treatment. The invention also provides a method for preventing cancer comprising administering to a subject a vector comprising a polynucleotide encoding an effective amount of a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or a cell comprising said vector. to provide.

The cancer is preferably any one selected from the group consisting of colorectal cancer, stomach cancer and lung cancer, but is not limited thereto. In a specific embodiment of the present invention, by transforming a vector capable of expressing the C12orf59 protein or fragment thereof in the SW480 cell line and HCT-15 cell line, which is a colon cancer cell line By overexpression, it was confirmed that the expression of ITGA5 involved in cancer cell infiltration was decreased, and cancer cell invasion ability was decreased. When siRNA was used to inhibit C12orf59, cancer cell invasion ability was increased, and cell viability under unattached conditions. In addition, it was confirmed that the intracellular signaling system is activated.

Thus, since the C12orf59 protein of the present invention functions as a tumor suppressor, a vector comprising the C12orf59 protein or a fragment thereof, or a polynucleotide encoding the same, or a cell comprising the vector, Or by administering to a subject with cancer, it can be usefully used in the method of preventing or treating cancer. The cancer prevention or treatment method of the present invention may be parenterally administered (for example, intravenously, intramuscularly, intraperitoneally, subcutaneously or topically) or orally, as desired. The range varies depending on age, sex, health condition, diet, time of administration, method of administration, excretion rate and severity of disease. The dose of the protein according to the present invention is 0.738 ug-7.38 g assuming an adult male is 60 kg (US FDA standard), preferably 7.38 ug ~ 0.738 g (12.3 mpk), which is administered once Preferably, the method of administration can be determined according to the patient's needs. The present invention also provides a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof for use in the manufacture of a medicament for the prevention and treatment of cancer. In addition, the present invention provides a vector comprising a polynucleotide encoding a C12orf59 (chromosome 12 open reading frame 59) protein or a fragment thereof, or a cell comprising the vector, for use in the manufacture of a medicament for preventing and treating cancer. to provide.

The cancer is preferably any one selected from the group consisting of colon cancer, stomach cancer and lung cancer, but is not limited thereto. In a specific embodiment of the present invention, after overexpressing the C12orf59 protein using a vector comprising a chromosome 12 open reading frame 59 (C12orf59) protein or a fragment thereof and a polynucleotide encoding the same, the cell is overexpressed in a cancer cell line. The C12orf59 protein inhibited the expression of integrin a5 (ITGA5) by inhibiting the activity of the transcription factor AP-1 related to cancer cell invasion, thereby inhibiting cancer cell invasion. It was confirmed that it can be usefully used for the preparation. Hereinafter, the present invention will be described in detail by Examples, Experimental Examples and Preparation Examples.

However, the following Examples, Experimental Examples and Preparation Examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following Examples, Experimental Examples, and Preparation Examples.

[Form for implementation of invention]

Example 1 Cancer Cell Line Culture

WiDr, Caco-2 cell line 10% FBS (fetal bovine serum: GIBCO, USA), penicillin-streptomycin, L-glutamine, sodium pyruvate, The cells were cultured in MEM (minimal essential medium: GIBCO, USA) medium containing non-essential ial amino acids.

HCT116, HT29, Colo205, SW480, SW620, HCT15, SK-OV-3, IGR0V-1 cell lines RPM 11640 with 10% FBS, penicillin-straptomycin, L-glutamine, sodium pyruvate (GIBCO, USA) Cultured in the medium. The HEK293E (Human Embryonic Kidney 293E) cell line was cultured in DMEMOXilbeco's Modified Eagle Medium: GIBCO, USA) containing 10% FBS, penicillin-strapmycin, L-glutamine, sodium pyruvate, and glucose.

Lung cancer cell line A549 and gastric cancer cell line AGS, KAT0III, MKN28, MKN45, NCI-N87, SNU-216, SNU-638, SNU-668, SNU-719, TMK1 to 10% FBS, penicillin-streptomycin, L-glutamine, sodium Cultured in RPMI1640 (GIBC0, USA) medium containing pyruvate.

MKN28, MKN45, SNU-216, SNU-638, SNU-668, and SNU-719 cell lines were provided by Korea Cell Line, Seoul, and TMK1 was provided by Professor Park Young-kyu of Hwasun Jeonnam National University Hospital. All cell lines were cultured at 37 ^° C. and 5% CO ₂ conditions.

Example 2 Confirmation of C12orf59 Gene Expression in Cancer Cell Lines

In order to confirm the expression of the C12orf59 gene in cancer cell lines, Example 1 TrizoKInvitrogen) was used to isolate total RNA from various cell lines cultured under the conditions of RT-PCR.

Specifically, RT-PCR reaction was carried out by the method as shown in the following figure, wherein the primer sequence used was forward primer: 5'- cagccctgctgtatttcatcc -3 '(SEQ ID NO: 3) and reverse primer: 5'- ggccaaacaccgactgcag -3' (SEQ ID NO: 4), and cDNA was synthesized from 1 ug RNA using Bioneer's cDNA synthesis pre-mix kit (cat. K-2046).

Meanwhile, beta-actin was used as an internal control of PCR reaction, and the primers used were forward primers: 5'-GCTCGTCGTCGAC CGGCTC-3 '(SEQ ID NO: 5) and reverse primers: -CAAACATGATCTGGGTCATCTTCTC-S' (SEQ ID NO: 6), and the resulting PCR product was electrophoresed on 2% agarose gel or 5%, 8% polyacrylamide gel to confirm its expression.

As a result, DNA fragments of 297 bp (for isoforml (183 a.a)) and 253 bp (for isoform2 (163 aa)) were amplified according to the type of subtype Usoform of the C12orf59 gene. (Very low level), HCT-15 (high level), SW480 (medium level), and expression (figure la and lb), both 183a. a. Subtypes were expressed relatively distinctly.

In addition, the gastric cancer cell lines ATOIII and NCI-N87 were expressed at intermediate levels similar to those of the colon cancer cell line SW480 cell line, and the lung cancer cell line A549, gastric cancer cell lines AGS, MKN28 and MKN45. It was confirmed that the expression at a very low level (Fig. 2). In particular, lung cancer cell line A549, gastric cancer cell lines MKN45 and NCI-N87 163a. a. It was confirmed that the expression of subtypes is relatively high.

Through this, it was confirmed that the C12orf59 gene is expressed as two types of subtypes in various cancer cell lines, and the expression level is different according to the cell lines. Example 3 Preparation of C12orf59 Expression Vectors

To investigate the effects of C12orf59 expression on cancer cell lines, several types of vectors with the C12orf59 gene were inserted.

Specifically, the amino acid immediately following myc in the pcDNA3.1-myc his A vector (Invitrogen) sequence was determined using a site-directed mutagenesis method (Quik kChange II site-directed mutagenesis kit, Stratagene). stop codon), and then the vector was subjected to PCR reaction using the primer sequences shown in Table 1 below under the conditions described in Table 2, and then subtypes of C12orf59 using Xhol / Hindlll restriction enzyme. isoform) 2 types (based on UniProtKB / Swiss-Prot; Q4KMG9-l (183a.a isoform 1), Q4KMG9-2 (163a.a isoform 2)) and 183a. a 66a, amino acids 1 to 66 from which the cytoplasmic domain has been removed from isoform 1. A form was subcloned. 183a, an isoform of C12orf59, for the expression of a C12orf59 protein that does not express a myc protein present in the vector. a isoform 1, 163a. a isoform 2, and 66a. The termination sequence was placed immediately after the a form and subcloned.

Table 1

ᅳ

99-2

ft $ -MttMa9ctttc «gttcM9 * gcu tJttcg-) '

a2

* g9C g atgtcgt9 cgg

^ mcM [Table 2]

Site-directed mutagenesis

40 cycles

72'C 72 «C

58 ^» C / 30sec 5mln

30sec 4 "C

As a result, pcDNA-C12or f 59-i sof orml-myc, pcDNA-C12orf59-isoformldel-myc, pcDNA-C12orf59- isoforml, pcDNA-C12orf59-isoform2 in the pcDNA—myc his A vector. -myc, and pcDNA-C12or f 59-i sof orm2 recombinant vectors were constructed.

Example 4 Integrin alpha 5 promoter-reporter construct construction

For Promoter reporter assay, an Integrin α5 promoter-reporter construct was constructed.

Specifically, primers 5'-CCGCTCGAGGAGCTGMGGTTGGGTCC-3 '(SEQ ID NO: 25) and 5'- in genomic DNA of colon cancer cell line SW480.

PCR was performed to amplify the human integrin alpha 5 promoter region using CCGCTCGAGCCGTCTGTTCCCGGC-3 '(SEQ ID NO: 26). The integrin alpha 5 promoter site, which is an amplification product obtained after PCR, was cut with restriction enzyme Xhol and inserted into pGL3 basic vector (Promega, Southampton, UK) to prepare an integrin alpha 5 promoter-reporter construct. Example 5 Poly-C12orf59 Antibody Preparation and Effect Confirmation

Antibodies specific for C12orf59 were customized to Youngin Frontier to detect expressed C12orf59.

Specifically, by immunizing rabbits with one peptide (the third underlined amino acid sequence of FIG. 3A) of three epitopes with high possibility of producing an antibody, a polyclonal antibody ) Was customized (Youngin Frontier) (FIG. 3A) and Western blots were performed for validation of the prepared antibodies.

Specifically, pcDNA-myc, pcDNA-C12or f 59-i so f orml-myc, pcDNA-C12orf59- isoforml, pcDNA-C12or f 59-i so f orm2-myc prepared in Example 3 on HEK293E cells, and 48 hours after the pcDNA-C12orf59-isoform2 vector was introduced into the PEI reagent, the cells were transferred to RIPA bufferdO mM Tris, pH7.2, 150 mM NaCl, 1% deoxycholate, 1% Triton X-100, 0.1% SDS, 1 lysate with mM sodium orthovanadate, 50 mM NaF, 1 mM PMSF, complete protease inhibitor) and quantify the protein in lysate obtained from the cells. 30 ug of quantitative cell lysates were heated in combination with SDS sample buffer and electrophoresed on 18% SDS-PAGE gel. Electrophoretically separated proteins were transferred to nitrocellulose membranes and blocked with 5% skim milk. Subsequently, the prepared antibody was reacted with 1: 2000 and reacted with a primary antibody, and then reacted with a secondary antibody (Bio-rad, USA) to which horseradish peroxidase was bound. Thereafter, the ECL kit (ECL Plus, Amersham, USA) was treated according to the manufacturer's method to analyze the affinity of the antibody for antigen.

As a result, it was confirmed that two antibodies (Rabbit No. 1 and Rabbit No. 2) obtained from two rabbits clearly recognized the C12orf59 protein from the cell lysate in which the C12orf59 protein was expressed (FIG. 3B, left panel, arrow). ). In addition, when such a band was blocked using a blocking reagent of the antigen peptide used for antibody production, by confirming that the identified band disappeared (FIG. 3B, right panel), the band was a C12orf59 protein. -It was confirmed that the specific, and through this it was confirmed that the antibody produced by ordering is a C12orf59 antibody that specifically recognizes the C12orf59 protein.

Experimental Example 1 Effect of C12orf59 Overexpression in Cancer Cell Lines

<1-1> Location of C12orf59 in Cancer Cell Lines

Electroporation of pcDNA-myc and pcDNA-C12orf 59- isof orml-myc vectors in colon cancer cell line SW480 to identify the intracellular location of C12orf59 in cancer cell lines (microporat ion) (Neon Transfection system, Invi trogen) was transformed.

Specifically, after harvesting SW480 cells, washed with PBS, R buffer (Neon

Resuspended at a concentration of 3xi0 ⁵ cells / 10 ul with Transfection system, Invitrogen), and then added pcDNA-myc and pcDNA-C12orf59-isoforml—myc vector DNA and transfected with an electroporation device (Neon Transfection system, Invitrogen). Switched. Subsequently, the cells adhere to cover slips, and after 48 hours, the attached cells are fixed with 3.7% paraformaldehyde dissolved in PBS, washed three times with PBS, and infiltrated with 0.3% Triton-X-100. After washing three times, the cells were blocked with 10% normal Goat serum, and then reacted with a C12orf59 antibody (dilution at 1: 500, YoungInfrontier) and fluorescently bound secondary antibody ( Vector lab, USA). In addition, F-actin and nuclei were stained and confirmed by confocal microscopy.

As a result, it was confirmed that the C12orf59 protein is present on the cell surface (FIG. 4), and the presence of the transmembrane domain on the amino acid sequence of C12orf59 confirmed that the C12orf59 protein could be located on the cell surface.

<1-2> Changes of Invasion Capacity by C12orf59 Overexpression in Cancer Cell Lines

To analyze the change of invasion ability by C12orf59 overexpression in cancer cell lines, we used pcDNA-myc, pcDNA—C12orf59-isoforml-iriyc, pcDNA-C12orf59-isoform2-myc, and pcDNA-C12or f 59-i sof ormlde in colon cancer cell line SW480. 48 hours later, an invasion assay was performed by transforming the 1-myc vector.

Specifically, the 250 membranes of a 24-well transwell plate (8 urn pore size; Costar, USA) were diluted in serum-free medium for infiltration analysis.

It was coated with a concentration of 100 id Matrigel (BD Biosciences, USA) and solidified by standing at room temperature for 1 hour. For migration and invasion experiments, the lower layer of the transwell plate was coated using collagen type I (Sigma) 100 ^ at a concentration of 20 μ / ίαί. PcDNA-myc, pcDNA-C12orf59-isoforml-myc, pcDNA-C12or f 59- by the microporat ion of <Experimental Example 1-1> in a serum-free medium in the upper chamber of the 24-well transwell plate. i sof orm2-myc, and pcDNA—C12orf 59- i sof ormlde 1-myc vector, each transformed 2.5X 10 ⁴ , 3X 10 ⁴ transformed cells transformed, 37 ^° C, 5% C0 ₂ trillion The gun was allowed to migrate from the upper chamber to the lower chamber while incubating for 48 hours. Untransferred cells were removed from the surface of the conflict chamber. Three transferred to lower chamber The fabric was fixed with 3.7% paraformaldehyde dissolved in PBS and stained with 2% crystal violet solution. The excess crystal vial solution was washed with distilled water and photographed of the selected area (X100), and the number of transferred and transferred cells was counted at five selected areas. Experiments are shown as representative results obtained by duplication under the same conditions. Data values reflect the number of metastasis cells x standard deviation (HPF) per X200 magnification. As a result, a transgenic vector introduced with pcDNA-myc, pcDNA-C12or f 59-i sof orml-myc, pcDNA-C12orf59-isoform2-myc, and pcDNA-C12or f 59-i so f ormlde 1 -myc vector in SW480 cell line Compared to the cell line into which the control pcDNA-myc vector was introduced in the ring cell line, when the C12orf59 protein or fragment thereof was expressed, it was confirmed that cancer cell invasion was reduced (FIGS. 5A and 5B), through which C12orf59 reduced cancer cell invasion. It was confirmed that effective.

Inhibition of Integrin Expression by C12orf59 Overexpression in Cancer Cell Lines

The promoter region of integrin alpha 5 ITGA5) contains the AP-1 site, and it has been reported that the transcription factor AP-1 induces the expression of ITGA5. Therefore, the expression of ITGA5 is reduced by the deactivation of the transcription factor AP-1. It can be inferred to be reduced, involved in cancer cell invasion and wound healing, has been reported to be highly expressed in cells with higher invasive capacity than cells with low invasive capacity among colon cancer cells, and integrin alpha 5 contributes to cancer cell migration and invasive capacity. Known. Therefore, it was confirmed that the reduction of invasion ability by C12orf59 overexpression in cancer cell line was caused by integrin alpha 5 which is known to contribute to cancer cell migration and invasion ability.

To this end, C12orf59 overexpression vector and reporter vector, Integrin α 5 promoter-reporter (ITGA5 promoter-reporter) and AP-1 cis element (AP-1 cis-Reporting system, Stratagene) reporter vector was expressed together and the activity change of each promoter was confirmed by lucif erase assay.

Specifically, after dispensing 2.5 × 10 ⁵ SW480 cells in a 6-well plate, after 24 hours 2 ug of reporter polasmid DNA and 1.8 ug of pcDNA-myc, pcDNA-C12or prepared in <Example 4> f 59-i so f orml-myc, pcDNA-C12orf59-isoform2-myc, and pcDNA-C12or f 59-i sof ormlde 1-myc vector were transformed together with Li ofectamine2000 reagent (invi trogen). 48 hours after transformation, luciferase activity was measured by Dual-lucif erase reporter assay system (Promega), and transformation efficiency was measured by transformation with 0.2 ug Renila luciferase vector pRL-TK (Promega). Renilla luciferase activity measurements were performed.

As a result, in the cell line in which the C12orf59 protein, AP-1 cis element, and ITGA5 promoter were introduced together, the activity of AP-1 cis element and ITGA5 promoter was reduced by C12orf59 overexpression, among which the pcDNA-C12orf59-isoformldel-myc vector was used. It was confirmed that the effect by the best (FIGS. 6A and 6B).

In addition, pcDNA-myc, pcDNA-C12orf59-isoforml-myc, pcDNA-C12orf59-isoform2-myc, pcDNA-C12or f 59-i sof ormlde 1-myc and AP-1 cis elements (APAP -1 cis-Reporting system, Stratagene) Reporter vector was transformed by Lipofectamine 2000 reagent in the same manner as above 48 hours, luciferase assay confirmed the activity of the AP-1 cis-element promoter.

As a result, it was confirmed that the expression of the transcription factor AP-1 decreased by the expression of C12orf59 in the HCT-15 cell line (FIG. 7A), and the degree of phosphorylation of c-jun, which is a major component of AP-1, was decreased. (FIGS. 7B and 7C).

Through this, it was confirmed that the inhibition of invasion by C12orf59 in cancer cell lines was achieved through the activation of transcription factor AP-1 and the inhibition of the expression of integrin α5.

Experimental Example 2 Inhibitory Effect of C12orf59 on Cancer Cell Lines

<2-1> Morphological Changes of Cells by Inhibiting the Expression of C12orf59 in Cancer Cell Lines In order to inhibit the expression of C12orf59 in cancer cell lines and confirm the morphological changes of the cells, C12orf59 specific siRNAs were transferred to colon cancer cell line SW480. The cells were transformed using a perforation technique, and the expression level and cell morphology of C12orf59 in the cells were confirmed.

Specifically, after harvesting SW480 cells, washed with PBS, resuspended in R buffer at a concentration of 3X10 ⁵ cells / 12 ul, and added 40 uM siRNA 2 ul and electroporation device (Neon Trans feet ion system, Invitrogen) was used for transformation, and its expression inhibition was confirmed by RT-PCR. The C12orf59-specific siRNA used at this time was purchased from Dharmacon Co. (4 mixtures), and the four target sequences were as follows:

5'-GGG UAC AUC UCU GGU AUA U-3 '(SEQ ID NO: 7) ，

5'-UCA CAU CUC UGC AGU CGG U-3 '(SEQ ID NO: 8),

5'-GAA UAG UUG ACU CUU GGA A-3 '(SEQ ID NO: 9), and

5'-GGU UCU UAC UCU UCG UUC A-3 '(SEQ ID NO: 10).

In addition, the cell morphology was transformed into C12orf59 siRNA 48 hours after, Observations were made using a Olympus microscope and photographed at 100 × magnification for comparative analysis.

As a result, 48 hours after the introduction of C12orf59-specific siRNA (Dharmacon) into the SW480 cell line, it was confirmed that the expression of C12orf59 was inhibited by RT-PCR (FIG. 8A), and cell type changes were observed to inhibit C12orf59 expression. It was confirmed that due to increased cell spread and the formation of lamellipodia (Fig. 8b).

Through this, it was confirmed that C12orf59 siRNA inhibited the expression of C12orf59 in cancer cell lines, and C12orf59 expression inhibited the change in the shape of cancer cells into highly mobile cell shapes.

<2-2> Change of Invasion Capacity by Inhibition of C12orf59 Expression in Cancer Cell Lines

To analyze the change in cancer cell invasion ability by inhibiting the expression of C12orf59 in cancer cell lines, C12orf59-specific siRNA (Dharmacon) and control siRNA (sense strand 5'- CUU ACG CUG AGU UCG ATT-3 '(SEQ ID NO: 11 ), Anti-sense strand 5'-UCG AAG UAC UCA GCG UAA GTT-3 '(SEQ ID NO: 12), Samchully Pharmaceutical) was transfected into the SW480 cell line and subjected to invasion assay 48 hours later It was.

Specifically, the porous membrane of a 24-well transwell plate (8 im pore size; Costar, USA) was diluted 250 with serum free medium.

Coated with a concentration of 100 ≠ Matrigel (BD Biosciences, USA) and left to solidify for 1 hour at room temperature. The lower layer of the transwell plate was a collagen type I (Sigma) at a concentration of 20 g / iiii as a chemoattractant. ) Was coated using 100 μί. ³ × 10 ⁴ SW480 cells resuspended in serum-free medium were dispensed into the upper chamber and allowed to migrate from the upper chamber to the lower chamber while incubating for 48 hours at 37 ° C., 5% CO ₂ conditions. Untransferred cells were removed from the surface of the upper chamber, and cells transferred to the lower chamber were fixed with 3.7% paraformaldehyde dissolved in PBS and stained with 2% crystal violet solution. The excess crystal vial solution was washed with distilled water, photographed of the selected area (X200), and the number of transferred cells was counted at five selected areas. The experiments were performed under duplicate under the same conditions, and the results were representative of at least two replicates. The data values reflect the number of standard cell deviations of HPF per X200 magnification.

As a result, it was confirmed that cancer cell infiltration is increased due to inhibition of expression of C12orf59 (FIG. 8C), through which C12orf59 expression is suppressed in cancer cell lines, thereby morphology of cancer cells. It was confirmed that changes occur, cell mobility increases, and as a result, cancer cell invasion is increased.

In addition, 48 hours after the introduction of C12orf59-specific siRNA (Samcheonri Pharm.) Into the colon cancer cell line HCT-15 by microporation, the expression of Cl2orf59 was suppressed through experiments using collagen and Matrigel-coated transwells. It was confirmed that due to increased infiltration in HCT-15 cell line (Figs. 9a and 9b).

<2-3> Confirmation of cancer cell viability changes by inhibition of C12orf59 expression in cancer cell lines To determine whether inhibition of expression by C12orf59 siRNA affects the viability of cancer cells, cell viability was measured under anchorage-independent conditions (non-cell conditions). Decided.

Specifically, 100 mg of 12 mg / ml poly-HEMA (Sigma) 100 ul in a 96-well plate, left on a clean bench for one day, dried, and then coated one more time the next day, the poly-HEMA coated plate After 48 hours after the siRNA transformation, cells were dialyzed with 1 × 10 ^{4 and} plated at 100 ul per well. At this time, serum-free medium was used, and after 72 hours, 10 ul of CCK-8 reagent (Dojindo cat. CK04-13) was added to each well and reacted for 3 hours to induce color reaction, and the absorbance at 0D450 nm. The cell viability was confirmed by measuring.

As a result, it was confirmed that cancer cell survival was increased by inhibiting the expression of C12orf59 by treating C12orf59 siRNA, compared to when the control siRNA was treated to cancer cells (FIG. 10), thereby suppressing the expression of C12orf59 by anoikis (unattached state). Apoptosis)-was confirmed to induce resistance.

<2-4> Confirmation of Signaling Activation by Inhibition of C12orf59 Expression in Cancer Cell Lines In order to confirm the activation level of the cell signaling system by C12orf59 siRNA in cancer cell lines, C12orf59-specific siRNA was introduced into SW480 cell line, a colon cancer cell line. Western blot analysis was performed using the cell lysate obtained after 48 hours.

Specifically, cells were prepared using RIPA complete solution (10 mM Tris, pH 7.2, 150 mM NaCl, 1% deoxycholate, 1% Triton X ᅳ 100, 0.1% SDS, 1 mM sodium or t ho vanadate, 50 mM NaF, 1 mM). Lysed with PMSF (complete protease inhibitor), and cell lysates were analyzed using a commercially available modified Bradford assay (Bio-Rad Laboratories, Hercules, CA). Quantification was carried out using. Thereafter, 30 ug of the obtained cell lysate was mixed with SDS sample buffer and heated, and then electrophoresed on an 8% SDS-PAGE gel. Proteins separated on SDS-PAGE by electrophoresis were transferred to nitrocellulose membrane and blocked with 5% skim milk. Thereafter, anti-beta-actin antibody (1: 1000 dilution: Santa Cruz), anti-phosphorylated -ERKl / 2 antibody, anti -ERK1 / 2 antibody, anti-phosphorylated -p38 antibody, anti-p38 antibody, anti-phosphorylated -JNK Antibody Anti-JNK antibody (1: 1000, Cell signaling technology) was reacted as a primary antibody, and then reacted with a secondary antibody conjugated with horseradish peroxidase, followed by ECL kit ( ECL Plus, Amersham, USA) was treated according to the manufacturer's method to induce color reaction.

As a result, it was confirmed that phosphorylation of ERKl / 2, p38 and JNK was increased by the inhibition of expression of C12orf59 (FIG. 11), through which MAPK activation was induced by cancer cell invasion and cell survival induced by inhibition of C12orf59 expression. Confirmed the contribution.

Preparation Example 1 Preparation of Pharmaceutical Formulation

1. Preparation of powder

2 g of C12orf59 protein or fragment thereof

1 g lactose

The above ingredients were mixed and filled in airtight cloth to prepare a powder.

2. Preparation of Tablets

C12orf59 protein or fragment thereof 100

Corn Starch 100

Lactose 100

Magnesium Stearate 2

After mixing the above components, it was compressed in accordance with the conventional manufacturing method of tablets to prepare.

3. Preparation of Capsule

C12orf59 protein or fragment thereof 100

Corn Starch 100

Lactose 100

Magnesium Stearate 2 After mixing the above components, the capsules were prepared by layering the gelatine capsules according to a conventional method for preparing capsules.

5. Preparation of Injectables

C12orf59 protein or fragment thereof 10 I

Until diluted hydrochloric acid BP pH 7.6

Sodium Chloride BP Up to 1

The C12orf59 protein was dissolved in an appropriate volume of main sodium chloride BP, and the pH of the resulting solution was adjusted to pH 7.6 using dilute hydrochloric acid BP, and the volume was adjusted and mixed well using main sodium chloride BP. The solution was layered in a 5 type I ampoule of transparent glass, encapsulated under an upper grid of air by dissolving the glass, and autoclaved at 120 to 15 minutes for sterilization to prepare an injection solution.

6. Manufacture of rings

1 g of C12orf59 protein or fragment thereof

ᄋ

1.5 g per ΤΓ

1 g of glycerin

0.5 g of Xili

After mixing the above components, it was prepared to be 4 g per ring according to a conventional method.

7. Preparation of Granules

C12orf59 protein or fragment thereof 150

Soybean Extract 50

Glucose 200

Starch 600

After mixing the above components, 30% ethane was added to 100 and dried at 60 to form granules, and then layered on fabric.

Industrial Applicability

As seen above, the C12orf59 protein or fragment thereof effectively inhibits the invasion and viability of cancer cells, and thus the C12orf59 protein or cancer Not only can polynucleotides be useful in pharmaceutical compositions for the prevention and treatment of cancer, but C12orf59 is useful for screening of candidates for diagnosis and treatment of cancer and for the prevention or treatment of cancer. It can be used for the preparation of pharmaceutical compositions for the prevention and treatment of cancer.

Claims

[Range of request]

[Claim 11

A pharmaceutical composition for preventing and treating cancer, comprising C12orf59 (chromosome 12 open reading frame 59) protein or a fragment thereof as an active ingredient.

[Claim 2]

A vector comprising a polynucleotide encoding a C12orf59 (chromosome 12 open reading frame 59) protein or a fragment thereof, or a pharmaceutical composition for preventing and treating cancer, comprising a cell comprising the vector as an active ingredient.

[Claim 3]

The method for preventing cancer according to claim 1 or 2, wherein the C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof has an amino acid sequence selected from the amino acid sequences of 1) to 3). And therapeutic pharmaceutical compositions:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2.

[Claim 4]

The pharmaceutical composition for preventing and treating cancer according to claim 1 or 2, wherein the fragment has an amino acid sequence set forth in SEQ ID NO: 27.

[Claim 5]

The pharmaceutical composition of claim 1 or 2, wherein the cancer is any one selected from the group consisting of colorectal cancer, gastric cancer, and lung cancer.

[Claim 6]

The pharmaceutical composition for preventing and treating cancer of claim 2, wherein the vector is a linear DNA, a plasmid DNA, or a recombinant viral vector.

[Claim 7]

The method of claim 6, wherein the recombinant virus is any one selected from the group consisting of retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, lentivirus for the prevention and treatment of cancer Composition.

[Claim 8]

The method of claim 2, wherein the cells are any one selected from the group consisting of hematopoietic stem cells, dendritic cells, autologous tumor cells, and established tumor cells. And therapeutic pharmaceutical compositions.

[Claim 9]

1) measuring the expression level of C12orf59 protein or fragment thereof in a sample derived from a subject;

3) A protein detection method for providing cancer diagnostic information, comprising determining that the risk of developing cancer is higher when the expression level of the C12orf59 protein or fragment thereof is reduced compared to the control group.

[Claim 10]

10. The method according to claim 9, wherein the expression level of the C12orf59 protein or fragment thereof in step 1) is measured by Western blotting, Enzyme—Immunosorbent assay (ELISA), immunohistochemical staining ( A protein detection method, characterized in that detection by any one method selected from the group consisting of immunohistochemical staining, immunoprecipitation (i mmunopr ec ipit at i on) and immunofluorescence (immuno fluorescence).

[Claim 111]

1) treating the test compound or composition to a cell line expressing C12orf59 protein or fragment thereof; 2) measuring the expression level of the C12orf59 protein or fragment thereof in the treated cell line of step 1); And

3) A method for screening a cancer drug candidate comprising the step of selecting a test compound or composition in which the expression level of the C12orf59 protein or fragment thereof of step 2) is increased compared to a control cell line which has not been treated with the test compound or composition.

[Claim 12]

3) selecting a test compound or composition wherein the activity of the C12orf59 protein or fragment thereof of step 2) is increased compared to the activity of the C12orf59 protein or fragment thereof which has not been treated with the test compound or composition Screening method.

[Claim 13]

The method according to any one of claims 9 to 12, wherein the C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof has an amino acid sequence selected from the amino acid sequences of 1) to 3) below. How to feature:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2.

[Claim 14]

13. The method of any one of claims 9 to 12, wherein the fragment has an amino acid sequence set forth in SEQ ID NO: 27.

[Claim 15]

The method of any one of claims 9 to 12, wherein the cancer is any one selected from the group consisting of colorectal cancer, gastric cancer and lung cancer.

[Claim 16] A method of treating cancer, comprising administering a pharmaceutically effective amount of chromosome 12 open reading frame 59 (C12orf59) protein or fragment thereof to a subject with cancer.

[Claim 17]

A method of preventing cancer, comprising administering to a subject a pharmaceutically effective amount of a C12orf 59 (chromosome 12 open reading frame 59) protein or fragment thereof.

[Claim 18]

A cancer comprising a vector comprising a polynucleotide encoding a pharmaceutically effective amount of a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof, or a cell comprising said vector to a subject with cancer Treatment method.

[Claim 19]

A method comprising a vector comprising a polynucleotide encoding a pharmaceutically effective amount of a C12orf 59 (chromosane 12 open reading frame 59) protein or fragment thereof, or administering a cell comprising the vector to a subject.

[Claim 20]

20. The method according to any one of claims 16 to 19, wherein the C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof has any one amino acid sequence selected from the amino acid sequences of 1) to 3) below. How to:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2.

[Claim 21]

20. The method of claim 16 or 19, wherein the fragment has an amino acid sequence set forth in SEQ ID NO: 27.

[Claim 22]

20. The method of any one of claims 16 to 19, wherein the cancer is colorectal cancer, gastric cancer and Lung cancer, characterized in that any one selected from the group consisting of.

[Claim 23]

C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof for use in the manufacture of a medicament for the prevention and treatment of cancer.

[Claim 24]

A vector comprising a polynucleotide encoding a C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof for use in the manufacture of a medicament for the prevention and treatment of cancer, or a cell comprising said vector.

[Claim 25]

Use according to claim 23 or 24, wherein the C12orf59 (chromosome 12 open reading frame 59) protein or fragment thereof has an amino acid sequence selected from the amino acid sequences of 1) to 3) below:

1) the amino acid sequence represented by SEQ ID NO: 1 or 2;

2) an amino acid sequence represented as part of SEQ ID NO: 1 or 2; And

3) an amino acid sequence showing at least 80% homology with SEQ ID NO: 1 or 2.

[Claim 26]

The use according to claim 23 or 24, wherein the fragment has an amino acid sequence set forth in SEQ ID NO: 27.

[Claim 27]

The use according to claim 23 or 24, wherein the cancer is any one selected from the group consisting of colorectal cancer, gastric cancer and lung cancer.