KR20180081872A - Pharmaceutical composition for prevention and treatment for Hepatitis C containing DR6 expression or activity inhibitors - Google Patents

Abstract

Hepatitis C virus (HCV) is a major cause of chronic liver disease and the life cycle of HCV is highly dependent on host proteins for virus propagation. By transcriptome sequencing analysis, the present inventors have identified host genes that were highly differentially expressed in HCV-infected cells. Of these candidates, the present inventors have selected Death receptor 6 (DR6) for further characterization. DR6 is an orphan member of the tumor necrosis factor receptor superfamily. In the present study, the present inventors demonstrated that both mRNA and protein levels of DR6 were increased in the context of HCV replication; and further showed that promoter activity of DR6 was increased by HCV infection. By employing promoter-linked reporter assay, we showed that HCV upregulated DR6 via ROS-mediated NF-κB pathway. Both mRNA and protein levels of DR6 were increased by NS4B or NS5A, however, NS5A, but not NS4B, specifically interacted with DR6. HCV modulated JNK, p38 MAPK, STAT3, and Akt signaling pathways in a DR6-dependent manner. Further, Akt signaling cascade was regulated by protein interplay between DR6 and NS5A. Silencing of DR6 expression resulted in a decrease in HCV assembly and egress without affecting viral entry, replication, and translation. Taken together, these data indicate that HCV modulates DR6 for viral propagation and may contribute to HCV-mediated pathogenesis.

Description

[0001] The present invention relates to a pharmaceutical composition for prevention and treatment of hepatitis C comprising DR6 inhibitor,

The present invention relates to a composition for the prevention and treatment of hepatitis C comprising a DR6 inhibitor, and it has been confirmed that HCV proliferation is inhibited by an experiment using siRNA targeting DR6, thereby confirming the possibility as an HCV therapeutic agent.

Hepatitis C virus (HCV) regulates host cell signaling pathways and immune responses to maintain persistent infection (1,2). A prominent feature of HCV infection is chronicization of patients with HCV infection. As a result, HCV infection often causes a wide spectrum of fibrosis, cirrhosis and hepatocellular carcinoma (HCC) (3). HCV, a member of the Flaviviridae family, is a positive-sense, single-stranded RNA virus. The 9.6 kb HCV genome encodes a long precursor polyprotein that is processed sequentially to form three structural proteins (core, E1 and E2) and seven nonstructural proteins (p7 and NS2 to NS5B) (4) . About 3% of the world's population is infected with HCV. However, there is no HCV vaccine yet. Recently, direct-acting antiviral (DAAs) treatment has been very successful for some types of HCV. However, there are still many problems, including the cost of expensive drugs, differences in treatment rates due to genotypes, and emergence of mutants associated with drug resistance. Because the HCV life cycle is highly dependent on host factors, identification of host factors involved in HCV proliferation may be an alternative to the development of host-targeted antiviral agents with high genetic barriers to tolerance.

1. Horner SM et al., 2011. Proc Natl Acad Sci U SA 108: 14590-14595. 2. Kim SJ et al., 2014. Proc Natl Acad Sci U SA 111: 6413-6418. 3. Saito I et al., 1990. Proc Natl Acad Sci U SE 87: 6547-6549. 4. Suzuki T et al., 2007. Adv Drug Deliv Rev 59: 1200-1212. 5. Park HH. 2011. Apoptosis 16: 209-220. 6. Pan G. et al., 1998. FEBS Lett 431: 351-356. 7. Air Condition M. et al., 2009. Biochim Biophys Acta 1793: 1579-1587. 8. Zeng L. et al., 2012. J Biol Chem 287: 29125-29133. 9. Yang X. et al., 2016. Oncogenesis 5: e206. 10. Kasof GM et al., 2001. Oncogene 20: 7965-7975. 11. Air conditioning M et al, 2011. Mol Immunol 48: 1439-1447. 12. Than TT et al., 2016. Sci Rep 6: 20819. 13. Smirnova OA et al., 2016. Oxid Med Cell Longev 2016: 834193 14. Park C et al., 2015 J Virol 89: 10073-10086. 15. Tran GV et al., 2016 J. Virol 90: 2794-2805. 16. Lin W et al., 2010. Gastroenterology. 138: 2509-2518. 17. Mannova P et al., 2005. J Virol 79: 8742-8749. 18. Waris G et al., 2005. J Virol 79: 1569-1580. 19. Shao RX et al., 2010. J Virol 84: 6060-6069. 20. Yang K et al., 2012. PLoS One 7: e36525. 21. Zhou Y et al., 2015. Genet Mol Res 14: 14066-14075. 22. Mas VR et al., 2009. Mol Med 15: 85-94. 23. Neumann O et al., 2012. Hepatology 56: 1817-1827. 24. Kurokouchi K et al., 1998. J Bone Miner Res 13: 1290-1299. 25. Gong G et al., 2001. Proc Natl Acad Sci U SA 98: 9599-9604. 26. Sethi G et al., 2014. Mol Cancer 13: 66. 27. Huang G et al., 2013. Cell Death Dis 4: e 841. 28. Romero-Brey I et al., 2012. PLoS Pathog 8: e1003056. 29. Presser LD et al., 2013. PLoS One 8: e56367. 30. Pei R et al., 2011. J. Gen Virol 92: 2237-2248. 31. Lim YS et al., 2011. J Virol 85: 8777-8788. 32. Yim SA et al., 2013. PLoS One 8: e68170. 33. Pham LV et al., 2012. J Hepatol 57: 960-966. 34. Suzuki K et al., 2010. BMC Res Notes 3: 294. 35. Nguyen LN et al., 2014. J Virol 88: 12311-12325. 36. Kang SM et al., 2011. FEBS Lett 585: 3236-3244. 37. Sung PS et al., 2014. J Virol 88: 9233-9244.

Accordingly, it is an object of the present invention to solve the problem that there is no effective therapeutic agent for hepatitis C in the past, and to provide a preventive and therapeutic agent which is effective for hepatitis C and does not show resistance.

Hepatitis C virus (HCV) is a major cause of chronic liver disease, and the life cycle of HCV is highly dependent on host proteins for virus multiplication. The present inventors have identified host genes that are highly differentially expressed in HCVcc (cell culture-grown HCV) infected cells by transcriptome sequencing analysis. Among these candidates, DR6 (Death receptor 6, death receptor 6, also referred to as "TNFRSF21") was selected and further characterized. DR6 is a member of the tumor necrosis factor (TNF) superfamily. In the present invention, it was revealed that DR6 mRNA and protein levels were both increased in the context of HCV replication. Also, DR6 promoter activity was increased by HCV infection. Using a promoter-linked reporter assay, we found that HCV upregulates DR6 through the reactive oxygen species-mediated NF-κB pathway. Both DR6 mRNA and protein levels were increased by NS4B or NS5A. However, in vitro binding assay and immunoprecipitation analysis revealed that only NS5A, not NS4B, specifically binds DR6. HCV regulated JNK, p38 MAPK, STAT3, SOCS3 and Akt signaling pathways in a DR6-dependent manner. Furthermore, the Akt signaling cascade was regulated by protein interactions between DR6 and NS5A. Silencing of DR6 expression reduced HCV assembly and release without affecting viral introduction, replication and translation. Taken together, these data indicate that HCV modulates DR6 for its proliferation and contributes to HCV-mediated development.

DR6 is one of the tumor necrosis factor related death receptor families containing the death domain and is encoded by the TNFRSF21 gene. DR6 consists of 655 amino acid residues and is present as a 72 kDa protein. The DR6 protein comprises three major domains: the N-terminal extracellular cysteine-rich domain, the transmembrane domain and the C-terminal cytoplasmic death-domain (6). The N-terminal domain of DR6 is responsible for post-translational modification (7) and the C-terminus of DR6 regulates cell death signaling. Human DR6 contains six N-sugar chainable sites and several putative O-sugar chains. The glycosylation pattern of DR6 differs depending on the cell type and confer structural and functional properties (7, 8). DR6 is involved in a variety of events that occur in cells, including cell apoptosis and tumor growth (9). DR6 overexpression has been associated with JNK (10), p38 MAPK and STAT3 signaling pathway (9). As a member of the TNF receptor superfamily, DR6 is upregulated by TNF-α through NF-κB activation in prostate cancer cell lines (10). Similarly, activation of NF-κB and NF-AT signal transduction transiently increases DR6 expression in both activated human CD4 ⁺ and CD8 ⁺ T cells (11). However, the functional relationship of DR6 to viral infection has not yet been determined.

Using RNA sequencing analysis, we recently identified 30 host cell genes up-regulated in HCV-infected cells (12). In the present invention, it has been shown that HCV infection upregulates DR6 expression through the reactive oxygen species-mediated NF-κB pathway. In addition, we have shown that HCV regulates JNK, p38 MAPK, STAT3 and Akt signaling pathways in a DR6-dependent manner. Furthermore, it has been shown that NS5A specifically binds DR6 and regulates Akt cascade signaling. In addition, DR6 has been shown to be required for HCV assembly or release. Taken together, these data suggest that DR6 is involved in not only HCV proliferation but also HCV-related outbreaks.

Transcript analysis data published by the present inventors showed that DR6 is highly expressed in HCVcc-infected cells (12). DR6, a member of the tumor necrosis factor-associated death receptor family, is highly expressed in several prostate cancer cell lines (10). DR6 is also considered to be a powerful biomarker of some adult breeds (20). In addition, DR6 mRNA levels were rapidly and dramatically increased during liver regeneration in rat hepatocytes (21). However, there is no evidence that DR6 is involved in viral mediated diseases. We have shown that both mRNA and protein levels of DR6 are upregulated by HCV. It has also been shown that DR6 promoter activity is upregulated by HCV. Using the available GEO data sets (GSE 14323 and GSE 50579) (22, 23), we observed that DR6 gene expression was significantly increased in the liver of HCV-positive patients. DR6 is up-regulated by TNF-α, which can increase NF-κB and its target gene IL-6 (interleukin-6) (24). We have shown that NS5A overexpression promotes DR6 expression. In fact, NS5A is a multifunctional protein that can induce oxidative stress and activates STAT-3 and NF-κB (25). In addition, we have observed that domain I (1-249 aa) of NS5A is responsible for upregulating DR6 expression (data not shown), consistent with the fact that domain I of NS5A induces production of reactive oxygen species (13). We further demonstrated that HCV up-regulates DR6 expression through NF-κB activation using a plasmid containing a mutation at the putative NF-κB binding site of the DR6 promoter. Taken together, these data suggest that HCV upregulates DR6 expression through oxidative stress mediated NF-κB activation.

DR6 is associated with JNK, p38 MAPK and STAT3 signaling (6, 9), and HCV infection is known to modulate JNK, p38 MAPK, STAT3 and Akt signaling pathways (23-25). Indeed, the present inventors have found that DR6 is required for the phosphorylation of JNK, p38 MAPK and STAT3 in HCV infected cells. Furthermore, it has been shown that both the Akt activity and the SOCS3 protein expression level in HCV-infected cells are regulated by DR6. Since SOCS3 protein is inhibited by HCV in a proteasome-dependent manner via ubiquitination (25), DR6 appears to be involved in downregulating SOCS3 in HCV-infected cells. STAT3 activation is involved in the growth of human hepatocellular carcinoma, including proliferation, survival and angiogenesis in both in vitro and in vivo (26). In addition, DR6-mediated SOCS3 degradation appears to inhibit the negative effects of SOCS3 on STAT3 activation.

The increased DR6 silencing is consistent with the fact that DR6 antagonists promote Akt activity in neurons (27). The present inventors have shown that DR6 overexpression inhibits Akt phosphorylation in hypothetical cells. On the other hand, DR6 overexpression did not further inhibit Akt phosphorylation in HCV-infected cells. HCV upregulates DR6 expression level, but DR6 can not inhibit Akt activity in HCV infected cells. Since DR6 reacts with NS5A, we investigated whether NS5A impairs DR6-mediated Akt activation. Using Pim1 as a competitor of NS5A binding to DR6, DR6 inhibitory activity against Akt phosphorylation was shown to be mediated by Pim1. We have shown that DR6-mediated Akt activation is impaired in HCV-infected cells. These data suggest that HCV can modulate Akt cascade signaling using DR6 to favor viral proliferation.

Next, the functional role of DR6 in HCV proliferation was evaluated. DR6 silencing impaired HCV RNA and protein levels. HCV infectivity was also significantly impaired by DR6 knockdown without cytotoxicity (data not shown). We have shown that DR6 is not involved in the HCV life cycle introduction, RNA replication and IRES-mediated translation steps. However, DR6 knockdown significantly reduced intracellular HCV infection. These data suggest that DR6 may be involved in the assembly or release phase of the HCV life cycle. Because NS5A plays a crucial role in HCV assembly (28), HCV promotes viral assembly by using DR6 via NS5A. In the present invention, it has been shown that DR6 plays an important role in activation of JNK and p38 MAPK in HCV-infected cells. Because JNK and p38 MAPK activation are involved in the assembly and release of HCV particles (29,30), the data of the present invention support that DR6 is an essential cellular factor in viral particle assembly. Taken together, HCV upregulates DR6 expression levels through the reactive oxygen species mediated NF-κB pathway. DR6 is not only required for HCV assembly or release but also for HCV-mediated JNK, p38 MAPK, STAT3, SOCS3 and Akt signaling pathways. These data suggest that DR6 is also involved in the onset of HCV.

The present invention provides a pharmaceutical composition for the prevention and treatment of hepatitis C comprising DR6 expression or activity inhibitor.

In addition, the present invention relates to an antisense nucleotide, shRNA (short hairpin RNA) and siRNA (short interfering RNA) complementary to the mRNA of the DR6 gene, an NF-κB inhibitor such as SN50 or NAC (N- And an antioxidant such as acetylcysteine.

In addition, the present invention is characterized in that the siRNA for DR6 is any one of SEQ ID NOS: 18, 19, and 21 to 28. The siRNA for DR6 can be easily prepared by those skilled in the art based on the DR6 gene sequence, and the number of possible siRNAs is not limited, and the above siRNA is merely an exemplary description. It is also apparent to those skilled in the art that the siRNA for the DR6 gene may bind to the DR6 gene and inhibit DR6 expression.

Also, the present invention is characterized in that the shRNA for DR6 is one of SEQ ID NOS: 29 to 38. The shRNA for DR6 can be easily prepared by those skilled in the art based on the DR6 gene sequence. There is no particular limitation on the number of possible shRNAs, and the shRNA for the DR6 gene is a DR6 gene To inhibit the expression of DR6, it will be apparent to those skilled in the art that the present invention is not limited thereto.

Also, the present invention provides a composition, wherein the DR6 protein activity inhibitor is an antibody binding to DR6 protein.

Also, the present invention provides a composition, wherein the antibody binding to the DR6 protein is produced from any one of SEQ ID NOS: 39 to 47 of the human DR6 protein as an antigenic determinant.

In addition, the present invention is characterized in that the DR6 protein expression inhibitor is an NF-κB inhibitor such as SN50 or an antioxidant such as NAC (N-Acetylcysteine).

The composition for the prevention and treatment of hepatitis C infection comprising the DR6 expression or activity inhibitor of the present invention as an active ingredient contains 0.0001 to 50% by weight of the active ingredient based on the total weight of the composition.

The composition of the present invention may contain at least one active ingredient which exhibits the same or similar function to the DR6 protein expression or activity inhibitor. The composition of the present invention can be administered orally or parenterally at the time of clinical administration and can be used in the form of a general pharmaceutical preparation.

The composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-described effective ingredients for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and one or more of these components. , A buffer solution, a bacteriostatic agent, and the like may be added. In addition, it can be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, A target organ specific antibody or other ligand can be used in combination with the carrier. And can be formulated preferably according to the respective ingredients using appropriate methods in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The composition of the present invention may comprise a freeze-dried composition, particularly for the composition of an injectable solution upon addition of an isotonic sterile solution or sterile water or suitable physiological saline. The dosage of the active ingredient to be used may vary depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate, severity of disease, etc. and the daily dosage is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, and may be administered once to several times per day.

The composition of the present invention may be used alone or in combination with radiation therapy, chemotherapy, and a method using a biological response modifier.

We have found that both DR6 mRNA and protein levels are increased in HCV-infected cells. In addition, using RNA inhibition technology, DR6 is not required for the other stages of the HCV life cycle but is required for the assembly and release stages. Taken together, these data indicate that HCV modulates DR6 activity to facilitate virus assembly and release, and inhibits HCV proliferation by inhibiting DR6 expression using siRNAs and antagonists.

Therefore, inhibiting the expression of DR6 or the activity of the protein inhibits the step of viral assembly and release of HCV, so that the expression or activity inhibitor of DR6 can be used for the treatment of HCV.

Figure 1 shows that HCV upregulates DR6 expression levels. (A) DR6 mRNA levels were analyzed by qRT-PCR at a designated time after addition of Huh7.5 cells or infection with HCV Jc1 for four hours. dpi: days postinfection. (B) Huh7.5 cells were infected with HCV Jc1 for 4 hours, and the total cell lysate was collected at the designated time and immunoblotted with the designated antibody. (C) DR6 mRNA levels in Huh7 cells, cells treated with interferon, and HCV genotype 1b-derived replicon cells were evaluated by qRT-PCR. (D) DR6 protein levels were immunoblotted with each antibody in Huh7 cells, cells treated with interferon, and HCV genotype 1b-derived replicon cells. (E) (top panel) This is a schematic diagram of DR6-luc promoter reporter construction. (Lower panel) Huh7.5 cells were infected with the DR6-luc promoter reporter plasmid after the infection with the HCV Jcl for four hours. Cells were collected and luciferase activity was measured at the indicated time. And quantified with data from two independent experiments. The asterisk indicates a significant difference from the control value (*, P <0.05; **, P <0.01; ***, P <0.001).
Figure 2 shows that HCV promotes DR6 expression through reactive oxygen species (ROS) mediated NF-kB activation. (A) (top panel) is a schematic of a DR6-luc promoter construct with mutations in the NF-KB binding site. (Lower panel) Huh7.5 cells were infused with HCV Jc1 for 4 hours. 48 hours after infection, the cells were transfected with pGL3 vector with wild type or mutant DR6 promoter. Forty-eight hours after transfection, cells were collected and luciferase activity was measured. And quantified with data from two independent experiments. The asterisk indicates a significant difference from the control value (**, P <0.01; ***, P <0.001). (B) Huh7.5 cells were infused with HCV Jc1 for 4 hours. After 48 hours of infection, cells were either left untreated or treated with increasing amounts of SN50. After 48 hours of inhibitor treatment, DR6 mRNA levels were measured by qRT-PCR. (C) Huh7.5 cells were infected with HCV Jc1 for 4 hours. After 48 hours of infection, cells were either left untreated or treated with increasing amounts of SN50. After 48 hours of inhibitor treatment, DR6 promoter activity was analyzed. (D) Huh7.5 cells were infused with HCV Jc1 for 4 hours. After 48 hours of infection, cells were either left untreated or treated with increasing amounts of SN50. Forty-eight hours after the inhibitor treatment, protein levels were measured by immunoblotting with the indicated antibody. Protein band intensity was analyzed by ImageJ. (E) Huh7.5 cells were infused with HCV Jc1 for 4 hours. After 48 hours of infection, cells were either left untreated or treated with increasing amounts of SN50. Forty-eight hours after the inhibitor treatment, cytoplasmic and nuclear fractions were immunoblotted to determine NF-κB levels. GAPDH and lamin A / C were used as cytosol and nuclear marker, respectively. (F) Huh7.5 cells were infected with Jc1 for 72 hours. Cells were either left untreated or treated with increasing amounts of NAC, the antioxidant. After 24 hours of NSC treatment, mRNA levels (left panel) and protein levels (right panel) of DR6 were analyzed by qRT-PCR and immunoblotting, respectively. (G) cells were infected with Jc1 for 72 hours. Leave without processing the cells were treated in Ca ^{2 +} gamyeo increasing the amount of the chelator BAPTA-AM. After 24 h of BAPTA-AM treatment, mRNA levels (left panel) and protein levels (right panel) of DR6 were analyzed by qRT-PCR and immunoblotting, respectively. Protein band intensity was analyzed by ImageJ. The asterisk indicates a significant difference from the control value (**, P <0.01, ***, P <0.001).
Figure 3 shows that DR6 expression levels are upregulated by NS5A and NS4B proteins. (A) Huh7.5 cells were transiently transfected with increasing amounts of vector or Myc-labeled core, NS3, NS4B, NS5A or NS5B expression plasmids, respectively. Forty-eight hours after transfection, DR6 protein levels were analyzed by immunoblotting. (B) Huh7.5 cells were transiently transfected with increasing amounts of vector or Myc-labeled NS4B or NS5A expression plasmids. After 48 hours of transfection, DR6 mRNA levels were measured by qRT-PCR. The asterisk indicates a significant difference from the control value (*, P <0.05, **, P <0.01, ***, P <0.001). (C) Huh7.5 cells were cotransfected with Myc-labeled NS4B and NS5A expression plasmids. After 48 hours of transfection, DR6 protein levels were measured by immunoblotting. Protein band intensity was analyzed by ImageJ. (D) Huh7 cells were each transfected with empty vectors, Myc-labeled NS4B, NS5A or NS5B expression plasmids, respectively. Twenty-four hours after the transfection, the cells were fixed with cold methanol and acetone, and DR6 (red) was detected by immunofluorescence staining using rabbit anti-DR6 antibody and TRITC-conjugated donkey anti-rabbit IgG, Myc-tagged proteins (green) were detected using monoclonal antibodies and FITC (fluorescein isothiocyanate) -based goat anti-mouse IgG. Cells were stained with DAPI to label nuclei (blue). Size bar = 5 μm. Fluorescence intensity was measured by measuring the DR6 distance and intensity at the indicated red line using ImageJ. (E) Huh7.5 cells were transfected with vector or Myc-labeled NS5A. After 48 hours of transfection, cells were either not treated or treated with increasing amounts of NAC. After 48 hours of treatment, the total cell lysate was immunoblotted with the indicated antibody. (F) Huh7.5 cells were transfected with vector or Myc-labeled NS5A. After 48 hours, the cells were either untreated or treated with increasing amounts of BAPTA-AM. After 48 hours of treatment, the total cell lysate was immunoblotted with the indicated antibody. (G) Huh7.5 cells were transfected with vector or Myc-labeled NS5A. After 48 hours, cells were either untreated or treated with increasing amounts of NAC or BAPTA-AM. Forty-eight hours after treatment, intracellular DR6 mRNA levels were analyzed by qRT-PCR. The asterisk indicates a significant difference from the control value (**, P <0.01, ***, P <0.001). (H) Huh7.5 cells were transfected with vector or Myc-labeled NS5A and treated after 48 hours with no treatment or increased amounts of SN50. After 48 hours of treatment, the total cell lysate was immunoblotted with the indicated antibody.
Figure 4 shows that DR6 interacts with the NS5A protein. (A) HEK293T cells were cotransfected with Flag-tagged DR6 and vector or indicated Myc-labeled respective HCV protein expression plasmids. Forty-eight hours after the transfection, the cell lysate was immunoprecipitated with anti-Myc antibody, and the bound protein was detected by immunoblotting using an anti-Flag antibody. Expression of Myc-labeled HCV proteins and Flag-labeled DR6 protein expression were confirmed by immunoblotting with antibodies directed at the bottom panel. (B) HEK293T cells were cotransfected with Flag-labeled DR6 and Myc-labeled NS5A expression plasmids. After 48 hours, the cell lysate was immunoprecipitated with anti-Flag antibody, and the bound protein was detected by immunoblotting with anti-Myc monoclonal antibody. Protein expression of Myc-labeled NS5A and Flag-labeled DR6 was confirmed by immunoblotting with the indicated antibodies. (C) (upper panel) Huh7.5 cells were cotransfected with V5-labeled DR6 and Myc-labeled NS5A expression plasmids. Forty-eight hours after transfection, the cell lysate was analyzed by immunoprecipitation with anti-V5 antibody, and the bound protein was analyzed by immunoblotting with anti-Myc antibody. (Lower panel) Conversely, the same cell lysate was immunoprecipitated with anti-Myc antibody, and the bound protein was analyzed by immunoblotting with anti-V5 antibody. (D) Huh7.5 cells were electroporated with in vitro-transcribed Jc1 RNA. After 4 days, total cell lysate was immunoprecipitated with mouse IgG or mouse anti-DR6 antibody. The bound protein was immunoblotted with the indicated antibody. (E) (upper panel) Huh7 cells were infected with Jc1. After 48 hours, the cells were transfected with a V5-labeled DR6 expression plasmid. Twenty-four hours post-transfection, cells were fixed with 4% paraformaldehyde and immunofluorescent staining with anti-V5 monoclonal antibody and FITC-conjugated goat anti-mouse IgG yielded V5-labeled DR6 (green) And detected NS5A (red) with rabbit anti-NS5A antibody and TRITC-conjugated donkey anti-rabbit IgG. The double dyeing of DR6 and NS5A shows the common position of DR6 and NS5A in yellow in the overlapping photograph. Cells were stained with DAPI and labeled with blue. (Bottom panel) Both Jc1-infected cells and HCV replicon cells were fixed with cold methanol at -20 ° C for 10 minutes and with acetone for 1 minute. Immunofluorescent staining was performed using an anti-DR6 monoclonal antibody and a TRIC-conjugated donkey anti-mouse IgG to detect endogenous DR6 (red), followed by rabbit anti-NS5A antibody and FITC-conjugated goat anti-rabbit IgG to NS5A (Green). Size bar = 5 μm. M1 (R / G), Mander's colocalization coeficient (co-location ratio of red fluorescence and green fluorescence).
Figure 5 shows that HCV regulates JNK, p38 MAPK, STAT3, Akt activity and SOCS3 expression levels through DR6. (A) Huh7.5 cells were transfected with an empty vector or V5-labeled Dr6 expression plasmid and analyzed 48 hours later by immunoblotting protein levels with the indicated antibodies. (B) Huh7.5 cells were infected with JC1 for 4 hours. After 48 hours of infection, cells were transfected with 20 nM negative siRNA or DR6 siRNA. After 48 hours of transfection, protein levels were analyzed by immunoblotting with the indicated antibodies. "Neg" represents a commercial negative control siRNA. (C) Huh7.5 cells were infected with Jc1 for 4 hours. Cells were transfected 48 hours after infection with V5-labeled DR6 expression plasmids. After 48 hours of transfection, protein levels were analyzed by immunoblotting with indicated antibodies. (D) Huh7.5 cells were cotransfected with V5-labeled DR6 and Myc-labeled NS5A expression plasmids. After 48 hours of transfection, total cell lysate was immunoblotted with the indicated antibody. The protein band intensity of p-Akt / Akt was analyzed using ImageJ. (E) Huh7.5 cells were cotransfected with Myc-labeled NS5A, V5-labeled DR6 and Flag-labeled Pim1 expression plasmids. After 48 hours of transfection, total cell lysates were immunoprecipitated with anti-Myc antibodies, and the bound proteins were detected by immunoblotting with anti-V5 and anti-Flag antibodies, respectively. (F) Huh7.5 cells were cotransfected with V5-labeled DR6, Myc-labeled HCV NS5A and Flag-labeled Pim1 expression plasmids. After 48 hours of transfection, total cell lysate was immunoblotted with the indicated antibody. The protein band intensity of p-Akt / Akt was analyzed using ImageJ.
Figure 6 shows that DR6 is essential for HCV proliferation. (A) Huh7.5 cells were transfected with 20 nM of indicated siRNAs. Two days after siRNA transfection, cells were infected with Jc1. After 48 hours of infection, RNA and protein levels were analyzed by qRT-PCR and immunoblotting with indicated antibodies. The asterisk indicates a significant difference from the negative control value (*, P <0.05; ***, P <0.001). Neg, negative universal control siRNA; Positive, HCV-specific siRNA targeting the 5 'untranslated portion (NTR) of Pos, Jc1. (B) Uninfected Huh7.5 cells were infected with Jc1 harvested from the culture supernatant of A above. After 48 hours of infection, RNA and protein levels were measured. Results are expressed as percentages of negative siRNA (mean ± standard deviation, n = 3). The asterisk indicates a significant difference from the negative control value (*, P <0.05). (C) Huh7.5 cells were transfected with 20 nM of indicated siRNAs. Two days after transfection, cells were infected with Jc1 labeled with a green fluorescent protein. After 48 hours of infection, HCV infection was measured by limiting dilution assay. Infected cells were evaluated by fluorescence microscopy. TCID50, tissue culture infectious dose 50%. (D) Huh7 cells were transfected with the indicated siRNAs. Twenty-four hours after siRNA transfection, cells were transfected with a wild-type or siRNA-resistant DR6 mutation plasmid and then infected with Jc1. 48 hours after infection, the cell suspension was immunoblotted with the indicated antibody. Res, V5-labeled siRNA resistance mutation of DR6. Protein band intensity was analyzed using ImageJ.
Figure 7 shows that DR6 is not involved in the introduction, replication and translation steps of the HCV life cycle. (A) Huh7 cells harboring genotype 1b derived HCV subgenomic replicons were transfected with indicated siRNAs. After 72 hours of siRNA transfection, RNA (left panel) and protein (right panel) levels were analyzed by qRT-PCR and immunoblotting, respectively. (B) (upper panel) is a schematic diagram of the pRL-HL plasmid. (Bottom panel). Huh7.5 cells were transiently transfected with the indicated siRNAs for 48 hours and then transfected with pRL-HL dual luciferase and pCH110? -Galactosidase plasmid. After 48 hours, relative luciferase activity was measured. (C) Huh7.5 cells were transfected with vector or V5-labeled DR6 expression plasmids for 48 hours and then infected with VSVpp or HCVpp from genotype 1a (H77) or 2a (JFH1) for six hours. After 72 hours of infection, viral introduction was measured as luciferase activity.
Figure 8 shows that DR6 is required for the late stages of the HCV life cycle. (A) Huh7.5 cells were infected with Jc1 for four hours. After 48 hours of infection, cells were transfected with 20 nM of indicated siRNAs. At the indicated times, intracellular RNA (top panel) and protein (bottom panel) were analyzed by qRT-PCR and immunoblotting, respectively. (B) Uninfected Huh7.5 cells were infected with Jc1 harvested from the culture supernatant of the panel. After 48 hours of infection, intracellular HCV RNA (upper panel) and protein (lower panel) levels were analyzed by qRT-PCR and immunoblotting, respectively. (C) The Huh7.5 cells described in panel A above were lyophilized and thawed three times and centrifuged at 15,000 x g for 15 minutes. The supernatants were collected and used for infected Huh7.5 cell infections. After 48 hours of infection, relative intracellular HCV infection was measured by qRT-PCR. "Neg" refers to a negative control siRNA.

Hereinafter, the configuration of the present invention will be described in more detail with reference to specific embodiments. However, it is apparent to those skilled in the art that the scope of the present invention is not limited to the description of the embodiments.

&Lt; Plasmid construction and DNA transfection >

Total cellular RNA was extracted from Huh7 cells using RiobEx (GeneAll) and cDNA was synthesized according to the manufacturer's instructions using a cDNA synthesis kit (Toyobo). (SEQ ID NO: 1), antisense, 5'-GCT CTA GAA CCA ACA GCA GGT CAG GAA GA-3 '(SEQ ID NO: Seq. No. 2)). The PCR product was inserted into the Not I and Xba I sites of the plasmid pEF6 / V5-HisB (Invitrogen). The full-length DR6 was amplified by PCR using primers set (sense, 5'-AAG CGG CCG CAA TGG GGA CCT CTC C-3 '(Seq.No.1), antisense, 5'- GCT CTA GAC TAC AGC AGG TCA GGA AGA T-3 (Seq. No. 3)), and the PCR product was inserted into the Not I and Xba I sites of the plasmid p3XFlag-CMV (Invitrogen). The siRNA-resistant DR6 mutant (pEF6 / V5-DR6-Res) was constructed by introducing three mutations at the siRNA binding site using PCR-based site-directed mutagenesis. All DNA transfections were performed as described in the references using PEI preparation (polyethyleneimine reagent, Sigma-Andrich) (31).

&Lt; Construction of DR6 promoter >

5'-GCT AGC ATA ATC TAT CAC TCT ATA GAG GGA-3 '(Seq. No. 4), 5'-AAG CTT ACT GAG TCG GTG GCC A-3' (SEQ ID NO: .5)) and Huh7 cells were used to construct a DR6 promoter. The amplified PCR product was cloned into the pGL3-basic vector (Promega) to construct a Luciferase reporter construct of the DR6 promoter. Two NF-kB putative binding sites in the DR6 promoter were mutated based on the predictions of the Matlnspector analyzer (Genomatix). Deletion mutants of the NF-κB binding site on the DR6 promoter were prepared by PCR using the following primers: NF-κB binding site deletion from -1035 to -1023 (forward, 5'-TCC TTT TAT TAT GAA GGT TTT AAT TGC ATT CA-3 '(Seq. No. 6); reverse 5'-TGA ATG CATA TTA AAA CCT TCA TAA TAA AAG GA-3' (Seq. -817 to -805 (forward, 5'-TGA ACT CTC CAA TTG AGG ATG CAG GGC AGC-3 '(Seq.No.8), reverse 5'-CGC TGC CCT GTA TCC TCA ATT GGA GAG TTC A-3 '(Seq. No. 9)). Luciferase assay was performed according to the description of the reference (32).

<Antibodies and chemical reagents>

(Thr183 / Tyr185), phosphorylated-p38 (Thr180 / Tyr182), and phosphorylated p38 (Santa Cruz) in Santa Cruz, (Tyr 705) and SOCS3 antibodies were purchased from Cell Signaling, beta-actin antibody was purchased from Sigma-Aldrich, V5 antibody was purchased from Invitrogen, and HCV core, NS3, NS4B and NS5A antibodies were purchased from other vendors ). The NF-κB inhibitor SN50 was purchased from EMD Millipore. NAC (N-acetyl-cysteine), an antioxidant, and BAPTA-AM, a calcium chelator, were obtained from Sigma-Aldrich and Enzo, respectively.

<Cell Culture>

All cell lines were cultured in DMEM (Dulbecco's modified Eagle's medium) medium containing 10% fetal calf serum and 100 units / ml penicillin-streptomycin at 37 ° C under 5% CO ₂ . Huh7 cells containing genotype 1b-derived HCV subgenomic replicon and cells healed with interferon were cultured as described in reference 31 (31).

<Immunoblot analysis>

Cells were washed twice with PBS and resuspended in RIPA buffer (50 mM Tris-HCl pH 7.5, 1% NP-40, 150 mM NaCl, 1 mM EDTA, 1 mM NaF, 1 mM Na ₃ VO ₄ And 1 mM PMSF (phenylmethylsulfonyl fluoride)} on ice for 15 minutes and centrifuged at 12,000 rpm for 10 minutes at 4 ° C. The supernatant was collected and the same amount of protein was subjected to SDS-PAGE and electrophoresis into a nitrocellulose membrane. The membranes were blocked with TBS-Tween (20 mM Tris-HCl [pH 7.6], 150 mM NaCl and 0.25% Tween 20) containing 5% defatted milk powder for one hour and then incubated with the indicated antibodies. Proteins were detected with the ECL kit (Abfrontier).

<RNA quantitation>

Total RNA was isolated from cells using the RiboEX reagent (GeneAll) as directed by the manufacturer. CDNA was synthesized using a cDNA synthesis kit (Toyobo) according to the manufacturer's instructions. Quantitative real time PCR (qRT-PCR) experiments were performed using the following primers: HCV-specific primers (forward, 5'-TTA GTA TGA GAG TCG TAC AGC CTC CAG-3 '(Seq. 5'-GGC ATG GAG TGG GTT TAT CCA AGA AAG G-3 '(Seq.No.11)), β-actin specific primer (forward, 5'-TGA CAG CAG TCG GTT GGA GCG-3' Specific primer (forward, 5'-TCT TCG TGG ATG AGT CGG (SEQ ID NO: 12), reverse 5'-GAC TTC CTG TAA CAA CGC ATC TCA TA- Specific primers (forward, 5'-CAG CTC CAA (SEQ ID NO: 15)), 5'-GGA AGT CAC AGG GGT CCA G- GAG CGA GTA CCA-3 '(Seq. No. 16), 5'-AGA AGC CGC TCT CCT GCA G 3' (Seq. qRT-PCR was performed using the CFX Connect real-time system (Bio-Rad Laboratories, Hercules, Calif.) under the following conditions: 15 min at 95 ° C, then 20 sec at 95 ° C, 20 sec at 55 ° C, 20 seconds, repeating this 40 times, and increasing the temperature from 60 ° C to 95 ° C by 0.5 ° C every 10 seconds 71 times.

<Immunoprecipitation method>

HEK293T cells were cotransfected with V5-labeled DR6 and Myc-labeled HCV cores, NS3, NS4B, NS5A and NS5B, respectively. The total amount of DNA was adjusted by adding an empty vector. Forty-eight hours after transfection, cells were collected and immuno-precipitation assay was performed using anti-Myc antibody and anti-Flag antibody.

<RNA inhibition>

(DR6 # 1 [5'-AGA CCA AAG GUA CUG AGU A-3 '(Seq. No. 18) and DR6 # 2 [5'- ACG GUU CCU UUA UUA CCA A -3 '] (Seq. No. 19)) and commercial negative control siRNA were purchased from Bioneer (Korea). (5'-CCU CAA AGA AAA ACC AAA CUU-3 '(Seq. No. 20)) targeting the 5' NTR of Jc1 was used as a positive control (33). siRNA transfection was performed according to the manufacturer's protocol using Lipofectamine RNAiMax reagent (Invitrogen, Carlsbad, Calif.).

<Immunofluorescence analysis>

The Huh7 cells grown on the cover slip were washed twice with PBS, fixed with cold methanol for 10 minutes at -20 [deg.] C and then with cold acetone for 1 minute. After washing three times with PBS, the fixed cells were blocked with PBS containing 1% BSA for one hour at room temperature. The cells were then incubated with anti-DR6 monoclonal antibody and rabbit anti-NS5A antibody. After washing three times with PBS, cells were incubated with FITC-conjugated goat anti-mouse IgG or TRITC (tetramethylrhodamine isothiocyanate) -conjugated donkey anti-rabbit IgG for one hour at room temperature. Cells were stained with DAPI (4 ', 6-diamidino-2-phenylindole) to label the nuclei. After washing three times with PBS, cells were analyzed with a Zeiss LSM 700 laser confocal microscope system (Carl Zeiss, Inc., Thornwood, NY).

<Nuclear and cytoplasmic fraction>

Nuclear and cytoplasmic fractions were performed. Briefly, Huh7.5 cells grown on a 10 cm diameter dish were treated with various concentrations of SN50. After 48 hours of treatment, the cells were washed twice with cold PBS and collected in 1.5 ml tubes. After centrifugation at 13,000 rpm for 10 seconds, the cell pellet was resuspended in cold PBS containing 0.1% NP40. The sample was pulverized five times using a p1000 micropipette and centrifuged at 13,000 rpm for 10 seconds. The supernatant was collected as a cytoplasmic fraction. The pellet was washed three times with cold PBS containing 0.1% NP40 and resuspended in RIPA buffer. The samples were sonicated three times for 30 seconds and then centrifuged at 13,000 rpm for 2 minutes to collect nuclear fractions.

<Lucifer Raise Reporter Analysis>

For the dual-luciferase reporter assay, Huh7.5 cells were transfected with the pRL-HL plasmid and the pCH110 reference plasmid containing the firefly luciferase gene under the control of the Renilla luciferase gene under the CMV (cytomegalovirus) promoter and the HCV IRES (internal ribosome entry site) And the plasmids indicated in the figure (35). Forty-eight hours after transfection, cells were harvested and luciferase assay was performed (36).

<Analysis of introduction of HCV-like particles>

HCV-like particles (HCV pseudoparticles, "HCVpp") and vesicular stomatitis virus (VSV) -like particles (VSVpp) containing E1 and E2 glycoproteins derived from genotype 1a (H77) or genotype 2a (JFH- (37). Briefly, HEK293T cells were transfected with PEI (polyethyleneimine, Sigma Aldrich), a transfer vector encoding a Gag-Pol (polymerase) -package plasmid and a firefly luciferase reporter protein, which are glycoprotein expression plasmids. After 48 hours of transfection, the supernatant containing HCVpp or VSVpp was collected. Cells were infected with HCVpp or VSVpp for six hours. The cell culture medium was then replaced with fresh culture medium. After 72 hours of infection, cells were collected and analyzed for luciferase activity.

<Statistical Analysis>

Data are presented as means ± SD. Student's t test was used for statistical analysis. As indicated in the drawing description, the asterisk indicates that there is a significant difference.

<DR6 siRNA, shRNA and antibody epitope sequence>

Tables 1, 2 and 3 below show siRNA, shRNA and antibody epitope sequences of DR6, respectively.

Table 1 shows the sense strand among the siRNAs against the human DR6 gene. In fact, siRNA is a two-stranded RNA coupled with an antisense strand complementary to the sense strand. However, in addition to those shown in Table 1, it is easy to derive the DR6 siRNA sequence to those of ordinary skill in the art to which the present invention belongs, and the siRNA for DR6 gene is not limited to the sequence shown in Table 1 It is obvious.

Table 2 illustrates shRNA sequences for the human DR6 gene. However, in addition to those shown in Table 2, it is easy to deduce the shRNA sequence of DR6 to those of ordinary skill in the art to which the present invention belongs, and the shRNA for the DR6 gene is not limited to the sequence shown in Table 2 It is obvious.

Table 3 shows the antigenic determinant of DR6. Anti-DR6 antibodies can be readily generated by one of ordinary skill in the art to bind to one or more of these antigenic determinant sites using conventional antibody production software.

site Seq. No. sequence One 1233 18 AGA CCA AAG GUA CUG AGUA 2 2154 19 ACG GUU CCU UUA UUA CCAA 3 974 21 CCUUCUAGUGUGAUGAAAU 4 1159 22 CCCUUCCUCCACUUAUGUU 5 1178 23 CCCAAAGGCAUGAACUCAA 6 1480 24 GCAUUUGCCCUGGAUGAUU 7 1513 25 GCUGGUGCUUGUGGUGAUU 8 1945 26 GCUGGAAACUGACAAACUA 9 2148 27 GCAGGAACGGUUCCUUUAU 10 2272 28 GCGGGUGAUUGAAGAGAUU

Site Seq. No. sequence One 781 29 GCCAAUGAUUGAGAAAUUACC 2 1184 30 GGCAUGAACUCAACAGAAUCC 3 1287 31 GGAAGGAAGACGUGAACAAGA 4 1480 32 GCAUUUGCCCUGGAUGAUUGU 5 1513 33 GCUGGUGCUUGUGGUGAUUGU 6 1714 34 GGGAAGCCAGUGGAAAGAUAU 7 1719 35 GCCAGUGGAAAGAUAUCUAUC 8 1945 36 GCUGGAAACUGACAAACUAGC 9 2148 37 GCAGGAACGGUUCCUUUAUUA 10 2368 38 GGACUCUGUUUAUAGCCAUCU

Location Seq. No. Epitope One  20 - 39 39 RATATMIAGSLLLLGFLSTT 2 172 - 191 40 ARGTFSDVPSSVMKCKAYTD 3 496 - 515 41 GLMEDTTQLETDKLALPMSP 4 441 - 460 42 SEREVAAFSNGYTADHERAY 5 279 - 298 43 TSSARGKEDVNKTLPNLQVV 6 618 - 637 44 IPQAEDKLDRLFEIIGVKSQ 7 307 - 326 45  RHILKLLPSMEATGGEKSST 8 123 - 142 46 CAALTDRECTCPPGMFQSNA 9 580 - 599 47 EKKDTVLRQVRLDPCDLQPI

Result 1: HCV  RTI ID = 0.0 &gt; DR6 &lt; / RTI &gt;

The present inventors previously performed next generation sequencing (RNA-Seq) to identify specifically 30 highly expressed genes in HCVcc infected cells (12). In the present invention, DR6, which is one of the TNF receptor family, was selected to characterize it. The mRNA level of DR6 was significantly increased in HCV-infected cells as compared to the additive cells (Figure 1A). Consistent with this, the protein expression level of DR6 gradually increased up to 6 days after infection (Fig. 1B). The protein expression pattern of DR6 varied depending on the cell type (data not shown).

The data of the present invention showed two major forms of the DR6 protein at 70 kDa and 110 kDa in Huh7 and Huh7.5 cells. Furthermore, the mRNA levels (Figure 1C) and protein levels (Figure 1D) of DR6 in HCV subgenomic replicon cells were significantly increased when compared to cells treated with parental Huh7 cells and interferon. To further investigate whether HCV upregulates DR6 transcription levels, Huh7 cells were transfected with Luciferase reporter constructs consisting of nucleotides -2000 to +20 of the DR6 promoter (Figure 1E, upper panel) Or infected with Jc1. DR6 promoter activity also increased gradually during HCV infection compared to the additive cells (Fig. 1E, bottom panel). Furthermore, DR6 mRNA levels were significantly higher in HCV-associated cirrhosis samples compared to normal liver samples (data not shown). These data suggest that HCV upregulates DR6 expression.

Result 2: HCV Active oxygen species  medium NF - κB  DR6 is adjusted up through the path.

DR6 expression in LnCaP and HEK293T cells has been reported to be regulated by TNFα through NF-κB signaling (10). We have also studied whether HCV-induced DR6 upregulation is also mediated through NF-kB activation. To this end, two mutants with mutations in the predicted NF-κB binding site of the DR6 promoter were constructed (FIG. 2A, top panel). Huh7.5 cells were transfected with wild-type or mutant forms of the DR6 promoter after infection with an additive salt or Jcl. HCV-induced DR6 promoter activity was suppressed in both mutants, indicating that HCV upregulates DR6 expression through NF-kB activation (Fig. 2A, bottom panel). In order to confirm the effect of NF-κB on DR6, Huh7.5 cells were treated with increasing concentrations of SNF, an NF-κB inhibitor. As expected, SN50 inhibited HCV-induced DR6 expression in a dose-dependent manner at mRNA (Fig. 2B), promoter activity (Fig. 2C) and protein (Fig. 2D) levels. To further confirm these results, nuclear fraction and cytoplasmic fraction of NF-κB were quantitated. As shown in Figure 2E, the nuclear fraction of NF-kB increased with HCV infection (lane 6). However, the transfer of NF-kB to the nucleus was dose-dependent by SN50 (Fig. 2E, lanes 7 and 8). Taken together, these data suggest that HCV upregulates DR6 expression through the NF-κB pathway. HCV was evaluated whether (13), Ca ^{2 +,} and free radicals involved in up-regulation DR6 paper in HCV-infected cells because they regulate NF-κB activity via the Ca ^{2 +} signaling and reactive oxygen species production. For this, Huh7.5 cells infected with Jc1 were treated with NAC (N-acetylcysteine), an antioxidant. As in FIG. 2F, DR6 mRNA (left panel) and protein (right panel) levels were significantly reduced by NAC in a dose-dependent manner. Conversely, the intracellular Ca ^{2 +} chelator BAPTA-AM had no effect on DR6 mRNA (Figure 2G, left panel) and protein (Figure 2G, right panel) levels. This shows that the non-Ca ^{2 +} reactive oxygen species is involved in DR6 expression. All these data indicate that HCV upregulates DR6 through the reactive oxygen species mediated NF-κB pathway.

Result 3: DR6 NS4B  And To NS5A  Lt; / RTI &gt;

Since DR6 levels were increased not only in HCV-infected cells but also in HCV replicon cells, the present inventors hypothesized that these non-structural proteins would be involved in this upregulation. To clarify this, Huh7.5 cells were transiently transfected with empty vectors or Myc-labeled cores, NS3, NS4B, NS5A, and NS5B, respectively, and the protein levels of DR6 were analyzed. As in Figure 3A, DR6 protein levels were increased by NS4B or NS5A. However, the core and other nonstructural proteins did not affect DR6 protein expression. Consistently, DR6 transcription levels were also dose-dependently increased by NS4B or NS5A (Fig. 3B). Notably, the level of DR6 expression was more strongly increased by NS5A than by NS4B. Both NS4B and NS5A displayed an additive effect on DR6 protein expression (Figure 3C). To further confirm this result, DR6 expression levels were analyzed in cells expressing vector or Myc-labeled NS4B, NS5A, NS5B, respectively. Immunofluorescence data showed that DR6 expression was significantly increased by NS5A or NS4B compared to vector ㄸ or NS5B (FIG. 3D). These data indicate that DR6 expression is upregulated by both NS4B and NS5A. Since DR6 expression was significantly up-regulated by NS5A, we have further explored the functional relevance of NS5A in DR6 upregulation. Huh7.5 cells were transfected with Myc-labeled NS5A and then treated with increasing amounts of NAC or BAPTA-AM. After 48 hours of transfection, total cell lysate was collected and immunoblotted with the indicated antibody. NS5A-induced DR6 protein levels were only reduced by NAC (Fig. 3E) and not by BAPTA-AM (Fig. 3F). Consistently, NS5A-induced DR6 mRNA levels were reduced only by NAC, not BAPTA-AM (FIG. 3G). We further confirmed that NS5A-induced DR6 expression levels were decreased by SN50 (FIG. 3H). We observed similar results using 4B (data not shown). These data suggest that both NS4B and NS5A are involved in DR6 upregulation and that this upregulation occurs via activation of the oxygen species-induced NF-κB activation in HCV-infected cells.

Result 4: HCV The NS5A  And reacts specifically with DR6.

Several evidences indicate that HCV proteins bind to host cell proteins and modulate cell characteristics and function (14, 15). Therefore, we studied possible protein interactions between DR6 and HCV proteins. For this, HEK293T cells were co-transfected with Flag-labeled DR6 and Myc-labeled virus protein expression plasmids, followed by immunoprecipitation analysis. As shown in Figure 4A, only NS5A reacted with DR6. Furthermore, it was confirmed that Flag-labeled DR6 specifically reacted with Myc-labeled NS5A (FIG. 4B). In order to further confirm this reaction in liver cancer cell lines, Huh7.5 cells co-transfected with V5-labeled DR6 and Myc-labeled NS5A plasmids were immunoprecipitated with anti-V5 antibody and the bound protein was incubated with anti-Myc antibody And analyzed by immunoblotting. As in Figure 4C, DR6 specifically reacted with NS5A (top panel). Inverse experiments further revealed that NS5A specifically reacted with DR6 in Huh7.5 cells (Figure 4C, bottom panel). Flag-labeled DR6 at the N-terminus is expressed as a 70-kDa protein if post-translational modification does not occur (FIGS. 4A and 4B), whereas V5-labeled DR6 at the C-terminus is expressed as a pair of protein chains by multiple glycosylation (FIG. 4C). It was also confirmed that endogenous DR6 specifically reacted with NS5A in HCV-infected Huh7.5 cells (Fig. 4D). Interaction between DR6 and NS5A suggests that NS5A is in common with DR6. To investigate this possibility, Huh7 cells were transiently transfected with the V5-labeled DR6 expression plasmid after infection with either additive or Jcl. Immunofluorescence analysis was performed 24 hours after the transfection. As shown in Figure 4E, NS5A and DR6 were both located in the cytoplasm of Jc1 infected cells, as shown by the yellow fluorescence in the overlapping photograph (top panel). Furthermore, endogenous Dr6 was at the same position as NS5A in both Jc1 infected cells and HCV replicon cells (Fig. 4E, bottom panel). Taken together, these data indicate that NS5A specifically reacts with DR6.

Result 5: HCV  DR6 dependent JNK , p38 MAPK , STAT3 , SOCS3  And Akt signal Adjust the delivery path.

DR6 has been reported to be involved in tumor angiogenesis through NFkB, p38 MAPK and STAT3 pathway (9). Since HCV infection modulates JNK, p38 MAPK, STAT3, SOCS3 and Akt signaling pathways (16-19), we examined whether DR6 is involved in these HCV mediated signaling pathways. V5-labeled DR6 was expressed in Huh7.5 cells at an abnormal location and signaling pathways were analyzed by immunoblotting using directed antibodies. As shown in FIG. 5A, phosphorylation levels of JNK, p38 MAPK and STAT3 were dose-dependently increased by DR6, while Akt phosphorylation level and protein level of SOCS3 were decreased by DR6 overexpression. To confirm this result in the context of HCV replication, Huh7.5 cells infected with Jc1 were transfected with DR6-specific siRNA. As in FIG. 5B, HCV infection increased the phosphorylation level of JNK, p38 MAPK, STAT3 and Akt, while decreasing the level of SOCS3 protein expression (FIG. 5B). In HCV-infected cells, DR6 knockdown inhibited HCV-induced JNK, p38 MAPK and STAT3 phosphorylation as compared to the addition of the cells. Surprisingly, DR6 silencing promoted Akt phosphorylation and slightly elevated SOCS3 protein levels in HCV infected cells. To further investigate the effect of DR6 on Akt phosphorylation in HCV-infected cells, Huh7.5 cells were transfected with a V5-labeled DR6 expression plasmid after infection with an additive salt or Jcl. As shown in FIG. 5C, DR6 overexpression inhibited Akt phosphorylation in the additive cells. However, DR6 overexpression in Jc1 infected cells no longer inhibited Akt phosphorylation. Since DR6 reacts with NS5A, it appears that NS5A interferes with DR6 function through protein interaction. To confirm this result, Huh7.5 cells were co-transfected with V5-labeled DR6 and Myc-labeled NS5A expression plasmids and the level of Akt phosphorylation was measured. As shown in Figure 5D, the inhibitory activity of DR6 on Akt phosphorylation is impaired by NS5A (lane 2 vs. lane 4). These data suggest that NS5A nullifies the inhibitory function of DR6 on Akt phosphorylation in HCV-infected cells. To further determine if NS5A damages DR6 function by exqorwlf interaction, Pim1, a serine / threonine kinase, was used as a competitor of NS5A binding. The present inventors have previously reported that Pim1 interacts with HCV NS5A to regulate HCV introduction (14). For this, Huh7.5 cells were cotransfected with Myc-labeled NS5A and V5-labeled DR6 with or without the Flag-tagged Pim1 plasmid. Figure 5E shows that DR6 specifically reacts with NS5A (lane 7). Notably, the protein interaction between DR6 and NS5A was dose-dependently reduced by Pim1. To determine whether protein interactions between DR6 and NS5A exert a negative effect on DR6 activity in Akt phosphorylation, Huh7.5 cells were treated with V5-labeled DR6 and Myc-labeled HCV NS5A with a flag-labeled Piml plasmid Without transfection. After 48 hours of transfection, Akt phosphorylation levels were analyzed. As shown in FIG. 5F, abnormal expression of ectopic expression of Pim1 did not affect Akt phosphorylation compared to vector transfected cells (lane 8 versus lane 1). As expected, the inhibitory activity of DR6 on Akt phosphorylation was impaired by NS5A (Fig. 5F, lane 3 vs. lane 2). Importantly, the inhibitory activity of DR6 on Akt phosphorylation was gradually restored by Pim1 in a dose-dependent manner (lanes 4 and 5). Taken together, these data indicate that NS5A interferes with DR6-mediated Akt signaling in HCV-infected cells.

Result 6: DR6 HCV  It is necessary for proliferation.

To determine whether DR6 is involved in HCV proliferation, Huh7.5 cells transfected with two siRNAs targeting DR6 were infected with Jc1 and RNA and protein levels were measured. As in Figure 6A, DR6 silencing inhibited HCV RNA levels (upper panel). Consistently, HCV protein expression levels were inhibited in DR6 knockdown cells (Figure 6A, bottom panel). To further investigate the role of DR6 in HCV proliferation, uninfected Huh7.5 cells were infected with Jc1 collected from the supernatant of a single infection (Fig. 6A) and HCV mRNA and protein levels were measured. Viral infectivity in the two infections was significantly reduced with DR6 knockdown (Figure 6B). In the DR6 knockdown cells, TCID ₅₀ of HCV (50% tissue culture infective dose). Figure 6C shows that HCV infectivity is significantly reduced in DR6-knockdown cells. To exclude the off target effect of DR6 siRNA, siRNA-resistant DR6 mutants were prepared. Exogenous expression of siRNA-resistant DR6 mutations restored HCV protein expression levels, whereas wild-type DR6 did not. Indicating that DR6 is specifically required for HCV proliferation.

Result 7: DR6 HCV  It has nothing to do with the introduction, replication and translation stages of the life cycle.

To further elucidate which phase of virus proliferation is DR6 dependent, Huh7 cells containing genotype 1b derived HCV subgenomic replicons were transfected with DR6-specific siRNAs and analyzed for HCV RNA and protein levels. As shown in Figure 7A, DR6 silencing did not affect HCV RNA (left panel) and protein (right panel) levels in HCV replicon cells. Next, we analyzed whether DR6 is involved in the internal ribosome entry site (HCV) IR-mediated translation. For this, Huh7.5 cells transfected with siRNA were transfected with pRL-HL plasmid (Fig. 7B, top panel) and the relative luciferase activity was measured. DR6 knockdown did not affect HCV IRES-dependent translation (Figure 7B, bottom panel). Next, we examined whether DR6 is involved in the introduction phase of the HCV life cycle. Huh7.5 cells were transfected with an empty vector or V5-labeled DR6 expression plasmid and then infected with VSVpp or HCVpp from genotype 1a (H77) or 2a (JFH1) (14). Figure 7C shows that DR6 overexpression also has no apparent effect on HCV introduction. These data indicate that DR6 can participate in other stages of the HCV life cycle.

Result 8: DR6 HCV  It is necessary for the assembly and release phases of the life cycle.

Next, we examined whether DR6 is required for later stages of the HCV life cycle. Huh7.5 cells were first transfected with Jc1 and transfected with siRNAs, where apoE (apolipoprotein E) siRNA was used as a control. Despite significant inhibition of DR6 mRNA levels, DR6 knockdown did not affect intracellular HCV RNA levels (Fig. 8A, top panel). Consistently, DR6 knockdown did not affect HCV protein levels (Fig. 8A, bottom panel). Infecting uninfected Huh7.5 cells with Jc1 harvested from the culture supernatant of Figure 8A significantly reduced intracellular HCV RNA levels of the two infections (Figure 8B, top panel). Consistently, the HCV protein levels at the two infections significantly decreased in cells infected with supernatants collected from DR6 knockdown cells (Fig. 8B, bottom panel). These data suggest that DR6 is involved in virus assembly and release. To further confirm these results, intracellular HCV infection was measured. Hc7.5 cells infected with Jc1 were transfected with the indicated siRNAs (Fig. 8C). After 24 or 48 hours of infection, the cells were repeatedly frozen and thawed. Cell supernatants were used to infect uninfected Huh7.5 cells and the relative intracellular HCV infectivity was measured by qRT PCR. As shown in FIG. 8C, the intracellular HCV infection level was significantly decreased in DR6 knockdown cells. This data suggests that DR6 is involved in the late stages of the HCV life cycle.

<110> Industry Academic Cooperation Foundation, Hallym University <120> Pharmaceutical composition for prevention and treatment for          Hepatitis C containing DR6 expression or activity inhibitors <130> Hallym-SBHwang-DR6 <160> 47 <170> KoPatentin 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aagcggccgc aatggggacc tctcc 25 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gctctagaac caacagcagg tcaggaaga 29 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gctctagact acagcaggtc aggaagat 28 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gctagcataa tctatcactc tatagaggga 30 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aagcttactg agtcggtggc ca 22 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tccttttatt atgaaggttt taattgcatt ca 32 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tgaatgcaat taaaaccttc ataataaaag ga 32 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tgaactctcc aattgaggat acagggcagc 30 <210> 9 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cgctgccctg tatcctcaat tggagagttc a 31 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ttagtatgag agtcgtacag cctccag 27 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ggcatagagt gggtttatcc aagaaagg 28 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tgacagcagt cggttggagc g 21 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gacttcctgt aacaacgcat ctcata 26 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tcttcgtgga tgagtcggag 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gcaagtcaca ggggtccag 19 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 cagctccaag agcgagtacc a 21 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 agaagccgct ctcctgcag 19 <210> 18 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 18 agaccaaagg uacugagua 19 <210> 19 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 19 acgguuccuu uauuaccaa 19 <210> 20 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting NTR of Jc1 <400> 20 ccucaaagaa aaaccaaacu u 21 <210> 21 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 21 ccuucuagug ugaugaaau 19 <210> 22 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 22 cccuuccucc acuuauguu 19 <210> 23 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 23 cccaaaggca ugaacucaa 19 <210> 24 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 24 gcauuugccc uggaugauu 19 <210> 25 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 25 gcuggugcuu guggugauu 19 <210> 26 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 26 gcuggaaacu gacaaacua 19 <210> 27 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 27 gcaggaacgg uuccuuuau 19 <210> 28 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA targeting DR6 <400> 28 gcgggugauu gaagagauu 19 <210> 29 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 29 gccaaugauu gagaaauuac c 21 <210> 30 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 30 ggcaugaacu caacagaauc c 21 <210> 31 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 31 ggaaggaaga cgugaacaag a 21 <210> 32 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 32 gcauuugccc uggaugauug u 21 <210> 33 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 33 gcuggugcuu guggugauug u 21 <210> 34 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 34 gggaagccag uggaaagaua u 21 <210> 35 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 35 gccaguggaa agauaucuau c 21 <210> 36 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 36 gcuggaaacu gacaaacuag c 21 <210> 37 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 37 gcaggaacgg uuccuuuauu a 21 <210> 38 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> shRNA targeting DR6 <400> 38 ggacucuguu uauagccauc u 21 <210> 39 <211> 20 <212> PRT <213> Homo sapiens <400> 39 Arg Ala Thr Ala Thr Met Ile Ala Gly Ser Leu Leu Leu Leu Gly Phe   1 5 10 15 Leu Ser Thr Thr              20 <210> 40 <211> 20 <212> PRT <213> Homo Sapiens <400> 40 Ala Arg Gly Thr Phe Ser Asp Val Ser Ser Val Met Lys Cys Lys   1 5 10 15 Ala Tyr Thr Asp              20 <210> 41 <211> 20 <212> PRT <213> Homo Sapiens <400> 41 Gly Leu Met Glu Asp Thr Thr Gln Leu Glu Thr Asp Lys Leu Ala Leu   1 5 10 15 Pro Met Ser Pro              20 <210> 42 <211> 20 <212> PRT <213> Homo sapiens <400> 42 Ser Glu Arg Glu Val Ala Ala Phe Ser Asn Gly Tyr Thr Ala Asp His   1 5 10 15 Glu Arg Ala Tyr              20 <210> 43 <211> 20 <212> PRT <213> Homo Sapiens <400> 43 Thr Ser Ser Ala Arg Gly Lys Glu Asp Val Asn Lys Thr Leu Pro Asn   1 5 10 15 Leu Gln Val Val              20 <210> 44 <211> 20 <212> PRT <213> Homo Sapiens <400> 44 Ile Pro Gln Ala Glu Asp Lys Leu Asp Arg Leu Phe Glu Ile Ile Gly   1 5 10 15 Val Lys Ser Gln              20 <210> 45 <211> 20 <212> PRT <213> Homo Sapiens <400> 45 Arg His Ile Leu Lys Leu Leu Pro Ser Met Glu Ala Thr Gly Gly Glu   1 5 10 15 Lys Ser Ser Thr              20 <210> 46 <211> 20 <212> PRT <213> Homo Sapiens <400> 46 Cys Ala Ala Leu Thr Asp Arg Glu Cys Thr Cys Pro Pro Gly Met Phe   1 5 10 15 Gln Ser Asn Ala              20 <210> 47 <211> 20 <212> PRT <213> Homo Sapiens <400> 47 Glu Lys Lys Asp Thr Val Leu Arg Gln Val Arg Leu Asp Pro Cys Asp   1 5 10 15 Leu Gln Pro Ile              20

Claims (11)

A pharmaceutical composition for the prevention or treatment of hepatitis C comprising a DR6 mRNA expression inhibitor.
The method according to claim 1,
Wherein the DR6 mRNA expression inhibitor is an antisense nucleotide complementary to the mRNA of the DR6 gene.
The method according to claim 1,
Wherein the DR6 mRNA expression inhibitor is shRNA (short hair RNA) against the DR6 gene.
The method of claim 3,
Wherein the shRNA is one selected from the group consisting of SEQ ID NOS: 29-38.
The method according to claim 1,
Wherein the DR6 mRNA expression inhibitor is siRNA (short interfering RNA) against the DR6 gene.
The method of claim 5,
Wherein the siRNA is one selected from the group consisting of SEQ ID NOS: 18, 19, 21 to 28. The pharmaceutical composition for preventing or treating hepatitis C virus according to claim 1,
The method according to claim 1,
Wherein the DR6 mRNA expression inhibitor is SN50 or NAC (N-acetylcystein).
A pharmaceutical composition for preventing or treating hepatitis C comprising a DR6 protein activity or expression inhibitor.
The method of claim 8,
Wherein the DR6 protein activity inhibitor is an antibody binding to DR6 protein.
The method of claim 9,
Wherein the antibody binding to the DR6 protein is produced by using any one of SEQ ID NOS: 39 to 47 of the human DR6 protein as an antigenic determinant.
The method of claim 8,
Wherein the DR6 protein expression inhibitor is SN50 or NAC (N-acetylcystein).

Images