KR101871199B1 - Pharmaceutical composition for prevention and treatment for Hepatitis C containing Rab32 expression or activity inhibitors - Google Patents

Abstract

Hepatitis C virus (HCV) is highly dependent on host cell factors in viral proliferation. Using a large-capacity next-generation sequencing method, the present inventors analyzed changes in host transcripts and identified 30 candidate genes up-regulated in HCVcc (cell culture-grown HCV) infected cells. Among the candidate genes, Rab32 was selected and studied intensively. Rab32 is a small GTPase that modulates various intracellular membrane-trafficking in a variety of cell types. In the present invention, we have found that Rab32 mRNA and protein levels are increased in HCV-infected cells and that GTP-binding Rab32, which mainly expresses HCV infection, is converted into GDP-binding Rab32 to contribute to Rab32 aggressiveness, . In addition, GDP-binding Rab32 selectively interacted with the HCV core to position the core within the Rab32-induced coagulation structure of the perinuclear region, which appears to be the viral assembly site. Using RNA inhibition technology, we found that Rab32 is not required for the other stages of the HCV life cycle but is required for the assembly phase. Taken together, these data indicate that HCV modulates Rab32 activity to facilitate virus assembly.

Description

[0001] The present invention relates to a pharmaceutical composition for prevention and treatment of hepatitis C comprising Rab32 inhibitor,

The present invention relates to a therapeutic agent for hepatitis C virus including a Rab32 inhibitor, and confirmed the inhibition of HCV proliferation by an experiment using siRNA targeting Rab32, and confirmed the possibility as an HCV therapeutic agent.

Hepatitis C virus (HCV) is a major cause of chronic liver disease, including liver cirrhosis and liver cancer (1). According to a recent report, the worldwide population of HCV infections is 80 million, with 350,000 deaths annually (2, 3). HCV has a positive, monoclonal RNA genome, is about 9.6 kb in length, and encodes a large polyprotein of about 3000 amino acids. This polyprotein is cleaved by the host and viral proteases to form ten polypeptides, which contain three structural proteins (core, E1 and E2) and seven nonstructural proteins (p7, NS2, NS3, NS4A , NS4B, NS5A and NS5B) (4). Previously, the combination of PEG-linked interferon alpha and ribavirin was the standard treatment for chronic hepatitis C treatment. Recently, a variety of direct-acting antivirals (DAAs) have been used in the treatment of HCV with high rates of treatment. However, the persistent response of the virus to new DAAs varies greatly depending on the HCV genotype (5), and the high cost of DAAs is a burden on most HCV patients worldwide (6). In addition, long-term administration of DAAs can result in the selection of drug-eluting mutants due to low genetic barriers to drug resistance (7). Because HCV proliferation and the invention are predominantly dependent on host cell machinery, host-targeted antiviral agents demonstrate advantages in high genetic barriers to resistance and antiviral activity potentials for all genotypes (8).

Rab32 belongs to the Ras superfamily of small GTPases, which contain at least 60 RAb genes in the human genome and play an important role in the regulation of membrane transport through changes between GDP-binding and GTP-binding forms 9).

Mouse Rab32 and its analog Rab38 have been reported to be involved in skin melanocyte staining and regulation of transgoli network tissue, and when Rab32 is silenced, the targeting is wrong and the major melanin including tyrosinase and tyrosinase- Resulting in destruction of the produced enzyme (10). In Xenopus melanophores, Rab32 controls melanosome movement in a cAMP-dependent protein kinase A-dependent manner (11). Despite being expressed elsewhere in most human tissues (12, 13), the exact function of Rab32 in non-melanogenic cells and tissues is poorly known. In cells such as COS7 and WI-38 fibroblasts that are not melanocytes, Rab32 was found at the same site as the mitochondria. In addition, Rab32 converts PKA targets into mitochondrial membranes and endoplasmic reticulum, and determines mitochondrial dynamics and apoptotic initiation (13, 14). Rab32 is also known to be essential for autolytic responses in HeLa and COS7 cells (15). Recently, it has been reported that Rab32 increases fat biosynthesis and autopagosomal formation during reprogramming (16). Rab32 is also involved in acute brain inflammation in mice (17). In addition, Rab32 interacts with LRRK2 (leucine-rich repeat kinase 2) in Parkinson's disease and regulates LRRK2 metastasis (18). To date, the functional association of RAb32 in HCV-induced outbreaks is unknown.

In the present invention, we have shown that HCV upregulates Rab32 expression and induces simultaneous expression of the expressed GTP-binding Rab32 to GDP-binding Rab32, which leads to aggregation of Rab32 protein and to less sensitivity to cellular degradation mechanisms. The present inventors further found that GDP-binding Rab32 selectively interacted with the HCV core to position the core within the Rab32-derived aggregated structure of the nuclear surrounding region similar to the viral assembly site. In addition, the present inventors have found that Rab32 is particularly essential for HCV particle assembly. Taken together, these data appear to modulate Rab32 activity so that HCV produces core-containing structures essential for HCV virion assembly.

Choo QL, Weiner AJ, Overby LR, Kuo G, Houghton M, Bradley DW. 1990. Hepatitis Cvirus: the major causative agent of viral non-A, non-B hepatitis. Br Med Bull 46: 423-441. Gower E, Estes C, Blach S, Razavi-Shearer K, Razavi H. 2014. Global epidemiology and genotype distribution of the hepatitis C virus infection. J Hepatol 61: S45-57. Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. 2006. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide.J Hepatol 45: 529-538. Lindenbach BD, Rice CM. 2005. Unraveling hepatitis C virus replication from genome to function. Nature 436: 933-938. Noviello S, Pedicone LD, Gibbons BR, Davis MN, Mukhopadhyay P, Koury K, Gibbons LM, Lee WM, Ghalib RH, Schiff ER, Galith JS, McHutchison JG, Laughz EJ, Muir AJ, Brassica, Albrecht JK, Sulkowski MS. 2009. Peginterferon alfa-2b or alfa-2a with ribavirin for treatment of hepatitis C infection. N Engl J Med 361: 580-593. Bansal S, Singal AK, McGuire BM, Anand BS. 2015. Impact of all oral anti-hepatitis C virustherapy: A meta-analysis. World J Hepatol 7: 806-813. Sarrazin C, Zeuzem S. 2010. Resistance to direct antiviral agents in patients with hepatitis Cvirus infection. Gastroenterology 138: 447-462. Baugh JM, Garcia-Rivera JA, Gallay PA. 2013. Host-targeting agents in the treatment of hepatitis C: a beginning and an end Antiviral Res 100: 555-561. Bock JB, Matern HT, Peden AA, Scheller RH. 2001. A genomic perspective on membranecompartment organization. Nature 409: 839-841. Wasmeier C, Romao M, Plowright L, Bennett DC, Raposo G, Seabra MC. 2006. Rab38 andRab32 control post-Golgi trafficking of melanogenic enzymes. J Cell Biol 175: 271-281. Park M, Serpinskaya AS, Papalopulu N, Gelfand VI. 2007. Rab32 regulates melanosometransport in Xenopus melanophores by protein kinase A (cβ / RIIα) recruitment. Curr Biol 17: 2030-2034. Bao X, Faris AE, Jang EK, Haslam RJ. 2002. Molecular cloning, bacterial expression andproperties of Rab31 and Rab32. Eur J Biochem 269: 259-271. Alto NM, Soderling J, Scott JD. 2002. Rab32 is an A-kinase anchoring protein and participatesin mitochondrial dynamics. J Cell Biol 158: 659-668. Gilad SY, Fitzsimmons RE, Benson MD, Lynes EM, Gesson K, Alto NM, Strack S, Scott JD, Simmen T. 2010. Rab32 modulates apoptosis onset and mitochondria-associated membane (MAM) properties. J Biol Chem 285: 31590-31602. Hirota Y, Tanaka Y. 2009. A small GTPase, human Rab32, is required for the formation of autophagic vacuoles under basal conditions. Cell Mol Life Sci 66: 2913-2932. Pei Y, Yue L, Zhang W, Wang Y, Wen B, Zhong L, Xiang J, Li J, Zhang S, Wang H, Mu H, Wei Q, Han J. 2015. Improvement in mouse iPSC induction by Rab32 importance oflipid metabolism during reprogramming. Sci Rep 5: 16539. Liang Y, Lin S, Zou L, Zhou H, Zhang J, Su B, Wan Y. 2012. Expression profiling of RabGTPases reveals the involvement of Rab20 and Rab32 in acute brain inflammation in mice. Neurosci Lett 527: 110-114. Waschbusch D, Michels H, Strassheim S, Ossendorf E, Kessler D, Gloeckner CJ, Barnekow A.2014. LRRK2 transport is regulated by its novel interacting partner Rab32. PLoS One9: e111632. Lim YS, Tran HT, Park SJ, Yim SA, Hwang SB. 2011. Peptidyl-prolyl isomerase Pin1 is acellular factor required for hepatitis C virus propagation. J Virol 85: 8777-8788. Park C, Min S, Park EM, Lim YS, Kang S, Suzuki T, Shin EC, Hwang SB. 2015. Pim kinaseinteracts with Nonstructural 5A protein and regulates Hepatitis C virus entry. J Virol 89: 10073-10086. Pham LV, Ngo HT, Lim YS, Hwang SB. 2012. Hepatitis C virus non-structural 5B protein interacts with cyclin A2 and regulates viral propagation. J Hepatol 57: 960-966. Tedbury P, Welbourn S, Pause A, King B, Griffin S, Harris M. 2011. The subcellular localization of the hepatitis C virus non-structural protein NS2 is regulated by an ion channel-independent function of the p7 protein. J Gen Virol 92: 819-830. Tran GV, Luong TT, Park EM, Kim JW, Choi JW, Park C, Lim YS, Hwang SB. 2015.Nonstructural 5A protein of Hepatitis C virus regulates Soluble Resistance-Related Calcium-Binding Protein activity for viral propagation. J Virol 90: 2794-2805. Than TT, Tran GVQ, Son K, Park E-M, Kim S, Lim Y-S, Hwang SB. 2016. Ankyrin RepeatDomain 1 is up-regulated during Hepatitis C virus infection and regulates Hepatitis C virus entry. Sci Rep 6: 20819. Stenmark H. 2009. Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol 10: 513-525. Tamura K, Ohbayashi N, Maruta Y, Kanno E, Itoh T, Fukuda M. 2009. Varp Is a NovelRab32 / 38-binding Protein That Regulates Tyrp1 Trafficking in Melanocytes. Mol Biol Cell 20: 2900-2908. Matto M, Rice CM, Aroeti B, Glenn JS. 2004. Hepatitis C virus Core protein associates withdetergent-resistant membranes distinct from classical plasma membrane rafts. J Virol 78: 12047-12053. Shanmugam S, Saravanabalaji D, Yi M. 2015. Detergent-resistant membrane association of NS2 and E2 during hepatitis C virus replication. J Virol 89: 4562-4574. Wileman T. 2006. Aggresomes and autophagy generate sites for virus replication. Science 312: 875-878. Wileman T. 2007. Aggresomes and pericentriolar sites of virus assembly: cellular defense orviral design Annu Rev Microbiol 61: 149-167. Suzuki R, Tamura K, Li J, Ishii K, Matsuura Y, Miyamura T, Suzuki T. 2001. Ubiquitin-mediated degradation of hepatitis C virus core protein is regulated by its carboxylterminus. Virology 280: 301-309. Howl PM, Miyamura T, Suzuki T, Suzuki R, Shimoji T, Fukuda K, Abe K, Sato S, Fukasawa M, Yamakawa Y, Nishijima M, Moriishi K, Matsuura Y, Wakita T, , Shoji I. 2007. E6AP ubiquitin ligase mediates ubiquitylation anddegradation of hepatitis C virus core protein. J Virol 81: 1174-1185. Afzal MS, Alsaleh K, Farhat R, Belouzard S, Danneels A, Descamps V, Duverlie G, Wychowski C, Zaidi N, Dubuisson J, Rouille Y. 2015. Regulation of core virus expression during the hepatitis C virus life cycle. J. Gen Virol 96: 311-321. Lyn RK, Hope G, Sherratt AR, McLauchlan J, Pezacki JP. 2013. Bidirectional lipid dropletvelocities are controlled by differential binding strengths of HCV core DII protein. PLoS One8: e78065. Syed GH, Amako Y, Siddiqui A. 2010. Hepatitis C virus hijacks host lipid metabolism. Trends Endocrinol Metab 21: 33-40. Miyanari Y, Atuzawa K, Usuda N, Watashi K, Hishiki T, Zayas M, Bartenschlager R, Wakita T, Hijikata M, Shimotohno K. 2007. The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 9: 1089-1097. Ngo HT, Pham LV, Kim JW, Lim YS, Hwang SB. 2013. Modulation of mitogen-activated protein kinase-activated protein kinase 3 by hepatitis C virus core protein. J Virol 87: 5718-5731. Shavinskaya, Boulant S, Penin F, McLauchlan J, Bartenschlager R. 2007. The lipid droplet binding domain of hepatitis C virus core protein is a major determinant for efficient virusassembly. J Biol Chem 282: 37158-37169. Gentzsch J, Brohm C, Steinmann E, Friesland M, Menzel N, Vieyres G, Perin PM, Frentzen A, Kaderali L. Pietschmann T. 2013. Hepatitis C virus p7 is critical for capsid assembly and envelopment. PLoS Pathog 9: e1003355. Sklan EH, Serrano RL, Einav S, Pfeffer SR, Lambright DG, Glenn JS. 2007. TBC1D20 is aRab1 GTPase-activating protein that mediates hepatitis C virus replication. J Biol Chem 282: 36354-36361. Manna D, Aligo J, Xu C, Park WS, Koc H, Heo WD, Konan KV. 2010. Endocytic Rabproteins are required for hepatitis C virus replication complex formation. Virology 398: 21-37. Salloum S, Wang H, Ferguson C, Parton RG, Tai AW. 2013. Rab18 binds to hepatitis C virusNS5A and promotes the interaction between sites of viral replication and lipid droplets. PLoS Pathog9: e1003513. Kondo H, Shirakawa R, Higashi T, Kawato M, Fukuda M, Kita T, Horiuchi H. 2006. Constitutive GDP / GTP exchange and secretion-dependent GTP hydrolysis activity for Rab27 inplatelets. J Biol Chem 281: 28657-28665. Chen X, Ernst SA, Williams JA. 2003. Dominant negative Rab3D mutants reduce GTP-boundendogenous Rab3D in pancreatic acini. J Biol Chem 278: 50053-50060. Wu L, Xu D, Zhou L, Xie B, Yu L, Yang H, Huang L, Ye J, Deng H, Yuan YA, Chen S, Li P.2014. Rab8a-AS160-MSS4 regulatory circuit controls lipid droplet fusion and growth. Dev Cell 30: 378-393. Kimura T, Kaneko Y, Yamada S, Ishihara H, Senda T, Iwamatsu A, Niki I. 2008. The GDP-dependent Rab27a effector coronin 3 controls endocytosis of secretory membrane in insulin-secreting cell lines. J Cell Sci 121: 3092-3098. Kim SJ, Syed GH, Siddiqui A. 2013. Hepatitis C virus induces the mitochondrial translocationof Parkin and subsequent mitophagy. PLoS Pathog 9: e1003285. Moshea, Gorovits R. 2012. Virus-induced aggregates in infected cells. Viruses 4: 2218-2232. Kleczkowskie, van K. 1961. Protection from proteolysis by aggregating the protein isolatedfrom tobacco mosaic virus. Biochim Biophys Acta 53: 181-185. Gorovits R, Fridman L, Kolot M, Rotem O, Ghanim M, Shriki O, Czosnek H. 2016. Tomatoyellow leaf curl virus confronts host degradation by sheltering in small / midsized proteinaggregates. Virus Res 213: 304-313. Neufeldt CJ, Joyce MA, Van Buuren N, Levine, Kirkegaard K, Gale M, Jr., Tyrrell DL, Wozniak RW. 2016. The hepatitis C virus-induced membranous web and associated nucleatransport machinery limit access of pattern recognition receptors to viral replication sites. PLoSPathog 12: e1005428. Lu W, Ou JH. 2002. Phosphorylation of hepatitis C virus core protein by protein kinase A and protein kinase C. Virology 300: 20-30. Majeau N, Bolduc M, Duvignaud JB, Fromentin R, Leclerc D. 2007. Effect of cAMP-dependent protein kinase A (PKA) on HCV nucleocapsid assembly and degradation. BiochemCell Biol 85: 78-87.

Accordingly, it is an object of the present invention to solve the problem that there is no effective therapeutic agent for hepatitis C in the past, and to provide a preventive and therapeutic agent which is effective for hepatitis C and does not show resistance.

The life cycle of HCV is closely related to the host cell machinery, and thus targeting host factors provides a viable approach to the development of antiviral agents. In the present invention, Rab32 is a novel host factor that plays a crucial role in virus replication, particularly in the assembly phase of the HCV life cycle. RNA-seq technology was employed to confirm the upregulation of Rab32 expression in HCVcc-infected cells. Several proteins in the Rab GTPase family have been reported to be involved in various stages of the HCV life cycle (40-42). Rab32 is frequently expressed in human tissues and performs a variety of functions including PKA-mediated calcium signaling, autologous cell death, mitochondrial kinetics, fat biosynthesis, and autophagosome formation (13-16). Nevertheless, the functional relevance of Rab32 in HCV proliferation has not been elucidated until now. In the present invention, HCV infection modulates Rab32 expression in a positive direction at the transcriptional level and HCV NS3 is predominantly associated with this upregulation (data not shown). Furthermore, Rab32 knockdowns markedly impaired viral infectivity.

Since Rab GTPase converts GDP- and GTP-binding forms and determines specific activity, it is important to see if there is a difference between the nucleotide status of Rab32 and uninfected and HCV-infected cells. Melanocyte-specific mouse Rab32 is mainly located in the trans-Golgi network and regulates the migration of major melanin-producing enzymes (10). In contrast, in other cells, such as Melanomas-free HeLa, endogenous membrane-bound Rab32 is predominantly located in the peri-nuclear region of the endoplasmic reticulum and mitochondria, thus performing other functions (14). It was used to quantify the amount of GTP-binding Rab32 in melanocytes, since the first amino acid-repeat domain of mouse VPS9-anchinin-repetitive protein functions as a GTP-dependent Rab32-binding protein (26). Paradoxically, the present inventors have found that human GDP-binding Rab32 in Huh7 cells reacts with VARP-ANKRD1 and coexists in the vicinity of the nucleus. In fact, Bui et al. (14) reported that GDP-binding Rab32-T39N was preferentially distributed in perinuclear ER and mitochondria in cells that do not produce melanin. Using the VARP-ANKRD1 construct, endogenous Rab32 was found to remain in GTP-conjugated form as in Rab3D and Rab27 in uninfected Huh7 cells (43, 44). Interestingly, Rab32 translocates from GTP-binding form to GDP-binding form in response to HCV infection. Although the mechanism underlying this transition is not yet clear, the HCV core appears to be involved in the Rab32 GDP-GTP cycle because the core selectively down-regulates Rab32-GTP rather than Rab32-GDP in a lysosome- (Data not shown). Another scenario may be due to the physical binding of the HCV core on the GDP-coupled Rab32, which may interfere with GDP emissions during the GDP-GTP conversion process.

The GDP-binding forms of Rab GTPases such as Rab8a and Rab27a exert a positive effect on certain biological functions (45, 46). The production of HCV-induced GDP-binding Rab32 leads to the analysis of its functional significance in HCV proliferation. Overexpression of Rab32 fixedly bound to GDP in COS-1 cells does not affect proteasome activity, leading to the formation of aggreso-like structures in the microtubule-forming center (15). GDP-binding Rab32 has been reported to cause mitochondria to form clusters around the nucleus in HeLa cells (13, 14). In the present invention, Rab32-T39N overexpression in Huh7 cells induces mitochondria to aggregate more around the nucleus and induces degradation of Rab32 protein, which is closely associated with the nucleus. Importantly, HCV infection has led to the formation of small Rab32 aggregates in the cytoplasm. In addition, HCV-infected Huh7 cells also aggregated mitochondria around the nucleus as previously reported (47) (data not shown). Various viruses have been shown to induce cell remodeling to grow intracellular aggregates containing virus capsid proteins to support virus proliferation. Viruses such as chicken pox virus, African swine fever virus, iridoviruses and phycodnaviruses rob the aggressor pathway while the human cytomegalovirus and the herpes simplex virus try to inhibit the capsid protein < RTI ID = 0.0 > , Mitochondria, and heat shock proteins are collected and aggression-like structures are used to generate virus assembly compartments (29, 30, 48). Thus, it has been suggested that nuclear peripheral aggregates induced by HCV-induced Rab32-GDP production may contribute to the assembly compartment required for HCV particle assembly. Indeed, HCV particle production was more efficient in cells transfected with Rab32 (Rab32-T39N) immobilized in a GDP-binding state than in cells transfected with an empty vector. Notably, viral proteins in functional complexes are able to counter host host defense mechanisms because they are stuck to aggregated structures (48-50). Interestingly, in the present invention, GDP-binding Rab32, which is not a GTP-binding form, specifically reacts with an HCV core to concentrate the core on a Rab32-induced nuclear aggregation structure, thereby enhancing the expression level of core protein. Our hypothesis also fits well with Shanmugam et al. (28), which demonstrated that HCV core-related detergent-resistant membranes can serve as platforms for virion assembly. It has been previously reported that Rab32 is located in the mitochondria-associated membrane (MAM) and regulates MAM characteristics (14). Since MAM is enriched for the viral assembly complex (51), it is plausible that Rab32 is located at the viral assembly site. Based on the results obtained by the present inventors, it was expected that the Rab32-induced aggregate structure in the HCV-infected cells constituted the viral granular compartment, which concentrated the core protein essential for viral morphogenesis and protected the core from the host cell degradation apparatus But changes the mitochondrial network to provide the energy needed for this process. However, further study is needed to confirm these assumptions. Indeed, Rab32 silencing significantly inhibited HCV proliferation and HCV intracellular infectivity. In addition, when Rab32 was knocked down, the core was retained on the surface of the clusters of lipids and caused a controversy about the defect in migration of the core from the lipocyte to the virus assembly site. The present inventors have found that the damage to the viral particle assembly correlates with the accumulation of cores on the lipid body, consistent with the previous report (39, 40). All these data indicate that Rab32 is essential for HCV assembly.

Several studies have shown that the core has other PKA phosphorylation sites (52, 53). In the present invention, both Rab32-T39N and Rab32-L188P (PKA-binding defect mutants) reacted with the core, but revealed that Rab32-L188P overexpression eradicated the core protein from the detergent-insoluble fraction and thereby impaired virus proliferation. These results suggest that appropriate PKA anchoring as well as PKA signaling plays a crucial role in HCV proliferation through core distribution and stability regulation. However, the precise role of the putative PKA immobilization activity of Rab32 in HCV proliferation requires further study. Taken together, the present inventors have found that Rab32 is a host factor essential for HCV particle assembly, and thus Rab32 can be a therapeutic target in inhibiting HCV proliferation.

The present invention provides a pharmaceutical composition for the prevention and treatment of hepatitis C comprising Rab32 expression or activity inhibitor.

The present invention also relates to a composition, wherein the Rab32 expression inhibitor is any one selected from the group consisting of antisense nucleotides, shRNA (short hairpin RNA) and siRNA (short interfering RNA) complementarily binding to mRNA of Rab32 gene to provide.

In addition, the present invention is characterized in that the siRNA for Rab32 is any one of SEQ ID NOS: 21, 22, and 24 to 31. The siRNA for Rab32 can be easily prepared by those skilled in the art based on the Rab32 gene sequence, and the number of possible siRNAs is not limited, and the above siRNA is merely an illustrative description. It is also apparent to those skilled in the art that the siRNA for the Rab32 gene can bind to the Rab32 gene and inhibit the expression of Rab32.

In addition, the present invention is characterized in that the shRNA for Rab32 is any one of SEQ ID NOs: 32 to 41. The shRNA for Rab32 can also be easily produced by those skilled in the art based on the Rab32 gene sequence. There is no particular limitation on the number of possible shRNAs, To inhibit the expression of Rab32, it will be apparent to those skilled in the art that the present invention is not limited thereto.

In addition, the present invention provides a composition, wherein the Rab32 protein activity inhibitor is an antibody binding Rab32 protein.

In addition, the present invention provides a composition, wherein the antibody binding to the Rab32 protein is produced by using any one of SEQ ID NO: 42 to SEQ ID NO: 97 as an antigenic determinant site in the human Rab32 protein.

The composition for the prevention and treatment of hepatitis C infection comprising the Rab32 expression or activity inhibitor of the present invention as an active ingredient contains 0.0001 to 50% by weight of the active ingredient based on the total weight of the composition.

The composition of the present invention may contain at least one active ingredient which exhibits the same or similar function to the Rab32 protein expression or activity inhibitor. The composition of the present invention can be administered orally or parenterally at the time of clinical administration and can be used in the form of a general pharmaceutical preparation.

The composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-described effective ingredients for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and one or more of these components. , A buffer solution, a bacteriostatic agent, and the like may be added. In addition, it can be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, A target organ specific antibody or other ligand can be used in combination with the carrier. And can be formulated preferably according to the respective ingredients using appropriate methods in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The composition of the present invention may comprise a freeze-dried composition, particularly for the composition of an injectable solution upon addition of an isotonic sterile solution or sterile water or suitable physiological saline. The dosage of the active ingredient to be used may vary depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate, severity of disease, etc. and the daily dosage is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, and may be administered once to several times per day.

The composition of the present invention may be used alone or in combination with radiation therapy, chemotherapy, and a method using a biological response modifier.

The present inventors have found that both mRNA and protein levels of Rab32 are increased in HCV-infected cells.

In addition, the present invention revealed that the GTP-binding Rab32, which is predominantly expressed by HCV infection, was replaced with a GDP-binding Rab32, contributing to the aggressiveness of Rab32 and thus making the mechanism of cell degradation less sensitive.

In addition, GDP-binding Rab32 selectively interacted with the HCV core to position the core within the Rab32-induced coagulation structure of the perinuclear region, which appears to be the viral assembly site.

In addition, using RNA inhibition technology, we found that Rab32 is not required for the other stages of the HCV life cycle but is required for the assembly phase.

Taken together, these data indicate that HCV modulates Rab32 activity to facilitate viral assembly, and suppressing the expression of Rab32, such as siRNA, inhibits HCV proliferation.

Therefore, suppressing the expression of Rab32 or the activity of protein can inhibit the step of viral assembly of HCV, so that the expression or activity inhibitor of Rab32 can be used for HCV treatment.

Figures 1A-1E show that Rab32 is increased by HCV infection. (Fig. 1A) After incubation of Huh7.5 cells for 4 hours with addition salts or HCV Jc1, the level of mRNA of Rab32 was analyzed at the indicated time by qRT-PCR. dpi: The date after infection (days postinfection). (Fig. 1b) Total bacterial cells were immunoblotted with antibodies directed at various times. (Figure 1c) Total cellular RNA was extracted from cells treated with HCV replicon and interferon (IFN) derived from parental Huh7, genotype 1b, respectively, and Rab32 mRNA levels were analyzed by qRT-PCR. (Fig. 1d) Total cell lysates collected from Huh7, HCV replicon and IFN-treated cells were immunoblotted with the indicated antibodies. (1e) Rab32 promoter activity is regulated by HCV infection. (Top) Overview of the Rab32 promoter structure. (Lower) Huh7.5 cells were infected with JC1. Four hours later the cells were transfected with the Rab32-luc promoter reporter plasmid. Luciferase activity was measured after 48 hours of infection. dpi: Number of days after infection (days postinfection). Data are presented as the mean of at least three independent experiments for A, C and E panels. The asterisk indicates a significant difference (*, P <0.05; **, P <0.01) for the control value.
Figures 2A-2E show that Rab32 is required for HCV proliferation. (Fig. 2a) Huh7.5 cells were transfected with 20 nM of siRNA indicated for 48 hours and then infected with adenosine or Jc1 for four hours. Two days after infection, intracellular RNA levels were measured by qRT-PCR. (Fig. 2B). After Huh7.5 cells were treated as described in Fig. 2A, the total cell lysate was immunoblotted with the antibody indicated. &Quot; Negative " refers to an unrelated negative siRNA. " positive " refers to an HCV-specific siRNA targeting the 5 ' untranslated region (NTR) of Jc1. (Fig. 2C) Huh7.5 cells were treated as described above in Fig. 2a and extracellular HCV RNA levels were quantified by qRT-PCR. (Fig. 1d) Uninfected Huh7.5 cells were infected with Jc1 harvested from the culture supernatant described above in Fig. 2a. After 48 hours of infection, intracellular HCV RNA (left panel) and protein (right panel) levels were measured. (E) Huh7.5 cells were transfected with 40 nM of indicated siRNA. After 72 hours of transfection, cell viability was determined by WST analysis. Data are expressed as the mean of three independent experiments. An asterisk indicates a significant difference from the control value (*, P <0.05; **, P <0.01).
Figures 3A-3E show that Rab32 is predominantly in GTP-binding form in uninfected Huh7 cells. (Figure 3a) Schematic representation of human VARP and Rab32 protein domain structures. (Fig. 3b) shows the intracellular distribution of GDP- and GTP-binding forms of Rab32 and VARP-ANKRD1 in Huh7 cells. Huh7 cells seeded on glass cover slips were co-transfected with Flag-labeled VARP-ANKRD1 and V5-labeled Rab32-T39N or Q85L expression plasmids. After 36 hours of transfection, cells were fixed with 4% paraformaldehyde and immunofluorescent staining was performed using anti-V5 and anti-Flag monoclonal antibodies. The double staining results showed that in the integrated image, Rab32-T39N and VARP-ANKRD1 were in the same position as the yellow fluorescence. Cells were stained with DAPI to label the nuclei (blue). (Figure 3c) (left panel) Purification of GST-VARP-ANKRD1 protein. The GST-VARP-ANKRD1 protein was expressed in E. coli BL21 (DE3) and purified with glutathione sepharose 4B beads, followed by elution with a buffer containing 30 mM reduced glutathione. Purified proteins were separated on 10% SDS-PAGE and stained with Coomassie Brilliant Blue. BSA was run side by side as a reference material. (Right panel) VARP-ANKRD1 reacts specifically with GDP-binding Rab32. Huh7 cells were transfected with Flag-tagged Rab32 expression plasmids. After 36 hours of transfection, 80 [mu] g of the cell lysate was treated with 0.5 mM GTPyS or 1 mM GDP for 30 minutes at 37 [deg.] C. Thereafter, cells were allowed to settle for 45 minutes with 2 μg of GST-VARP-ANKRD1 fixed in 40 μl of 50% (v / v) glutathione sepharose slurry at 4 ° C. for three hours. Binding proteins were detected by immunoblot analysis with anti-Flag monoclonal antibodies. (Figure 3d) HEK293T cells (left panel) or Huh7 cells (right panel) were transiently transfected with empty, Flag-labeled Rab32-WT, Rab32-T39N, Rab32-Q85L expression vectors, respectively. After 36 hours of transfection, total cell infusions were incubated with GST or GST-VARP-ANKRD1 protein. Protein complexes were precipitated with glutathione beads at 4 ° C for 45 min. Binding proteins were detected by immunoblot analysis using anti-Flag monoclonal antibodies. (Fig. 3E) HEK293T cells (left panel) or Huh7 cells (right panel) were incubated with Flag-labeled VARP-ANKRD1 and empty vector, Flag-tagged Rab32-WT, Rab32-T39N, Rab32-Q85L and Rab32-L188P expression vectors Respectively. &Lt; tb &gt;&lt; TABLE &gt; After 36 hours of transfection, total cell lysates were immunoprecipitated with anti-Flag monoclonal antibody. Binding proteins were detected by immunoblot analysis using anti-V5 monoclonal antibodies.
Figure 4 shows that HCV infection converts to GDP-binding Rab32 in the predominantly expressed GTP-binding form. Huh7 cells were infected for 4 hours with adjuvant or Jcl. Cells were harvested at the indicated date after infection and the cell lysate was precipitated with GST-VARP-ANKRD1 immobilized on glutathione sepharose 4B beads for 3 hours at 4 ° C. The bound Rab32 protein was detected by immunoblot analysis using anti-Rab32 polyclonal antibody.
Figures 5A-5E show that Rab32 forms aggregates in HCV infected cells. (Fig. 5A) Solubility of Rab32 wild type and mutant type. Huh7 cells were transiently transfected with empty vectors, Flag-labeled Rab32-WT, Rab32-T39N, Rab32-Q85L and Rab32-L188P expression vectors, respectively. After 36 hours of transfection, the total cell lysate was separated into the (S) fraction dissolved in the detergent and the (I) fraction not dissolved, as described in the examples. Both fractions were immunoblot analyzed with anti-Flag monoclonal antibody. Calnexin was used as a marker for the soluble fraction. (Figure 5b) The T39N and L188P mutations of Rab32 are very common in Huh7 cells. Huh7 cells were co-transfected with HA-labeled ubiquitin and empty vector, Flag-labeled Rab32-WT, Rab32 T39N, Q85L, and L188P expression plasmids, respectively. After 36 hours of transfection, total cell lysates were collected and immunoprecipitated with anti-Flag monoclonal antibody. Bound proteins were detected by immunoblot analysis using anti-HA monoclonal antibodies. The arrow indicates IgG. (Fig. 5c). Insoluble Rab32 is highly resistant to cell degradation mechanisms. Huh7 cells were transiently transfected with a Flag-tagged Rab32-T39N expression plasmid. After 36 hours of transfection, cells were treated with 10 [mu] g / ml of CHX and cells were harvested at indicated times. Total cell lysate was divided into detergent-soluble (S) fraction and detergent-insoluble (I) fraction. Rab32 protein was detected by immunoblot analysis using anti-Flag monoclonal antibody. Calnexin was used as a marker for the soluble fraction. (Figure 5d) Formation of Aggresome-like structures in cells expressing Rab32-T39N protein. Huh7 cells seeded on glass cover slips were transfected with V5-labeled Rab32-WT, Rab32-T39N, Q85L expression plasmids, respectively. Thirty hours after transfection, cells were incubated with 100 nM Mitotracker for 40 minutes to stain mitochondria. The cells were then fixed with 4% paraformaldehyde and immunofluorescent stained with anti-V5 monoclonal antibody. Cells were stained with DAPI to label the nuclei (blue). Arrows indicate the nucleus-surrounding aggregation structure of Rab32. "Crop" shows the image of the square box. (Figure 5e) depositing endogenous Rab32 in the insoluble fraction in HCV infected cells. Huh7 cells were infected with Jc1 for either 4 hours or additionally. Four days after infection, the total cell lysate was divided into detergent-soluble (S) fraction and insoluble (I) fraction. Equal amounts of protein were analyzed by immunoblotting with indicated antibodies. Calnexin was used as a marker for the soluble fraction.
Figures 6A-6D show that Rab32-GDP upregulates HCV core protein expression and facilitates virus propagation. (Fig. 6A) Huh7.5 cells were infused with Jc1 for 4 hours. After 24 hours of infection, cells were transiently transfected with the indicated Rab32 expression plasmid. Forty-eight hours after transfection, the cells were collected and the total cell lysate was immunoblotted with the indicated antibody. The band intensity of the averaged core protein was quantified with ImageJ. (Figure 6b) Uninfected Huh7.5 cells were infected with the virus-containing supernatant obtained as described above in Figure 6a. Forty-eight hours after infection, the cells were collected and the total cell lysate was immunoblotted with the indicated antibody. The band intensity of the averaged core protein was quantified with ImageJ. (Figure 6c) Huh7 cells were cotransfected with various constructs of GFP-tagged HCV cores and vectors or indicated Rab32 expression plasmids. After 36 hours of transfection, immunofluorescence of GFP-labeled HCV cores was analyzed using a fluorescent cell analyzer. GFP-positive cells were counted using ImageJ. (Fig. 6d) Huh7.5 cells were cotransfected with various constructs of Myc-labeled HCV core (left panel) or Myc-labeled HCV NS5A (right panel) and indicated Rab32 expression plasmids. After 36 hours of transfection, the cells were collected and the total cell lysate was immunoblotted with the indicated antibody. The band intensity of the averaged core protein was quantified with ImageJ.
Figures 7A-7H show that Rab32-GDP selectively reacts with the HCV core and is concentrated in the detergent-insoluble fraction. (Fig. 7A) Rab32 selectively reacts with the HCV core but does not react with other HCV proteins. HEK293T cells were transiently transfected with Myc-labeled HCV core, NS3, NS4B, NS5A and NS5B expression plasmids, respectively. After 36 hours of transfection, total cell lysates were incubated with GST or GST-Rab32 protein. Protein complex was precipitated with glutathione beads at 4 캜 for 45 minutes. Bound proteins were detected by immunoblotting using anti-Myc monoclonal antibody. (Figure 7b) HEK293T cells were co-transfected with Flag-labeled Rab32 and empty vectors, Myc-labeled HCV core or HCV NS5B expression plasmids, respectively. After 36 hours of transfection, total cell lysates were immunoprecipitated with anti-Myc monoclonal antibody. Binding proteins were detected by immunoblot analysis using anti-Flag monoclonal antibodies. The arrow indicates IgG. (Fig. 7c) Huh7.5 cells were infected with Jc1 for four hours. Four days after infection, total cell lysate was immunoprecipitated with IgG or anti-Rab32 polyclonal antibody. Bound proteins were analyzed by immunoblotting with anti-HCV core or anti-NS5A polyclonal antibody. The arrow indicates IgG. (Fig. 7d) Huh7 cells were infected for four hours with either an addition salt (left panel) or Jc1 (right panel). After 48 hours of infection, the cells were seeded in a glass cover slip and incubated for 36 hours. Cells were fixed in cold methanol and immunofluorescent staining was performed using anti-Rab32 and anti-HCV core polyclonal antibodies. Cells were stained with DAPI to label the nuclei (blue). The arrows show the spot structure of Rab32. The (-) sign of "Merge" indicates HCV-negative cells. (Fig. 7e) HEK293T cells (left panel) or Huh7 cells (right panel) were transfected with Myc-labeled HCV core and empty vector, Flag-tagged Rab32-WT, Rab-T39N, Rab32-Q85L, Rab32-L188P expression plasmids Respectively. After 36 hours of transfection, total cell lysates were immunoprecipitated with anti-Myc monoclonal antibodies. Binding proteins were detected by immunoblot analysis with anti-Flag monoclonal antibodies. The arrow indicates IgG. (Fig. 7f) GDP-conjugated Rab32 concentrates the core with a detergent-insoluble fraction. Huh7 cells were transiently transfected with an empty vector, Flag-tagged Rab32-WT, Rab32-T39N, Rab32-Q85L, Rab32-L188P expression plasmids, respectively. Twenty-four hours after transeproduction, the cells were infected with Jcl for four hours. After 36 hours of infection, total cell broths were divided into 1% Triton X-100 soluble (S) and insoluble (I) fractions. Equal amounts of protein in each fraction were immunoblot analyzed using indicated antibodies. Calnexin was used as a marker for the soluble fraction. The band intensity of the core protein was quantified by ImageJ. (Fig. 7g) GDP-binding Rab32 was in the same position as the HCV core, but GTP-binding RAb32 was not. Huh7 cells were infected with Jc1 for four hours. After 48 hours of infection, cells were transfected with the V5-labeled T39N or Q85L expression plasmid of Rab32. After 36 hours of transfection, cells were fixed with 4% paraformaldehyde and immunofluorescent staining was performed using anti-HCV core polyclonal antibody. Double staining results show that HCV core and Rab32-T39N coexist in the surrounding and perinuclear coagulation structures, which appeared as yellow fluorescence in the "Crop" image. Cells were stained with DAPI to label the nuclei (blue). (Fig. 7h) Huh7 cells were infected with Jc1 for four hours. After 48 hours of infection, the cells were transfected with an empty vector (upper panel) or V5-labeled Rab32-WT (lower panel). After 30 hours of transfection, cells were soaked in 1% Triton X-100 solution four times for 5 seconds each. Cells were fixed with 4% paraformaldehyde and immunofluorescent staining was performed using anti-HCV core polyclonal antibody and anti-V5 monoclonal antibody. The yellow fluorescence of the overlapping image indicates that the detergent-resistant core and Rab32 are in the same position. Cells were stained with DAPI to label the nuclei (blue). (-) refers to HCV-negative cells. (+) Indicates Rab32-transfected cells. Arrows indicate detergent-resistant cores.
Figures 8A-8H show that Rab32 is involved in the assembly phase of the HCV life cycle. (Figure 8a) Huh7 cells were transfected with 20 nM indicated siRNAs for 48 hours. The cells were then infected with HCVpp from genotype 2a (JFH-1). After 72 hours of infection, the introduction of the virus was determined by measuring the luciferase activity. Data are expressed as mean values from three independent experiments. (Figure 8b). Huh7 cells were transfected with 20 nM of indicated siRNAs for 48 hours. Cells were transfected with 0.2 [mu] g of pRL-HL and 0.3 [mu] g of [beta] -galactosidase expression plasmid. After 48 hours of transfection, HCV-IRES dependent translation was measured by collecting the cells and measuring luciferase activity. Data were expressed as the mean of three independent experiments. HCV replicon cells (upper panel) derived from genotype 1b or HCV replicon cells (lower panel) derived from genotype 2a were transfected with 40 nM of indicated siRNAs. After 72 hours of transfection, intracellular RNA levels (left panel) and protein levels (right panel) were analyzed. The asterisk indicates a significant value compared with the control (*, P <0.05). (Fig. 8d) Huh7 cells were infected with HCV Jc1 for four hours. After 60 hours of infection, 20 nM of indicated siRNAs were transfected. After 72 hours of transfection, intracellular RNA (left panel) and protein (right panel) levels were analyzed by qRT-PCR and immunoblotting, respectively. (FIG. 8E) The extracellular HCV RNA collected from the cell culture supernatant described in FIG. 8D was quantified by qRT-PCR. (Fig. 8f) Uninfected Huh7 cells were infected with Jc1 harvested from the culture supernatant during the experiment described in Fig. 8d above. After 48 hours of infection, intracellular HCV RNA levels (left panel) and protein levels (right panel) were analyzed using qRT-PCR and indicated antibodies. The intensity of the standardized HCV protein band was quantified by ImageJ. (Fig. 8g) Huh7 cells were infected with HCV Jcl for four hours. After 60 hours of infection, cells were transfected with 20 nM of indicated siRNA. After 72 hours of transfection, the cells were treated with trypsin and the cells were disrupted by repeated freezing and thawing. The post-nuclear supernatant was used to infect uninfected Huh7 cells. After 48 hours of infection, intracellular HCV RNA levels were analyzed by qRT-PCR. The asterisk indicates a significant difference from the control (*, P <0.05; **, P <0.01). (Fig. 8h) Rab32 silencing allowed the core to stay on the surface of the fat body. Huh7 cells were infected with HCV Jcl for four hours. After 48 hours of infection, cells were treated with 20 nM negative or Rab32-specific siRNA. Forty-eight hours after transfection, cells were fixed with 4% paraformaldehyde and immunofluorescent staining was performed using anti-HCV core polyclonal antibody. Lipid bodies were visualized by staining with BODIPY (439/503). In addition, cells were stained with DAPI and labeled with nuclei (blue).

Hereinafter, the configuration of the present invention will be described in more detail with reference to specific embodiments. However, it should be apparent to those skilled in the art that the present invention is not limited to the description of the embodiments.

Plasmid construction

Total RNA was isolated from Huh7 cells using RiboEx (GeneAll). cDNA was synthesized using cDNA synthesis kit (Toyobo). These cDNAs were used to amplify the full length human Rab32 and ANKR1 (first human ankyrin-repeat domain (VPS9-ankyrin-repeat protein) (451-650 aa). PCR products were p3XFlag-CMV- Aldrich) or pGEX-4T-1 expression vector (Amersham Biosciences) to generate Flag-labeled Rab32 and GST-labeled VARP-ANKRD1 constructs. Rab32 expresses pGEX-4T-1 vector The mutations T39N, Q85L and L188P of Rab32 were generated by PCR-based mutations, and each construct was inserted into the corresponding plasmid p3XFlag-CMV-10. The wild type and mutants of Rab32 all contained pEF6-V5-HisB The Rab32 promoter structure (from -643 to +260 nt) was amplified from the Huh7 genomic DNA and inserted into the pGL3-basic vector (Promega). The Myc-label HCV core, NS3, NS4B, NS5A and NS5B Plasmids It produced as described in the prior art (19).

Cell culture

All cell lines were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal calf serum and 100 units / ml penicillin-streptomycin at 37 ° C in a 5% CO ₂ environment. Huh7 cells containing HCV subgenomic replicons derived from genotypes 1b, 2a and IFN-treated cells were cultured as in the prior art (19).

Antibodies and reagents

Antibody was purchased as follows: Mouse anti-Rab32 antibody was purchased from Abcam, mouse anti-Flag antibody was purchased from Sigma-Aldrich, mouse anti-c-Myc and anti-HA antibody was purchased from Santa Cruz, Sigma-Aldrich anti-beta-actin antibody and mouse anti-V5 antibody were purchased from Invitrogen. HCV core, NS3 and NS5A antibodies were purchased as described in the prior art (20). A goat anti-rabbit antibody or goat anti-mouse antibody (Jackson ImmunoResearch Laboratories, West Grove, Pa.) Coupled with horseradish peroxidase was used as the secondary antibody. GTPγS and GDP were purchased from Sigma-Aldrich.

Immune precipitation

HEK293T or Huh7 cells were transfected with the indicated expression plasmids. The total amount of DNA was adjusted by adding an empty vector. After 36 hours of transfection, cells were harvested in lysis buffer. Cells were centrifuged at 13,500 rpm for 15 minutes. The supernatant was incubated overnight at 4 ° C with the indicated antibodies. Protein complexes were precipitated with 40 [mu] l protein A beads (Sigma-Aldrich) for 45 min at 4 [deg.] C. The beads were washed three times with wash buffer and the bound proteins were detected by immunoblot analysis.

GDP and GTP  Bond analysis

Huh7.5 cells were transfected with a Flag-tagged wild-type Rab32 expression plasmid. After 36 hours of transfection, cells were lysed in lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 5 mM MgCl ₂ , 1% NP-40, 0.25% sodium dioxycholate and protease inhibitor) . 80 μg of cell lysate was supplemented with 10 mM EDTA (pH 8.0) and treated with 0.5 mM GTPγS or 1 mM GDP for 30 minutes at 37 ° C. The sample was placed on ice and 60 mM MgCl ₂ was added and the reaction was terminated. The cell lysate was added with 2 μg GST-VARP-ANKRD1 and settled for 45 min and fixed in 40 μl 50% (v / v) glutathion sepharose 4B slurry at 4 ° C for 3 h. Bound proteins were immunoblot analyzed using anti-Flag monoclonal antibodies.

GST Fusion protein  refine

GST (glutathione S-transferase) -Rab32 and GST-VARP-ANKRD1 fusion proteins were expressed in E. coli BL21 (DE3) (Novagen). Cells by the supplement lysis buffer (10 mM Tris, (pH 7.5 ) and 150 mM NaCl) 5 mM DTT, 5 mM MgCl2 _{in, 1 mM MnCl 2, 10 μg} / ml DNase, 10 μg / ml RNase and 1 mM PMSF . The GST fusion protein was purified using glutathion sepharose 4B beads (Amersham Biosciences) and eluted with a buffer containing 20 mM Tris, (pH 8.5), 500 mM NaCl, 20 mM DTT and 40 mM reduced GSH.

RNA interference

Rab32 siRNAs (Rab32 siRNA # 1, 5'-CUG AGA AUG GGU UAC AGA U (dTdT) -3 '[sense] and 5'-AUC UGU AAC CCA UUC UCA G (dTdT) -3' (DTdT) -3 '[sense] and 5'-UAA GUU ACA GAG CCA CUA G (dTdT) -3' [antisense]) and general-purpose negative Control siRNA was purchased from Bioneer (Korea). The siRNA (5'-CCU CAA AGA AAA ACC AAA CUU-3 ') targeting the 5'-NTR (nontranslated region) of the JC1 virus was used as a positive control (21). siRNA transfection was performed using Lipofectamine RNAiMax reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions.

Cell separation

The separation of the Triton X-100-soluble and -insoluble fractions was carried out with a slight modification of the prior art (22). Briefly, into a Huh7 cells in 60-mm plate, PBS twice washing, lysis buffer (1% Triton X-100, 120 mM KCl, 30 mM NaCl, 5 mM MgCl 2 and 10% glycerol, protease 200 &lt; / RTI &gt;&lt; RTI ID = 0.0 &gt; ul &lt; / RTI &gt; After incubation on ice for 15 min, the supernatant was obtained by centrifugation at 500 x g for 5 min in a 4 ° C soluble fraction. The pellet was washed twice with lysis buffer and solubilized with 50 μl of SDS buffer (10 mM Tris, (pH 7.5), 1% SDS and protease inhibitor) at room temperature for 5 minutes. 150 [mu] l of the RIPA buffer was added to the dissolved portion and ultrasonicated for 30 seconds into an insoluble fraction. Equivalents of protein in soluble and insoluble fractions were analyzed by immunoblotting method.

Immunofluorescence  analysis

Huh7 cells were seeded onto a glass cover slip and transfected with the indicated plasmid. At the indicated time points, the cells were washed twice with PBS and fixed in cold PBS for 20 minutes at -20 ° C or in PBS containing 4% paraformaldehyde for 10 minutes at room temperature, followed by 0.1% And permeabilized with PBS containing Triton X-100. After washing three times with PBS, the fixed cells were blocked with PBS containing 3% BSA (bovine serum albumin) for 1 hour at room temperature. Cells were incubated with the indicated primary antibody at 4 ° C for one day. After washing three times with PBS, the cells were incubated with TRITC (tetramethylrhodamine isothiocyanate) -conjugated donkey anti-mouse / rabbit IgG or FITC (fluorescein isothiocyanate) -based goat anti-mouse / rabbit IgG for one hour at room temperature. Cells were back-stained with DAPI (4 ', 6-diamidino-2-phenylindole) to label the nucleus. The mitochondria were stained with 100 nM of CMXRos (Molecular Probes) at 37 占 폚 for 40 minutes. Lipid bodies were visualized by staining with BODIPY (439/503) (Invitrogen) for 30 minutes at room temperature. After washing three times with PBS, the cells were analyzed using a Zeiss LSM 700 laser-assisted microscope system (Carl Zeiss, Inc., Thornwood, NY).

WST  analysis

Approximately 1.5 x 10 ⁴ cells seeded on 24-well plates were transfected with negative, positive and Rab32-specific siRNAs. Cell viability was determined as in the prior art using water-soluble tetrazolium salt (WST) (Dail Lab) (20).

dose

qRT-PCR was performed using Rab32 primer: 5'-TGG GAC AGC AGG ACT CTG G -3 '(sense) and 5'-ACT CGG GTC ATG TTG CCA A -3' (antisense) (23). &Lt; tb &gt; &lt; TABLE &gt;

Statistical analysis

Data are presented as means ± SD. Student's t test was used for statistical analysis. As indicated in the drawing description, the asterisk indicates that there is a significant difference.

Result 1: HCV  When infected Rab32 The level increases .

To identify host factors that play an essential role in HCV proliferation, the inventors have employed RNA-Seq technology to identify changes in transcripts in the entire genome in HCVcc infected cells. By performing qRT-PCR analysis, the inventors have shown that 30 host factors are significantly expressed upon HCV infection (24). In the present invention, we have selected Rab32 to elucidate in more detail the characteristics of this protein to determine whether it is functionally involved in the regulation of HCV proliferation. Rab32 mRNA levels were measured at different times in Jc1-infected Huh7.5 cells to confirm the increased expression of Rab32 in HCVcc-infected cells. As expected, the level of Rab32 mRNA was significantly increased in HCV-infected cells compared to the additive cells, doubling at 6 days (Fig. 1a). In the same vein, the level of Rab32 protein increased proportionally during HCV infection (Fig. 1b). We also tested Rab32 levels of HCV subgenomic replicon cells from genotype 1b and found that the mRNA level (Figure 1c) and protein expression level (Figure 1d) of Rab32 in HCV replicon cells are the parental Huh7 cell Lt; RTI ID = 0.0 &gt; IFN-treated &lt; / RTI &gt; cells. These data suggest that HCV nonstructural proteins may be responsible for the upregulation of RAb32 in HCV-infected cells. Indeed, HCV NS3 overexpression increased Rab32 mRNA levels (data not shown). To determine whether Rab32 transcription levels were also modulated by HCV infection, Huh7.5 cells were either down-loaded or infected with Jc1. Four hours after infection, the cells were transfected with a luc reporter plasmid consisting of -643 nt to +260 nt of the Rab32 promoter and then analyzed for luciferase activity two days later. Figure 1 e shows that Rab32 promoter activity is significantly increased in HCV-infected cells. In addition, these data clearly indicate that HCV upregulates Rab32 gene expression.

Result 2: Rab32 HCV  Necessary for multiplication Is a host factor .

To investigate whether Rab32 is functionally involved in HCV proliferation, Huh7.5 cells transfected with two siRNAs targeting Rab32 were infected with Jc1. After 48 hours of infection, HCV RNA and protein levels were measured. As shown in Figure 2a, Rab32 knockdown significantly inhibited HCV RNA levels. In the same vein, HCV protein expression was inhibited in Rab32 knockdown cells (Fig. 2B). We further found that the extracellular HCV RNA of the culture supernatant significantly reduced the silencing of Rab32 (Figure 2c). To further characterize the role of Rab32 in HCV proliferation, uninfected Huh7.5 cells were infected with Jc1 harvested from the first infection culture supernatant (Fig. 2a) and analyzed for HCV RNA and protein levels. The second infection result was consistent with the first infection result, showing a significant decrease in protein levels as well as HCV RNA by Rab32 knockdown compared to negative control (FIG. 2d). Furthermore, the inventors have shown that siRNA treatment has no effect on cell viability and that the silencing effect is specific to Rab32 (Fig. 2e). Taken together, these data clearly show that Rab32 is an important host factor for HCV proliferation.

Result 3: Rab32  Uninfected Huh7  Mainly in cells GTP  It exists in the form of a bond.

Rab GTPase crosses the GDP-bound state and the GTP-bound state, which is regulated by GEFs (guanine nucleotide exchange factors) and GAPs (GTPase activating proteins) and affects intracellular location and activity (25) . Therefore, it is important to study the nucleotide-dependent function of the Rab32 protein in viral infected cells and uninfected hepatocytes. The nucleotide status of Rab32 in mouse melanocytes was frequently measured using Varp (vacuolar protein sorting 9-ankyrin-repeat protein) as an ANKRD1 (first ankyrin-repeat domain) that specifically reacts with Rab32 in a GTP-dependent manner 3a) (26). However, the nucleotide status of Rab32 in other cells (14, 15), which do not produce melanoma and have a distribution within Rab32 cells, is not well known until now. To do this, we constructed a cDNA clone encoding the human ANKRD1 domain (VARP-ANKRD1) of amplified VARP in Huh7 cells and used it to test the Rab32 nucleotide status. First, we examined the intracellular distribution of VARP-ANKRD1 in GDP-fixed (T39N) or GTP-fixed (Q85L) forms of Rab32 in Huh7 cells. Rab32-T39N preferentially binds to GDP due to mutations in the conserved GTP-binding site, whereas Rab32-Q85L has a unique GTPase activity, so the GTP form is permanently GTP-like (13). Rab32-L188P has been reported to be unable to respond to PKA due to the collapse of the secondary structure (13). We have found that the Flag-labeled VARP-ANKRD1 is in the same position as the GDP-binding Rab32 in the structure with small spots (Fig. 3b, left panel). On the other hand, GTP-binding Rab32 was widely distributed throughout the cell and there was no signal overlapping with VARP-ANKRD1 (Fig. 3B, right panel). As a result, the present inventors considered human VARP-ANKRD1 to recognize and recognize Rab32-GDP in Huh7 cells. We also identified a nucleotide-dependent binding pattern of Rab32 with GST-pulldown assay with VARP-ANKRD1. For this, GST-labeled VARP-ANKRD1 fusion protein was induced in E. coli and the purified protein was analyzed by 10% SDS-PAGE (Fig. 3C, left panel). The Huh7 cell lysate containing Flag-labeled Rab32 was treated with GTPγS or GDP and the cell lysate was precipitated with GST-labeled VARP-ANKRD1. We found that VARP-ANKRD1 specifically reacted with GDP-binding Rab32 but not with GTPγS-binding Rab32 (FIG. 3c, right panel). As a result, GST-labeled VARP-ANKRD1 specifically captured Rab32-T39N in HEK293T and Huh7 cells, but Rab32-Q85L forms were not captured (FIG. 3D). Thus, the present inventors concluded that VARP-ANKRD1 selectively reacted with GDP-binding Rab32. It is noteworthy that the wild-type Rab32 protein overexpressed in Huh7 cells did not react with VARP-ANKRD1 more than GDP-binding Rab32 (T39N) (Fig. 3d, lower panel). Using the Flag-label VARP-ANKRD1, we have confirmed that VARP-ANKRD1 precipitates with HAK293 cells with Rab32-WT, Rab32-T39N and Rab32-L188P (FIG. 3e, top panel). However, no reaction between wild-type Rab32 and VARP-ANKRDl was detected in Huh7 cells (Fig. 3e, bottom panel). These data indicate that Rab32 is present primarily in GTP-binding form in uninfected Huh7 cells.

Result 4: HCV  Infection Of Rab32  GDP-bond forms and GTP - Moves the balance between bound forms.

To investigate the nucleotide status of Rab32 in HCV-infected cells, Huh7 cells were either down-regulated or infected with Jc1 for 2 and 4 days and analyzed for GST-labeled VARP-ANKRD1 with endogenous Rab32-GDP levels. 4, endogenous Rab32 was not precipitated by the GST-labeled VARP-ANKRD1 in virally infected cells (lane 3 on both panels). However, endogenous Rab32 in HCV infected cells precipitated with the GST-labeled VARP-ANKRD1 (lanes 4 on both panels of Fig. 4). Given the exclusive interaction between VARP-ANKRDl and Rab32 in HCV-infected cells, the present inventors have found that HCV not only increases Rab32 total protein expression levels, but also alters the balance between GDP-binding and GTP- And to produce more forms of bonding. Nonetheless, further research is needed to elucidate the specific mechanisms underlying the transformation of the nucleotide status of Rab32 in HCV-infected cells.

Result 5: HCV  In infected cells Rab32  To form an aggregate.

The nucleotide-dependent function of Rab32 has been extensively studied in melanocytes, where Rab32 plays an important role in importing melanocytes from the trans-Golgi network (10, 26). However, endogenous Rab32 bound to membranes in cells that do not produce melanomas exhibit a different function (13-15). In the present invention, the inventors observed that Rab (R32) was abundant in ER and mitochondrial fractions in Huh7 cells (data not shown). The present inventors sought to determine why GTP-bound Rab32, which is predominantly expressed by HCV infection, is converted into a GDP-binding form. It has been reported that Rab32-T39N overexpression in COS-1 cells forms an aggressive-like structure composed of speck-like and / or chain-like aggregate forming Rab32, which is not due to a secondary structural modification of the mutant (15), we anticipated that HCV infection would cause aggregation of Rab32 proteins. To test this hypothesis, we first tested the solubility of various forms of the Rab32 protein in 1% Triton X-100, since most of the aggregated proteins are detergent-resistant. Calnexin was used as a marker of the soluble fraction as reported previously (27, 28). As shown in Figure 5a, the wild-type and GTP-fixed Rab32 protein (Q85L) was found mainly in soluble fractions, whereas the Rab32 L188P mutant that failed to bind well to GDP-fixed T39N and PKA was relocated to the insoluble fraction. These data suggest that the solubility of Rab32 decreases as the GTP-binding state changes to the GDP-binding state. Consistent with the conventional paper (15), we observed that both Rab32-T39N and Rab32-L188P proteins were poly-ubiquitinated in Huh7 cells (Figure 5b). Huh7 cells overexpressing the Flag-labeled Rab32-T39N plasmid were treated with CHX (cycloheximide) and collected at the indicated time to examine the protein half-life of the soluble and insoluble fractions of GDP-conjugated Rab32. The cells were fractionated and the same amount of protein of different soluble fraction and insoluble fraction was analyzed by immunoblotting. As shown in FIG. 5C, the T39N protein in the soluble fraction was gradually degraded, but the insoluble fraction of the T39N protein was highly resistant to cell degradation under CHX treatment conditions. This result suggests that most of the insoluble fractions have a GDP-binding form of Rab32 which makes them less susceptible to enzyme attack from host cells. In order to study the intracellular distribution of wild-type and mutant forms of Rab32 protein, Huh7 cells were transfected with V5-labeled wild-type (WT), T39N, Q85L type Rab32 expression plasmids and detected with mitotracker and anti-V5 monoclonal antibody And analyzed by immunofluorescence. Consistent with previous studies (15), Rab32-T39N expressing cells formed a concentrated distribution that appeared to show aggression-like structures, whereas Rab32-Q85L expressing cells did not (Fig. Interestingly, we found that Bui et al. (14), we observed that mitochondria were frequently and highly condensed in the nuclear periphery of cells overexpressing the Rab32-T39N protein. Finally, we investigated the solubility of endogenous Rab32 protein in both the hypotonic salt and Jc1 infected Huh7 cells. As expected, Rab32 was not detected in the detergent-insoluble fraction of the additive cells (Fig. 5e, lane 2). In contrast, Rab32 in Jc1 infected cells was also found in the detergent-soluble fraction (Fig. 5e, lane 3) and was present in significant levels in the insoluble fraction (Fig. 5e, lane 4). These results indirectly suggest that HCV promotes the formation of GDP-binding Rab32 and contributes to the aggregation of Rab32 in HCV-infected cells. Since some viruses use intracellular cohesive protein structures for viral replication and / or assembly (29, 30), the present inventors have determined whether HCV induces the aggregation form of Rab32 to create an intracellular environment favoring viral replication I expected.

Result 6: HCV  Protein expression levels Of Rab32 T39N  It is upregulated by mutation.

To investigate the functional relationship of Rab32 in HCV proliferation, Huh7.5 cells were transiently transfected with Jc1 and then transfected with empty vector, Rab32 wild type (WT), T39N, Q85L and L188P mutant expression plasmids, respectively. Two days after transfection, HCV protein levels were analyzed by immunoblotting with indicated antibodies. As shown in Figure 6a, the levels of viral proteins including NS3 and NS5A in cells expressing various constructs of Rab32 were not changed compared to the vector transfected with control. Surprisingly, in cells expressing wild-type Rab32 or T39N, core protein levels were dramatically higher than those expressing Rab85 Q85L or L188P mutants. When infected Huh7.5 cells were infected with the virus-containing culture supernatant collected from Panel A, the level of HCV protein at the time of the second infection was also higher in cells expressing wild-type Rab32 or T39N than those expressing Q85L or L188P mutants of Rab32 (Figure 6b, lane 2 and 3 Vs. 4 and 5). These data suggest that GDP-binding Rab32 has a positive effect on HCV production. In addition, we have shown that overexpression of L188P, which provides a false PKA-immobilized signal, significantly inhibited HCV proliferation (Fig. 6B, lane 5). Taken together, these data suggest that HCV upregulates GDP-binding Rab32 in order to enhance core protein expression, which facilitates virus multiplication and that PK32-immobilized activity of Rab32 plays a key role in this regulation. Using GFP-core we showed that the core protein was up-regulated in cells expressing Rab32-WT or T39N, whereas the amount of GFP signal was lowest in Rab32-L188P expressing cells (FIG. 6c). We also confirmed that the core protein (left panel), not NS5A (right panel), was upregulated by Rab32-T39N (Fig. 6d) and core protein expression levels other than other HCV proteins were elevated by Rab32-T39N (Data not shown).

Result 7: Rab32 HCV  Selectively reacting with the core and concentrating the core into the detergent-insoluble fraction.

Assuming that the expression level and activity of Rab32 induce a fundamental change in HCV proliferation and core protein expression, the possibility of interaction between Rab32 and HCV proteins was examined. For this, GST-pulldown analysis was performed using GST-labeled Rab32 protein in E. coli. As shown in Fig. 7 (a), Rab32 did not react with other HCV proteins but selectively reacted with core proteins. This reaction was confirmed by immunoprecipitation (Fig. 7B). Furthermore, it was confirmed whether the core protein reacts with endogenous Rab32 in HCV-infected cells (Fig. 7C). These data suggest that Rab32 is in the same position as the core in HCV infected cells. To investigate this possibility, immunofluorescence analysis was performed after Huh7 cells were infected with additive salts or Jcl. The endogenous Rab32 and HCV cores were in the same location in the cytoplasm, which appears yellow fluorescent (Figure 7d, right panel). It is noteworthy that the yellow fluorescent signal overlaps with the spot structure of the Rab32 protein, which indicates that Rab32 is absent in the cell (in the right panel). These data suggest that HCV infection promotes small cytoplasmic Rab32 aggregation formation (Fig. 5) and that Rab32 specifically reacts with the HCV core protein, as previously predicted. Next, the nucleotide-dependency of Rab32 was analyzed when reacted with the core protein. For this, HEK293T cells (left panel) or Huh7 cells (right panel) were co-transfected with various constructs of Myc-tagged HCV core and Flag-tagged Rab32 expression plasmids. Immunoprecipitation data showed that Rab32-T39N, but not Q85L, immunoprecipitated with the core protein (Fig. 7e), indicating that the HCV core specifically reacted with GDP-binding RAb32. Importantly, only a small amount of wild-type Rab32 in Huh7 cells reacted with the core protein (Fig. 7e, bottom panel), further confirming that most Rab32 proteins in uninfected Huh7 cells were GTP-bound.

And leads to a redistribution of similar structure - a non-Q85L Rab32-T39N expressed Hsc70 and α - synuclein in some air upgrade (α -synuclein) ubiquitination proteins microtubule formation center (microtubule-organizing center) in the cytoplasm, including Have been reported (15). It is also known that the HCV core protein is ubiquitinated by ubiquitin ligase E6AP and is degraded by the proteasome-dependent pathway (31, 32). Recently, Afzal et al. Reported that the core appears to inhibit its degradation by undergoing post-translational modification, post-translational modification allowing the core portion to become a detergent-resistant microdomain of the membrane of the endoplasmic reticulum (33). Thus, the present inventors anticipated that HCV-induced GDP-coupled Rab32 production would play an important role in core stabilization by allowing the core to concentrate into a Rab32-induced cohesive structure. To confirm this, Huh7 cells transfected with various Rab32 constructs were infected with Jc1, and the cell broth was divided into detergent-soluble and insoluble fractions. Figure 7f shows that when HCV is infected most of the wild-type Rab32 protein is redistributed into the insoluble fraction in the detergent-soluble fraction (lane 4) and further that the HCV infection is in GDP-bound form in the predominantly nucleotide state of Rab32 . Importantly, the major changes in protein solubility occur in the core protein and not in other HCV proteins. As expected, the ectopic expression of both Rab32 wild-type and T39N increased 1.64-fold and 2.29-fold, respectively, insoluble core protein levels compared to the vector control (Fig. 7f, lanes 4 and 6). This result indicates that the GDP-bound RAb32 reacts with the core and concentrates the core in the detergent-insoluble fraction. Notably, despite the response to the core, expressing the L188P mutation of Rab32 results in the lowest level of detergent-insoluble core protein, which is indicative of the functional significance of PKA-fixing activity in Rab32 as well as PKA signaling. In the cells overexpressing Rab32-T39N rather than Q85L by immunofluorescence analysis, the core protein accumulated in the cytoplasmic juxtanuclear structure as yellow granules (Fig. 7g). This data suggests that GDP-coupled Rab32 selectively reacts with the HCV core and concentrates the core in Rab32 aggregates. To demonstrate the effect of the Rab32 protein on detergent-resistance of the core protein, Huh7 cells infected with Jc1 were transfected with an empty vector (upper panel) or V5-labeled wild-type Rab32 (lower panel). After 30 hours of transfection, cells were briefly soaked in 1% Triton X-100 solution and taken out for immunofluorescence analysis. As previously reported (27), some core spots and patches were resistant to detergent treatment (Fig. 7h, arrows in the lower panel). Importantly, core proteins are located on detergent-resistant Rab32 and accumulate at high levels in cells expressing Rab32 protein (Figure 7h, bottom panel), whereas in neighboring untransfected cells only small spots Was detected. This data shows that insoluble Rab32 protects the core protein from the detergent and thus accumulates more core proteins in the detergent-insoluble fraction.

Result 8: Rab32 HCV  Engage in the assembly phase of the life cycle.

The HCV core protein appears to be located in a detergent-resistant membrane that is supposed to be the platform of HCV particle assemblies (27, 28). In addition, the HCV core is located in the lipocyte surface of the infected cells and in the lipocyte assembly surrounded by the core around the nucleus, which is proven to be essential for virus assembly (34-36). Since the stabilization of core-lipid bodies can be mediated through the formation of aggression-like structures (29, 30), we hypothesize that HCV will use Rab32 harvested for virus assembly. To investigate the function of Rab32 in the HCV life cycle, Rab32 silencing was performed by introducing HCV-like particles (HCV pseudoparticle; HCVpp) using JFH-1 envelope glycoprotein as described in the prior art (20) (Fig. 8A). Next, we examined whether Rab32 is involved in the internal ribosome entry site (HCV) IR-mediated translation. For this, Huh7 cells transfected with Rab32 siRNA were transfected with pRL-HL and? -Galactosidase expression plasmids (37) and luciferase activity was measured. We also found that Rab32 is not involved in HCV IRES-dependent translation (Figure 8b). We then examined whether Rab32 is required for HCV RNA replication. To answer this question, treatment of siRNAs directed against HCV subgenomic replicon cells from genotype 1b or genotype 2a revealed that Rab32 silencing is prominent in both HCV subgenomic replicon cells from genotype 1b or genotype 2a (Figure 8c) But no effect. This data suggests that Rab32 is involved in the late stages of the HCV life cycle. To determine whether Rab32 is essential for the late stages of the HCV life cycle, Huh7 cells were transfected with the Jc1 virus followed by negative siRNA or Rab32-specific siRNA or positive siRNA. Although the level of Rab32 mRNA was significantly inhibited by siRNA treatment, intracellular HCV RNA levels (left panel) and protein levels (right panel) were unaffected (FIG. 8d). Similarly, Rab32 had no effect on extracellular HCV RNA levels (Figure 8e). However, when infected Huh7 cells were infected with Jc1 collected from the cultured supernatant of Figure 8d, intracellular HCV RNA levels in the second infection were reduced to 50% in Rab32 knockdown cells (Figure 8f, left panel). In the same vein, HCV protein levels were also significantly reduced in Rab32 knockdown cells (Figure 8f, right panel), indicating that Rab32 is involved in myelosis assembly or release. To demonstrate this hypothesis, intracellular HCV infection was measured. For this, Huh7 cells infected with Jc1 were transfected with the indicated siRNA. After 72 hours, the cells were disrupted by repeated freezing and thawing several times. The infected Huh7 cells were infected with cell supernatants and the relative intracellular HCV infection was analyzed by qRT-PCR. As shown in FIG. 8g, intracellular HCV infection was significantly reduced in Rab32-knockdown cells. These data suggest that RAb32 is specifically involved in the assembly phase of the HCV life cycle. Because Rab32 collects the HCV core into the assembly site, the effect of Rab32 silencing on core and lipid body distribution was studied by confocal analysis. Consistent with previous reports (38, 39), the Jc1 core protein showed a low core-lipoprotein association level in cells treated with negative siRNA and showed a net-like staining pattern (Figure 8h, top panel). Note that knocking down Rab32 allows the core to remain on the surface of the crowded fat body, which means that the core is prevented from moving to the assembly site (Fig. 8h, bottom panel). Taken together, the present inventors have provided strong evidence that Rab32 is an essential host for HCV particle assembly.

Table 1 is a list of primers used in the examples of the present invention.

Tables 2, 3 and 4 below show the siRNA, shRNA and antibody epitope sequences of Rab32, respectively.

Table 2 shows the sense strand among the siRNAs against the human Rab32 gene. In fact, siRNA is a two-stranded RNA coupled with an antisense strand complementary to the sense strand. However, in addition to those shown in Table 2, it is easy to derive the siRNA sequence of Rab32 to those of ordinary skill in the art to which the present invention belongs, and the siRNA for the Rab32 gene is not limited to the sequence shown in Table 2 It is obvious.

Table 3 shows the shRNA sequence for the human Rab32 gene. However, in addition to those shown in Table 3, it is easy to derive the shRNA sequences of Rab32 to those of ordinary skill in the art to which the present invention belongs, and the shRNA for the Rab32 gene is not limited to the sequences shown in Table 3 It is obvious.

Table 4 shows the antigenic determinants of Rab32. Anti-Rab32 antibodies can be readily generated by one of ordinary skill in the art to bind to one or more of these antigen recognition sites using known antibody production software.

Target site SiRNA Sequence One 907 CUG AGA AUG GGU UAC AGAI 2 1028 CUA GUG GCU CUG UAA CUUE 3 248 AGCACCUCUUCAAGGUGCUGGUGAU 4 440 GAUUUGGCAACAUGACCCGAGUAUA 5 456 CCGAGUAUACUACAAGGAAGCUGUU 6 509 GAAGUUCCACAUUUGAGGCAGUCUUU 7 511 AGUUCCACAUUUGAGGCAGUCUUAA 8 648 CCAGGUGGACCAAUUCUGCAAAGAA 9 736 CGGUUCCUAGUGGAGAAGAUUCUUG 10 737 GGUUCCUAGUGGAGAAGAUUCUUGU

Target site Oligonucleotide sequence (Top strand) One 432 5'-CACCGCAGGAGCGATTTGGCAACATCGAAATGTTGCCAAATCGCTCCTGC -3 ' 2 445 5'-CACCGGCAACATGACCCGAGTATACCGAAGTATACTCGGGTCATGTTGCC -3 ' 3 446 5'-CACCGCAACATGACCCGAGTATACTCGAAAGTATACTCGGGTCATGTTGC -3 ' 4 651 5'-CACCGGTGGACCAATTCTGCAAAGACGAATCTTTGCAGAATTGGTCCACC -3 ' 5 654 5'-CACCGGACCAATTCTGCAAAGAACACGAATGTTCTTTGCAGAATTGGTCC -3 ' 6 737 5'-CACCGGTTCCTAGTGGAGAAGATTCCGAAGAATCTTCTCCACTAGGAACC -3 ' 7 753 5'- CACCGATTCTTGTAAACCACCAAAGCGAACTTTGGTGGTTTACAAGAATC -3 ' 8 810 5'-CACCGCTAGATCAAGAGACCTTGAGCGAACTCAAGGTCTCTTGATCTAGC -3 ' 9 832 5'-CACCGCAGAGAACAAATCCCAGTGTCGAAACACTGGGATTTGTTCTCTGC -3 ' 10 835 5'-CACCGAGAACAAATCCCAGTGTTGCCGAAGCAACACTGGGATTTGTTCTC -3 '

location Residue start End Peptides Score location Residue start End Peptides Score 4 G One 8 MAGGGAGD 4.1 154 S 151 158 SSQSPSQV 4.55 5 G 2 9 AGGGAGDP 4.888 155 P 152 159 SQSPSQVD 4.988 6 A 3 10 GGGAGDPG 5.338 156 S 153 160 QSPSQVDQ 4.925 7 G 4 11 GGAGDPGL 3.475 157 Q 154 161 SPSQVDQF 3.025 8 D 5 12 GAGDPGLG 3.475 160 Q 157 164 QVDQFCKE 3 9 P 6 13 AGDPGLGA 3.025 162 C 159 166 DQFCKEHG 3.688 10 G 7 14 GDPGLGAA 3.025 174 S 171 178 FETSAKDN 4.388 17 P 14 21 AAAPAPET 3.2 175 A 172 179 ETSAKDNI 4.537 18 A 15 22 AAPAPETR 3.462 176 K 173 180 TSAKDNIN 4.438 19 P 16 23 APAPETRE 4.175 179 I 176 183 KDNINIEE 3.663 20 E 17 24 PAPETREH 4.175 180 N 177 184 DNINIEEA 3.213 86 E 83 90 AGQERFGN 3.663 198 S 195 202 NHQSFPNE 3.663 112 S 109 116 SRSSTFEA 3.7 199 F 196 203 HQSFPNEE 3.763 113 T 110 117 RSSTFEAV 2.425 200 P 197 204 QSFPNEEN 4.375 122 S 119 126 KWKSDLDS 3.15 201 N 198 205 SFPNEEND 4.875 123 D 120 127 WKSDLDSK 3.15 202 E 199 206 FPNEENDV 3.6 124 L 121 128 KSDLDSKV 3.938 203 E 200 207 PNEENDVD 6 125 D 122 129 SDLDSKVH 3.488 204 N 201 208 NEENDVDK 6.45 144 K 141 148 LANKCDQN 3.75 205 D 202 209 EENDVDKI 4.575 145 C 142 149 ANKCDQNK 5.613 206 V 203 210 ENDVDKIK 4.313 146 D 143 150 NKCDQNKD 6.6 210 K 207 214 DKIKLDQE 3.5 147 Q 144 151 KCDQNKDS 6.538 215 T 212 219 DQETLRAE 4.237 148 N 145 152 CDQNKDSS 6.637 216 L 213 220 QETLRAEN 3.863 149 K 146 153 DQNKDSSQ 7.213 217 R 214 221 ETLRAENK 3.825 150 D 147 154 QNKDSSQS 6.775 218 A 215 222 TLRAENKS 3.663 151 S 148 155 NKDSSQSP 6.288 219 E 216 223 LRAENKSQ 3.763 152 S 149 156 KDSSQSPS 6.225 220 N 217 224 RAENKSQC 5.087 153 Q 150 157 DSSQSPSQ 6.263 221 K 218 225 AENKSQCC 4.737

<110> Industry-Academic Corporation Foundation, Hallym University <120> Pharmaceutical composition for prevention and treatment for          Hepatitis C containing Rab32 expression or activity inhibitors <130> SBHwang-Rab32-161019 <160> 97 <170> KoPatentin 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tgggacagca ggactctgg 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 actcgggtca tgttgccaa 19 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 taatagaatt ccatggcggg cggaggagcc 30 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gccggatcct cagcaacact gggatttgtt c 31 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tagcgcttga tgatgctgtt cttgcccacg cca 33 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tgtgggacat cgcggggctg gagcgatttg gca 33 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atgttgccaa atcgctccag ccccgcgatg tcc 33 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tgtgggacat cgcggggctg gagcgatttg gca 33 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tacaagaatc ttctccacgg ggaaccgggc agc 33 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 aggaagctgc ccggttcccc gtggagaaga ttc 33 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 atgaattcat ggcgggcgga ggagcc 26 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 aagcggccgc tcagcaacac tgggatttg 29 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 taatagaatt catggcgggc ggaggagcc 29 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ccggtctaga ctgcaacact gggatttgtt c 31 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gatcacgcgt tccgtccttc gttaagttc 29 <210> 16 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gctaagatct cagagtcctg ctgtcccag 29 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 gcgaattccc ctcagttgtc actccattct cc 32 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 aagcggccgc gctggaagtg gaggactctt g 31 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 acgaattcac cctcagttgt cac 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 aggatcctta gctggaagtg gag 23 <210> 21 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA top strand <400> 21 cugagaaugg guuacagau 19 <210> 22 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 22 cuaguggcuc uguaacuua 19 <210> 23 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Jc1 NTR siRNA top strand <400> 23 ccucaaagaa aaaccaaacu u 21 <210> 24 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 24 gauuuggcaa caugacccga guaua 25 <210> 25 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 25 ccgaguauac uacaaggaag cuguu 25 <210> 26 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 26 gaaguuccac auuugaggca gucuu 25 <210> 27 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 27 aguuccacau uugaggcagu cuuaa 25 <210> 28 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 28 ccagguggac caauucugca aagaa 25 <210> 29 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 29 cgguuccuag uggagaagau ucuug 25 <210> 30 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 30 gguuccuagu ggagaagauu cuugu 25 <210> 31 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Rab32 siRNA top strand <400> 31 agaccucenti caaggugcug gugau 25 <210> 32 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA top strand <400> 32 caccgcagga gcgauuuggc aacaucgaaa uguugccaaa ucgcuccugc 50 <210> 33 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA top strand <400> 33 caccggcaac augacccgag uauaccgaag uauacucggg ucauguugcc 50 <210> 34 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 34 caccgcaaca ugacccgagu auacucgaaa guauacucgg gucauguugc 50 <210> 35 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 35 caccggugga ccaauucugc aaagacgaau cuuugcagaa uugguccacc 50 <210> 36 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 36 caccggacca auucugcaaa gaacacgaau guucuuugca gaauuggucc 50 <210> 37 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 37 caccgguucc uaguggagaa gauuccgaag aaucucucc acuaggaacc 50 <210> 38 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 38 caccgauucu uguaaaccac caaagcgaac uuuggugguu uacaagaauc 50 <210> 39 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 39 caccgctaga tcaagagacc ttgagcgaac tcaaggtctc ttgatctagc 50 <210> 40 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 40 caccgcagag aacaaauccc agugucgaaa cacugggauu uguucucugc 50 <210> 41 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Rab32 shRNA <400> 41 caccgagaac aaaucccagu guugccgaag caacacuggg auuuguucuc 50 <210> 42 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> human Rab32 antibody epitope <400> 42 Met Ala Gly Aly Gly Asp   1 5 <210> 43 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> human Rab32 antibody epitope <400> 43 Ala Gly Aly Gly Aly Gly Asp Pro   1 5 <210> 44 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> human Rab32 antibody epitope <400> 44 Gly Gly Gly Ala Gly Asp Pro Gly   1 5 <210> 45 <211> 8 <212> PRT <213> homo sapiens <400> 45 Gly Gly Ala Gly Asp Pro Gly Leu   1 5 <210> 46 <211> 8 <212> PRT <213> Homo sapiens <400> 46 Gly Ala Gly Asp Pro Gly   1 5 <210> 47 <211> 8 <212> PRT <213> Homo sapiens <400> 47 Ala Gly Asp Pro Gly   1 5 <210> 48 <211> 8 <212> PRT <213> Homo sapiens <400> 48 Gly Asp Pro Gly   1 5 <210> 49 <211> 8 <212> PRT <213> Homo sapiens <400> 49 Ala Ala Ala Pro Ala Pro Glu Thr   1 5 <210> 50 <211> 8 <212> PRT <213> Homo sapiens <400> 50 Ala Ala Pro Ala Pro Glu Thr Arg   1 5 <210> 51 <211> 8 <212> PRT <213> Homo sapiens <400> 51 Ala Pro Ala Pro Glu Thr Arg Glu   1 5 <210> 52 <211> 8 <212> PRT <213> Homo sapiens <400> 52 Pro Ala Pro Glu Thr Arg Glu His   1 5 <210> 53 <211> 8 <212> PRT <213> Homo sapiens <400> 53 Ala Gly Gln Glu Arg Phe Gly Asn   1 5 <210> 54 <211> 8 <212> PRT <213> Homo sapiens <400> 54 Ser Arg Ser Ser Thr Phe Glu Ala   1 5 <210> 55 <211> 8 <212> PRT <213> Homo sapiens <400> 55 Arg Ser Ser Thr Phe Glu Ala Val   1 5 <210> 56 <211> 8 <212> PRT <213> Homo sapiens <400> 56 Lys Trp Lys Ser Asp Leu Asp Ser   1 5 <210> 57 <211> 8 <212> PRT <213> Homo sapiens <400> 57 Trp Lys Ser Asp Leu Asp Ser Lys   1 5 <210> 58 <211> 8 <212> PRT <213> Homo sapiens <400> 58 Lys Ser Asp Leu Asp Ser Lys Val   1 5 <210> 59 <211> 8 <212> PRT <213> Homo sapiens <400> 59 Ser Asp Leu Asp Ser Lys Val His   1 5 <210> 60 <211> 8 <212> PRT <213> Homo sapiens <400> 60 Leu Ala Asn Lys Cys Asp Gln Asn   1 5 <210> 61 <211> 8 <212> PRT <213> Homo sapiens <400> 61 Ala Asn Lys Cys Asp Gln Asn Lys   1 5 <210> 62 <211> 8 <212> PRT <213> Homo sapiens <400> 62 Asn Lys Cys Asp Gln Asn Lys Asp   1 5 <210> 63 <211> 8 <212> PRT <213> Homo sapiens <400> 63 Lys Cys Asp Gln Asn Lys Asp Ser   1 5 <210> 64 <211> 8 <212> PRT <213> Homo sapiens <400> 64 Cys Asp Gln Asn Lys Asp Ser Ser   1 5 <210> 65 <211> 8 <212> PRT <213> Homo sapiens <400> 65 Asp Gln Asn Lys Asp Ser Ser Gln   1 5 <210> 66 <211> 8 <212> PRT <213> Homo sapiens <400> 66 Gln Asn Lys Asp Ser Ser Gln Ser   1 5 <210> 67 <211> 8 <212> PRT <213> Homo sapiens <400> 67 Asn Lys Asp Ser Ser Gln Ser Pro   1 5 <210> 68 <211> 8 <212> PRT <213> Homo sapiens <400> 68 Lys Asp Ser Ser Gln Ser Ser Ser   1 5 <210> 69 <211> 8 <212> PRT <213> Homo sapiens <400> 69 Asp Ser Ser Gln Ser Ser Ser Gln   1 5 <210> 70 <211> 8 <212> PRT <213> Homo sapiens <400> 70 Ser Ser Gln Ser Ser Ser Gln Val   1 5 <210> 71 <211> 8 <212> PRT <213> Homo sapiens <400> 71 Ser Gln Ser Ser Ser Gln Val Asp   1 5 <210> 72 <211> 8 <212> PRT <213> Homo sapiens <400> 72 Gln Ser Ser Ser Gln Val Asp Gln   1 5 <210> 73 <211> 8 <212> PRT <213> Homo sapiens <400> 73 Ser Pro Ser Gln Val Asp Gln Phe   1 5 <210> 74 <211> 8 <212> PRT <213> Homo sapiens <400> 74 Gln Val Asp Gln Phe Cys Lys Glu   1 5 <210> 75 <211> 8 <212> PRT <213> Homo sapiens <400> 75 Asp Gln Phe Cys Lys Glu His Gly   1 5 <210> 76 <211> 8 <212> PRT <213> Homo sapiens <400> 76 Phe Glu Thr Ser Ala Lys Asp Asn   1 5 <210> 77 <211> 8 <212> PRT <213> Homo sapiens <400> 77 Glu Thr Ser Ala Lys Asp Asn Ile   1 5 <210> 78 <211> 8 <212> PRT <213> Homo sapiens <400> 78 Thr Ser Ala Lys Asp Asn Ile Asn   1 5 <210> 79 <211> 8 <212> PRT <213> Homo sapiens <400> 79 Lys Asp Asn Ile Asn Ile Glu Glu   1 5 <210> 80 <211> 8 <212> PRT <213> Homo sapiens <400> 80 Asp Asn Ile Asn Ile Glu Glu Ala   1 5 <210> 81 <211> 8 <212> PRT <213> Homo sapiens <400> 81 Asn His Gln Ser Phe Pro Asn Glu   1 5 <210> 82 <211> 8 <212> PRT <213> Homo sapiens <400> 82 His Gln Ser Phe Pro Asn Glu Glu   1 5 <210> 83 <211> 8 <212> PRT <213> Homo sapiens <400> 83 Glu Ser Phe Pro Asn Glu Glu Asn   1 5 <210> 84 <211> 8 <212> PRT <213> Homo sapiens <400> 84 Ser Phe Pro Asn Glu Glu Asn Asp   1 5 <210> 85 <211> 8 <212> PRT <213> Homo sapiens <400> 85 Phe Pro Asn Glu Glu Asn Asp Val   1 5 <210> 86 <211> 8 <212> PRT <213> Homo sapiens <400> 86 Pro Asn Glu Glu Asn Asp Val Asp   1 5 <210> 87 <211> 8 <212> PRT <213> Homo sapiens <400> 87 Asn Glu Glu Asn Asp Val Asp Lys   1 5 <210> 88 <211> 8 <212> PRT <213> Homo sapiens <400> 88 Glu Glu Asn Asp Val Asp Lys Ile   1 5 <210> 89 <211> 8 <212> PRT <213> Homo sapiens <400> 89 Glu Asn Asp Val Asp Lys Ile Lys   1 5 <210> 90 <211> 8 <212> PRT <213> Homo sapiens <400> 90 Asp Lys Ile Lys Leu Asp Gln Glu   1 5 <210> 91 <211> 8 <212> PRT <213> Homo sapiens <400> 91 Asp Gln Glu Thr Leu Arg Ala Glu   1 5 <210> 92 <211> 8 <212> PRT <213> Homo sapiens <400> 92 Gln Glu Thr Leu Arg Ala Glu Asn   1 5 <210> 93 <211> 8 <212> PRT <213> Homo sapiens <400> 93 Glu Thr Leu Arg Ala Glu Asn Lys   1 5 <210> 94 <211> 8 <212> PRT <213> Homo sapiens <400> 94 Thr Leu Arg Ala Glu Asn Lys Ser   1 5 <210> 95 <211> 8 <212> PRT <213> Homo sapiens <400> 95 Leu Arg Ala Glu Asn Lys Ser Gln   1 5 <210> 96 <211> 8 <212> PRT <213> Homo sapiens <400> 96 Arg Ala Glu Asn Lys Ser Gln Cys   1 5 <210> 97 <211> 8 <212> PRT <213> Homo sapiens <400> 97 Ala Glu Asn Lys Ser Gln Cys Cys   1 5

Claims (9)

A pharmaceutical composition for the prevention and treatment of hepatitis C comprising siRNA (short interfering RNA) for one Rab32 gene selected from SEQ ID NOS: 21, 22, and 24 to 31.
delete delete delete delete delete delete delete delete

Images