WO2012036301A1

WO2012036301A1 - Process for producing vinylglycine derivatives

Info

Publication number: WO2012036301A1
Application number: PCT/JP2011/071542
Authority: WO
Inventors: Tomoyasu Kawabe; Daizo Kudou
Original assignee: Sumitomo Chemical Company, Limited
Priority date: 2010-09-15
Filing date: 2011-09-14
Publication date: 2012-03-22
Also published as: JP2012080879A

Abstract

A process for producing a vinylglycine derivative, comprising a reaction with a vinyl glyoxylic acid derivative and a transformant harboring an amino acid dehydrogenase gene.

Description

DESCRIPTION

PROCESS -FOR PRODUCING VINYLGLYCINE DERIVATIVES TECHNICAL FIELD

[0001]

The present invention relates to a process for producing a vinylglycine derivative or a salt thereof.

BACKGROUND ART

[0002]

Vinylglycine, which is an amino acid that does not commonly constitute a protein, has been shown that it is isolated from fungus and inhibits many enzymes. Vinylglycine and derivative thereof have been utilized as enzyme inhibitors or antibiotics (see e.g. Accounts of Chemical Research, 8(8), 281-288 (1975); Current Medicinal Chemistry, 14 ( 12 ), 1291-1324 (2007); 01998 /012173 ; JP-A- 5-105657 etc. ) .

As to a method for producing vinylglycine using an enzyme, known is a process employing aminotransferase [EC 2.6.1.X], an enzyme catalyzing the transfer of an amino group of an amino acid to 2-oxo acid (i.e. vinylketoacid (vinylglyoxylic acid) ) . to produce another oxo acid and another amino acid (i.e. vinylglycine derivative) (see JP-A- 2007-295865) . DISCLOSURE OF INVENTION

[0003]

Since the above-mentioned process requires an amino acid as an amino group donor, it is not easy to avoid an increase in cost of producing a vinylglycine derivative.

[0004]

The present invention provides:

[1] A process for producing a vinylglycine derivative represented by the formula (2) :

wherein R¹ represents hydrogen, an alkyl group having

8 carbon atoms, or an aryl group having 6 to 20 carbon atoms;

or a salt thereof

comprising a step of reacting in the presence of an ammonium salt compound and a cofactor

a vinyl glyoxylic acid represented by the formula (1) :

wherein R¹ is the same as defined above;

or a salt thereof with a culture of a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell, or a processed product of the culture (hereinafter, "an amino acid dehydrogenase" is sometimes referred to as "the enzyme used in the present invention"; "a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase" is sometimes referred to as "the polynucleotide used in the present invention"; "a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell" is sometimes referred to as "the transformant used, in the present invention"; and "The process of the item [1]" is sometimes referred to as "the process of the present invention");

[2] The process according to the item [1] wherein the amino acid dehydrogenase is one or more enzymes selected from the group consisting of:

(1) leucine dehydrogenase;

(2) glutamic acid dehydrogenase;

(3) alanine dehydrogenase; and

(4) phenylalanine dehydrogenase;

[3] The process according to the item [1] wherein the amino acid dehydrogenase is an enzyme comprising any one of the following amino acid sequences:

a) the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7;

b) an amino acid sequence which is encoded by a nucleotide sequence of DNA that hybridizes to DNA consisting of the nucleotide sequence represented by any one of SEQ ID NOs: 8 to 14 under a stringent condition and which is an amino acid sequence of an enzyme capable of converting the vinyl glyoxylic acid or a salt thereof to the vinylglycine derivative or a salt thereof; and

c) an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted or added in the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7 and which is . an amino acid sequence of an enzyme capable of converting the vinyl glyoxylic acid or a salt thereof to the vinylglycine derivative or a salt thereof;

[4] The process according to the item [1] wherein the amino acid dehydrogenase is an enzyme comprising the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7;

[5] The process according to any one of the items [1] to

[4] wherein the cofactor is NADH or NADPH;

[6] The process according to any one of the items [1] to [5] wherein R¹ of the vinyl glyoxylic acid or a salt thereof is hydrogen or an alkyl group having 1 to 5 carbon atoms;

[7] The process according to any one of the items [1] to [6] wherein R¹ of the vinyl glyoxylic acid or a salt thereof is hydrogen; and

[8] Use of a culture of a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell, or a processed product of the culture as a catalyst for converting in the presence of an ammonium salt compound and a cofactor a vinyl glyoxylic acid represented by the formula (1) :

wherein R¹ represents hydrogen, an alkyl group having 1 to 8 carbon atoms, or an aryl group having 6 to 20 carbon atoms ;

or a salt thereof

to a vinylglycine derivative represented by the formula (2) :

wherein R¹ is the same as defined above;

or salt thereof ("The use of the item [8] is, hereinafter, sometimes referred to as "the use of the present invention") .

[0005]

Since the process of the present invention does not require an amino acid as an amino group donor and utilizes ammonia, it is easy to avoid the increase in cost for producing a vinylglycine derivative.

BRIEF DESCRIPTION OF DRAWINGS

[0006]

Figure 1 shows a change of absorbance at 340 nm (A₃₄₀ ) in one embodiment of the present invention where a processed product of -the culture of the transformant used in the present invention (which is specifically a product obtained by disrupting the cell wall) were reacted with 2- keto-3-butenoic acid.

MODE FOR CARRYING OUT THE INVENTION

[0007]

It will be understood that the inventions described herein are not limited to the particular methodologies, protocols, and reagents described herein and that they can be modified. It will be understood that the terms used herein are meant only to describe a particular embodiment of the present invention, and that such terms do not limit the scope of the present invention.

Unless otherwise noted, all of the technical terms and chemical terms used herein have the same meaning as those commonly understood by a person skilled in the technical field of the present invention. While the present invention may be carried out or examined by using methods or materials similar or equivalent to those described herein, some of the preferred methods, equipments, and materials are described in the following.

[0008]

"Cofactor" as used in the process of the present invention means a chemical substance other than a protein, and said chemical substance is required for a catalytic activity of an enzyme and is necessary to bind to the enzyme to allow the enzyme to function. Specifically, examples of cofactor include a coenzyme. The coenzyme is an organic molecule other than a protein and transfers a functional group between enzymes. These molecules are loosely-bound to an enzyme and usually dissociate from the enzyme during normal stage of the enzyme reaction.

[0009]

Hereinafter, the present invention is explained in more detail.

The process of the present invention is a process for producing a vinylglycine derivative represented by the formula (2 ) :

wherein R¹ represents hydrogen, an alkyl group having 1 to 8 carbon atoms, or an aryl group having 6 to 20 carbon atoms;

or a salt thereof (hereinafter, sometimes referred to as "Compound (2)")

comprising a step of reacting in the presence of an ammonium salt compound and a cofactor a vinyl glyoxylic acid represented by the formula (1) :

wherein R¹ is the same as defined above;

or a salt thereof (hereinafter, sometimes referred to as "Compound (1)")

with a culture of a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell, or a processed product of the culture (i.e. the above-described "a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell" is "the transformant used in the present invention"; and the above- described "a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase" is "the polynucleotide used in the present invention"; and the above-described "amino acid dehydrogenase" is "the enzyme used in the present invention" ) .

[0010]

Examples of "an alkyl group having 1 to 8 carbon atoms" represented by R¹ in Compound (1) and Compound (2) include a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, an isobutyl group, a t- butyl group, a pentyl group, a hexyl group, a heptyl group, and an octyl group. Examples of "an aryl group having 6 to 20 carbon atoms" represented by R¹ include a phenyl group, a tolyl group, and a naphthyl group.

Preferred examples of R¹ include hydrogen atom or an alkyl group having 1 to 5 carbon atoms. More preferred examples of R¹ include hydrogen atom.

[0011]

A transformant used as a catalyst for the process of the present invention may be prepared by introducing a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an enzyme capable of converting Compound (1) to Compound (2) into a microorganism cell according to the conventional genetic engineering method (i.e. the above-described "a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an enzyme capable of converting Compound (1) to Compound (2)" is "the polynucleotide used in the present invention"; and the above-described "an enzyme capable of converting Compound (1) to Compound (2)" is "the enzyme used in the present invention") .

[0012]

The polynucleotide used in the present invention, for example, may be a natural gene, or a gene prepared by introducing a mutation into a natural gene by means of site-directed mutagenesis or random mutagenesis. To screen the natural gene, a microorganism capable of producing an enzyme having an ability to convert Compound (1) to Compound (2) may be a target for the gene screening.

Specifically, for example, to identify the microorganism, 5 ml of sterilized culture medium is placed in a test tube, into which a microorganism obtained by purchasing from a culture collection or a microorganism isolated from soils is inoculated. The inoculated medium is incubated with shaking at 30 °C under an aerobic condition. After the culture is completed, the microbial cells are collected by centrifugation to give viable cells. The resulting viable cells are suspended in 1.5 ml of 0.2 M potassium phosphate buffer (pH 7.9) followed by addition of 0.065 ml of aqueous solution of 2% (w/v) 2-keto-3-butenoic acid. The resulting mixture is shaken at 30 °C for 2 to 3 days .

After the completion of the reaction, the reaction solution is sampled. The amount of the produced vinylglycine is analyzed by liquid chromatography etc.

Thus, microorganism capable of producing an enzyme having an ability to convert 2-keto-3-butenoic acid to the corresponding vinylglycine are screened. As described later, the screened microorganism may be used for identification of the polynucleotide used in the present invention.

[0013]

Examples of the enzyme used in the present invention include one or more enzymes selected from the group consisting of leucine dehydrogenase, glutamic acid dehydrogenase, alanine dehydrogenase and phenylalanine dehydrogenase. Origins of these enzymes may be any kind of organs (e.g. liver) derived from mammals such as bovine, or microorganisms as described below.

[0014]

These enzymes may be isolated from the above-described origins according to general biochemical procedure or easily obtained by purchasing them as commercialized products from reagent manufacturers.

[0015]

Examples of the microorganism having an ability to produce the enzyme used in the present invention include one or more microorganisms selected., from a group consisting of microorganisms of the genus Bacillus, microorganisms of the genus Proteus, microorganisms of the genus Sporosarcina and microorganisms of the genus Saccharomyces .

Examples of the microorganism having the above ability

(i.e. the microorganism used in the present invention) also include one or more microorganisms selected from the following group of microorganisms:

Bacillus sphaericus;

Bacillus subtilis;

Bacillus cereus;

Bacillus stearothermophilus;

Proteus inconstans;

Sporosarcina ureae; and

Saccharomyces cerevisiae .

[0016]

These microorganisms may be either isolated from natural sources, or easily obtained by purchasing from culture collections. Examples of culture collections from which the microorganisms can be purchased include the following culture collections.

[0017]

1. IFO (Institute of Fermentation Osaka) culture collection At present, the culture collection is transferred to National Institute of Technology and Evaluation Biological Resource Center (NBRC) . Microorganisms can be purchased by filing an application to NBRC, which can be done by, for example, accessing the website of NBRC

(http : //www. nbrc .nite . go . jp/NBRC2/NBRCDispSearchServlet?lan g=jp) .

2. ATCC (American Type Culture Collection)

Microorganisms can be purchased through Summit Pharmaceuticals International Corporation, ATCC Industry Division by, for example, accessing its website (http : //www . summitpharma . co . j p/j apanese/service/s_ATCC . html ) . Alternatively, microorganisms can be purchased directly from ATCC.

3. IAM Culture Collection

At present, among the IAM Culture Collection, bacteria, yeasts, and filamentous fungi are transferred to National Institute of Physical and Chemical Research Biological Resource Center, Microbe Division (JCM), and microalgae are transferred to Microbial Culture Collection in National Institute for Environmental Studies (NIES) . Microorganisms can be purchased by filing an application to JCM or NIES, which can be done by, for example, accessing a site for the culture collections in the website of JCM (http://www.jcm.riken.go.jp/JCM/aboutJCM_J.shtml) or in the website of NIES (http://mcc.nies.go.jp/aboutOnlineOrder.do) . 4. JCM (Japan Collection of Microorganisms)

At present, the culture collection is transferred to National Institute of Physical and Chemical Research Biological Resource Center (RIKEN BRC) , Microbe Division. Microorganisms can be purchased by filing an application to RIKEN BRC, which can be done by, for example, accessing a site for the culture collection in the website of RIKEN (http://www.jcm.riken.go.jp/JCM/aboutJCM_J.shtml) .

[0018]

Hereinafter, a method of preparing the transformant used in the present invention into which a foreign gene has been introduced is explained in more detail.

First of all, Examples of the enzyme used in the present invention include one or more enzyme selected from the following group of enzymes

(1) leucine dehydrogenase;

(2) glutamic acid dehydrogenase;

(3) alanine dehydrogenase; and (4) phenylalanine dehydrogenase;

[0019]

Specifically, examples of origins of these enzymes include Proteus inconstahs IFP12930 (said enzyme derived from said microorganism can be purchased from TOYOBO CO., LTD.);

(1) a^■ microorganism of the genus Bacillus such as Bacillus cereus in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO:l (said enzyme derived from said microorganism can be purchased from Sigma) ;

(2) a microorganism of the genus Bacillus such as Bacillus stearothermophilus in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO: 2 (said enzyme derived from said microorganism can be purchased from Wako Pure Chemical Industries, Ltd.);

(3) a microorganism of the genus Bacillus such as Bacillus sphaericus in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO: 3 (said enzyme derived from said microorganism can be purchased from TOYOBO CO. , LTD. ) ;

(4) a microorganism of the genus Bacillus such as Bacillus subtilis in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO: 4 (said enzyme derived from said microorganism can be purchased from Sigma) ;

(5) an organ (e.g. liver) of a mammal such as bovine in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO: 5 (said enzyme derived from said microorganism can be purchased from MP Biomedicals LLC);

(6) a microorganism of the genus Saccharomyces such as Saccharomyces cerevisiae in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO: 6 (said enzyme derived from said microorganism can be purchased from Oriental Yeast Co., ltd.); and

(7) a microorganism of the genus Sporosarcina such as Sporosarcina ureae in the case of an enzyme comprising the amino acid sequence represented by SEQ ID NO: 7 (said enzyme derived from said microorganism can be purchased from MP Biomedicals. LLC. ) .

[0020]

More specifically, examples of the enzyme used in the present invention include an enzyme comprising any one of the following amino acid sequences:

a) an amino acid sequence represented by any one of SEQ ID NOs: 1 to 7;

c) an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted or added in the amino acid sequence represented by any one of SEQ ID NOs : 1 to 7 and which is an amino acid sequence of an enzyme capable of converting the vinyl glyoxylic acid or a salt thereof to the vinylglycine derivative or a salt thereof.

[0021]

The polynucleotide used in the present invention has a nucleotide sequence encoding an amino acid sequence of the enzyme used in the present invention having an ability to convert Compound (1) to Compound (2) .

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:l include a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 8.

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID N0:2 include a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9.

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3 include a polynucleotide comprising the nucleotide sequence of SEQ ID NO:10.

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence, of SEQ ID NO: 4 include a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 11.

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5 include a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 12.

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6 include a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 13.

Examples of the polynucleotide used in the present invention which comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 7 include a polynucleotide comprising the nucleotide sequence of SEQ ID NO : 14 .

[0022]

Referring to the polynucleotide used in the present invention, "the DNA that hybridizes to DNA consisting of the nucleotide sequence of any one of SEQ ID NOs : 8 to 14 under a stringent condition" denotes DNA that (1) forms a DNA-DNA hybrid with (A) DNA consisting of a nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs: 1 to 7, or DNA consisting of the nucleotide sequence of any one of SEQ ID NOs: 8 to 14 by hybridizing at 65°C under high ion concentration condition [for example, 6XSSC (900mM sodium chloride, 90mM sodium citrate)], and (2) the resulting hybrid can be maintained even after temperature insulation at 65°C for 30 minutes under low ion concentration condition [for example, 0.1XSSC (15mM sodium chloride, 1.5mM sodium citrate)], in the Southern Hybridization techniques, for example, described in "Cloning and Sequence" (Itaru Watanabe supervised, Masahiro Sugiura edited, 1989, published by Noson Bunka sha) , "Molecular Cloning, A Laboratory Manual 2nd ed." (Cold Spring Harbor Laboratory Press (1989)), "Current Protocols in Molecular Biology" (John Wiley & Sons (1987-1997)) and others.

[0023]

Specific examples of the polynucleotide used in the present invention include: DNA comprising a nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs: 1 to 7; DNA comprising a nucleotide sequence in which a part of its nucleotides (for example, one or a plurality of nucleotides) have been deleted, substituted or added in the nucleotide sequence of any one of SEQ ID NOs : 8 to 14 and which encodes an amino acid sequence of an enzyme capable of converting Compound (1) to Compound (2); DNA comprising a nucleotide sequence which has a sequence identity of 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more with a nucleotide sequence encoding the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7 and which encodes an amino acid sequence of an enzyme capable of converting Compound (1) to Compound (2); and DNA comprising a nucleotide sequence which encodes an amino acid sequence having a sequence identity of 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more with the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7 and which encodes an amino acid sequence of an enzyme capable of converting Compound (1) to Compound (2) . Such DNA may be DNA cloned from DNAs present in the natural source, DNA containing artificially introduced deletion, substitution or addition of a part of nucleotides in a nucleotide sequence of the cloned DNA, or artificially synthesized DNA.

[0024]

Examples of a nucleotide sequence in which one or a plurality of nucleotides have been deleted, substituted or added in a nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs : 1 to 7 include: (i) a nucleotide sequence wherein 1 to 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2) nucleotide base(s) is/are deleted in the nucleotide sequence of any one of SEQ ID NOs: 8 to 14, (ii) a nucleotide sequence wherein 1 to 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2) nucleotide base(s) is/are substituted with other nucleotide base(s) in the nucleotide sequence of any one of SEQ ID NOs: 8 to 14, (iii) a nucleotide sequence wherein 1 to 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2) nucleotide base(s) is/are added in the nucleotide sequence of any one of SEQ ID NOs: 8 to 14, or (iv) a nucleotide sequence of a combination of the above (i) to (iii) .

[0025]

A polynucleotide comprising a nucleotide sequence in which one or a plurality of nucleotides have been deleted, substituted or added in the nucleotide sequence of any one of SEQ ID NOs: 8 to 14 can be prepared, for example, according to site-directed mutagenesis described in "Molecular Cloning, A Laboratory Manual 2nd ed." (Cold Spring Harbor Press (1989)), "Current Protocols in Molecular Biology" (John Wiley & Sons (1987-1997)), Kunkel (1985) Proc. Natl. Acad. Sci. USA 82: 488-92, Kunkel (1988) Method. Enzymol. 85: 2763-6 and others.

[0026]

In order to introduce mutation into a polynucleotide, it can be carried out according to a known method such as Kunkel method and Gapped duplex method by using a mutagenesis Kit for site-directed mutagenesis such as QuikChangeTM Site-Directed Mutagenesis. Kit (Stratagene Corp.) GeneTailorTM Site-Directed Mutagenesis System (Invitrogen. Corp.), or TaKaRa Site-Directed Mutagenesis System (Takara Bio Inc.: Mutan-K, Mutan-Super Express Km and the like) .

[0027]

The present polynucleotide can be prepared, for example, as follows.

[0028]

The present polynucleotide that comprises the nucleotide sequence of any of SEQ ID NOs : 8 to 14 can be prepared, for example, as follows.

A cDNA library can be prepared according to a conventional genetic engineering technique (for example, a method described in "Shin Saibokogaku Jikken Protocol" (edited by Tokyo University, Medical Science Laboratoty, Oncology Research Department; Shunjunsha, 1993) from fresh bovine liver and others. Alternatively, a DNA library can be prepared according to a conventional genetic engineering technique from a microorganism such as Bacillus cereus . PCR can be performed using the prepared cDNA library or DNA library as a temperate and using appropriate primers, thereby amplifying DNA comprising a nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs : 1 to 7; DNA comprising a nucleotide sequence encoding an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted or added in the amino acid sequence of any one of SEQ ID NOs: 1 to 7 and/or DNA comprising the nucleotide sequence of SEQ ID NOs: 8 to 14, and others, to prepare DNA of the polynucleotide used in the present invention.

Alternatively, PCR can be performed using the prepared cDNA library or DNA library as a temperate and using the following oligonucleotides (i) and (ii) as appropriate primers :

(i) an oligonucleotide which comprises a partial nucleotide sequence selected from among nucleotide sequences encoding the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7 (e.g. an oligonucleotide comprising a nucleotide sequence having about 14 bases or more which is located at 5 ' terminal of a nucleotide sequence encoding the amino acid sequence represented by any one of SEQ ID NOs : 1 to 7) ;. and

(ii) an oligonucleotide comprising a nucleotide sequence having about 14 bases or more which is complementary to a nucleotide sequence located adjacent to DNA insertion site of the vector used for preparation of the library. Thus, DNA comprising a nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs : 1 to 7; or DNA comprising a nucleotide sequence encoding an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted or added in the amino acid sequence of any one of SEQ ID NOs: 1 to 7, and others, can be amplified to prepare DNA of the polynucleotide used in the present invention.

[0029]

Examples of the condition of the PCR include a condition in which a reaction solution obtained by mixing 4 kinds of dNTPs each in amount of 20 μΜ, 2 kinds of oligonucleotide primers each in amount of 15 μπιοΐ, Taq polymerase in an amount of 1.3 U and a cDNA library as a template is heated at 97°C (for 2 minutes), then, a cycle of 97°C (for 0.25 minutes) , 50°C (for 0.5 minutes) and then 72°C (for 1.5 minutes) is repeated 10 times, then, a cycle of 97°C (for 0.25 minutes), 55°C (for 0.5 minutes) and then 72°C (for 2.5 minutes) is repeated 20 times, further, the reaction solution is kept at 72°C for 7 minutes.

[0030.] A restriction enzyme recognition sequence or the like may be added to the 5' end of a primer used for the PCR.

[0031]

A series of forward primers and reverse primers may be synthesized so that they can have a series of nucleotide sequences of approximately 40 bp which results from division of a nucleotide sequence encoding the amino acid sequence represented by any one of SEQ ID NOs : 1 to 7 into nucleotide sequences each having approximately 40 bp, and the primers are ligated (e.g. by means of Assembly PCR method) to synthesize an oligonucleotide having a nucleotide sequence encoding the amino acid sequence represented by any one of SEQ ID NOs : 1 to 7.

[0032]

DNA amplified as described above can be cloned to a vector according to a method described in "Molecular Cloning: A Laboratory Manual 2nd edition" (1989), Cold Spring Harbor Laboratory Press, "Current Protocols in Molecular Biology" (1987), John Wiley & Sons, Inc. ISBNO- 471-50338-X, and the like, to obtain a recombinant vector.

Specific examples of the vector to be used include pUC119 (Takara Shuzo Co., Ltd.), pTV118N (Takara Shuzo Co., Ltd.), pBluescriptll (Toyobo Co., Ltd.), pCR2.1-TOPO ( Invitrogen) , pTrc99A (Pharmacia), pKK223-3 (Pharmacia) and the like.

[0033] DNA of the polynucleotide used in the present invention can be obtained, for example, by hybridizing, under conditions described below, a DNA library which has been inserted into a microorganism- or phage-derived vector with DNA of about 15 nucleotide bases or more having a partial nucleotide sequence chosen from a whole nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NOs : 1 to 7 as a probe; and detecting DNA to which the probe binds specifically.

[0034]

Examples of the method of hybridizing a probe to chromosomal DNA or cDNA include colony hybridization and plaque hybridization, and the method can be selected depending on the kind of a vector used for preparing a library.

[0035]

When a library to be used is prepared using a plasmid vector, it is recommendable to use colony hybridization. Specifically, DNA of a library is introduced into a host microorganism to obtain transformants , the resulting transformants are diluted. Then, the diluted product is inoculated on an agar medium, and culturing is performed until appearance of a colony.

[0036] ,

When a library to be used is prepared using a phage vector, it is recommendable to use plaque hybridization. Specifically, a host microorganism and a phage of a library are mixed under infectable condition, further mixed with a soft agar medium. Then, the mixture is inoculated on an agar medium, and culturing is performed until appearance of a plaque.

[0037]

In either of the hybridization cases, a membrane is placed on the agar medium on which the above-mentioned culturing has been effected, and a transformant or phage is adsorbed and transferred to the membrane. This membrane is treated with an alkali, then, neutralized, followed by treatment to allow the DNA to be immobilized on the membrane. As more specific examples of plaque hybridization, a nitrocellulose membrane or nylon membrane (for example, Hybond-N⁺ (registered trademark of Amersham) ) is placed on the above-mentioned agar medium, and allowed to stand still for about 1 minute to cause adsorption and transfer of phage particles to a membrane. Then, the membrane is immersed in an alkali solution (for example, 1.5 M sodium chloride, 0.5 M sodium hydroxide) for about 3 minutes to cause dissolution of phage particles, thereby, eluting phage DNA on a membrane, then, immersed in a neutralization solution (for example, 1.5 M sodium chloride, 0.5 M Tris-HCl buffer, pH 7.5) for about 5 minutes. Then, the membrane is washed with a washing solution (for example, 0.3 M sodium chloride, 30 mM citric acid, 0.2 M Tris-HCl buffer, pH 7.5) for about 5 minutes, then, for example, heated at about 80°C for about 90 minutes, to allow the phage DNA to be immobilized on the membrane.

[0038]

Using thus prepared membrane, hybridization is carried out using the above-mentioned DNA as a probe. Hybridization can be conducted, for example, according to descriptions of J. Sambrooke, E. F. Frisch, T. Maniatis, "Molecular Cloning: A Laboratory Manual 2nd edition (1989)", Cold Spring Harbor Laboratory Press, and the like.

[0039]

DNA used as a probe may be one labeled with a radioisotope, or one labeled with a fluorescent coloring matter.

As the method of labeling DNA used as a probe with a radioisotope, there is, for example, a method of performing PCR using, as a template, DNA which is used as a probe, replacing dCTP in the PCR reaction solution with (α- ³²P)dCTP, by utilizing Random Primer Labeling Kit (Takara Shuzo Co., Ltd.) and the like.

When DNA used as a probe is labeled with a fluorescent coloring matter, there can be used, for example, ECL Direct Nucleic Acid Labeling and Detection System manufactured by Amersham, and the like.

[0040]

Hybridization can be performed, for example, as described below.

A prehybridization solution containing 450 to 900 mM sodium chloride and 45 to 90 mM sodium citrate, containing sodium dodecylsulfate (SDS) in a concentration of 0.1 to 1.0 wt %, containing denatured non-specific DNA in a concentration of 0 to 200 μΐ/ml, and depending on conditions, optionally containing albumin, ficoll, polyvinylpyrrolidone and the like each in a concentration of 0 to 0.2 wt % (preferably, prehybridization solution containing 900 mM sodium chloride, 90 mM sodium citrate, 1.0 wt % SDS and 100 μΐ/ml denatured Calf-thymus DNA) is prepared in a proportion of 50 to 200 μΐ per 1 cm² of a membrane produced as described above, and the above- mentioned membrane is immersed in the prehybridization solution and kept at 42 to 65°C for 1 to 4 hours.

Next, for example, a prehybridization solution containing 450 to 900 mM sodium chloride and 45 to 90 mM sodium citrate, containing SDS in a concentration of 0.1 to 1.0 wt %, containing denatured non-specific DNA in a concentration of 0 to 200 μΐ/ml, and depending on conditions, optionally containing albumin, ficoll, polyvinylpyrrolidone and the like each in a concentration of 0 to 0.2 wt % (preferably, prehybridization solution containing 900 m sodium chloride, 90 niM sodium citrate, 1.0 wt % SDS and 100 g/ml denatured Calf-thymus DNA) is mixed with a probe prepared by the above-mentioned method (amount corresponding to 1.0*10⁴ to 2.0*10⁶ cpm per 1 cm² of membrane) to give a solution which is prepared in a proportion of 50 to 200 μΐ per 1 cm² of the membrane, and the membrane is immersed in the hybridization solution and kept at 42 to 65°C for 12 to 20 hours.

[0041]

After the hybridization, the membrane is taken out, and washed using a washing solution of 42 to 65°C containing 15 to 300 mM sodium chloride, 1.5 to 30 mM sodium citrate and 0.1 to 1.0 wt % SDS and the like (preferably, washing solution of 65°C containing 15 mM sodium chloride, 1.5 mM sodium citrate and 1.0 wt %. SDS) . The washed membrane is rinsed slightly with 2<SSC (300 mM sodium chloride, 30 mM sodium citrate), then, dried. This membrane is subjected to, for example, autoradiography and the like to detect a position of a probe on the membrane, thereby specifying, on the original agar medium, a clone that is hybridized with a probe used and corresponds to a position of DNA on the membrane, and this is picked up to isolate a clone having the DNA.

[0042] The polynucletide used in the present invention can be prepared from a cultured microbial cell obtained by culturing thus obtained clone.

[0043]

The polynucleotide used in the present invention can be synthesized artificially. A design and synthesis of an artificial-synthetic gene can be carried out by referring to a method described in Cell Technology additional volume, plant cell technology series 7, "PCR experimental protocol of plant", page 95- 100, Takumi Shimamoto and Takuji Sasaki supervised, Shujunsha published, issued on July 1, 1997.

[0044]

Specifically, for example, the amino acid sequence of any one of SEQ ID NOs : 1 to 7 is created, and a nucleotide sequence of the polynucleotide used in the present invention is designed so that a codon that is frequently used in. a microorganism cell (for example, E. coli . ) which will be used to express the polynucleotide will be selected as a codon corresponding to each amino acid included in the amino acid sequence. The information on codon usage in E. coli and others is, for example, available from a DNA data base well-known to those skilled in the art (GenBank, EMBL, DDBJ and others) . Also when Bacillus subtilis is the microorganism cell and a signal sequence is added to the above amino acid sequence to transport it extracellularly, an amino acid sequence of the whole protein including the signal sequence is created. The signal sequence is preferably one derived from the microorganism cell, and examples thereof include a signal sequence of ά-amylase of Bacillus subtilis and others, which is an extracellular transfer signal.

[0045]

Hereinafter, specific experimental procedures are described.

First, the number of each amino acid included in the created amino acid sequence is calculated. To be the closest to an. average appearance frequency of the codon of a microorganism cell that will be used to express the polynucleotide, codons are allocated to amino acids of which the number is calculated above. The order of using each codon is applied so that the same codon will be not consecutive as much as possible. It is selected sequentially from amino acids on N-terminal side in the order of the codons decided on each amino acid, and then the codon of the each amino-acid residue is temporarily decided. The codons of all amino acids to the C-terminus are temporarily decided by repeating these procedures, and finally the termination codon is arranged. The artificial gene composed of the decided codons is , checked to ensure absence of the nucleotide sequence that inhibits the transcription of the gene in the microorganism cell and absence of the nucleotide sequence that the restriction enzyme used in the operation described below recognizes. When such a nucleotide sequence is present, the codon that is allocated in this part of the nucleotide sequence is exchanged for a codon used in another part. When the gene is designed, it is preferable to add nucleotide sequences which are recognized by restriction enzymes suitable for the operation described below to 5 ' -end and 3 '-end of the gene.

[0046]

Next, the gene having the nucleotide sequence designed above can be synthesized using long length chain DNA synthesis method that uses PCR (Shimamoto, et al . , "PCR experiment protocol of plant", refer to the above) (hereinafter, this method may be sometimes referred to as "Assembly PCR method") . In the method, DNA is synthesized using long synthetic oligonucleotide primers only. The pair of the primer is synthesized so that the complementary strand or the overlap of about 10 to 12 bp will be present at each 3 '-end, and primers each other are used as a template, then, DNA is synthesized. The total length of the primer may be, for example, about 60 to 100 mer. Preferably, it may be, for example, about 80 to 100 mer.

[0047] First, based on the designed nucleotide sequence, for example, DNA oligomers that made a primer every about 90 nucleotide bases are designed and synthesized. The synthesis of DNA oligomer can be carried out with DNA synthesizer by β-cyanoethylphosphoramidite method. For example, a first DNA oligomer is designed and synthesized using the designed nucleotide sequence from the vicinity of the center part to about 90 residues upstream on the 5'- side. Next, a complementary strand oligomer, that contains a nucleotide sequence of 12 residues on the 3 '-side of the first DNA oligomer and has a long of about 90 residues downstream on the 3 '-side from this part, are synthesized and is defined as the second DNA oligomer. Also, a complementary strand oligomer, that contains a nucleotide sequence of 12 residues on the 5 '-side of the first DNA oligomer and has a long of about 90 residues upstream on the 5 ' -side from this part, are synthesized and is defined as the third DNA oligomer. Further, a complementary strand oligomer, that contains a nucleotide sequence of 12 residues on the 5 '-side (the 3 '-site from the view of the gene site) of the second DNA oligomer and has a long of about 90 residues upstream on the 3 '-side from this part, are synthesized and is defined as the firth DNA oligomer. Subsequently, in the same way, an appropriate amount of DNA oligomers are synthesized. When desired polynucleotide has not been covered, the oligomers are further synthesized until it is covered.

[0048]

Next, these oligomers are sequentially bound by the PCR reaction. First, PCR reaction is carried out using the first DNA oligomer and the second DNA oligomer as primers. PCR reaction is carried out by making the obtained PCR products a template and using the third DNA oligomer and the fourth DNA oligomer as primers.

The PCR reaction is, for example, 5 cycles of one set of denaturation temperature 94 °C (for 1 minutes), anneal temperature 51°C (1 minutes), extension temperature 72°C (for 2 minutes) and thereafter, 20 cycles of one set of denaturation temperature 94°C (1 minutes), anneal temperature 60°C (1 minutes), extension temperature 72°C (2 minutes) . It is preferable that DNA polymerase used in the reaction uses an enzyme with low incorporating error rate of the nucleotide base. Subsequently, the nucleotide sequence is extended by repeating the above operation, to obtain a desired nucleotide sequence. The restriction enzyme site is installed at both ends of a desired nucleotide sequence as needed, and it introduces into a cloning vector according to a common procedure, then a subcloning is done. The nucleotide sequence of the obtained clone is confirmed with DNA sequencer, and thus it is confirmed to have obtained a polynucleotide having a desired nucleotide sequence.

[0049]

For allowing the polynucleotide used in the present invention to express in a microorganism cell, for example, a DNA in which a promoter functional in the microorganism cell is operably linked to the polynucleotide used in the present invention is introduced into the microorganism cell.

[0050]

Here, "operably linked" means that when a microorganism cell is transformed by introducing the above DNA into the microorganism cell, the polynucleotide used in the present invention is under condition of bonding to a promoter so as to be expressed under control of the promoter. Examples of the promoter includes a lac promoter of lactose operon of E. coli, a trp promoter of tryptophan operon of E. coli, or synthetic promoters that are uniquely-altered and designed to be functionable in E. coli such as tac promoter, trc promoter and others. Also PL promoter or PR promoter of Lambda Phage origin, gluconate synthase promoter of Bacillus subtilis origin (gnt), alkaline protease promoter (apr) , neutral protease promoter (npr) , and a-amylase promoter (amy) and others are included.

[0051]

In general, DNA operably linked to a promoter functional in a microorganism cell can be cloned to a vector according to a method described in "Molecular Cloning: A Laboratory Manual 2nd edition" (1989), Cold Spring Harbor Laboratory Press, "Current Protocols in Molecular Biology" (1987), John Wiley & Sons, Inc. ISBNO- 471-50338-X, to obtain a recombinant vector.

[0052]

The vector to be used should not be limited as long as it can maintain the polynucleotide used in the present invention and is replicable (for example, a vector containing DNA sequence, promoter, ribosome binding sequence, transcription terminator (transcription termination sequence) , selective marker gene, which is necessary for plasmid to grow in microbial cell), and the vector that is appropriate for each host can be used. For example, plasmid DNA and bacteriophage and others can be included.

Examples of plasmid DNA include plasmid of E. coli. origin (ColE plasmid such as pBR322, pUC18, pUC19, pUC118, pUC119 (TAKARA SHUZO CO., LTD.), pTV118N (TAKARA SHUZO CO., LTD.), pBluescriptll (TOYOBO) , pCR2.1-TOPO (Invitrogen) , pTrc99A (Pharmacia), pKK223-3 (Pharmacia) and others), plasmid of Actinomycetes origin (pIJ486 and others) , plasmid of Yeast origin (YEpl3, YEp 24, Ycp50 and others) . Examples of phage DNA include Apharge (Charon4A, Charon21A, EMBL3, EMBL4, XgtlO, Agtll and others), retrotransposon DNA, artificial chromosome and others.

Also as to a vector, when a vector containing a selective marker gene (antibiotic resistance-imparted gene such as, dehydrofolate reductase gene, kanamycin-resistant gene, ampicillin-resistant gene, neomycin-resistant gene, blasticidin-resistant gene and others) is used as the vector, a transformant containing the vector introduced can be selected utilizing the phenotype of the selective marker gene and the like as an index. Also, the SD sequence and the Kozak sequence are known as a ribosome binding sequence, and these sequences can be inserted into the upstream of the mutation gene. Utilizing the PCR method and others, the SD sequence may be added when a prokaryotic cell is used as a host and the the Kozak sequence may be added when eukaryote is used as a host. Examples of the SD sequence include a sequence of E. coli. origin, Rhodococcus bacteria origin, or Bacillus subtilis origin and others, but should not be limited as long as the nucleotide sequence is one that can function in the desired host cell. For example, consensus sequence in which a nucleotide sequence complementary to 3' terminal region of 16S ribosome RNA is consecutive more than four nucleotide bases is produced by the DNA synthesis method, then may be utilized. Though transcription termination sequence is not necessarily necessary, p factor independent one such as lipoprotein terminator and trp operon terminator and others may be utilized. ·

[0053]

An incorporation of the polynucleotide used in the present invention into such a vector can be carried out by cutting DNA containing the polynucleotide used in the present invention with an appropriate restriction enzyme and if necessary, adding an appropriate linker to the DNA and thereafter, by binding the DNA to the vector that is cut with an appropriate restriction enzyme. Also another method can be carried out by subjecting the DNA containing the polynucleotide used in the present invention to PCR amplification using a primer containing an appropriate restriction enzyme recognition site, then, processing the amplified product with the restriction enzyme and thereafter, by binding the DNA to the vector that is cut with an appropriate restriction enzyme.

[0054]

If the recombinant vector thus produced is introduced in the microorganism cell, the transformant that expresses the enzyme used in the present invention highly can be obtained. It is possible to express the enzyme used in the present invention by culturing the transformant.

[0055] The method of introducing the polynucleotide used in the present invention operably linked to a promoter functional in a microorganism cell or the recombinant vector retaining the polynucleotide, into a microorganism cell, may be a DNA introduction method conventionally used depending on the microorganism cell to be used, and examples thereof include a calcium chloride method described, in "Molecular Cloning: A Laboratory Manual 2nd edition" (1989), Cold Spring Harbor Laboratory Press, "Current Protocols in Molecular Biology" (1987), John Wiley & Sons, Inc. ISBNO-471-50338-X, and the like, or an electroporation method described in "Methods in Electroporation : Gene Pulser/E. coli Pulser System" Bio-Rad Laboratories (1993) and others.

[0056]

Examples of "microorganism cell" herein include microorganisms such as E. coli (specifically, for example, K12 strain, B strain, JM109 strain, XLl-Blue strain, C600 strain, w3110 strain), Bacillus subtilis, yeast, fungus, Rhodococcus genus. Preferably, microorganisms belonging to Escherichia genus, Bacillus genus, Corynebacterium genus, Staphylococcus genus, Streptomyces genus, Saccharomyces genus (specifically, for example, Saccharomyces cerevisiae) , Schizosaccharomyces genus (specifically, for example, Schizosaccharomyces pombe) , Pichia genus (specifically, for example, Pichia pastoris) , Kluyveromyces genus, Aspergillus genus and Rhodococcus genus (specifically, for example, Rhodococcus rhodochrousATCC 12674 strain, Rhodococcus rhodochrous J-l strain (FERM BP-1478)) and others are included.

[0057]

Next, culture of the transformant is reacted with the compound (1). Then a fact that the obtained DNA encodes an amino acid, sequence . of an enzyme which has the above- mentioned abilities can be checked by analyzing an amount of the compound (2) in a reaction product.

[0058]

The fact can be checked by sequencing a nucleotide sequence of DNA using a conventional method. For example, sequencing is carried out by Dideoxy Chain Termination Method (see, for example, F. Sanger, S. Nicklen, A. R. Coulso, Proceeding of Natural Academy of Science U.S.A. (1977) 74: pages 5463-5467) . To prepare the sample for a nucleotide sequence analysis, commercial reagents such as ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit ( Perkin-Elmer Corp.) may be used. Also, the nucleotide sequence can be analyzed utilizing an appropriate DNA sequencer.

[0059]

A method for introducing the above-described expression vector into a microorganism cell is not limited as long as the method is a method for introducing DNA. Examples of such method include a method using calcium ion and a method using electroporation.

. Examples of a method for introducing an expression plasmid into E.coli include a method using heat shock. For the method using heat shock, competent cells which are preliminarily prepared may be used. Examples of a method for introducing an expression plasmid into yeast include, but not limited to, a method using electroporation, a method using spheroplast and a method using lithium acetate.

[0060]

For selecting the transformant into which the polynucleotide operably linked to a promoter functional in a microorganism cell or the recombinant vector retaining the polynucleotide and others has been introduced, for example, it is recommendable to select the transformant utilizing the phenotype of a selective marker gene contained in a vector as described above as an indicator.

A fact that the transformant obtained retains the polynucleotide used in the present invention can be checked, for example, by performing confirmation of a restriction enzyme site, analysis , of a nucleotide sequence, Southern Hybridization, Western Hybridization and the like, according to usual methods described in "Molecular Cloning: A Laboratory Manual 2nd edition" (1989), Cold Spring Harbor

Laboratory Press, and others.

[0061]

If the recombinant vector thus produced is introduced in the microorganism cell, the transformant that expresses the enzyme used in the present invention highly can be obtained. It is possible to. express the enzyme used in the present invention by culturing the transformant .

[0062]

Hereinafter, a method for the preparation of the transformants used in the present invention is explained.

The transformants used in the present invention may be cultured in a culture medium for culturing various microorganisms which appropriately contain a carbon source, a nitrogen source, an organic salt, an inorganic salt, and so on.

[0063]

Examples of the carbon source include sugars such as glucose, .dextrin and sucrose; sugar alcohols such as glycerol; organic acids such as fumaric acid, citric acid and pyruvic acid; animal oils; vegetable oils; and molasses These carbon sources are added to the culture medium in an amount of usually about 0.1 % (w/v) to 30 % _.(w/v) of the culture .

[0064] Examples of the nitrogen source include natural organic nitrogen sources such as meat extract, peptone, yeast extract, malt extract, soy flour, Corn Steep Liquor, cottonseed flour, dried yeast and casamino acids; amino acids; sodium salts of inorganic acids such as sodium nitrate; ammonium salts of inorganic acids such as ammonium chloride, ammonium sulfate and ammonium phosphate; ammonium salts of organic acids such as ammonium fumarate and ammonium citrate; and urea. Among these nitrogen sources, ammonium salts of organic acids, natural organic nitrogen sources, and amino acids and others may also be used as carbon sources in many cases. The above nitrogen sources are added to the culture medium in an amount of usually about 0.1 % ( /v) to 30 % (w/v) of the culture.

[0065]

Examples of the organic salt and inorganic salt include chloride, sulfate, acetate, carbonate and phosphate of potassium, sodium, magnesium, iron, manganese, cobalt, zinc, and others. Specific examples thereof include sodium chloride, potassium chloride, magnesium sulfate, ferrous sulfate, manganese sulfate, cobalt chloride, zinc sulfate, copper sulfate, sodium acetate, calcium carbonate, potassium hydrogen phosphate and dipotassium hydrogen phosphate. These organic salts and/or inorganic salts are added to the culture medium in an amount of usually about 0.0001 % (w/v) to 5 % (w/v) of the culture.

[0066]

When a transformant prepared by introduction of DNA in which the polynucleotide used in the present invention is operably linked to an inducible promoter as a promoter is cultured, an inducer may be added into culture medium as needed. For example, in culturing a transformant prepared by introduction of DNA in which the polynucleotide used in the present invention is operably linked to an allolactose- inducible promoter such as tac promoter, trc promoter and lac promoter, an agent for inducing a production of the enzyme used in the present invention such as isopropyl thio- -D-galactoside (IPTG) can be added in a small amount into culture medium. Also, in culturing a transformant prepared by introduction of DNA in which the polynucleotide used in the present invention is operably linked to an indoleacetic acid ( IAA) -induced type promoter such as trp promoter, an agent for inducing a production of the enzyme used in the present invention such as IAA can be added in a small amount into culture medium.

[0067]

Examples of the culture method include solid culture and liquid culture (e.g. a test tube culture, a flask culture, or a jar fermenter culture).

Culture temperature and pH of the culture are not particularly limited as long as the present transformants are able to grow in the range thereof. For example, the culture temperature may be in a range of about 15°C to about 45°C and the pH of the culture may be in a range of about 4 to about 8. The culture time may be appropriately selected depending on the culture conditions, and is usually about 1 day to about 7 days.

[0068]

The culture of the transformants used in the present invention can be directly used as a catalyst for the process of the present invention. Examples of a method for using the cultured product of the transformant include the following (1) and (2) :

(1) a method for directly using a culture, and

(2) a method for using microbial cells collected by centrifuging a culture (wet microbial cells washed as needed with buffer or water) .

[0069]

The processed products of the culture of the transformants used in the present invention may also be used as a catalyst for the process of the present invention Examples of the processed products include microbial cells obtained by culturing followed by treating with an organic solvent (e.g. acetone and ethanol), lyophilizing, or treating with alkali; the physically or enzymatically disrupted microbial cells; and crude enzymes separated or extracted from the microbial cells. Furthermore, examples of the processed products include those immobilized by a known method after the above-mentioned treatments.

[0070]

A method generally used for microbial technology and protein technology may be applied to a method for purifying a cell wall disruption ^" product from a culture of the transformant used in the present invention, and for example, the following methods are included.

[0071]

First, microbial cells are collected from a culture of the transformant used in the present invention by centrifugation etc . , and thereafter, these are disrupted by physical crushing methods such as ultrasonic treatment, dynomill treatment, French press treatment and the like or chemical crushing methods using a surfactant or a bacteriolysis enzyme such as lysozyme and the like. Impurities are removed from the resulting disrupted liquid by centrifugation, membrane filter filtration and the like to prepare a cell wall disruption product.

[0072]

Specific embodiments include a culture of the transformants used in the present invention and a processed products thereof. Examples of the processed products of the culture include lyophilized microorganisms, organic solvent-treated microorganisms, dried microorganisms, disrupted microorganisms, autolysates of microorganisms, sonicated microorganisms, extracts of microorganisms, and alkali-treated microorganisms .

[0073]

In the event that the transformants used in the present invention are used in the industrial production process, the products of killed microorganisms might be preferred to unprocessed microorganisms from the point of view of limitation of manufacturing equipments or other factors. Examples of a method for killing the microorganisms include physical sterilization (e.g. heating, drying, freezing, irradiation, sonication, filtration, and electric sterilization) and sterilization with chemical agents (e.g. alkalis, acids, halogens, oxidizing agents, sulfur, boron, arsenic, metals, alcohols, phenols, amines, sulfides, ethers, aldehydes, ketones, cyan, and antibiotics). Among these killing methods, generally, it is preferable to select a method which can lower the amount of residues or contaminants in the reaction system and can minimize inactivation of the above-described ability of the enzyme used in the present invention to convert Compound (1) to Compound (2).

[0074] Hereinafter, the present invention is explained more specifically.

1. A processed product of a culture (first embodiment)

The centrifugation method or the film filtration method can be used to collect the microbial cell from the culture of the transformant used in the present invention. While the condition of the centrifugation should not be limited, the method can be carried out, for example, under the condition of 3, 000 to 4,500*g at 4°C for 5 to 20 minutes. The collected transformant can be, as needed, washed with monosodium phosphate buffer, phosphate buffer and others, then suspended. The suspension of the microbial cell is thus obtained.

As a method of disrupting microbial cell (cell wall of microorganisms) , ultrasonic treatment, high-pressure treatment with French press treatment or homogenizer, grinding treatment with glass beads, enzymatic treatment with lysozyme, cellulase and pectinase, freeze-thaw treatment, treatment with hypotonic fluid, lytic induction treatment with phage and others can be utilized. The disruption treatment is carried out under ice-cooling as needed. For example, the suspension of the microbial cell may be disrupted under ice-cooling for 1 to 5 minutes, preferably for 3 minutes with ultrasonic vibrator VP-15S (Taitec, Japan) in the setting condition of Output control 4, DUTY CYCLE 40%, PULS , TIMER=B mode 10s. Also, for example, the suspension of the microbial cell may be disrupted under 100 MPa pressurized condition with a homogenizer PANDA2K type manufactured by Niro Soavi.

After disrupting, the disrupted residue of the microbial cell can be removed from the disrupted products of the transformant used in the present invention as needed. Examples of the method of removing the residue include centrifugation method and filtration and others. As needed, residue removal efficiency can be raised using an aggregating agent or filter aid and others. Though the condition of the centrifugation should not be limited, the method can be carried out, for example, under the condition of 4, 000 to 25, 000xg at 4°C for 3 to 45 minutes. The residue may be thus removed from the disrupted products.

[0075]

2. A processed product of a culture (second embodiment)

A lot of proteins other than the enzyme used in the present invention can be denatured by heating-treatment of the above-mentioned disrupted products of the transformant or cell-free extracts. Thus, the solution of the enzyme used in the present invention can be obtained as a soluble fraction by heating-treatment of the disrupted products of the transformant or cell-free extracts.

''Heating-treatment'¹ herein referred to as a thermal deactivation procedure to denature proteins other than the enzyme used in the present invention derived from the transformant used in the present invention and a temperature of heating-treatment is preferably between 50°C or more and 75°C or less, more preferably between 55°C or more and 60°C or less. Though the period of heating- treatment should not be limited, it is preferable to be 10 minutes or more after the disrupted products of the transformant used in the present invention or the cell-free extracts reaches at a preset temperature. More preferred period is between 30 minutes or more and 5 hours or less.

For example, the heating-treatment can be achieved by placing the disrupted products of the transformant and others in a test tube, and then incubating the test tube in water bath that set to keep a given temperature for a given period. Also, the heating-treatment can be achieved by placing the disrupted products of the transformant and others in three-neck flask with a thermometer, and then heating the flask until the given temperature for a given period.

After heating-treatment of the disrupted products of the transformant (i.e. preheating-treatment ) , the residue is removed and thereafter, reheating-treatment may be carried out. In the case of the reheating, zinc salt may_. be existed. Examples of the method of removing the insoluble material formed by heat-treating include centrifugation method and filtration and others. As needed, residue removal efficiency _. can be raised using an aggregating agent or filter aid and others. If necessary, it may be further purified using various chromatographies (gel filtration, ion-exchange chromatography, affinity chromatography and others) .

[0076] .

The process of the present invention is usually carried out in the presence of water. The water used in this case may be in the form of a buffer. Examples of buffering agents used in the buffer include alkali metal salts of phosphoric acid such as sodium phosphate and potassium phosphate, alkali metal salts of acetic acid such as sodium acetate and potassium acetate, and alkaline buffers such as Tris-HCl buffer, Tris-citrate buffer and Tris-glycine buffer.

The process of the present invention may also be carried out by additionally using a hydrophobic organic solvent, i.e. in the presence of water and the hydrophobic organic solvent. Examples of the hydrophobic organic solvent used in this case include esters such as ethyl formate, ethyl acetate, propyl acetate, butyl acetate, ethyl propionate and butyl propionate, alcohols such as n- butyl alcohol, n-amyl alcohol and n-octyl alcohol, aromatic hydrocarbons such as benzene, toluene and xylene, ethers such as diethylether , diisopropylether and methyl-t- butylether, halogenated hydrocarbons such as chloroform and 1 , 2-dichloroethane , and mixtures thereof.

The process of the present invention may also be carried out by additionally using a hydrophilic organic solvent, i.e. in the presence of water and an aqueous medium. Examples of the hydrophilic organic solvent used in this case include alcohols such as methanol and ethanol, ketones such as acetone, ethers such as dimethoxyethane, tetrahydrofuran and dioxane, dimethylsulfoxide , and mixtures thereof.

[0077]

Since ammonia is used as an amino group donor in the process of the present invention, chloride of ammonia is usually added into the reaction system. Examples of the chloride of ammonia added into the reaction system include ammonium sulfate, ammonium chloride, ammonium formate, ammonium nitrate, ammonium phosphate, ammonium hydroxide, ammonium tartrate and ammonium acetate. An amount of the ammonia added into the reaction system is usually equal to or more than the mole of a vinyl glyoxylic acid represented by the above-described formula (1) or a salt thereof (i.e. Compound (1)) which is the starting compound, and the ammonia is preferably added at the start of the reaction. [0078]

Since a cofactor is used as a coupling factor in the process of the present invention, a cofactor is usually added into the reaction system. Examples of the cofactor added into the reaction system include reduced nicotinamide adenine dinucleotide (i.e. NADH) and reduced nicotinamide adenine dinucleotide phosphate (i.e. NADPH) . An amount of the cofactor added into the reaction system is usually equal to or more than the mole of a vinyl glyoxylic acid represented by the above-described formula (1) or a salt thereof (i.e. Compound (1)) which is the starting compound, and the cofactor is preferably added at the start of the reaction.

[0079]

While the process of the present invention is usually carried out in a range of pH of aqueous layer of 3 to 11, the pH may be appropriately changed in such a range that the reaction proceeds. It is preferable that the process of the present invention is carried out in the alkaline range, and it is more preferable that the process is carried out in a range of pH of aqueous layer of 7 to 10.

[0080]

While the process of the present invention is usually carried out in a range of about 0 °C to about 60 °C, preferably about 10 °C to about 50 °C, the temperature may be appropriately changed in such a range that the reaction proceeds .

[0081]

The process of the present invention is usually carried out in a range of for about 0.5 hours to about 10 days. After the completion of adding the vinylglyoxylic acid represented by the formula (1) or a salt thereof [i.e. Compound (1)], which is the starting compound, the endpoint of the reaction can be checked, for example, by measuring the amount of the vinylglycine derivative of the formula (2) or a salt thereof [i.e. Compound (2)] or the vinylglyoxylic acid of the formula (1) or a salt thereof [i.e. Compound (1)] in the reaction solution by liquid chromatography or gas chromatography and the others .

By use of the above-described coupling factor, the reaction progress can be monitored without performing direct quantitative analysis by liquid chromatography or gas chromatography as described above. For example, the reaction progress can be monitored by measuring change of absorbance at a wavelength specific for the cofactor such as NADH and NADPH (e.g. 340nm) .

[0082]

The concentration of vinylglyoxylic acid of the formula (1) or a salt thereof [i.e. Compound (1)], which is the starting compound used in the process of the present invention, is usually 50 % (w/v) or less and the vinylglyoxylic acid of the formula (1) or a salt thereof [i.e. Compound (1)] may be continuously or successively added to a reaction system in order to maintain the concentration of the vinylglyoxylic acid of the formula (1) or a salt thereof [i.e. Compound (1)] in the reaction system nearly constant.

[0083]

During the process of the present invention, for example, a sugar such as glucose, sucrose or fructose, or a surfactant such as Triton X-100 (registered trade mark) or Tween 60 (registered trade mark) may be added to the reaction system if necessary.

[0084]

The recover of the vinylglycine derivative of the formula (2) or a salt thereof [i.e. Compound (2)] from the reaction solution may be performed by any methods known in the art.

Examples of the method of recovering the vinylglycine derivative of the formula (2) or a salt thereof include purification by performing post-treatment of the reaction solution such as organic solvent extraction and concentration, if necessary in combination with column chromatography, and distillation and others.

Preferable example of the recovering method is as follows. A mineral acid such as hydrochloric acid is added to the reaction solution and the mixture is heated to reflux with being stirred for one hour. After the solution is cooled by being left standing, the reaction mixture is washed with chloroform. The aqueous phase is concentrated to . be dried up followed by addition of acetone to the resulting residue, and the mixture is heated to reflux with being stirred and washed for 10 . minutes. After the solution is cooled by being left standing, the crystal is recovered by filtration and washed with acetone and chloroform to purify the crystalline mineral acid salt of vinylglycine derivative represented by the formula (2).

EXAMPLES

[0085]

Hereinafter, the present invention is explained in more detail with some examples.

[0086]

Example 1

Production of a vinylglycine derivative or a salt thereof from a vinylglyoxylic acid or a salt thereof according to the process of the present invention

In line with a method described in JP-A-2008-526720 , was synthesized 2-keto-3-butenoic acid, which is a starting material used in the Examples. A standard preparation of a reaction product, vinylglycine hydrochloride, was synthesized in line with a method described in Journal of Organic Chemistry, 45, 4817 (1980). Ammonium chloride, used as an amino group donor, on the market had been purchased from NACALAI TESQUE, INC. and was used.

[0087]

To amplify a DNA encoding leucine dehydrogenase, PCR was performed under the condition described below using chromosomal DNA prepared from Bacillus shpaericus IF03525 by means of QIAamp DNA Mini Kit (manufactured by Qiagen) as a template; Expand High Fidelity PLUS PCR system (manufactured by Roche) ; and an oligonucleotide having the nucleotide sequence represented by SEQ ID NO: 17 (25 mer: 5'- GCCATGGAAATCTTCAAGTATATGG -3') and an oligonucleotide having the nucleotide sequence represented by SEQ ID NO: 18 (30 mer: 5'- GGGCCCGGGTTAACGGCCGTTCAAAATATT -3')·

Said PCR was run for 25 cycles using GeneAmp^® PCR System 9700 (manufactured by Applied Biosystems), each cycle consisting of denaturation time of 10 sec at 94°C; annealing time of 30 sec at 60°C; and extension time of 90 sec at 72 °C . The reaction mixture of the PCR was described below:

5xReaction Buffer with MgCl₂ 10 μ 1

dNTP (lOmM) 1 μΐ each of primers (5μΜ) 4 μΐ

chromosomal DNA (50ης/μΐ) 1 μΐ

Expand High Fidelity PLUS DNA polymerase 0.5 μ 1

distilled water 29.5 μ 1

The nucleotide sequence of the amplified DNA was analyzed. The amplified DNA comprised the nucleotide sequence of SEQ ID NO: 10, which encodes . the amino acid sequence of SEQ ID NO: 3.

[0088]

10 μΐ of a solution of the resulting amplified DNA encoding leucine dehydrogenase was mixed with 2 μΐ of a restriction enzyme: Ncol; 2 μΐ of Smal; 4 μΐ of BSA; 4 μΐ of 10XT Buffer (these four materials were manufactured by TAKARA BIO INC.); and 18 μΐ of distilled water followed by digestion for 30 min at 37 °C.

6 μΐ of pTrc99A (manufactured by Amersham Bioscience) was mixed with 1 μΐ of a restriction enzyme: Ncol; 1 μΐ of Smal; 1 μΐ of BSA; 1 μΐ of 10XT Buffer (these four materials were manufactured by TAKARA BIO INC.) followed by digestion for 30 min at 37 °C.

Each of the digested DNA fragment was electrophoresed through agarose gels and purified by Min Elute Gel Extraction Kit (manufactured by Qiagen) . Both of the resulting DNA fragments were ligated using DNA Ligation Kit ver. 2.1 (manufactured by TAKARA BIO INC.). E. coli J 109 (manufactured by TOYOBO CO., LTD) was transformed with the ligated DNA fragment by means of heat shock method. The resulting transformants were cultured on LB agar plate (containing 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, 15 g of agar in 1 L of the medium) containing 50 μς/πιΐ ampicillin at 37 °C overnight. Thereafter, some colonies were picked up among colonies grown on the agar plate and the picked up colonies were inoculated to LB medium containing 50 μg/ml ampicillin and cultured at 37 °C overnight. The resulting culture was centrifuged to prepare bacteria cell pellet, and a plasmid was extracted from the bacteria cell pellet using QIAprep Spin Miniprep Kit (manufactured by Qiagen) .

7 μΐ of the extracted plasmid was mixed with 0.5 μΐ of a restriction enzyme: Ncol; 0.5 μΐ of Smal; 1 μΐ of BSA; 1 μΐ of 10XT Buffer (these four materials were manufactured by TAKARA BIO INC.) followed by digestion for 30 min at 37

°C . Thereafter, the digestion product was electrophoresed through 1 % agarose gels and to confirm amplification of the desired DNA fragment, and the positive colonies were selected. Thus, the desired transformants were obtained. The obtained recombinant plasmid was named as pTrcLD, and E.coli transformed with the plasmid pTrcLD was named as E.coli pTrcLD.

[0089] The obtained trans formants (i.e. E.coli pTrcLD: E. coli JM 109 possessing the plasmid pTrcLD) was inoculated to 100 ml of sterilized LB medium (containing 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl in 1 L of the medium) containing 50 μg/ml ampicillin and 0.1 mM IPTG, and cultured while shaking at 37°C for 24 hours. Also, as a control, E. coli JM109 possessing a plasmid vector pTrc99A (pTrc99A is manufactured by Amersham Bioscience, and E. coli JM109 possessing a plasmid vector pTrc99A is sometimes referred to as E.coli pTrc99A) was inoculated to 100 ml of sterilized LB medium containing 50 μg/ml ampicillin and 0.1 mM IPTG, and cultured while shaking at 37°C for 24 hours. Each of the resulting culture liquid was centrifuged to give approximately 0.6g of wet microbial cells, respectively. Each of the resulting wet microbial cells was suspended in 10 ml of 0.1 M Tris-HCl buffer (pH 9.0), and each of the cell bodies in the suspension was crashed using glass beads to give approximately 6 ml of cell wall disruption, respectively.

[0090]

In a well of Multi Well Plate for Cell Culture 96F (SUMITOMO BAKELITE CO., LTD.), 0.161 ml of 1 mM potassium phosphate buffer (pH 7.0) was mixed with 0.005 ml of cell wall disruption product of E. coli pTrcLD as prepared above, 0.014 ml of 3.3 M aqueous ammonium chloride solution and 0.013 ml of 7.5 mM cofactor solution (i.e. either 7.5 M NADH aqueous solution or 7.5 M NADPH aqueous solution) . The resulting mixture was kept at 30 °C; and 0.007 ml of 2% (w/v) 2-keto-3-butenoic acid aqueous solution was added to the mixture; and the temperature of the resulting mixture was kept at 30 °C to perform the reaction for about 10 minutes. As a control, instead of 0.005 ml of the cell wall disruption product of E. coli pTrcLD, 0.005 ml of the cell wall disruption product of E.coli pTrc99A was used to perform the reaction in the same way. A change in absorbance of NADH at 340 nm (A340) was monitored using multiplatereader (SPECTRA max 340PC manufactured by Nihon Molecular Devices) for 10 minutes after the start of the reaction. The results are shown in Figure 1.

From the difference in amount of absorbance reduction which was obtained from the above 10-minutes reaction by subtracting "amount of absorbance reduction (Δ A340) measured in the amination reaction of 2-keto-3-butenoic acid using the cell wall disruption product of E.coli pTrc99A" from . "amount of absorbance reduction (Δ A₃₄₀) measured using the cell wall disruption product of E.coli pTrcLD", the amount of vinylglycine production was calculated using an equation that had been obtained by pre- measurement to show "a correlation between amount of reduction in absorbance of NADH or NADPH at 340 nm and amount of vinylglycine production determined by quantitative analysis using liquid chromatography". The result of the calculation showed that 0.027 mM vinylglycine was produced.

[0091]

Reference Example 1

Screening microorganisms capable of producing an enzyme that has an ability to convert a vinylglyoxylic acid or a salt thereof into a corresponding vinylglycine derivative or a salt thereof.

In a test tube is placed 5 ml of sterilized culture medium, which is prepared by adding glucose (20 g) , polypeptone (5. g) , yeast extract (3 g) , meat extract (3 g) , ammonium sulfate (2 g) , potassium dihydrogen phosphate (1 g) and magnesium sulfate heptahydrate (0.5 g) to 1 L of water and then adjusting the pH to 7.0, and thereto is inoculated with a microorganism obtained by purchasing from a culture collection or a microorganism isolated from soils The resultant is incubated with shaking at 30 °C under an aerobic condition. After the completion of the incubation, microbial cells are collected by centrifugation to obtain viable cells. In a screw-top test tube is placed 1.5 ml of 0.1 M potassium phosphate buffer (pH 7.0), and thereto is added the above-prepared viable cells, and the mixture is suspended. To the suspension obtained is added 0.065 ml of aqueous solution of 2% (w/v) 2-keto-3-butenoic . acid, and the resultant mixture is shaken at 30 °C for 2 to 3 days.

After the completion of the reaction, 0.6 ml of the reaction solution is sampled. The cells are removed from the sampling solution, and the amount of the vinylglycine produced in the reaction solution is analyzed by liquid chromatography .

Thus, microorganisms capable of producing an enzyme that has an ability to convert a vinylglyoxylic acid or a salt thereof into a corresponding vinylglycine derivative or a salt thereof are screened.

[0092]

Conditions for content analysis

Column: Unison UK-C18 (4.6 mmcp ^χ 250 mm, 3 μπι) (manufactured by Imtakt Corp.)

Mobile phase: Solution A (50 mM phosphoric acid + 10 mM sodium heptanesulfonate aqueous solution) : Solution B (methanol) =90 (%): 10 (%) (constant)

Analysis time: 60 min

Flow rate: 0.8 ml/min

Column temperature: 37 °C

Detection: 210 nm

[0093]

INDUSTRIAL APPLICABILITY The present invention can provide a novel process for producing a vinylglycine derivative, for exapmple.

Claims

A process for producing a vinylglycine derivative presented by the formula (2) :

or a salt thereof

comprising a step of reacting in the presence of an ammonium salt compound and a cofactor a vinyl glyoxylic acid represented by the formula (1):

wherein R¹ is the same as defined above;

or a salt thereof

with a culture of a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell, or a processed product of the culture.

2 . The process according claim 1 wherein the amino acid dehydrogenase is one or more enzymes selected from the group consisting of:

(1) leucine dehydrogenase;

(2) glutamic acid dehydrogenase;

(3) alanine dehydrogenase; and

(4) phenylalanine dehydrogenase.

3. The process according to claim 1 wherein the amino acid dehydrogenase is an enzyme comprising any one of the following amino acid sequences:

a) the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7;

c) an amino acid sequence in which one or a plurality of amino acids have been deleted, substituted or added in the amino acid sequence represented by any one of SEQ ID NOs: 1 to 7 and which is an amino acid sequence of an enzyme capable of converting the vinyl glyoxylic acid or a salt thereof to the vinylglycine derivative or a salt thereof.

4. The process according to claim 1 wherein the amino acid dehydrogenase is an enzyme comprising the amino acid sequence represented by any one of SEQ ID NOs : 1 to 7.

5. The process according to any one of claims 1 to 4 wherein the cofactor is NADH or NADPH.

6. The process according to any one of the claims 1 to 5 wherein R¹ of the vinyl glyoxylic acid or a salt thereof is hydrogen or an alkyl group having 1 to 5 carbon atoms.

7. The process according to any one of the claims 1 to 6 wherein R¹ of the vinyl glyoxylic acid or a salt thereof is hydrogen.

8. Use of a culture of a transformant in which a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of an amino acid dehydrogenase has been introduced into a microorganism cell, or a processed product of the culture as a catalyst for converting in the presence of an ammonium salt compound and a cofactor a vinyl glyoxylic acid represented by the formula (1) :

or a salt thereof

to a vinylglycine derivative represented by the formula 2) :

or a salt thereof.