WO2012022243A1

WO2012022243A1 - Kit for quantitatively detecting her2 amplification

Info

Publication number: WO2012022243A1
Application number: PCT/CN2011/078395
Authority: WO
Inventors: 许军普; 陈钊; 莫敏俐; 李隽�
Original assignee: 北京雅康博生物科技有限公司
Priority date: 2010-08-18
Filing date: 2011-08-15
Publication date: 2012-02-23
Also published as: CN102373197A

Abstract

The present invention provides primers, probes and a kit for detecting HER2 gene amplification by using fluorescent quantitation PCR, which is useful in predicting the efficacy of a molecularly targeted antineoplastic drug.

Description

Kit for quantitative detection of HER2 amplification

The present invention relates to a kit for diagnosing cancer. In particular, the invention relates to a kit for diagnosing cancer by quantitative detection of HER2 amplification. Background of the invention

There are about 180,000 new breast cancers in China every year. In nearly 30% of breast cancer patients, the amount of HER2 protein on the surface of tumor cells increases, which is called "HER2 positive". HER2, also known as human epidermal growth factor receptor 2, plays an important role in regulating cell growth, development and differentiation. Once overexpressed (ie HER2 positive), HER2 stimulates the cancer cells to grow wildly and increase their invasiveness. Therefore, HER2-positive breast cancer progresses faster than other types of breast cancer, with a higher degree of malignancy and faster recurrence and metastasis [Burstein HJ, N Engl J Med, 2005, 353(16): 1652-1654]. The results of the study showed that patients with HER2-positive breast cancer survived only half of the HER2-negative patients if they received only conventional combination therapy.

Patients with HER2-positive breast cancer benefit from a single-drug regimen of trastuzumab (Herceptin) or a combination of partial chemotherapy drugs [ Piccart- GebHERt MJ, Procter M, et al. N Engl J Med, 2005, 353 (16 ): 1659-1672; Romond EH, Perez EA, et al. N Engl J Med, 2005, 353(16): 1673-1684]. The monoclonal antibody Herceptin binds to the extracellular domain of the HER2 receptor and has high affinity and specificity. It can block the HER2 receptor and produce anti-tumor effects, and can also interact with human immune cells to produce antibody-dependent cellular cytotoxicity (ADCC). Effects and complement-mediated cytotoxicity (CDC) effects. The total effective rate of Herceptin monotherapy for HER2-positive metastatic breast cancer was 23%, and the effective rate of HER2(+ + +) patients was 31%. Currently, Herceptin is mainly used to treat patients with breast cancer who have HER2 gene amplification or overexpression and axillary lymph node metastasis [Pegram MD, Konecny GE, et al. J Natl Cancer Inst, 2004, 96(10): 739- 749]. This shows that if you can determine HER2 early Amplification or expression status allows patients to receive better treatment options at an early stage, giving patients more chances to survive.

In the "China Anti-Cancer Association Breast Cancer Diagnosis and Treatment Guidelines and Regulations (2007 Edition)", "Breast Cancer HER2 Detection Guide" (2009 Edition), "Breast Cancer Clinical Practice Guide (China Edition)" (first edition 2009) Note: For patients with unclear results for HER2 immunohistochemistry, FISH testing is required to determine. However, FISH testing is more expensive, causing many breast cancer patients to lose their testing opportunities. Studies have shown that real-time fluorescent PCR and FISH methods for detecting breast cancer tissue samples are highly consistent and may have higher sensitivity [Gjerdrum LM, Sorensen BS, et al. J Mol Diagn, 2004, 6(1): 42 -51].

The human HER2 gene amplification quantitative detection kit (real-time fluorescent PCR method) used in this test has the following advantages over FISH detection:

1. The sample processing process is simple, the experiment cycle is short, and the experimental operation is easy to standardize.

2. The price is moderate and easy to promote.

3. Quantitative accuracy, this is the most unique advantage of this reagent method. The HER2 gene copy number in the sample was quantified by real-time fluorescent PCR amplification of the curve parameters.

4. Reduce human error in experimentation. FISH detection is subject to subjective factors leading to misjudgment, and is also limited by the tester's expertise and laboratory conditions, and the current FISH test reagents are expensive and difficult to promote on a large scale.

The human HER2 gene amplification quantitative detection kit (real-time fluorescent PCR) is the first product to achieve batch and standardization of HER2 gene amplification detection. Summary of the invention

The problem to be solved by the present invention is to provide a quantitative test kit for amplification of the HER2 gene.

In order to solve the above problems, the present invention provides a quantitative detection kit and a detection method comprising a Taq enzyme, a 10 Taq buffer solution, a MgCl ₂ , a dNTP mixture, and a PCR primer and a probe capable of specifically amplifying the HER2 gene:

(1) Designing upstream and downstream primers and specific probes for HER2 genomic DNA, which can specifically amplify a sequence of the HER2 genome, which can specifically bind to HER2. (2) In order to quantitatively detect the ratio of HER2 amplification, the present invention designs an internal reference to design an upstream and downstream primer and a specific probe for the internal reference gene ACTB genomic DNA, and the primer can specifically amplify a sequence of the ACTB genome. The needle can specifically bind to ACTB.

(3) In order to quantitatively detect the ratio of HER2 amplification, the present invention designed a standard product, and performs quantitative PCR detection of HER2 and internal reference genes on the sample to be tested and the standard.

(4) A standard curve for quantification is obtained from the standard test results, and the ratio of the HER2 gene to the ACTB gene of the sample nucleic acid to be tested is calculated from a standard curve.

Before the step (1), the method further comprises: extracting, purifying and concentration determining the nucleic acid in the sample to be tested.

For HER2 genomic DNA, the probe used for real-time PCR detection binds to the base of HER2 under appropriate PCR conditions. Preferably, the probe has a fluorescent luminescent group attached to the 5' end, and a fluorescent quenching group is attached to the 3' end. The fluorescent emitting group is selected from the group consisting of: FAM, TET, HEX, ROX; the fluorescent quenching group is selected from the group consisting of: BHQ, TAMARA. Preferably, the fluorescent emitting group is FAM, and the fluorescent quenching group is BHQ. The sequence of the probe is preferably SEQ ID NO: 11, SEQ ID NO: 12.

For the internal reference gene ACTB genomic DNA, the probe used for real-time PCR detection was specifically bound to the base of ACTB under appropriate PCR conditions. Preferably, the probe is attached to the fluorescent moiety at the 5' end and the fluorescent quencher is attached to the 3' end. The fluorescent emitting group is selected from the group consisting of: FAM, TET, HEX, ROX; and the fluorescent quenching group is selected from the group consisting of: BHQ, TAMARA. Preferably, the fluorescent emitting group is FAM, and the fluorescent quenching group is BHQ. The sequence of the probe is preferably SEQ ID NO: 13, SEQ ID NO: 14.

The standard comprises at least one of a plasmid, genomic DNA or a chemically synthesized sequence. Preferably, the standard is a plasmid, the sequence of the plasmid containing the partial HER2 gene sequence is SEQ ID NO: 15; and the sequence of the plasmid containing the partial ACTB gene sequence is SEQ ID NO: 16.

The sample to be tested includes fresh tissue, paraffin embedded tissue.

The primer consists of an upstream primer and a downstream primer. The HER2 primer is preferably SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6; The ACTB primer is preferably SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10.

The quantitative detection kit for amplification of the HER2 gene comprises an agent selected from the group consisting of primers, probes and controls as described above. The kit preferably further comprises a mixture of Taq enzyme, lO x Taq buffer, MgCl ₂ , dNTP. Preferably, the ratio of primer to probe is 2: 1-10:1, and the ratio between the preferred forward and reverse primers is 1:3-3:1. DRAWINGS

The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a view showing the construction method of a standard used in Example 2 of the present invention.

Fig. 2 is a plasmid map of Example 2 of the present invention, and the arrow indicates the position of the inserted PCR product sequence in the vector.

Figure 3 is a graph showing the results of sequencing of the HER2 plasmid standard of Example 2 of the present invention. Figure 4 is a graph showing the results of sequencing of the ACTB plasmid standard of Example 2 of the present invention. Figure 5 is a graph showing the amplification of a standard of Example 3 of the present invention, wherein Figure A is

The amplification curve of the HER2 plasmid standard, and Figure B is the amplification curve of the ACTB plasmid standard.

Figure 6 is a standard curve plotted according to Figure 5, wherein Figure A is the HER2 plasmid standard curve and Figure B is the ACTB plasmid standard curve.

Fig. 7 is a graph showing the amplification of the sample HER2 gene of Example 3 of the present invention, wherein Fig. A is a graph of a paraffin-embedded tissue amplification curve; and Figure B is a fresh tissue amplification curve.

Fig. 8 is a graph showing the amplification curve of the sample ACTB gene of Example 3 of the present invention, wherein Figure A is a graph showing the amplification curve of the paraffin-embedded tissue; and Figure B is a graph of the amplification curve of the fresh tissue.

Figure 9 is a schematic illustration of the quantitative method of the present invention. Example

The following examples are provided to provide a person skilled in the art with a complete disclosure and description of how to make and use the invention, and these examples are not intended to limit the scope of the invention as claimed by the inventor, nor Experiment is All experiments performed were also experiments that were only practicable. Experimental methods in which no specific conditions are indicated in the examples are generally carried out according to conventional conditions, such as the third edition of the Molecular Cloning Experiment Guide (Sambrook J.), or in accordance with the conditions recommended by the manufacturer.

Example 1 : Human fresh tumor tissue, paraffin-embedded tissue genomic DNA extraction

We tested human fresh breast cancer tissue and paraffin-embedded breast cancer tissue.

Specimen DNA extraction

The genomic DNA of the sample can be extracted using the DNA extraction kit of Qiagen, Promega, and Roche, and the concentration and purity of the DNA can be detected using Gene Nanodrop ND1000 nucleic acid oxime measuring instrument (OD260/OD280 is about 1.8, OD260/OD230 is greater than 2.0). The sample DNA extraction step is described below using Promega's DNA extraction kit as an example:

1. Fresh tissue DNA extraction

(1) Cut the tissue about the size of the soybeans with scissors, place them in a mortar, cut the tissue, and pour the liquid nitrogen into a powder.

(2) Add 600 μl of pre-cooled lysate to the mortar and blow 6 times with a large 1 ml head. Mix the tissue powder with the lysate as much as possible, transfer the mixture to a 1.5 ml EP tube, and invert the mixture 6 times. Water bath at 65 °C for 20 minutes.

(3) Add 3 μl of RNase, mix upside down 6 times, and bath at 37 °C for 20 minutes.

(4) Cool to room temperature, add 200 μl of protein precipitant, mix upside down 6 times, place on ice for 5 minutes, 13,000*g, and centrifuge at room temperature for 4 minutes.

(5) Transfer the supernatant to a new tube with 600 μl of isopropanol (room temperature) in advance, gently knead it 6 times, 13,000*g, and centrifuge at room temperature for 1 minute.

(6) Discard the supernatant, add 600μ1 70% ethanol (room temperature) to the pellet, and invert the mixture 11,000*g 6 times and then centrifuge at room temperature for 1 minute.

(7) Drain the ethanol and air dry for 15 minutes.

(8) The precipitate was added to a 40 μl hydrazine solution, and the mixture was allowed to stand at 65 ° C for 1 hour or 4 ° C overnight. 2. Paraffin-embedded tissue DNA extraction

(1) Place 1 mg or less of tissue in a 1.5 ml centrifuge tube. (2) A freshly prepared ΙΟΟμΙ incubation buffer/proteinase K solution was added. Incubate overnight at 56 ° C depending on the type of sample.

(3) Remove the incubated sample tube and add two volumes of lysis buffer.

(4) The resin was vortexed at a high speed for 10 seconds until the resin was completely suspended, and 7 μl of the completely suspended resin was added. The mixture was vortexed at high speed for 3 seconds and then incubated at room temperature for 5 minutes.

(5) High-speed vortexing for 2 seconds, place the tube on the MagneSpHER2e® magnetic separation rack. Magnetic separation proceeds immediately.

(6) Carefully remove all solutions and do not touch the resin on the tube wall.

(7) Add ΙΟΟμΙ lysis buffer, remove the tube from the magnetic separator, and vortex at high speed for 2 seconds.

(8) Return the tube to the magnetic separator and remove all lysate.

(9) Add the lx washing solution prepared by ΙΟΟμΙ, remove the tube from the magnetic separator, and vortex at high speed for 2 seconds.

(10) Return the tube to the magnetic separation rack and remove any washing liquid.

(11) Repeat steps 9 and 10 twice for a total of 3 washes and ensure that all liquid is removed after the last wash.

(12) Open the lid, place the tube on the magnetic separator, and dry it in the air for 5 minutes.

(13) Add 25 μl of eluate.

(W) Cover the tube and vortex at high speed for 2 seconds. Incubate at 65 °C for 5 minutes.

(15) Remove the incubated tube and vortex at high speed for 2 seconds. Immediately put on the magnetic separation rack.

(16) Carefully transfer the DNA solution to the selected container. Example 2: Preparation of positive standards

1 carrier preparation

TA cloning vector pMD18-T was purchased from TAKARA.

2 Insertion preparation

The insert was prepared by the PCR method, and the template of the PCR was the sample genomic DNA extracted in Example 1, and the reaction system and amplification conditions are as follows (Table 1, Table 2, Table 3):

Table 1: PCR reaction system (50μ1)

Reagent name dosage (μΐ/tube) double distilled water 29.75 10 x buffer (without Mg ²⁺ ) 5

MgCl ₂ ( 25mM ) 7.5

dNTP (10 mM) 1.25

Upstream primer (25μΜ) 1.25

Downstream primer (25μΜ) 1.25

Taq pickled 1

DNA template 3

Total volume 50 If a HER2 positive standard is prepared, HER2-F-1 is required in the amplification system.

(SEQ ID NO: 3) and HER2-R-1 (SEQ ID NO: 5) primer sequences; if an ACTB-positive standard is prepared, ACTB-Fl (SEQ ID NO: 7) and ACTB-R-1 need to be added to the amplification system. (SEQ ID NO: 9) Primer sequence.

Table 2: PCR primers

Name

HER2-F-1 GAAAGAGACGGAGCTGAGGAA (SEQ ID NO: 3)

HER2-R-1 GGCCCTGACCTTGTAGACTGT (SEQ ID NO: 5)

ACTB-F-1 CAGGATGCAGAAGGAGATCACT (SEQ ID NO: 7)

ACTB-R-1 CAGCTCAGGCAGGAAAGACA (SEQ ID NO: 9) Table 3: PCR amplification conditions

Step number of cycles

First step 1 95 °C, 1-5 minutes

The second step is 20-30 95. C, 10- 15 seconds; 55- 65. C, 30- 60 seconds

1.3 After recovering the target fragment using the QIAgen Gel Recovery Kit, it was ligated into the pMD18-T vector (purchased from TAKARA) by TA cloning.

1.4 The newly constructed plasmid was amplified in E. coli DH5a strain and purified by extraction (for details, see the Guide to Molecular Cloning, Third Edition, 96-99, 103).

1.5 It was double-digested and identified by BamHl and Hindlll. 1.6 The strains positive for the enzyme digestion result were sent to the sequencing, and the sequencing was performed correctly as a standard (Fig. 3, Fig. 4). Example 3: Human fresh tumor tissue, paraffin-embedded tissue genomic DNA HER2 gene amplification assay

1. Fluorescence Quantification The PCR reaction template was the genomic DNA of the breast cancer sample extracted in Example 1 and the standard prepared in Example 1, using double distilled water as a negative control.

2. Reaction system and reaction conditions (Table 4, Table 5, Table 6, Table 7), wherein the labeled probe fluorescent emitting group is selected from the group consisting of: FAM, TET, HEX, ROX; the fluorescence quenching group is selected from the group consisting of: BHQ, TAMARA. Table 4: Fluorescence quantitative PCR reaction system (20μ1/tube)

Reagent name Dosage (μΐ/tube) Double distilled water 9.9

10 X buffer (without Mg ²⁺ ) 2

MgCl ₂ ( 25mM ) 3

dNTP (10 mM) 0.5

Upstream primer (25μΜ) 0.5

Downstream primer (25μΜ) 0.5

Fluorescent probe (25μΜ) 0.2

Taq pickling 0.4

DNA template 3

Total volume 20

HER2-F-1 (SEQ ID NO: 3) or HER2-F-2 (SEQ ID NO: 4) and HER2-R-1 (SEQ ID NO: 5) or HER2-R- are required to be added to the HER2 amplification system. 2 (SEQIDNO: 6) primer sequence; ACTB-F-1 (SEQ ID NO: 7) or ACTB-F-2 (SEQ ID NO: 8) and ACTB-R-1 (SEQ ID) are required in the ACTB amplification system. NO: 9) or ACTB-R-2 (SEQ ID NO: 10) primer sequence (Table 5).

Table 5: Primers

Name sequence HER2-F-1 GAAAGAGACGGAGCTGAGGAA ( SEQ ID NO: 3 )

HER2-F-2 CAGACCATTTGGGTTCAAATCC ( SEQ ID NO: 4)

GGCCCTGACCTTGTAGACTGT ( SEQ ID NO: 5 )

HER2-R-2 GAGACCAAAGCAGAGAGTTCT ( SEQ ID NO: 6)

ACTB-F-1 CAGGATGCAGAAGGAGATCACT (SEQ ID NO: 7)

ACTB-F-2 CATCCTCACCCTGAAGTA ( SEQ ID NO: 8)

ACTB-R-1 CAGCTCAGGCAGGAAAGACA (SEQ ID NO: 9)

ACTB-R-2 ACACGCAGCTCATTGTAG (SEQ ID NO: 10) The HER2-P-1 (SEQ ID ΝΟ:11) or HER2-P-2 (SEQ ID NO: 12) probe sequence is required in the HER2 amplification system; ACTB The ACTB-P-1 (SEQ ID NO: 13) or ACTB-P-2 (SEQ ID NO: 14) probe sequences (Table 6) need to be added to the amplification system. Table 6: Probes

Name sequence

HER2-P-1 CTCCTCCACTCACTAGCACAATGAC (SEQ ID NO: ll) HER2-P-2 TCAAGGCTCAAGGTTCCTCTTCTGC (SEQ ID NO: 12) ACTB-P-1 TGGCACCCAGCACAATGAAGATCA (SEQ ID NO: 13) ACTB-P-2 CCCATCGAGCACGGCATCGT (SEQ ID NO: 14) pieces

1 95 °C, 1-5 minutes

30-45 95°C, 10- 15 seconds; 55- 65°C (fluorescence), 30-60 seconds

3. Draw a standard curve

A standard curve is drawn according to the CT value obtained from the standard in step 3. Figure 5 is a plasmid standard amplification curve. In the figure, the five rising curves are sequentially diluted from left to right to represent 10E-lng/μΐ 5E- 2ι3⁄4/μ1, 5Ε- 3ι3⁄4/μ1, 5E-4ng. Amplification curve of plasmid standard of /uK 5E- 5ι3⁄4/μ1. The horizontal axis refers to the number of cycles, The vertical axis refers to the fluorescence detection value. This allows you to further plot the standard curve for calculation (Figure

6). In Fig. 6, the horizontal axis represents the logarithm of the template copy number, and the vertical axis represents the CT value. The template copy number = mass / molecular weight X 6.02 10 ²³ , the plasmid in this experiment consists of the pMD18-T vector and the insert, because the length of the insert is basically the same, the largest gap is only twenty bases in length. Compared with the length of the 2,992 bp of the PMD18-T vector, the ratio of the ratio of the copy number of the HER2 to the ACTB plasmid standard is small.

4. Specimen HER2 gene amplification calculation

According to the standard curve, the copy number of the HER2 and ACTB genomic DNA of the reaction was determined from the CT value of the sample, and the ratio of HER2 DNA to ACTB DNA was the amount of HER2 gene amplification. The CT values of the paraffin-embedded tissue and the fresh tissue HER2 shown in Fig. 7 and Fig. 8 are 21.05 and 23.40, respectively, and the CT values of the internal reference gene ACTB are 25.88 and 24.95, respectively, which can be determined by the corresponding standard curve formula (Fig. 6). When the respective copy numbers were obtained, the amplified amount of the detected samples was 281% and 161%, respectively.

5. Test results

In this example, HER2 gene amplification was detected in 50 specimens of breast cancer. A total of 14 cases were detected to be amplified. The specific amplification is shown in Table 8.

HER2 amplification and number of amplifications

Amount of HER2 gene amplification (%) Number of amplification cases

100-149 3

150-189 5

190-299 4

≥300 2

Total 14

Claims

Claim

A polymerase chain reaction primer that reacts with the HER2 gene or the ACTB gene under suitable PCR conditions.

2. The primer according to claim 1, wherein the primer consists of an upstream primer and a downstream primer.

The primer according to claim 1 or 2, wherein the primer has the sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8. , SEQ ID NO: 9 or SEQ ID NO: 10.

4. A fluorescent quantitative PCR probe that specifically binds to a base sequence of a HER2 gene or an ACTB gene under suitable PCR conditions.

The probe according to claim 4, wherein the probe 5 is connected to a fluorescent luminescent group at its end, and the terminal 3 is connected to a fluorescence quenching group.

The probe according to claim 4 or 5, wherein the sequence of the probe is SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14.

7. A plasmid comprising the HER2 gene or ACTB gene sequence to be detected.

The plasmid according to claim 7, wherein the plasmid comprises the HER2 gene sequence of SEQ ID NO: 15, and the ACTB gene sequence of SEQ ID NO: 16.

A quantitative detection kit for amplification of a HER2 gene, characterized in that the kit comprises an agent selected from the group consisting of the primer according to any one of claims 1 to 3, or the method according to claim 4 or 5. The probe, and the plasmid of claim 7 or 8.

The kit according to claim 9, wherein the ratio of the primer to the probe is 2:1 to 10:1, and the ratio between the forward and reverse primers is 1:3 to 3:1.