WO2012003472A1 - Anticorps anti-notch1 - Google Patents

Anticorps anti-notch1 Download PDF

Info

Publication number
WO2012003472A1
WO2012003472A1 PCT/US2011/042843 US2011042843W WO2012003472A1 WO 2012003472 A1 WO2012003472 A1 WO 2012003472A1 US 2011042843 W US2011042843 W US 2011042843W WO 2012003472 A1 WO2012003472 A1 WO 2012003472A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
acid sequence
amino acid
variable region
chain variable
Prior art date
Application number
PCT/US2011/042843
Other languages
English (en)
Inventor
Ronan O'hagan
Alisa C. Bell
Lyne Breault
Joelle Brodeur
Adrian Cooper
Jinwei Jiang
David Keane
Jeanine Lorusso
H. Heidi Okamura
Samantha Perino
William Rideout
Solly Weiler
William M. Winston
Jin-Kyeung Woo
Jeno Gyuris
Original Assignee
Aveo Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aveo Pharmaceuticals, Inc. filed Critical Aveo Pharmaceuticals, Inc.
Publication of WO2012003472A1 publication Critical patent/WO2012003472A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the field of the invention is molecular biology, immunology and oncology. More particularly, the field is antibodies that bind human Notch 1.
  • Notch pathway signaling is involved in numerous cellular processes, including cell fate determination, differentiation, proliferation, apoptosis, migration and angiogenesis.
  • Notch receptors sometimes called "Notch receptors”
  • All four Notch proteins have a similar domain structure, which includes an extracellular domain, a negative regulatory (NRR) domain, a single-pass transmembrane domain, and an intracellular domain.
  • the extracellular domain contains a series of EGF-like repeats that are involved in ligand binding.
  • the Notch polypeptide is cleaved by a furin-like protease.
  • Notch intracellular domain a transcription factor called Notch intracellular domain (NICD), which is released upon proteolytic cleavage by gamma secretase, in response to binding of the Notch protein by a ligand.
  • Notch ligands are Delta-like and Jagged. When the NICD is released, it travels to the nucleus, where it activates transcription of the Notch-responsive genes, HES1, HES5, NRARP, Deltexl and c-MYC.
  • Notch proteins play crucial roles in normal development, dysregulation of the Notch proteins is associated with various types of cancer, including T-cell acute lymphatic leukemia/lymphoma (T-All), breast cancer, colon cancer, ovarian cancer and lung cancer. See, e.g., Miele et al, 2006, CURRENT CANCER DRUG TARGETS 6:313-323. Accordingly, one therapeutic approach for the treatment of cancer is inhibition of Notch pathway signaling. Inhibition of Notch pathway signaling has been achieved using monoclonal antibodies (Wu et al, 2010, NATURE 464: 1052-1057; Aste-Amezaga et al, 2010, PLOS ONE 5: 1-13 e9094).
  • Naturally-occurring antibodies are multimeric proteins that contain four polypeptide chains (FIG. 1). Two of the polypeptide chains are called immunoglobulin heavy chains (H chains), and two of the polypeptide chains are called immunoglobulin light chains (L chains). The immunoglobulin heavy and light chains are connected by an interchain disulfide bond. The immunoglobulin heavy chains are connected by interchain disulfide bonds.
  • a light chain consists of one variable region (V L in FIG. 1) and one constant region (C L in FIG. 1).
  • the heavy chain consists of one variable region (V H in FIG. 1) and at least three constant regions (CHi, CH 2 and CH 3 in FIG. 1). The variable regions determine the specificity of the antibody.
  • Each variable region contains three hypervariable regions known as
  • CDRs complementarity determining regions flanked by four relatively conserved regions known as framework regions (FRs).
  • FRs framework regions
  • Naturally occurring antibodies have been used as starting material for engineered antibodies, such as chimeric antibodies and humanized antibodies.
  • the invention is based on the discovery of a family of antibodies that specifically bind human Notch 1.
  • Antibodies disclosed herein contain Notch 1 binding sites based on the CDRs of the anti-Notch 1 antibodies described herein.
  • the disclosed antibodies prevent or inhibit activation of human Notch 1. They do so by inhibiting Notch 1 from binding to Notch ligands, i.e., Jagl, Jag2, DLLl, and DLL4.
  • the disclosed antibodies can be used to inhibit the proliferation of tumor cells in vitro and/or in vivo. When administered to a human cancer patient, the antibodies inhibit or reduce tumor growth in the human patient.
  • FIG. 1 (prior art) is a schematic representation of a typical naturally-occurring antibody.
  • FIG. 2 is a sequence alignment showing the amino acid sequence of the complete immunoglobulin heavy chain variable region of the antibodies designated 2G10, 2E6, 2A11 and 2D11.
  • the amino acid sequences for each antibody are aligned against one another, and Complementary Determining Sequences (CDR) (Kabat definition), CDR l5 CDR 2 , and CDR 3 are identified in boxes.
  • CDR Complementary Determining Sequences
  • the unboxed sequences represent framework (FR) sequences.
  • FIG. 3 is a sequence alignment showing the CDR l5 CDR 2 , and CDR 3 sequences (Kabat definition) for each of the variable region sequences shown in FIG. 2.
  • FIG. 4 is a sequence alignment showing the amino acid sequence of the complete immunoglobulin light chain variable region of antibodies 2G10, 2E6, 2A11 and 2D11.
  • the amino acid sequences for each antibody are aligned against one another, and CDR l5 CDR 2 , and CDR 3 sequences (Kabat definition) are identified in boxes.
  • the unboxed sequences represent framework (FR) sequences.
  • FIG. 5 is a sequence alignment showing the CDR l5 CDR 2 , and CDR 3 sequences (Kabat definition) for each of the variable region sequences shown in FIG. 4.
  • FIG. 6 is a histogram summarizing results of an experiment to determine specificity of antibody binding to human Notch 1 on the surface of CHO-Flpln-Notchl cells.
  • Antibodies 2G10, 2E6 also referred to herein as antibody 2E06
  • 2A11, and 2D11 are shown from left to right.
  • FIG. 7A is a histogram summarizing results from a Notch 1- specific reporter assay showing that antibody 2E6 (also referred to herein as antibody 2E06) inhibits Notch 1- dependent reporter gene expression in the presence of Jagl.
  • the Notch 1- specific (Nl-specific) control inhibitor is an anti-Notchl polyclonal antibody (AF1057, R&D Systems).
  • the Notch2- specific (N2-specific) control inhibitor is an anti-Notch2 polyclonal antibody (AF1190, R&D Systems).
  • the Notch3- specific (N3-specific) control inhibitor is an anti-Notch3 polyclonal antibody (AF1559, R&D Systems).
  • FIG. 7B is a histogram summarizing results from a No tch2- specific reporter assay showing that antibody 2E6 does not inhibit Notch2-dependent reporter gene expression in the presence of Jagl.
  • the Notch 1 -specific (Nl -specific) control inhibitor is an anti-Notch 1 polyclonal antibody (AF1057, R&D Systems).
  • the No tch2- specific (N2-specific) control inhibitor is an anti-Notch2 polyclonal antibody (AF1190, R&D Systems).
  • the Notch3- specific (N3-specific) control inhibitor is an anti-Notch3 polyclonal antibody (AF1559, R&D Systems).
  • FIG. 7C is a histogram summarizing results from a Notch3- specific reporter assay showing that antibody 2E6 does not inhibit No tch3 -dependent reporter gene expression in the presence of Jagl.
  • the Notch 1 -specific (Nl -specific) control inhibitor is an anti-Notch 1 polyclonal antibody (AF1057, R&D Systems).
  • the No tch2- specific (N2-specific) control inhibitor is an anti-Notch2 polyclonal antibody (AF1190, R&D Systems).
  • the Notch3- specific (N3-specific) control inhibitor is an anti-Notch3 polyclonal antibody (AF1559, R&D Systems).
  • FIG. 8A is a histogram summarizing results of Notch 1- specific reporter assays showing that antibody 2E6 inhibits Notch 1 -dependent reporter gene expression induced by the ligands Jagl, Jag2, DLL1 and DLL4. Reporter activity in the absence of any activating ligand (Fc + mlgG) was defined as 100% inhibition, and activity in the presence of ligand and treated with mouse IgG (Ligand alone + mlgG) was defined as 0% inhibition.
  • FIG. 8B is a histogram summarizing results of Notch 1 -specific reporter assays showing that antibody 2A11 inhibits Notch 1 -dependent reporter gene expression induced by the ligands Jagl, Jag2, DLL1 and DLL4. Reporter activity in the absence of any activating ligand (Fc + mlgG) was defined as 100% inhibition, and activity in the presence of ligand and treated with mouse IgG (Ligand alone + mlgG) was defined as 0% inhibition.
  • FIG. 8C is a histogram summarizing results of Notch 1- specific reporter assays showing that antibody 2D11 inhibits Notch 1 -dependent reporter gene expression induced by the ligands Jagl, Jag2, DLL1 and DLL4. Reporter activity in the absence of any activating ligand (Fc + mlgG) was defined as 100% inhibition, and activity in the presence of ligand and treated with mouse IgG (Ligand alone + mlgG) was defined as 0% inhibition. [0023] FIG.
  • 9A is a histogram showing the effect of DBZ (dibenzazipine; a gamma secretase inhibitor dosed at 10 ⁇ /kg once daily) and antibody 2E6 (dosed at 40, 100, or 150 mg/kg (abbreviated "mpk”) three times per week) on thymocyte population in mice.
  • DBZ dibenzazipine
  • mpk 150 mg/kg
  • FIG. 9B is a graph showing mouse body weight over time, for mice treated with DBZ or antibody 2E6.
  • DBZ at 30 ⁇ /kg (A ) or 10 ⁇ /kg ( ⁇ ) induces weight loss in mice in 4 days and 17 days, respectively.
  • 40 mg/kg abbreviated as mpk
  • 150 mg/kg (+) of antibody 2E6 does not induce weight loss in mice (vehicle, ( ⁇ ) and murine IgG (x)).
  • FIG. 10 is a histogram summarizing data from an experiment to assess the effects of antibody 2E6 on functional angiogenesis in vivo induced by bFGF, with hemoglobin content serving as a surrogate indicator of functional angiogenesis.
  • FIG. 11 is a histogram summarizing data from an experiment to assess the effects of antibody 2E6 on functional angiogenesis in vivo induced by human cancer cell lines (pancreatic cancer (SW1990) cells, breast cancer (MDA-MB-231 cells), and human lung cancer (Calu-6) cells), with hemoglobin content serving as a surrogate indicator of functional angiogenesis.
  • human cancer cell lines pancreatic cancer (SW1990) cells, breast cancer (MDA-MB-231 cells), and human lung cancer (Calu-6) cells
  • hemoglobin content serving as a surrogate indicator of functional angiogenesis.
  • FIG. 12 is a schematic diagram showing the amino acid sequences of the complete immunoglobulin heavy chain variable region of 2E6 (SEQ ID NO: 12) and the complete humanized heavy chain variable regions denoted as Hu2E6_Hvl (SEQ ID NO: 103),
  • Hu2E6_Hvl T57A (SEQ ID NO: 105), Hu2E6_Hv2 (SEQ ID NO: 107), and Hu2E6_Hv2 T57A (SEQ ID NO: 109).
  • the amino acid sequences for each heavy chain variable region are aligned against one another, and Complementary Determining Sequences (CDR) (Kabat definition), CDR l5 CDR 2 , and CDR 3> are identified in boxes.
  • the unboxed sequences represent framework (FR) sequences.
  • FIG. 13 is a schematic diagram showing the CDR l5 CDR 2 , and CDR 3 sequences (Kabat definition) for each of the variable region sequences shown in FIG. 12.
  • FIG. 14 is a schematic diagram showing the amino acid sequences of the complete light chain variable region of 2E6 (SEQ ID NO: 14) and the complete humanized light chain variable regions denoted as Hu2E6_Kvl (SEQ ID NO: 111) and Hu2E6_Kv2 (SEQ ID NO: 113).
  • the amino acid sequences for each light chain variable region are aligned against one another, and CDR l 5 CDR 2 , and CDR 3 sequences (Kabat definition) are identified in boxes.
  • the unboxed sequences represent framework (FR) sequences.
  • FIG. 15 is a sequence alignment showing the CDR l5 CDR 2 , and CDR 3 sequences (Kabat definition) for each of the variable region sequences shown in FIG. 14.
  • Fig. 16 is a graph summarizing results from a Notch- 1 specific reporter assay showing inhibition of DLL4-induced Notch- 1 dependent reporter gene expression by antibodies mu2E6 ( ⁇ ), Hu2E6-62 ( A ), A2-NRR1 ( T ), and a murine IgG control ( ⁇ ).
  • Reporter activity in the absence of any activating ligand was defined as 100% inhibition, and activity in the presence of ligand and treated with mouse IgG (Ligand alone + mlgG) was defined as 0% inhibition.
  • Fig. 17 A is a histogram summarizing results from a Notch- 1 specific reporter assay showing that antibody Hu2E6-62 inhibits Notch- 1 dependent reporter gene expression in the presence of DLL4.
  • Fig. 17B are histograms demonstrating inhibition of endogenous Notch 1- target genes by the Hu2E6-62 antibody.
  • Fig. 18 is a histogram showing the effect of the Hu2E6-62 antibody dosed at 20 mg/kg (abbreviated "mpk”) three times per week on thymocyte population in mice.
  • Fig. 19A is a graph showing mouse body weight over time, for mice treated with the antibodies Hu2E6-62 ( ⁇ ), A2-NRR1 ( A ) and a human IgG ( )control.
  • Fig. 19B are photographs showing alcian blue staining of small intestine sections after treatment with antibodies Hu2E6-62, A2-NRR1 and a human IgG control.
  • Fig. 20 is a histogram summarizing data from an experiment to assess the effects of antibody Hu2E6-62 on functional angiogenesis in vivo induced by bFGF, with hemoglobin content serving as a surrogate indicator for functional angiogenesis.
  • Fig. 21 is a histogram summarizing data from an experiment to assess the effects of antibody Hu2E6-62 on functional angiogenesis in vivo induced by the human lung cancer cell line Calu-6, with hemoglobin content serving as a surrogate indicator of functional
  • the antibodies of the invention are based on the antigen binding sites of certain monoclonal antibodies that have been selected on the basis of binding and neutralizing the activity of human Notch 1.
  • the antibodies contain immunoglobulin variable region CDR sequences that define a binding site for human Notch 1.
  • antibodies Because of the neutralizing activity of these antibodies, they are useful for inhibiting the growth and/or proliferation of certain cancer cells and tumors.
  • the antibodies can be engineered to minimize or eliminate an immune response when administered to a human patient. Various features and aspects of the invention are discussed in more detail below.
  • antibody means an intact antibody (e.g., an intact monoclonal antibody) or antigen-binding fragment of an antibody (e.g., an antigen-binding fragment of a monoclonal antibody), including an intact antibody or antigen-binding fragment that has been modified, engineered or chemically conjugated.
  • antibodies that have been modified or engineered are chimeric antibodies, humanized antibodies, and multispecific antibodies (e.g., bispecific antibodies).
  • antigen-binding fragments include Fab, Fab', F(ab') 2 , Fv, single chain antibodies (e.g., scFv), minibodies, and diabodies.
  • An antibody conjugated to a toxin moiety is an example of a chemically conjugated antibody.
  • the antibodies may comprise: (a) an immunoglobulin heavy chain variable region comprising the structure CDRHI-CDRH 2 -CDRH3 and (b) an
  • immunoglobulin light chain variable region comprising the structure CDR L1 -CDR L2 -CDR L3 , wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding human Notchl .
  • the antibody comprises: (a) an immunoglobulin heavy chain variable region comprising the structure CDR H i-CDR H2 -CDR H3 and (b) an immunoglobulin light chain variable region, wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding human Notchl .
  • a CDRHI comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 5 (2G10), SEQ ID NO: 38 (2G10), SEQ ID NO: 15 (2E6), SEQ ID NO: 40 (2E6), SEQ ID NO: 25 (2A11), SEQ ID NO: 42 (2A11), SEQ ID NO: 32 (2D11), and SEQ ID NO: 44 (2D11);
  • a CDR H2 comprises an amino acid sequence selected from the group consisting SEQ ID NO: 6 (2G10), SEQ ID NO: 16 (2E6), SEQ ID NO: 26 (2A11), SEQ ID NO: 33 (2D11), SEQ ID NO: 94
  • a CDRH 3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 7 (2G10), SEQ ID NO: 17 (2E6), SEQ ID NO: 27 (2A11), and SEQ ID NO: 34 (2D11).
  • SEQ ID NO: 7 2G10
  • SEQ ID NO: 17 2E6
  • SEQ ID NO: 27 2A11
  • SEQ ID NO: 34 2D11
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: 5 (2G10) or SEQ ID NO: 38 (2G10), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 6 (2G10), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 7 (2G10).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: 15 (2E6) or SEQ ID NO: 40 (2E6), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 16 (2E6), and a CDRH 3 comprising the amino acid sequence of SEQ ID NO: 17 (2E6).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: 25 (2A11) or SEQ ID NO: 42 (2A11), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 26 (2A11), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 27 (2A11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: 32 (2D11) or SEQ ID NO: 44 (2D11), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 33 (2D11), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 34 (2D11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: 15 (2E6), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 94 (Hu2E6_Hvl T57A), SEQ ID NO: 95 (Hu2E6_Hv2), or SEQ ID NO: 96 (Hu2E6_Hv2 T57A), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 17 (2E6).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: 15 (2E6), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 94 (Hu2E6_Hvl T57A), and a CDRH 3 comprising the amino acid sequence of SEQ ID NO: 17 (2E6).
  • the CDR H I, CDR H2 , and CDR H3 sequences are interposed between human or humanized immunoglobulin FRs.
  • the antibody can be an intact antibody or an antigen-binding antibody fragment.
  • the antibody comprises (a) an immunoglobulin light chain variable region comprising the structure CDR L I-CDR L2 -CDR L3 , and (b) an immunoglobulin heavy chain variable region, wherein the IgG light chain variable region and the IgG heavy chain variable region together define a single binding site for binding human Notch 1.
  • a CDR L1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (2G10), SEQ ID NO: 18 (2E6, 2A11), SEQ ID NO: 35 (2D11), and SEQ ID NO: 99
  • a CDR L2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9 (2G10), SEQ ID NO: 19 (2E6, 2A11), SEQ ID NO: 36 (2D11), SEQ ID NO: 100 (Hu2E6_Kvl), and SEQ ID NO: 101 (Hu2E6_Kv2); and a CDR L3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDR L1 comprising the amino acid sequence of SEQ ID NO: 8 (2G10); a CDR L2 comprising the amino acid sequence of SEQ ID NO: 9 (2G10); and a CDR L3 comprising the amino acid sequence of SEQ ID NO: 10 (2G10).
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDR L1 comprising the amino acid sequence of SEQ ID NO: 18 (2E6, 2A11); a CDR L2 comprising the amino acid sequence of SEQ ID NO: 19 (2E6, 2A11); and a CDR L3 comprising the amino acid sequence of SEQ ID NO: 20 (2E6, 2A11).
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDR L1 comprising the amino acid sequence of SEQ ID NO: 35 (2D11); a CDR L2 comprising the amino acid sequence of SEQ ID NO: 36 (2D11); and a CDR L3 comprising the amino acid sequence of SEQ ID NO: 37 (2D11).
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDR L1 comprising the amino acid sequence of SEQ ID NO: 99
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDR L1 comprising the amino acid sequence of SEQ ID NO: 99
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDR L1 comprising the amino acid sequence of SEQ ID NO: 99
  • the CDR L1 , CDR L2 , and CDR L3 sequences are interposed between human or humanized immunoglobulin FRs.
  • the antibody can be an intact antibody or an antigen-binding antibody fragment.
  • the antibody comprises: (a) an immunoglobulin heavy chain variable region comprising the structure CDR H i-CDR H2 -CDR H3 and (b) an immunoglobulin light chain variable region comprising the structure CDR L1 -CDR L2 -CDR L3 , wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding human Notch 1.
  • the CDR H I is an amino acid sequence selected from the group consisting of SEQ ID NO: 5 (2G10), SEQ ID NO: 38 (2G10), SEQ ID NO: 15 (2E6), SEQ ID NO: 40 (2E6), SEQ ID NO: 25 (2A11), SEQ ID NO: 42 (2A11), SEQ ID NO: 32 (2D11), and SEQ ID NO: 44 (2D11);
  • the CDR H2 is an amino acid sequence selected from the group consisting SEQ ID NO: 6 (2G10), SEQ ID NO: 16 (2E6), SEQ ID NO: 26 (2A11), SEQ ID NO: 33 (2D11), SEQ ID NO: 94 (Hu2E6_Hvl T57A), SEQ ID NO: 95 (Hu2E6_Hv2), and SEQ ID NO: 96 (Hu2E6_Hv2 T57A);
  • the CDR H3 is an amino acid sequence selected from the group consisting of SEQ ID NO: 7 (2G10), SEQ ID NO: 17 (2E6), SEQ
  • the CDR L I is an amino acid sequence selected from the group consisting of SEQ ID NO: 8 (2G10), SEQ ID NO: 18 (2E6, 2A11), SEQ ID NO: 35 (2D11), and SEQ ID NO: 99 (Hu2E6_Kvl, Hu2E6_Kv2);
  • the CDR L2 is an amino acid sequence selected from the group consisting of SEQ ID NO:9 (2G10), SEQ ID NO: 19 (2E6, 2A11), SEQ ID NO: 36 (2D11), SEQ ID NO: 100 (Hu2E6_Kvl), and SEQ ID NO: 101 (Hu2E6_Kv2);
  • the CDR L3 is an amino acid sequence selected from the group consisting of SEQ ID NO: 10 (2G10), SEQ ID NO: 20 (2E6, 2A11), and SEQ ID NO: 37 (2D11).
  • the antibody comprises an immunoglobulin heavy chain variable region selected from the group consisting of SEQ ID NO: 2 (2G10), SEQ ID NO: 12 (2E6), SEQ ID NO: 22 (2A11), SEQ ID NO: 29 (2D11), SEQ ID NO: 103 (Hu2E6_Hvl), SEQ ID NO: 105 (Hu2E6_Hvl T57A), SEQ ID NO: 107 (Hu2E6_Hv2), and SEQ ID NO: 109 (Hu2E6_Hv2 T57A), and an immunoglobulin light chain variable region selected from the group consisting of SEQ ID NO: 4 (2G10), SEQ ID NO: 14 (2E6), SEQ ID NO: 24 (2A11), SEQ ID NO: 31 (2D11), SEQ ID NO: 111 (Hu2E6_Kvl), and SEQ ID NO: 113
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 2 (2G10), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 4 (2G10).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 12 (2E6), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 14 (2E6).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 22 (2A11), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 24 (2A11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 29 (2D11), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 31 (2D11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 105 (Hu2E6_Hvl T57A), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 111 (Hu2E6_Kvl).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 105 (Hu2E6_Hvl T57A), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 113 (Hu2E6_Kv2).
  • the antibody comprises (i) an immunoglobulin heavy chain selected from the group consisting of SEQ ID NO: 69 (2G10), SEQ ID NO: 73 (2E6), SEQ ID NO: 77 (2A11), SEQ ID NO: 81 (2D11), SEQ ID NO: 120 (2E6 Chimeric Heavy IgGl), SEQ ID NO: 124 (Hu2E6_Hvl IgGl), SEQ ID NO: 126 (Hu2E6_Hvl T57A IgGl), SEQ ID NO: 128 (Hu2E6_Hv2 IgGl), and SEQ ID NO: 130 (Hu2E6_Hv2 T57A IgGl), and (ii) an immunoglobulin light chain selected from the group consisting of SEQ ID NO: 71 (2G10), SEQ ID NO: 75 (2E6), SEQ ID NO: 79 (2A11), SEQ ID NO: 83 (2D11), SEQ ID NO: 122 (2E6 Chimeric Kapp
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 69 (2G10), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 71 (2G10).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 73 (2E6), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 75 (2E6).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 77 (2A11), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 79 (2A11).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 81 (2D11), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 83 (2D11).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 126 (Hu2E6_Hvl T57A IgGl), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 132
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 126 (Hu2E6_Hvl T57A IgGl), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO: 134
  • an isolated antibody comprises an immunoglobulin heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire variable region or the framework region sequence of SEQ ID NO: 2 (2G10), SEQ ID NO: 12 (2E6), SEQ ID NO: 22 (2A11), SEQ ID NO: 29 (2D11), SEQ ID NO: 103 (Hu2E6_Hvl), SEQ ID NO: 105 (Hu2E6_Hvl T57A), SEQ ID NO: 107 (Hu2E6_Hv2), or SEQ ID NO: 109 (Hu2E6_Hv2 T57A).
  • an isolated antibody comprises an immunoglobulin light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire variable region or the framework region sequence of SEQ ID NO: 4 (2G10), SEQ ID NO: 14 (2E6), SEQ ID NO: 24 (2A11), SEQ ID NO: 31 (2D11), SEQ ID NO: 1 1 1 (Hu2E6_Kvl), or SEQ ID NO: 1 13 (Hu2E6_Kv2).
  • Homology or identity may be determined in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
  • BLAST Basic Local Alignment Search Tool
  • analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al, ( 1990) PROC. NATL. ACAD. SCI. USA 87, 2264-2268; Altschul, (1993) J. MOL.
  • EVOL. 36, 290-300; Altschul et al, (1997) NUCLEIC ACIDS RES. 25, 3389-3402, incorporated by reference) are tailored for sequence similarity searching.
  • the approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance.
  • NATURE GENETICS 6, 1 19- 129 which is fully incorporated by reference.
  • Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • the search parameters for histogram, descriptions, alignments, expect i.e., the statistical significance threshold for reporting matches against database sequences
  • cutoff, matrix and filter are at the default settings.
  • the default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al, (1992) PROC. NATL. ACAD. SCI. USA 89, 10915-10919, fully incorporated by reference).
  • immunoglobulin heavy chain variable region sequences and/or light chain variable region sequences that together bind human Notchl may contain amino acid alterations (e.g., at least 1, 2, 3, 4, 5, or 10 amino acid substitutions, deletions, or additions) in the framework regions of the heavy and/or light chain variable regions.
  • an isolated antibody binds human Notchl with a K D of 100 nM, 50 nM, 20 nM, 15 nM, 12 nM, 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM or lower.
  • K D values are determined by surface plasmon resonance methods under the conditions described in Examples 3 and 14.
  • Antibody Hu2E6-62 binds human Notchl with a K D of 10 nM, 9 nM, 8 nM, 7 nM, 5 nM, 4 nM, 2 nM, 1 nM or lower as measured by surface plasmon resonance methods under the conditions described in Examples 3 and 14.
  • antibody Hu2E6-62 binds human Notch 1 with a K D of 8 nM or lower as measured by surface plasmon resonance methods at 37°C under the conditions described in Examples 3 and 14.
  • Antibody Hu2E6-74 binds human Notchl with a K D of 10 nM, 9 nM, 8 nM, 7 nM, 5 nM, 4 nM, 2 nM, 1 nM or lower as measured by surface plasmon resonance methods under the conditions described in Examples 3 and 14.
  • antibody Hu2E6-74 binds human Notchl with a K D of 8 nM or lower as measured by surface plasmon resonance methods at 37°C under the conditions described in Examples 3 and 14.
  • DNA molecules encoding light chain variable regions and/or heavy chain variable regions can be chemically synthesized using the sequence information provided herein.
  • Synthetic DNA molecules can be ligated to other appropriate nucleotide sequences, including, e.g., constant region coding sequences, and expression control sequences, to produce conventional gene expression constructs encoding the desired antibody. Production of defined gene constructs is within routine skill in the art.
  • sequences provided herein can be cloned out of hybridomas by conventional hybridization techniques or polymerase chain reaction (PCR) techniques, using synthetic nucleic acid probes whose sequences are based on sequence information provided herein, or prior art sequence information regarding genes encoding the heavy and light chains of murine antibodies in hybridoma cells.
  • Nucleic acids encoding desired antibodies can be incorporated (ligated) into expression vectors, which can be introduced into host cells through conventional transfection or transformation techniques.
  • Exemplary host cells are E. coli cells, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), and myeloma cells that do not otherwise produce IgG protein.
  • Transformed host cells can be grown under conditions that permit the host cells to express the genes that encode the immunoglobulin light and/or heavy chain variable regions.
  • Specific expression and purification conditions will vary depending upon the expression system employed. For example, if a gene is to be expressed in E. coli, it is first cloned into an expression vector by positioning the engineered gene downstream from a suitable bacterial promoter, e.g. , Trp or Tac, and a prokaryotic signal sequence. The expressed secreted protein accumulates in refractile or inclusion bodies, and can be harvested after disruption of the cells by French press or sonication. The refractile bodies then are solubilized, and the proteins refolded and cleaved by methods known in the art.
  • a suitable bacterial promoter e.g. , Trp or Tac
  • the expressed secreted protein accumulates in refractile or inclusion bodies, and can be harvested after disruption of the cells by French press or sonication.
  • the refractile bodies then are solubilized, and the proteins refolded and cleaved by methods known in the art.
  • the engineered gene is to be expressed in eukayotic host cells, e.g., CHO cells, it is first inserted into an expression vector containing a suitable eukaryotic promoter, a secretion signal, IgG enhancers, and various introns.
  • This expression vector optionally contains sequences encoding all or part of a constant region, enabling an entire, or a part of, a heavy or light chain to be expressed.
  • the gene construct can be introduced into eukaryotic host cells using conventional techniques.
  • the host cells express VL or VH fragments, VL-VH
  • VH-VL or VL-VH single chain polypeptides complete heavy or light
  • a host cell is transfected with a single vector expressing a polypeptide expressing an entire, or part of, a heavy chain (e.g., a heavy chain variable region) or a light chain (e.g., a light chain variable region).
  • a host cell is transfected with a single vector encoding (a) a polypeptide comprising a heavy chain variable region and a polypeptide comprising a light chain variable region, or (b) an entire immunoglobulin heavy chain and an entire immunoglobulin light chain.
  • a host cell is co-transfected with more than one expression vector (e.g., one expression vector encoding a polypeptide comprising an entire, or part of, a heavy chain or heavy chain variable region, and another expression vector encoding a polypeptide comprising an entire, or part of, a light chain or light chain variable region).
  • more than one expression vector e.g., one expression vector encoding a polypeptide comprising an entire, or part of, a heavy chain or heavy chain variable region, and another expression vector encoding a polypeptide comprising an entire, or part of, a light chain or light chain variable region.
  • a polypeptide comprising an immunoglobulin heavy chain variable region or light chain variable region can be produced by growing a host cell transfected with an expression vector encoding such variable region, under conditions that permit expression of the polypeptide. Following expression, the polypeptide can be harvested and purified using techniques well known in the art, e.g., affinity tags such as glutathione-S-transferase (GST) and histidine tags.
  • GST glutathione-S-transferase
  • histidine tags such as glutathione-S-transferase (GST) and histidine tags.
  • a monoclonal antibody that binds human Notch 1, or an antigen-binding fragment of the antibody can be produced by growing a host cell transfected with: (a) an expression vector that encodes a complete or partial immunoglobulin heavy chain, and a separate expression vector that encodes a complete or partial immunoglobulin light chain; or (b) a single expression vector that encodes both chains (e.g., complete or partial heavy and light chains), under conditions that permit expression of both chains.
  • the intact antibody (or antigen-binding fragment of the antibody) can be harvested and purified using techniques well known in the art, e.g., Protein A, Protein G, affinity tags such as glutathione-S-transferase (GST) and histidine tags. It is within ordinary skill in the art to express the heavy chain and the light chain from a single expression vector or from two separate expression vectors.
  • the antibodies are to be administered to a human, the antibodies preferably are "humanized" to reduce or eliminate antigenicity in humans.
  • the humanized antibodies have the same, or substantially the same, affinity for the antigen as the non-humanized mouse antibody from which it was derived.
  • chimeric proteins are created in which mouse immunoglobulin constant regions are replaced with human immunoglobulin constant regions. See, e.g., Morrison et al, 1984, PROC. NAT. ACAD. SCI. 81 :6851-6855, Neuberger et al, 1984, NATURE 312:604-608; U.S. Patent Nos. 6,893,625 (Robinson); 5,500,362 (Robinson); and 4,816,567 (Cabilly).
  • CDR grafting In an approach known as CDR grafting, the CDRs of the light and heavy chain variable regions are grafted into frameworks from another species. For example, murine CDRs can be grafted into human FRs.
  • the CDRs of the light and heavy chain variable regions of an anti-Notch 1 antibody are grafted into human FRs or consensus human FRs.
  • consensus human FRs FRs from several human heavy chain or light chain amino acid sequences are aligned to identify a consensus amino acid sequence. CDR grafting is described in U.S. Patent Nos. 7,022,500 (Queen); 6,982,321 (Winter);
  • human CDR sequences are chosen from human germline genes, based on the structural similarity of the human CDRs to those of the mouse antibody to be humanized. See, e.g., U.S. Patent No. 6,881,557 (Foote); and Tan et al., 2002, J. IMMUNOL 169: 1119-1125.
  • ACTIVMABTM technology Vaccinex, Inc., Rochester, NY
  • a vaccinia virus-based vector to express antibodies in mammalian cells.
  • High levels of combinatorial diversity of IgG heavy and light chains are said to be produced. See, e.g., U.S. Patent Nos. 6,706,477 (Zauderer); 6,800,442 (Zauderer); and 6,872,518 (Zauderer).
  • Any suitable approach including any of the above approaches, can be used to reduce or eliminate human immunogenicity of an antibody of the invention.
  • the antibody can be conjugated to an effector moiety such as a small molecule toxin or a radionuclide using standard in vitro conjugation chemistries. If the effector moiety is a polypeptide, the antibody can be chemically conjugated to the effector or joined to the effector as a fusion protein. Construction of fusion proteins is within ordinary skill in the art. IV. Use of Antibodies
  • Antibodies disclosed herein can be used to treat various forms of cancer, e.g., breast, ovarian, prostate, cervical, colorectal, lung, pancreatic, gastric, and head and neck cancers.
  • the cancer cells are exposed to a therapeutically effective amount of the antibody so as to inhibit or reduce proliferation of the cancer cells.
  • the antibodies inhibit cancer cell proliferation by at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100%.
  • the disclosed antibodies may inhibit or reduce proliferation of a tumor cell by inhibiting binding of human Notchl to a ligand, e.g., Jagl, Jag2, DLL1, and DLL4.
  • the antibodies e.g., 2E6, 2G10, 2A11, 2D11, Hu2E6) can also be used in therapy.
  • the disclosed antibodies e.g., 2E6, 2G10, 2A11, 2D11, Hu2E6) can be used in a method to inhibit tumor growth in a mammal (e.g., a human patient). The method comprises administering to the mammal a therapeutically effective amount of the antibody.
  • antibody Hu2E6-62 is used in therapy.
  • antibody Hu2E6-62 can be used for inhibiting or reducing proliferation of a tumor cell.
  • Antibody Hu2E6-62 can also be used for inhibiting or reducing tumor growth in a mammal.
  • antibody Hu2E6-74 is used in therapy.
  • antibody Hu2E6-74 can be used for inhibiting or reducing proliferation of a tumor cell.
  • Antibody Hu2E6-74 can also be used for inhibiting or reducing tumor growth in a mammal.
  • Cancers associated with Notchl overexpression and/or activation include breast cancer, ovarian cancer, prostate cancer, cervical cancer, lung cancer, brain cancers (e.g., glioblastoma, astrocytoma, neuroblastoma), melanomas, gastrointestinal cancers (e.g., colorectal, pancreatic, and gastric), head and neck cancer, and hematopoietic cell cancers, (e.g., multiple myeloma, leukemia, e.g., precursor T acute lymphoblastic leukemia (T-ALL), precursor B acute lymphoblastic leukemia (B-ALL) and B-cell chronic lymphoblastic leukemia (B-CLL)).
  • T-ALL precursor T acute lymphoblastic leukemia
  • B-ALL precursor B acute lymphoblastic leukemia
  • B-CLL B-cell chronic lymphoblastic leukemia
  • treat means the treatment of a disease in a mammal, e.g., in a human. This includes: (a) inhibiting the disease, i.e., arresting its development; and (b) relieving the disease, i.e., causing regression of the disease state; and (c) curing the disease.
  • a therapeutically effective amount of active component is in the range of 0.1 mg/kg to 100 mg/kg, e.g., 1 mg/kg to 100 mg/kg, 1 mg/kg to 10 mg/kg.
  • the amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health of the patient, the in vivo potency of the antibody, the pharmaceutical formulation, and the route of administration.
  • the initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue-level. Alternatively, the initial dosage can be smaller than the optimum, and the daily dosage may be progressively increased during the course of treatment.
  • Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study designed to run from 0.5 mg/kg to 20 mg/kg.
  • Dosing frequency can vary, depending on factors such as route of administration, dosage amount and the disease being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks. A preferred route of administration is parenteral, e.g., intravenous infusion. Formulation of monoclonal antibody-based drugs is within ordinary skill in the art. In some embodiments, a monoclonal antibody is lyophilized and reconstituted in buffered saline at the time of administration.
  • an antibody preferably is combined with a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • the carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient.
  • Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art.
  • compositions containing antibodies disclosed herein can be presented in a dosage unit form and can be prepared by any suitable method.
  • a pharmaceutical composition should be formulated to be compatible with its intended route of administration. Examples of routes of administration are intravenous (IV), intradermal, inhalation, transdermal, topical, transmucosal, and rectal administration. A preferred route of administration for monoclonal antibodies is IV infusion.
  • Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).
  • Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • chelating agents such as EDTA
  • buffers such as acetates, citrates or phosphates
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS).
  • the carrier should be stable under the conditions of manufacture and storage, and should be preserved against microorganisms.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol), and suitable mixtures thereof.
  • compositions preferably are sterile. Sterilization can be
  • composition is lyophilized
  • filter sterilization can be conducted prior to or following lyophilization and reconstitution.
  • B cells were harvested and fused with a myeloma line. Fusion products from AJ mice and Balb/c mice were serially diluted in forty 96- well plates to near clonality. A total of 10,560 supernatants from the cell fusions were screened for binding to human Notchl on the surface of CHO cells, using a Mesoscale
  • the light chain isotype and heavy chain isotype of each monoclonal antibody in Example 1 was determined using the IsoStripTM Mouse Monoclonal Antibody Isotyping Kit according to the kit vendor's instructions (Roche Applied Science, Indianapolis, IN). All antibodies were found to be kappa light chain and IgGl or IgG2b heavy chain.
  • the heavy and light chain variable regions of the mouse monoclonal antibodies were sequenced using 5' RACE (Rapid Amplification of cDNA Ends).
  • Total RNA was extracted from each monoclonal hybridoma cell line using the RNeasy ® Miniprep kit according to the vendor's instructions (Qiagen, Valencia, CA).
  • Full-length first strand cDNA containing 5' ends was generated using either the GeneRacerTM Kit (Invitrogen, Carlsbad, California) or SMARTerTM RACE cDNA Amplification Kit (Clontech, Mountain View, CA) according to the kit vendor's instructions, using random primers for 5' RACE.
  • variable regions of the kappa and heavy (IgGlor IgG2b) chains were amplified by PCR, using KOD Hot Start Polymerase (EMD Chemicals, Gibbstown, NJ), Expand High Fidelity PCR System (Roche Applied Science), or Advantage 2 Polymerase Mix (Clontech, Mountain View, CA) according to the vendor's instructions.
  • KOD Hot Start Polymerase EMD Chemicals, Gibbstown, NJ
  • Expand High Fidelity PCR System Roche Applied Science
  • Advantage 2 Polymerase Mix Advantage 2 Polymerase Mix
  • cgactggagcacgaggacactga 3' (SEQ ID NO: 84) (Invitrogen) was used as a 5' primer.
  • cgactggagcacgaggacactga 3' (SEQ ID NO: 84) (Invitrogen) was used as a 5' primer.
  • Heavy chain variable regions were amplified using the above 5' primers and a 3' IgGl constant region specific primer, either 5' TATGCAAGGCTTACAACCACA 3' (SEQ ID NO: 87) or 5' GCCAGTGGATAGACAGATGGGGGTGTCG 3' (SEQ ID NO: 88).
  • IgG2b sequences were amplified with 5' GGCCAGTGGATAGACTGATGGGGGTGTTGT 3' (SEQ ID NO: 89).
  • Kappa chain variable regions were amplified with the above 5' primers and a 3' kappa constant region specific primer, either 5' CTCATTCCTGTTGAAGCTCTTGACAAT 3' (SEQ ID NO: 90) or 5' CGACTGAGGCACCTCCAGATGTT 3' (SEQ ID NO: 91).
  • PCR products were isolated by agarose gel electrophoresis and purified using the Qiaquick ® Gel Purification kit, according to the kit vendor's instructions (Qiagen). The PCR products were subsequently cloned into the pCR ® 4Blunt plasmid or pCR2. l ® TOPO plasmid using the Zero Blunt ® TOPO ® PCR Cloning Kit or the TOPO ® TA Cloning Kit, respectively, according to the kit vendor's instructions (Invitrogen) and transformed into DH5- ⁇ bacteria (Invitrogen), using standard molecular biology techniques. Plasmid DNA isolated from transformed bacterial clones was sequenced using Ml 3 Forward
  • Example 1 The amino acid sequences defining the immunoglobulin light chain variable regions for the antibodies in Example 1 are aligned in FIG. 4. Amino terminal signal peptide sequences (for proper expression/secretion) are not shown. CDR l5 CDR 2 and CDR 3 are identified by boxes. FIG. 5 shows an alignment of the separate CDR l5 CDR 2 , and CDR 3 sequences for each antibody.
  • Table 1 shows the SEQ ID NO. of each sequence discussed in this Example.
  • each variable sequence above is combined with its respective constant region.
  • a complete heavy chain comprises a heavy variable sequence followed by the murine IgGl or IgG2b heavy chain constant sequence
  • a complete kappa chain comprises a kappa variable sequence followed by the murine kappa light chain constant sequence.
  • Signal sequences for proper secretion of the antibodies are not shown in the full length heavy and light chain sequences disclosed herein and are not included in the final secreted protein. Also not shown are stop codons for termination of translation required at the 3' end of the DNA sequences. It is within ordinary skill in the art to select a signal sequence and/or a stop codon for expression of the disclosed full length IgG heavy chain and light chain sequences. It is also contemplated that the variable region sequences can be ligated to other constant region sequences to produce active full length IgG heavy and light chains.
  • Table 4 shows the correspondence between the full length sequences of the antibodies discussed in this Example with those presented in the Sequence Listing.
  • Rabbit anti-mouse IgGs (Biacore, Cat. No. BR- 1008-38) were immobilized on carboxymethylated dextran CM4 sensor chips by amine coupling (GE Healthcare) using a standard coupling protocol according to vendor's instructions. The analyses were performed at 25°C, using PBS (Invitrogen, Cat. No. 14040-133) containing 0.05% surfactant P20 (GE Healthcare) as running buffer.
  • the antibodies were captured in individual flow cells, at a flow rate of 10 ⁇ /min. Injection time was varied for each antibody to yield an Rmax between 30 and 60 RU. Buffer or rhNotchl-Fc diluted in running buffer was injected sequentially over a reference surface (no antibody captured) and the active surface (antibody to be tested) for 300 seconds, at 60 ⁇ /min. The dissociation phase was monitored for up to 3600 seconds. The surface was then regenerated with two 60-second injections of 10 mM Glycine-HCl, pH 1.7, at a flow rate of 60 ⁇ /min. The rhNotchl-Fc concentration range tested was 6.25 nM to 100 nM. Kinetic parameters were determined using the kinetic function of the BIAevalutation software (GE)
  • Antibodies 2G10, 2E6, 2A11 and 2G11 were tested for binding to human Notchl, human Notch2, or human Notch3, protein. Binding measurements were made by bio-layer interferometry (BLI), using a ForteBio Octet ® QK instrument (ForteBio, Menlo Park, CA). Anti-human-Fc sensors were soaked in PBS containing 1 mg/ml BSA for 5 minutes prior to binding of antibodies. Then the following proteins (400 nM, in PBS containing 1 mg/ml BSA) were allowed to bind to the sensors: rhNotchl-Fc (R&D Systems, Minneapolis, MN; Cat. No.
  • Notch protein bound sensors were immersed in antibody solution (50 ⁇ g/ml) to allow binding of antibody to the Notch protein. Binding was detected by shifts in the interference pattern.
  • CHO FlplnTM cells (Invitrogen, Cat. No. R758-07) expressing each of the four human Notch proteins were produced, according to the vendor's instructions. A CHO line lacking any human Notch protein was also produced for use as a negative control. Cells were grown under standard conditions (37°C, DMEM/F12 + 10% FBS). For binding studies, cells were washed in PBS containing calcium and magnesium, removed from the plate, and disaggregated by treatment with dissociation buffer (GIBCO Cat. No. 13151014) for 10 minutes at 37 °C.
  • Cells were seeded at a density of 30,000 cells per well, in hybridoma media, in a standard 96-well binding plates (Meso Scale Discovery, Cat. No. L15XA-6). Cells were incubated for one hour at 37°C. Antibodies or control IgG were added at 5 ⁇ g/ml, in 50 ⁇ hybridoma media, and incubated for 1 hour at 37°C. The plates were washed twice with PBS containing 3% BSA. Binding of the antibodies to cell surface was detected using 2 ⁇ g/ml of MSD anti-mouse IgG secondary antibody (Meso Scale Discovery, Cat. No. R32AC-1) for 1 hour at 4°C.
  • Antibodies 2E6, 2A11 and 2D11 were tested for their ability to inhibit the binding of rhNotchl to human Jagl, Jag2, DLLl and DLL4. Binding measurements were made by bio- layer interferometry (BLI), using a ForteBio Octet QK instrument (ForteBio, Menlo Park, CA). The ligands tested were rhJagl-Fc (R&D Cat. No. 1277-JG-050 ), rhJag2-Fc (R&D Cat. No. 1726-JG-050), rhDLLl-Fc (R&D Cat. No. 5026-DL-050), and His tagged rhDLL4 (R&D Cat. No. 1506-D4-050).
  • the Octet sensors were loaded with recombinant human Notch 1, and each antibody was allowed to bind, as described in Example 4 (above). Subsequently sensors were immersed in 500 ⁇ g/ml human IgG, to block non-specific binding. Ligands were prepared at 400 nM, in PBS containing 3% BSA, and were allowed to bind. The on-rate and off-rate for ligand binding were detected using the Octet ® QK instrument and software. Antibodies 2E6, 2A11, and 2D11 blocked binding of all four ligands to rhNotchl-Fc.
  • Notchl signaling in cell lines various Notchl -expressing cells were plated in 96- well plates on wells coated with Notch ligands.
  • the wells were prepared by diluting oc-human Fc (Jackson ImmunoResearch, West Grove, PA) to 10 ⁇ g/ml in sterile- filtered carbonate -bicarbonate coating buffer, pH 9.4 (Pierce 28382). Then 1 ⁇ g of the diluted antibody was added to each well of a 96-well MaxisorpTM plate and incubated overnight at 4°C.
  • Cells were pre-incubated with 10 ⁇ g/ml blocking antibody for one hour at 37°C, before seeding 100 ⁇ of the suspension into 96-well plates coated with ligand or hFc. Cells were incubated for four hours at 37°C before being dislodged from the well by pipetting and harvested. Wells were washed with PBS and pooled with harvested cells to ensure complete collection. Cells were sedimented in a refrigerated microcentrifuge, washed with 100 ⁇ PBS, and lysed by resuspending cell pellet in 30 ⁇ of RIPA buffer containing protease inhibitors. Lysates were clarified by centrifugation in a refrigerated microcentrifuge.
  • Reporter cell lines dependent upon Notchl, Notch2, or Notch3 were produced by lentiviral introduction of a RBP-jK-dependent luciferase reporter gene (SABiosciences,
  • Notchl -dependent signaling and transcription cells were plated on ligand-coated wells prepared, as described in Example 6 (above). Cells were pre-incubated with a 3-fold dilution series of Notchl antibody concentrations ranging from 0-300 ⁇ g/ml, for one hour at 37°C, before seeding 100 ⁇ of the suspension into 96-well plates coated with ligand or hFc. Cells were incubated in ligand-coated or human-Fc-coated wells for four or 24 hours at 37°C, in 5% C0 2 .
  • Notchl signaling was activated by Jagl, as described above.
  • Karpas45 cells with IgG control, Notchl antibodies, or DBZ was assessed by quantitative RT-PCR.
  • Karpas45 cells were seeded into 6-well plates, in 2 ml of media. Replicate wells of cells were treated with antibody 2E6, IgG control, 1 ⁇ DBZ, or vehicle control (DMSO), immediately after seeding. Cells were incubated at 37°C, 5% C0 2 for 20 hours after treatment, collected, and rinsed with PBS. Cell pellets were frozen on dry ice and stored -80°C.
  • RNA was prepared using Qiagen RNeasyTM miniprep columns (Qiagen GR8RNA).
  • Quantitative RT-PCR was performed to analyze Notch target gene expression, using a commercial kit according to the kit vendor's instructions (Quantitect SYBR GREEN RT-PCR Kit; Qiagen). Results were analyzed using the comparative Ct method. Beta actin was used as an internal standard, and Stratagene Universal Human Reference RNA (Stratagene 740000) was used as an external standard for measurement of expression levels of the genes investigated. These results showed that antibody 2E6 inhibits transcription of endogenous Notch target genes, including Heyl.
  • Antibody 2E6 was tested for inhibition of ligand-dependent and ligand-independent proliferation of human cancer cells that express Notchl.
  • the T-ALL cell line Karpas45 expresses elevated levels of Notchl.
  • To screen for antagonistic Notchl antibodies cells were grown in 96- well plates in wells coated with either human Fc or rhJagl-Fc. Growth was measured in the presence of various concentrations of antibodies (0 - 300 ⁇ g/ml in 100 ⁇ final volume) by MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assays conducted two days after plating cells on ligand or human Fc control. These results showed that antibody 2E6 inhibits proliferation of Karpas45 cells.
  • quantitative RT-PCR analysis as described in Example 7 (above) demonstrated that antibody 2E6 inhibited expression of the Notch target gene Heyl in Karpas45 cells.
  • Antibodies 2G10, 2E6, 2A11 and 2D11 were shown to bind to Notchl on the surface of human umbilical vein endothelial cells (HUVEC) (ATCC Cat. No. CRL-1730), as determined by FACS analysis. To determine whether inhibition of Notchl signaling affects angiogenesis, these four antibodies were tested for promotion of endothelial cell branching morphogenesis.
  • MatrigelTM was prepared in 24- well plates by adding 250 ⁇ of growth factor reduced Matrigel (GFR; BD Bioscience Cat. No. 356231) to each well, and incubated for one hour at 37 °C.
  • HUVECs were washed in PBS, and resuspended in EGM-2 growth media (Lonza Cat. No. CC-3156) plus 2% FBS.
  • Antibodies, human IgG, or positive controls were added to the media containing cells, and 40,000 cells per well were plated on polymerized GFR matrix.
  • Branching morphogenesis was assessed at various time points, by image capture and analysis, using ImageJ public domain image processing software. All four antibodies promoted vascular branching morphogenesis resulting in increased branching of vessels and increased overall vascular area.
  • Example 10 Inhibition of T-cell Fate Specification In Vivo
  • Antibodies 2G10, 2E6, 2A11 and 2D11 did not bind with high affinity to mouse Notchl. Therefore, to determine the effect of these Notchl antibodies on Notchl function in mice in vivo, the mouse Notchl gene was engineered to express a Notchl protein containing the human amino acid sequence from amino acid 413 to 488. No phenotypic difference was observed in these "humanized” Notchl mice. Importantly, the number and distribution of the thymocyte population in these animals was indistinguishable from wild-type mice. This indicated that the engineered Notchl protein was fully functional in the humanized mice.
  • Inhibition of thymocyte development and T-cell fate specification can be used as an indication that an anti-Notch 1 antibody is actually inhibiting Notchl function in vivo.
  • Antibody 2E6 reduced the total number of thymocytes, and decreased the percent of CD4/CD8 double positive cells, while increasing the percentage of CD4 single positive, CD8 single positive, and CD4/CD8 double negative cells. These effects of antibody 2E6 were comparable to the effects observed when animals were treated with 10 ⁇ /kg of the gamma-secretase inhibitor DBZ. This indicated that antibody 2E6 was inhibiting Notch 1 in vivo function in thymocyte development.
  • Loss of hair pigmentation can be used as an indication that an anti-Notch 1 antibody is inhibiting Notch 1 function in vivo. Therefore, mice (C57bl/6; 129Sv/Ev mixed background) homozygous for humanized Notch 1 gene were treated with antibody 2E6, IgG control, or DBZ, as described in Example 10. Daily monitoring revealed loss of hair pigmentation in the antibody-treated mice within 2 weeks. No such loss of pigmentation was observed in IgG control treated mice.
  • mice were treated with antibody 2E6, IgG control, or DBZ, as described in Example 10 (FIG. 9A). Over time, DBZ treated animals exhibited loss of body weight, while animals treated with up to 150 mg/kg Notch 1 antibody three times per week exhibited normal weight gain (FIG. 9B). After 18 days, animals were sacrificed, small intestines were collected, fixed and embedded in paraffin. To observe goblet cells in the small intestine, sections of small intestine from antibody-treated, IgG-treated, and DBZ-treated animals were stained with Alcian Blue (Diagnostic Biosystems, Cat. No. KT 003).
  • mice treated with 40, 100 or 150 mg/kg of Notch 1 antibody 2E6 showed no increase in goblet cell numbers compared to control animals.
  • small intestines from animals treated with DBZ (10 ⁇ /kg) showed extensive alcian blue staining.
  • FIG. 9A The results in FIG. 9A also demonstrate that antibody 2E6 at doses of 40, 100 or 150 mg/kg inhibit thymocyte development as effectively as 10 ⁇ /kg of DBZ. Therefore, as shown in FIGS. 9A-9B, and by alcian blue staining of the small intestine, antibody 2E6 does not have toxic effects (as measured by body weight loss and goblet cell conversion) at doses significantly higher than the dose required to inhibit thymocyte development.
  • a standard curve of hemoglobin concentration was prepared using 180 mg/ml, 120 mg/ml, 60 mg/ml, 30 mg/ml, 15 mg/ml, 7.5 mg/ml and 0 mg/ml of hemoglobin in a 1: 1 mixture of water and Drabkin's reagent (Sigma- Aldrich, St. Louis, MO). Test samples were centrifuged to pellet matrigel and cells. A 225 ⁇ sample of supernatant was removed, mixed with an equal volume of Drabkin's reagent, and incubated for 15 minutes at room temperature.
  • This Example describes the humanization of the murine antibody designated 2E6, and the characterization of the resulting humanized antibodies.
  • the humanized anti-Notch 1 antibodies were designed using methods well-known in the art. Two different humanized versions were made for each chain and a predicted N-linked glycosylation site in 2E6 heavy CDR2 was mutated to prevent any possible glycosylation.
  • the designed amino acid sequences were converted to codon-optimized DNA sequences and synthesized by DNA2.0, Inc. to include (in the following order): 5' Hindlll restriction site, Kozak consensus sequence, amino terminal signal sequence, humanized variable region, human IgGl or Kappa constant region, stop codon, and a 3' EcoRI restriction site.
  • the anti-Notch 1 humanized antibody chains are designated with the prefix "Hu2E6_Hv” or “Hu2E6_Kv”, referring to humanized 2E6 heavy or kappa light, respectively, and the designations are then followed by a numeric suffix (e.g., Hu2E6_Hvl, Hu2E6_Hv2, Hu2E6_Kvl, or Hu2E6_Kv2). In some cases, the designation is also followed by an amino acid substitution abbreviation (e.g., Hu2E6_Hvl T57A or Hu2E6_Hv2 T57A). Combinations of humanized heavy light chains are designated with the prefix "Hu2E6” and a numeric suffix.
  • Chimeric (murine variable region and human constant region) 2E6 heavy (human IgGl) and light (human Kappa) chains were also constructed.
  • the murine variable regions were fused to the human constant region using overlap extension PCR, including (in the following order): 5' Hindlll restriction site, Kozak consensus sequence, amino terminal signal sequence, mouse variable region, human IgGl or Kappa constant region, stop codon, and 3' EcoRI restriction site.
  • the humanized and chimeric heavy chains were subcloned into pEE6.4 (Lonza, Basel, Switzerland) via Hindlll and EcoRI sites using In-FusionTM PCR cloning (Clontech, Mountain View, CA).
  • the humanized and chimeric Kappa light chains were subcloned into pEE14.4 (Lonza) via Hindlll and EcoRI sites using In-FusionTM PCR cloning.
  • Hu2E6_Kvl (SEQ ID NO 111)
  • Hu2E6_Hvl (SEQ ID NO: 103)
  • Hu2E6_Kvl (SEQ ID NO 111)
  • Hu2E6_Hvl T57A (SEQ ID NO: 105)
  • Hu2E6_Kvl (SEQ ID NO 111)
  • Hu2E6_Hv2 (SEQ ID NO: 107)
  • Hu2E6_Kvl (SEQ ID NO 111)
  • Hu2E6_Hv2 T57A (SEQ ID NO: 109)
  • Hu2E6_Kv2 (SEQ ID NO 113)
  • Hu2E6_Hvl (SEQ ID NO: 103)
  • Hu2E6_Kv2 (SEQ ID NO 113)
  • Hu2E6_Hvl T57A (SEQ ID NO: 105)
  • Hu2E6_Kv2 (SEQ ID NO 113) Hu2E6_Hv2 (SEQ ID NO: 107)
  • Hu2E6_Kv2 (SEQ ID NO 113)
  • Hu2E6_Hv2 T57A (SEQ ID NO: 109)
  • nucleic acid sequences encoding and the protein sequences defining variable regions of the humanized 2E6 antibodies are summarized below (amino terminal signal peptide sequences are not shown).
  • CDR sequences Kabat definition) are shown in bold and are underlined in the amino acid sequences.
  • FIG. 12 shows an alignment of the separate CDRi, CDR 2 , and CDR 3 sequences for each of the variable region sequences shown in FIG. 12.
  • Example 14 The amino acid sequences defining the immunoglobulin light chain variable regions for the antibodies in Example 14 are aligned in FIG. 14. Amino terminal signal peptide sequences (for proper expression/secretion) are not shown. CDR l5 CDR 2 and CDR 3 are identified by boxes. FIG. 15 shows an alignment of the separate CDR l5 CDR 2 , and CDR 3 sequences for each of the variable region sequences shown in FIG. 14.
  • Table 8 is a concordance chart showing the SEQ ID NO. of each sequence discussed in this Example.
  • each variable sequence above is combined with its respective human constant region.
  • a complete heavy chain comprises a heavy variable sequence followed by a human IgGl heavy chain constant sequence.
  • a complete kappa chain comprises a kappa variable sequence followed by the human kappa light chain constant sequence.
  • the following sequences represent the actual or contemplated full length heavy and light chain sequence (i.e., containing both the variable and constant regions sequences) for each antibody described in this Example.
  • Signal sequences for proper secretion of the antibodies e.g., signal sequences at the 5' end of the DNA sequences or the amino terminal end of the protein sequences
  • stop codons for termination of translation required at the 3' end of the DNA sequences. It is within ordinary skill in the art to select a signal sequence and/or a stop codon for expression of the disclosed full length IgG heavy chain and light chain sequences.
  • the variable region sequences can be ligated to other constant region sequences to produce active full length IgG heavy and light chains.
  • Table 11 provides a concordance chart showing the SEQ ID NO. of each sequence discussed in this Example.
  • Table 12 below shows antibodies containing chimeric immunoglobulin heavy and light chains and each of the possible combinations of the full-length humanized
  • immunoglobulin heavy and light chains are immunoglobulin heavy and light chains.
  • Hu2E6-62 Humanized Hu2E6_Hvl T57A Heavy Chain Variable Region and Human IgGl Constant Region (SEQ ID NO: 126) plus Hu2E6_Kvl Light Chain Variable Region and Human Kappa Constant Region (SEQ ID NO: 132)
  • Hu2E6-74 Humanized Hu2E6_Hvl T57A Heavy Chain Variable Region and Human IgGl Constant Region (SEQ ID NO: 126) plus Hu2E6_Kv2 Light Chain Variable Region and Human Kappa Constant Region (SEQ ID NO: 134)
  • Goat anti-human IgG Fc (Jackson ImmunoResearch, Catalog No. 109-005-098) was immobilized on carboxymethylated dextran CM4 sensor chips (Biacore, Catalog No. BR- 1005-34) by amine coupling (Biacore, Catalog No. BR- 1000-50) using a standard coupling protocol according to the vendor's instructions.
  • the analyses were performed at 37°C using PBS (Invitrogen, Catalog No. 14040-133) containing 0.05% surfactant P20 (Biacore, Catalog No. BR- 1000-54) as running buffer.
  • the antibodies were captured in individual flow cells at a flow rate of 10 ⁇ /minute. Injection time was varied for each antibody to yield an R max between 30 and 60 RU. Buffer or recombinant human Notch 1 monomer diluted in running buffer was injected sequentially over a reference surface (no antibody captured) and the active surface (antibody to be tested) for 240 sec at 60 ⁇ /minute. The dissociation phase was monitored for up to 1200 sec. The surface was then regenerated with two 60 second injections of Glycine pH 2.25 (made from Glycine pH 2.0 (Biacore, Catalog No. BR- 1003-55) and pH 2.5 (Biacore, Catalog No. BR- 1003-56) at 30 ⁇ /minute.
  • Glycine pH 2.25 made from Glycine pH 2.0 (Biacore, Catalog No. BR- 1003-55) and pH 2.5 (Biacore, Catalog No. BR- 1003-56) at 30 ⁇ /minute.
  • A2-NRR1 as disclosed in Wu et al, (2010) NATURE 464: 1052-57, is an antibody known to inhibit the function of human Notch 1.
  • the binding specificities of antibodies mu2E6, Hu2E6-62, and A2-NRR1 against human Notch 1 protein expressed on the surface of the T- ALL cell line Karpas45s were measured as described above (See Example 4). Results are summarized in Table 15.
  • Antibodies mu2E6 and Hu2E6-62 were tested for their ability to inhibit the binding of rhNotchl-Fc to human Jagl, Jag2, DLLl and DLL4. Binding measurements were made by bio-layer interferometry (BLI), using a ForteBio Octet ® QK instrument as described in
  • Example 5 The ligands tested were rhJagl-Fc (R&D Cat. No. 1277-JG-050), rhJag2-Fc (R&D Cat. No. 1726-JG-050), rhDLLl-Fc (R&D Cat. No. 5026-DL-050), and His tagged rhDLL4 (R&D Cat. No. 1506-D4-050).
  • the inhibitory activities of the antibodies on Notch 1-ligand binding are summarized in Table 16. Table 16
  • Antibodies mu2E6, Hu2E6-62, and A2-NRR1 were tested for their ability to inhibit Notch 1 -dependent signaling and transcription in the presence of DLL4 as described in Example 7. Results are shown in Fig. 16 and demonstrate that Hu2E6-62 is approximately three times more potent than mu2E6 in inhibiting Notch 1 -dependent transcription. Further, antibodies Hu2E6-62 and A2-NRR1 are equally effective in their inhibitory activities.
  • Notch 1 antibodies mu2E6, Hu2E6-62, and A2-NRR1 were tested for their ability to inhibit Notch 1 -dependent transcription by each of the ligands Jagl, Jag2, DLLl and DLL4 as described in Example 7.
  • the inhibitory activities of antibodies mu2E6, Hu2E6-62, and A2- NRR1 on Notch 1 -dependent transcription are summarized in Table 17. Table 17
  • a reporter cell line dependent upon Notch 1 was produced by lenti viral introduction of a RBP-jK-dependent luciferase reporter gene (SABiosciences, Frederick, MD) into DU4475 cells.
  • RBP-jK-dependent luciferase reporter gene SABiosciences, Frederick, MD
  • Notch 1 signaling was activated by Jagl in DU4475 cells, as described above (See Example 7).
  • the effect on expression of endogenous Notchl targets, as a result of treatment with IgG control or antibody Hu2E6-62 was assessed by quantitative RT-PCR.
  • DU4475 cells were seeded into 6-well plates, in 2 ml of media. Replicate wells of cells were treated with antibody Hu2E6-62, IgG control, or vehicle control (DMSO), immediately after seeding. Cells were incubated at 37°C, 5% C0 2 for 20 hours after treatment, collected, and rinsed with PBS. Cell pellets were frozen on dry ice and stored at -80°C. RNA was prepared using Qiagen RNeasyTM miniprep columns (Qiagen GR8RNA). Quantitative RT-PCR was performed to analyze Notch target gene expression, using a commercial kit according to the kit vendor's instructions (Quantitect SYBR GREEN RT-PCR Kit; Qiagen).
  • Results were analyzed using the comparative Ct method. Beta actin was used as an internal standard, and Stratagene Universal Human Reference RNA (Stratagene 740000) was used as an external standard for measurement of expression levels of the genes investigated. Results as shown in FIG. 17B showed that antibody Hu2E6-62 inhibited transcription of endogenous Notch target genes, including Heyl, Hey 2, HeyL, and Hes5.
  • Example 17 Inhibition of T-cell Fate Specification In Vivo
  • antibody Hu2E6-62 reduced the total number of thymocytes by greater than 95%. Similar levels of thymocyte depletion were observed with A2-NRR1. The results indicate that antibodies Hu2E6-62 and A2-NRR1 inhibited the in vivo function of Notch 1 in thymocyte development to equivalent extents.
  • mice were treated with 20 mg/kg of antibodies Hu2E6-62, or a IgG control three times per week, or 5 mg/kg of A2- NRR1 twice per week, as described in Example 10.
  • the Hu2E6-62 treated animals exhibited normal weight gain indicating a lack of toxicity of these antibodies.
  • the A2-NRR1 treated mice exhibited significant weight loss over the period of treatment, accompanied by diarrhea.
  • mice treated with antibody Hu2E6-62 showed no increase in goblet cell numbers compared to control animals treated with IgG.
  • small intestines from animals treated with A2-NRR1 showed extensive Alcian Blue staining.
  • A2-NRR1 treatment led to dramatic goblet cell hyperplasia indicative of severe intestinal toxicity.
  • A2-NRR1 treated animals also exhibited diarrhea, significant weight loss (FIG. 19A), and approximately 30% of the animals died within 18 days of treatment.
  • Example 19 Inhibition of Angiogenesis in vivo
  • a second matrigel plug was obtained from each bFGF treated mouse and processed for histologic analysis, in parallel with the hemoglobin measurements. Plugs were removed, fixed over night in 10% buffered formalin at room temperature, embedded in paraffin, and 10- 20 um sections were prepared for immunohistochemistry. To detect blood vessels present in the matrigel plug, thin sections were stained for CD31, using an anti-mouse-CD31 antibody (Biocare Medical, Cat. Nos. CM303 and RT517SK) according to the vendor's instructions. CD31 staining of the matrigel plugs demonstrated increased vessel branching and smaller vessels after treatment with antibody Hu2E6-62, when compared to mice treated with IgG control. (Data not shown).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des anticorps monoclonaux qui se lient et inhibent l'activation de la protéine Notch1 humaine. Les anticorps peuvent être utilisés pour traiter les maladies et les troubles prolifératifs cellulaires, y compris certaines formes de cancer, associés à l'activation de Notch1.
PCT/US2011/042843 2010-07-02 2011-07-01 Anticorps anti-notch1 WO2012003472A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US36131210P 2010-07-02 2010-07-02
US61/361,312 2010-07-02
US201161497289P 2011-06-15 2011-06-15
US61/497,289 2011-06-15

Publications (1)

Publication Number Publication Date
WO2012003472A1 true WO2012003472A1 (fr) 2012-01-05

Family

ID=44628773

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/042843 WO2012003472A1 (fr) 2010-07-02 2011-07-01 Anticorps anti-notch1

Country Status (1)

Country Link
WO (1) WO2012003472A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013173542A1 (fr) * 2012-05-16 2013-11-21 Oncomed Pharmaceuticals, Inc. Procédés de traitement du cancer avec des anticorps notch2/3
WO2014172653A2 (fr) 2013-04-19 2014-10-23 Aveo Pharmaceuticals, Inc. Anticorps anti-notch1
US8921106B2 (en) 2007-01-24 2014-12-30 Oncomed Pharmaceuticals, Inc. Antibodies that bind the glutamate ligand binding region of NOTCH3
US8945547B2 (en) 2008-07-08 2015-02-03 Oncomed Pharmaceuticals, Inc. Notch1 receptor antibodies and methods of treatment
US9132189B2 (en) 2008-07-08 2015-09-15 Oncomed Pharmaceuticals, Inc. Notch1 binding agents and methods of use thereof
US9676865B2 (en) 2006-06-13 2017-06-13 Oncomed Pharmaceuticals, Inc. Antibodies to a non-ligand binding region of at least two NOTCH receptors
US9879083B2 (en) 2012-12-19 2018-01-30 Aveo Pharmaceuticals, Inc. Anti-Notch3 antibodies
US11142573B2 (en) 2016-04-29 2021-10-12 Aveo Pharmaceuticals, Inc. Anti-Notch3 antibody

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011794A1 (fr) 1991-12-13 1993-06-24 Xoma Corporation Procedes et matieres de preparation de domaines variables d'anticorps modifies et leurs utilisations therapeutiques
US5500362A (en) 1987-01-08 1996-03-19 Xoma Corporation Chimeric antibody with specificity to human B cell surface antigen
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5859205A (en) 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
US5869619A (en) 1991-12-13 1999-02-09 Xoma Corporation Modified antibody variable domains
WO2000020576A2 (fr) * 1998-10-02 2000-04-13 The Government Of The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services, The National Institutes Of Health Agents induisant une apoptose et methodes afferentes
US6054297A (en) 1991-06-14 2000-04-25 Genentech, Inc. Humanized antibodies and methods for making them
US6072035A (en) 1992-09-25 2000-06-06 Novartis Corporation Reshaped monoclonal antibodies against an immunoglobulin isotype
US6706477B2 (en) 1997-09-22 2004-03-16 University Of Rochester Methods for producing polynucleotide libraries in vaccinia virus
US6881557B2 (en) 2001-07-12 2005-04-19 Arrowsmith Technologies Llp Super humanized antibodies
US6893625B1 (en) 1986-10-27 2005-05-17 Royalty Pharma Finance Trust Chimeric antibody with specificity to human B cell surface antigen
US6982321B2 (en) 1986-03-27 2006-01-03 Medical Research Council Altered antibodies
WO2007145840A2 (fr) * 2006-06-13 2007-12-21 Oncomed Pharmaceuticals, Inc. Compositions et procédés de diagnostic et de traitement du cancer
WO2008091641A2 (fr) * 2007-01-24 2008-07-31 Oncomed Pharmaceuticals, Inc. Compositions et procédés utilisés pour le diagnostic et le traitement du cancer

Patent Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6982321B2 (en) 1986-03-27 2006-01-03 Medical Research Council Altered antibodies
US6893625B1 (en) 1986-10-27 2005-05-17 Royalty Pharma Finance Trust Chimeric antibody with specificity to human B cell surface antigen
US5500362A (en) 1987-01-08 1996-03-19 Xoma Corporation Chimeric antibody with specificity to human B cell surface antigen
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US7022500B1 (en) 1988-12-28 2006-04-04 Protein Design Labs, Inc. Humanized immunoglobulins
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US5693761A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Polynucleotides encoding improved humanized immunoglobulins
US6180370B1 (en) 1988-12-28 2001-01-30 Protein Design Labs, Inc. Humanized immunoglobulins and methods of making the same
US5859205A (en) 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
US6054297A (en) 1991-06-14 2000-04-25 Genentech, Inc. Humanized antibodies and methods for making them
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5869619A (en) 1991-12-13 1999-02-09 Xoma Corporation Modified antibody variable domains
US5766886A (en) 1991-12-13 1998-06-16 Xoma Corporation Modified antibody variable domains
WO1993011794A1 (fr) 1991-12-13 1993-06-24 Xoma Corporation Procedes et matieres de preparation de domaines variables d'anticorps modifies et leurs utilisations therapeutiques
US5770196A (en) 1991-12-13 1998-06-23 Xoma Corporation Modified antibody variable domains and therapeutic uses thereof
US5821123A (en) 1991-12-13 1998-10-13 Xoma Corporation Modified antibody variable domains
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US6072035A (en) 1992-09-25 2000-06-06 Novartis Corporation Reshaped monoclonal antibodies against an immunoglobulin isotype
US6706477B2 (en) 1997-09-22 2004-03-16 University Of Rochester Methods for producing polynucleotide libraries in vaccinia virus
US6800442B2 (en) 1997-09-22 2004-10-05 University Of Rochester Methods of selecting polynucleotides encoding antigens
US6872518B2 (en) 1997-09-22 2005-03-29 University Of Rochester Methods for selecting polynucleotides encoding T cell epitopes
WO2000020576A2 (fr) * 1998-10-02 2000-04-13 The Government Of The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services, The National Institutes Of Health Agents induisant une apoptose et methodes afferentes
US6881557B2 (en) 2001-07-12 2005-04-19 Arrowsmith Technologies Llp Super humanized antibodies
WO2007145840A2 (fr) * 2006-06-13 2007-12-21 Oncomed Pharmaceuticals, Inc. Compositions et procédés de diagnostic et de traitement du cancer
WO2008091641A2 (fr) * 2007-01-24 2008-07-31 Oncomed Pharmaceuticals, Inc. Compositions et procédés utilisés pour le diagnostic et le traitement du cancer

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING COMPANY
ASTE-AMÉZAGA ET AL., PLOS ONE, vol. 5, 2010, pages 1 - 13 E9094
BRAY, NATURE REVIEWS, vol. 7, 2006, pages 678 - 689
HENIKOFF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 - 10919
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
KOPAN ET AL., CELL, vol. 137, 2009, pages 216 - 233
MIELE ET AL., CURRENT CANCER DRUG TARGETS, vol. 6, 2006, pages 313 - 323
MORRISON ET AL., PROC. NAT. ACAD. SCI., vol. 81, 1984, pages 6851 - 6855
NEUBERGER ET AL., NATURE, vol. 312, 1984, pages 604 - 608
OKAMURA HEIDI ET AL: "Monoclonal antibodies to Notch receptors inhibit tumor maintenance", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, vol. 51, April 2010 (2010-04-01), & 101ST ANNUAL MEETING OF THE AMERICAN-ASSOCIATION-FOR-CANCER-RESEARCH; WASHINGTON, DC, USA; APRIL 17 -21, 2010, pages 1254, XP002661144, ISSN: 0197-016X *
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 327
ROGUSKA ET AL., PROT. ENGINEER, vol. 9, 1996, pages 895 - 904
TAN ET AL., J. IMMUNOL, vol. 169, 2002, pages 1119 - 1125
VASWAMI ET AL., ANNALS OF ALLERGY, ASTHMA, & IMMUNOL., vol. 81, 1998, pages 105
VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536
WINTER, FEBS LETT, vol. 430, 1998, pages 92 - 94
WU ET AL., NATURE, vol. 464, 2010, pages 1052 - 1057
WU ET AL., NATURE, vol. 464, 2010, pages 1052 - 57

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9676865B2 (en) 2006-06-13 2017-06-13 Oncomed Pharmaceuticals, Inc. Antibodies to a non-ligand binding region of at least two NOTCH receptors
US9617340B2 (en) 2007-01-24 2017-04-11 Oncomed Pharmaceuticals, Inc. Compositions and methods for diagnosing and treating cancer
US8921106B2 (en) 2007-01-24 2014-12-30 Oncomed Pharmaceuticals, Inc. Antibodies that bind the glutamate ligand binding region of NOTCH3
US9505832B2 (en) 2008-07-08 2016-11-29 Oncomed Pharmaceuticals, Inc. Method of treating cancer by administering a monoclonal antibody that binds human NOTCH2 and NOTCH3
US8945547B2 (en) 2008-07-08 2015-02-03 Oncomed Pharmaceuticals, Inc. Notch1 receptor antibodies and methods of treatment
US8945873B2 (en) 2008-07-08 2015-02-03 Oncomed Pharmaceuticals, Inc. Polynucleotides encoding Notch receptor antibodies
US8945874B2 (en) 2008-07-08 2015-02-03 Oncomed Pharmaceuticals, Inc. Polynucleotides encoding NOTCH1 receptor antibodies
US8980260B2 (en) 2008-07-08 2015-03-17 Oncomed Pharmaceuticals, Inc. Monoclonal antibody that binds human notch2 and notch3
US9499613B2 (en) 2008-07-08 2016-11-22 Oncomed Pharmaceuticals, Inc. Notch1 receptor binding agents and methods of use thereof
US9132189B2 (en) 2008-07-08 2015-09-15 Oncomed Pharmaceuticals, Inc. Notch1 binding agents and methods of use thereof
EP2849785A4 (fr) * 2012-05-16 2015-12-16 Oncomed Pharm Inc Procédés de traitement du cancer avec des anticorps notch2/3
JP2015517529A (ja) * 2012-05-16 2015-06-22 オンコメッド ファーマシューティカルズ インコーポレイテッド Ｎｏｔｃｈ２／３抗体によって癌を治療するための方法
WO2013173542A1 (fr) * 2012-05-16 2013-11-21 Oncomed Pharmaceuticals, Inc. Procédés de traitement du cancer avec des anticorps notch2/3
US9879083B2 (en) 2012-12-19 2018-01-30 Aveo Pharmaceuticals, Inc. Anti-Notch3 antibodies
US10745476B2 (en) 2012-12-19 2020-08-18 Aveo Pharmaceuticals, Inc. Anti-NOTCH3 antibodies
WO2014172653A3 (fr) * 2013-04-19 2015-01-08 Aveo Pharmaceuticals, Inc. Anticorps anti-notch1
WO2014172653A2 (fr) 2013-04-19 2014-10-23 Aveo Pharmaceuticals, Inc. Anticorps anti-notch1
US11142573B2 (en) 2016-04-29 2021-10-12 Aveo Pharmaceuticals, Inc. Anti-Notch3 antibody

Similar Documents

Publication Publication Date Title
US11725047B2 (en) Anti-GDF-15 antibodies
US8481688B2 (en) Anti-FGFR2 antibodies
US8829164B2 (en) Anti-ron antibodies
US20210171627A1 (en) Anti-notch3 antibodies
WO2012003472A1 (fr) Anticorps anti-notch1
WO2011156617A2 (fr) Anticorps anti-egfr
BR112015014768B1 (pt) Anticorpos anti-gdf15, seu método de produção, seu uso, e composição farmacêutica compreendendo os mesmos

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11734226

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11734226

Country of ref document: EP

Kind code of ref document: A1