WO2011142460A1 - Procédé de détection de la schizophrénie - Google Patents

Procédé de détection de la schizophrénie Download PDF

Info

Publication number
WO2011142460A1
WO2011142460A1 PCT/JP2011/061068 JP2011061068W WO2011142460A1 WO 2011142460 A1 WO2011142460 A1 WO 2011142460A1 JP 2011061068 W JP2011061068 W JP 2011061068W WO 2011142460 A1 WO2011142460 A1 WO 2011142460A1
Authority
WO
WIPO (PCT)
Prior art keywords
schizophrenia
rage
receptor
end product
gene
Prior art date
Application number
PCT/JP2011/061068
Other languages
English (en)
Japanese (ja)
Inventor
昌成 糸川
誠 新井
光弘 宮下
Original Assignee
財団法人東京都医学総合研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 財団法人東京都医学総合研究所 filed Critical 財団法人東京都医学総合研究所
Priority to JP2012514848A priority Critical patent/JP5840124B2/ja
Publication of WO2011142460A1 publication Critical patent/WO2011142460A1/fr

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/30—Psychoses; Psychiatry
    • G01N2800/302—Schizophrenia

Definitions

  • the present invention relates to a method for detecting schizophrenia and the like.
  • Schizophrenia is a major psychiatric disorder that represents psychiatry along with mood disorders. Lifetime morbidity is as high as 1%, and it belongs to “common diseases” as well as high blood pressure and diabetes. According to the 2008 patient survey by the Ministry of Health, Labor and Welfare, 22% of hospitalized patients by injury and illness category fall into mental and behavioral disorders, of which 187,400 are schizophrenia, schizophrenic type disorder and paranoid disorder Go up. In addition, schizophrenia, schizophrenia-type disorder, and delusional disorder have been reported as 66,500 in the breakdown of the number of outpatients, which is a very frequent disease. Therefore, the labor and productivity losses associated with the onset are greater than expected, and medical costs are said to be the same as for all respiratory diseases.
  • the Maillard reaction reported by L.C. Maillard is initiated by a non-enzymatic reaction between the amino group of the protein and the carbonyl group of the reducing sugar.
  • a reversible Schiff base is formed, and the Schiff base forms a stable Amadori compound by Amadori rearrangement.
  • advanced glycation end products (AGEs) and the like are formed through a plurality of reaction processes such as dehydration, oxidation, and rearrangement of the Amadori compound.
  • Such a state in which AGEs accumulate in a living body has been proposed as “carbonyl stress” (Patent Document 1: JP 2009-39088, Non-Patent Document 1: Miyata et al., Kidney Int. 55.
  • Non-patent Document 1 Non-patent Document 1
  • Vitamin B6 is one of the molecules that function in the carbonyl stress elimination system in vivo (Non-patent Document 2: Bohlender et al., Am J Physiol Renal Physiol 289: F645-59, 2005). In addition to vitamin B6, the carbonyl stress elimination system has a systemic system called GLO metabolism (Non-patent Document 3: Thornalley PJ. Mol Aspects Med. 14: 287-371, 1993). In recent years, it has been reported that GLO1 dysfunction is involved in multiple pathological conditions such as mood disorders, autism, anxiety disorders, and chronic alcoholism. However, sufficient research has been conducted on the relationship with AGEs accumulation. Not.
  • This invention aims at providing the detection method of schizophrenia.
  • the present inventor has intensively studied to solve the above problems. As a result, they found that the secreted glycated end product receptor is related to schizophrenia, and completed the present invention. That is, the present invention measures the amount of a glycation end product receptor [for example, membrane-bound (mRAGE) or soluble (sRAGE), etc.] in a biological sample and correlates the obtained measurement result with schizophrenia. This is a method for detecting schizophrenia. Further, the present invention measures the amount of a glycation end product receptor [for example, membrane-bound (mRAGE) or soluble (sRAGE)] in a biological sample, and correlates the obtained measurement result with schizophrenia. It is the evaluation method of the state of schizophrenia characterized by these.
  • a glycation end product receptor for example, membrane-bound (mRAGE) or soluble (sRAGE)
  • At least one selected from the group consisting of a genetic abnormality of the glyoxylase I gene, the amount of a protein modification of a carbonyl compound, and the amount of pyridoxal is combined with the amount of the receptor to associate schizophrenia Can do.
  • the schizophrenia condition include at least one selected from the group consisting of symptoms, progress and severity of schizophrenia.
  • An example of the protein modification product of the carbonyl compound is pentosidine.
  • the present invention is a pharmaceutical composition for treating schizophrenia comprising a glycation end product receptor or a gene encoding the receptor.
  • the present invention conducts a binding test between a glycation end product receptor and a glycation end product in the presence of a test substance (candidate substance), and selects a substance that inhibits binding as a substance that can be used for the treatment of schizophrenia.
  • a screening method for a substance for treating schizophrenia is a pharmaceutical composition for treating schizophrenia, comprising a substance obtained by the above screening method.
  • the present invention is a pharmaceutical composition for treating schizophrenia comprising an inhibitor of a glycation end product receptor.
  • the inhibitor of a glycation end product receptor include a compound that promotes down-regulation of the receptor, a substance that inhibits the action of the receptor blocker, or a glycation end product.
  • a method for detecting schizophrenia can be provided.
  • schizophrenia can be detected or examined in more detail, and early diagnosis and early prevention methods can be established.
  • clinical application is possible for intractable cases, and tailor-made medical care can be provided according to individual pathological conditions.
  • FIG. 3 is a diagram showing the nucleotide sequence and primer design of a region containing exons 6 to 8 encoding RAGE. It is a figure which shows the fall of esRAGE in the sample which has the variant of AGER variants. It is a figure which shows eight classification
  • the present invention is a soluble glycation end product receptor or membrane-bound glycation end product that functions in the direction of reducing advanced glycation end products (AGEs) (functions as an elimination system).
  • AGEs advanced glycation end products
  • the present invention relates to a method for detecting schizophrenia using a product receptor as an index.
  • Pentosidine levels (mean: 68.4 ng / ml) in patients with schizophrenia reached about 1.7 times that of healthy subjects (mean: 39.6 ng / ml).
  • pentosidine accumulation in cases has been shown to be associated with schizophrenia.
  • GLO1 glyoxalase I
  • GLO1 glyoxalase I
  • Vitamin B6 reduction in patients with schizophrenia Vitamin B6 plays an important role in various physiological functions by being interconverted into pyridoxine, pyridoxal, and pyridoxamine in vivo.
  • the inventor found a significant decrease in vitamin B6 concentration (24.4%, 11/21 cases) in addition to the finding of pentosidine accumulation in schizophrenic patients. This phenomenon was thought to be the result of pyridoxamine, which is capable of eliminating carbonyl stress, being mobilized and depleted to suppress carbonyl stress.
  • GLO1 metabolism interacts with various blood dynamics such as antioxidants, vitamins, and amino acids to contribute to the maintenance of homeostasis, and the functional breakdown of their molecular network is a pathology of schizophrenia (Krebs MO, et al. Trends Mol Med. 15 (12): 562-70, 2009).
  • GLO1 gene In order to explore the molecular basis of carbonyl stress in schizophrenic patients, genetic analysis of the GLO1 gene using DNA provided by 3,682 subjects including 1,761 schizophrenic patients revealed a rare frameshift. Fourteen mutations and missense mutations were identified. In schizophrenic patients and healthy individuals with heterozygous frameshift mutations, GLO1 mRNA, protein expression, and enzyme activity decreased to about 50%, and plasma pentosidine levels showed a significant increase of 80.9 ng / ml on average, Vitamin B6 level was markedly lowered to 3.6 ng / ml. In addition, about 15-20% reduction in enzyme activity was observed in schizophrenic patients with missense mutations as homozygotes, and plasma pentosidine accumulation and vitamin B6 reduction were observed.
  • the C-terminal deletion type is a soluble glycation end product receptor, and the soluble type includes (i) endogenous secretory RAGE (endogenous secretary RAGE (esRAGE), and (ii) full-length type RAGE.
  • endogenous secretory RAGE endogenous secretary RAGE (esRAGE)
  • esRAGE endogenous secretary RAGE
  • full-length type RAGE There is a truncated RAGE (metalloproteinase-cleaved RAGE) that has undergone shedding by a matrix metalloprotease.
  • sRAGE metalloproteinase-cleaved RAGE
  • sRAGE has an AGEs-binding region and lacks a transmembrane region, so it is secreted outside the cell and activates intracellular signal activation through AGE-RAGE binding.
  • the present inventor is a secreted endogenous glycation end product receptor that functions as an elimination system for advanced glycation end products (AGEs) in carbonyl stress schizophrenia without Glyoxalase I (GLO1) gene mutation (esRAGE))
  • GLO1 Glyoxalase I
  • esRAGE carbonyl stress schizophrenia without Glyoxalase I
  • the genetic factor of the RAGE gene is related to the decrease in secretory esRAGE. Therefore, in the present invention, a new development of a method for detecting and diagnosing schizophrenia by the amount of secreted esRAGE and a membrane-bound (full-length) RAGE genotype and a therapeutic method by supplementing secreted esRAGE is expected. it can.
  • the present inventor has identified a frameshift mutation in a gene encoding the neutralizing enzyme GLO1 of AGEs from a proband of multiple families, and AGEs (pentosidine) in the peripheral blood of cases is about 3.7 times the wild type. It increased (carbonyl stress) and found that vitamin B6, a scavenger of AGEs IV, was significantly reduced.
  • dopamine receptors and acetylcholine receptors when dopamine and acetylcholine (ligand) are bound, emit a receptor signal to cause a physiological action that excites dopamine neurons and acetylcholine neurons. It is regulated so that neuronal excitement does not occur more than necessary even if it increases (desensitization).
  • dopamine receptor desensitization is impaired, so that dopamine signal runaway (enhancement) occurs and auditory hallucinations are heard.
  • RAGE originally has a physiological function that emits an immune response signal as a receptor when infectious bacteria enter. Therefore, RAGE, like other receptors, is considered to have a desensitizing function in order to prevent immune overresponse. It is not the original physiological action that AGE binds to RAGE to cause RAGE response, but excess AGE is present in 46.7% of schizophrenia. Therefore, even in schizophrenic patients, it is considered that RAGE is decreased (has a negative correlation) due to desensitization.
  • thiazolidinedione is exemplified as a compound that promotes down-regulation of RAGE (Marx et al., Diabetes 53: 2662-2668, 2004), and low molecular weight heparin (Myint KM. Et al., Diabetes. 2006 Sep; 55 (9): 2510-22), ⁇ -lipoic acid (Bierhaus A. et al., Diabetes. 1997 Sep; 46 (9): 1481-90), phenylpyrrole derivatives and the like.
  • Substances that inhibit AGE action include Candesartan or Olmesartan (Qiuling F. et.al., Nephrol Dial Transplant (2004) 19: 3012-3020; Fujita M.
  • “Inhibiting AGE action” refers to, for example, causing suppression of RAGE expression and suppression of NFkB and VCAM1, which are downstream signals of RAGE, via endothelial cells.
  • Aminoguanidine (Thornalley PJ., Arch Biochem Biophys 419: 31-40, 2003), OPB-9195 (Miyata et al., J Am Soc Nephrol 11: 1719-1725, 2000; Nakamura et al., Am J Kidney Dis 41: S68-S71, 2003), ALT-946 (Forbes et al., Diabetologia 44: 108-114, 2001), Alagebrium (Susic et al., Curr Opin Cardiol 19: 336-340, 2004), N-phenacylthiazolium bromide (Cooper et al., Diabetologia 43: 660-664, 2000) also inhibits AGE action by suppressing AGE formation.
  • sRAGE has an AGE binding region but lacks a transmembrane region, so it is secreted extracellularly and inhibits AGE action. Therefore, sRAGE, preferably esRAGE, can be a therapeutic drug for schizophrenia.
  • RAGE and sRAGE can be used as clinical markers of schizophrenia, and by measuring the amount of RAGE or sRAGE in a biological sample, the measurement result is used as an index. Schizophrenia can be detected.
  • the biological sample is not particularly limited.
  • biological components such as blood and blood components (serum, plasma, blood cells, etc.), urine, spinal fluid, saliva, tears, sweat, etc.
  • a solid component derived from a living body such as a part of tissue excised by hair, biopsy or the like. Blood or blood components are preferable, and serum or plasma is particularly preferable.
  • the sample adjusted by adding a certain process can also be used as the object of the biological sample of this invention.
  • the amount of glycation end product receptor (mRAGE or sRAGE) can be measured if the method has sufficient detection sensitivity and measurement accuracy for the receptor.
  • a known analysis method or immunological method can be employed.
  • HPLC method etc. are mentioned as an analytical method
  • ELISA method, RIA method, Sandwich ELISA method etc. are mentioned as an immunological measuring method.
  • the measurement target may be either mRAGE or sRAGE, preferably sRAGE, and more preferably esRAGE.
  • the average value of esRAGE in patients with schizophrenia is approximately 0.23 ng / mL, which is approximately 0.72 times the average level of healthy subjects, approximately 0.32 ng / mL (P ⁇ 0.01, statistical The difference is more than 99.9%).
  • the level of esRAGE in patients with schizophrenia is less than or equal to 0.19 ng / ml (average of healthy individuals -1SD), more preferably 0.06 ng / mL (average of healthy individuals -2SD) Can be associated with schizophrenia.
  • the ratio (Test / Control) between the esRAGE amount (Test) in the test sample derived from a schizophrenia patient and the esRAGE amount (Control) in the test sample derived from a healthy person is 0.72 or less (for example, Test average value: 0.2308 / Control average value: 0.3199), preferably 0.48 or less (for example, Test average value -0.5SD: 0.1551 / Control average: 0.3199), more preferably 0.25 or less (for example, Test average value -1SD: 0.2308 / Control average value: 0.3199) is judged positive for detection of schizophrenia, and 0.72 or more (for example, Test average value: 0.2308 / Control average value: 0.3199) If so, it can be determined as a false positive.
  • schizophrenia can be detected using the amount of mRNA of a glycation end product receptor (such as mRAGE or sRAGE) as an index.
  • Measurement of mRNA can be performed by, for example, RT-PCR, Real-time PCR, microarray, or the like. And the judgment whether it is schizophrenia should just compare with the mRNA expression level derived from a healthy subject.
  • NM_001136 Homo sapiens, advanced glycosylation end product-specific receptor, transcript variant 1, mRNA
  • NM_172197 Homo sapiens, advanced glycosylation end product specific receptor, mRNAs
  • AB061669 Homo sapiens, mRNA for N-terminal truncated form of receptor for advanced glycation endproducts
  • the mRAGE level of a schizophrenic patient can be set by statistical processing in the same manner as the schizophrenia determination criterion setting method using the esRAGE concentration as an index.
  • the level of mRAGE or sRAGE may be measured using the biological tissue sample derived from several patients. Therefore, the mRAGE or sRAGE amount is measured in a predetermined number of schizophrenic patients (primary population), and the obtained measurement values are used as basic data, and the basic data and individual detection targets. The amount of mRAGE or sRAGE derived from a biological sample derived from a subject can be compared.
  • the mRAGE or sRAGE level is included in the population value and data processing is performed again (eg, averaging), and the target patient (population)
  • data processing is performed again (eg, averaging)
  • the target patient population
  • the number of examples can also be increased. By increasing the number of cases, the accuracy of the critical value of RAGE or sRAGE can be increased, and the detection or diagnosis accuracy of schizophrenia can be increased by appropriately correcting the critical value as occasion demands.
  • the detection result can be, for example, main data or auxiliary data when performing a definitive diagnosis of schizophrenia.
  • other test results such as carbonyl compound modification levels, pyridoxal (vitamin B6) levels, and GLO gene abnormalities It may be determined comprehensively in combination with at least one selected from the following (described later).
  • mutation of membrane-bound mRAGE gene (NM_001136) (SEQ ID NO: 1) or its corresponding amino acid sequence (SEQ ID NO: 2) is used as a glycation end product receptor gene.
  • NP_001127 esRAGE gene
  • SEQ ID NO: 3 mutation or its corresponding amino acid sequence (SEQ ID NO: 4) (AAX07273) mutation, and the like can be used to detect schizophrenia.
  • These mutations and the like can be used as main data or auxiliary data when performing a definitive diagnosis of schizophrenia.
  • the detection or diagnosis accuracy of schizophrenia can be improved by taking into account mutations other than those described above.
  • the following mutations can be used in the present invention.
  • the state of schizophrenia means the presence or absence of positive or negative symptoms, progress, or generalized life scale (GAF) among schizophrenia.
  • GAF generalized life scale
  • one of these schizophrenia states may be selected, or a plurality thereof may be selected in appropriate combination.
  • To evaluate the symptoms of schizophrenia determine whether the patient is resistant to treatment or a PANSS severity rating scale.
  • Positive symptoms include delusions, conceptual integration disorders, hallucinatory behaviors, excitement, hype, suspicion, and hostility. Judgment is based on whether or not one of these is true. Negative symptoms include flattened emotions, emotional withdrawal, communicative disability, social withdrawal due to passive / motivated, difficulty in abstract thinking, lack of spontaneous and fluent speech, regularity Thinking, etc. are listed, and judgment is made based on whether or not at least one of them is applicable.
  • the progression of schizophrenia is judged as mild when the GAF is 70 or more, and severe when the GAF is less than 30.
  • the symptom evaluation of schizophrenia is judged as severe when the total of PANSS P score + N score is 72 points or more, and is judged as mild when the total of PANSS P score + N score is less than 24 points.
  • esRAGE clearly shows a low value for schizophrenia compared to healthy individuals. That is, in one embodiment of the method of the present invention, it is possible to determine whether or not the patient has schizophrenia with esRAGE as an index with extremely high accuracy.
  • mRAGE or sRAGE protein modifications of carbonyl compounds such as pentosidine, pyridoxal and GLO1 gene mutation
  • the order of combination is not limited. For example, pentosidine in plasma is first measured, and subjects are classified into a high pentosidine group and a normal pentosidine group with a predetermined critical value as a boundary. Next, the amount of sRAGE (for example, esRAGE) is measured, and subjects are classified into a low value group and a normal group with a predetermined critical value as a boundary.
  • sRAGE for example, esRAGE
  • pyridoxal levels are measured and classified into low and normal groups.
  • pentosidine, esRAGE and pyridoxal when used as an index, it can be classified into a total of 8 types of schizophrenia by dividing into a high or low value group and a normal group, and each disease state can be evaluated. (Table 1).
  • pathological conditions 1 to 8 indicate the severity of schizophrenia and can be classified as follows.
  • Pathology 1 PANSS P score + N score is 84 points or more Pathology 2: PANSS P score + N score is 72 points or more and less than 84 points Pathology 3: PANSS P score + N score is 60 points More than 72 points Pathology 4: PANSS P score + N score is 48 points or more and less than 60 points Pathology 5: PANSS P score + N score is 36 points or more and less than 48 points Pathology 6: PANSS P score + N score is 24 or more and less than 36.
  • Pathology 7 PANSS P score + N score is 14 or more and less than 24.
  • Pathology 8 PANSS P score + N score is 14 points.
  • the treatment policy can be determined accordingly. For example, since pathological conditions 1 to 4 belong to the treatment resistance group, conventional schizophrenia ameliorating drugs are often not effective, and it is necessary to examine another treatment method, whereas pathological conditions 5 to 8 It is more likely that treatment will be effective, reducing the burden on the patient.
  • the target carbonyl compound includes arabinose, GO, MGO, 3-DG, glycolaldehyde, dehydroascorbic acid, hydroxynonenal, malondialdehyde, acrolein, 5-hydroxymethylfurfural, formaldehyde, Acetaldehyde, repric acid, furfural, etc. can be mentioned. These amounts can usually be measured by performing instrumental analysis such as high performance liquid chromatography (HPLC) or gas chromatography / mass spectrometry (GC / MS) using standard products of known concentrations.
  • HPLC high performance liquid chromatography
  • GC / MS gas chromatography / mass spectrometry
  • AGEs protein modifications (for example, “AGEs”) (hereinafter referred to simply as “AGEs”) produced by the reaction of these carbonyl compounds with biological proteins are also analyzed using standard products of known concentrations. And can be measured by instrumental analysis such as GC / MS. AGEs are an aggregate of a plurality of structures (AGEs structures). Therefore, AGEs can be measured by measuring the AGEs structure.
  • the AGEs structure includes pentosidine, croslin, pyropyridine, vesperlidine A, B, C, glyoxal-lysine dimmer (GOLD), methylglyoxal-lysine dimmer (MOLD) (above, fluorescent substance), N ⁇ - (carboxymethyl) lysine ( CML), N ⁇ - (carboxyethyl) lysine (CEL), argpyrimidine, pyralin, imidazolone, GA-pyridine (non-fluorescent substance), and the like. Pentosidine is preferable.
  • Pentosidine has a structure in which pentose, equimolar lysine and arginine are cross-linked, and is a fluorescent substance stable to acid hydrolysis. It is known to accumulate in human skin in correlation with aging and the onset of diabetes, and it has been reported to increase especially in the onset of diabetes and end-stage nephropathy. Pentosidine contained in proteins such as blood can be quantified by HPLC after acid hydrolysis using the fluorescence (Ex: 335 nm, Em: 385 nm) as an index. Pentosidine can be quantified using an immunochemical method using a monoclonal antibody against pentosidine (for example, ELISA, particularly sandwich ELISA or competitive ELISA).
  • a monoclonal antibody against pentosidine for example, ELISA, particularly sandwich ELISA or competitive ELISA.
  • the monoclonal antibody and polyclonal antibody with respect to pentosidine can be prepared in accordance with a conventional method, they can also be obtained commercially easily (for example, (transgenic), Fushimi Pharmaceutical, etc.).
  • carboxymethyl lysine which is an AGEs structure, and antibodies against protein modifications of malondialdehyde and hydroxynonenal are also commercially available.
  • a specimen (plasma) pretreated with proteolytic enzyme and a standard AGEs structure are added to a microplate on which an AGEs structure such as pentosidine is immobilized, and an antibody against the AGEs structure is added and reacted. Then, after washing, the enzyme solution can be added and washed again, and a color former can be added to measure the absorbance.
  • This method is a method defined as a blood chemistry test for pentosidine, and can be carried out simply by using a quantitative kit such as “FSK Pentosidine” (product name) (Fushimi Pharmaceutical Co., Ltd.).
  • the amount of AGEs such as pentosidine accumulated in the skin can be easily measured using a commercially available AGE-Reader device (Diagn-Optics).
  • the test method of the present invention measures the amount of pyridoxal in a biological sample of a subject by the above method, and then compares the measured value with the corresponding amount (control amount) in a healthy person. This can be done by evaluating. In this case, the judgment that the subject is suffering from schizophrenia or has a high risk of developing it in the future can be used as an indicator that the subject's pyridoxal amount is lower than the control amount.
  • the serum concentration of pyridoxal in healthy subjects is 6.0-40.0 ng / ml for men and 4.0-19.0 ng / ml for women.
  • Pyridoxal levels are linked to homocysteine levels, and homocysteine levels tend to increase as pyridoxal levels decrease. For this reason, when measuring the amount of pyridoxal, the amount of homocysteine may be measured together to confirm the accuracy and accuracy of the measured value of the amount of pyridoxal. In this case, if the subject's pyridoxal level is lower than the control level and the subject's homocysteine level is higher than the healthy person's homocysteine level (control level), then the subject is suffering from schizophrenia, or There is a high probability that there is a high risk of developing it in the future.
  • the amount of homocysteine can be measured according to a conventional method. For example, it can usually be measured by performing instrumental analysis such as HPLC or GC / MS using a standard product having a known concentration.
  • the serum concentration of homocysteine in healthy individuals is 3.7-13.5 nmol / ml.
  • Glyoxylase gene abnormality A glyoxylase I gene (also referred to as GLO-I gene) gene abnormality may be present, and a test for measuring a glyoxylase I gene abnormality in advance may be performed. You may be a person.
  • the target glyoxylase I gene abnormality means a gene abnormality that results in a decrease in glyoxylase I activity, such as a deficiency in glyoxylase I or a poor expression of glyoxylase I.
  • at least one allele of the glyoxylase I gene is point-mutated (glyoxylase I gene coding region base sequence (NM_006708) (SEQ ID NO: 5) between positions 79 and 80.
  • the amount of carbonyl compound protein modifications (AGEs) and pyridoxal, which are used as indicators for examination in the present invention varies depending on the presence or absence of renal dysfunction, diabetes or inflammation. Therefore, the subject is preferably a person who does not have at least renal dysfunction, diabetes and inflammation.
  • the genetic abnormality of the GLO-I gene targeted by the present invention is a genetic abnormality that results in a decrease in GLO-I activity, such as deficiency of glyoxylase I (GLO-I) or poor expression of GLO-I.
  • GLO-I glyoxylase I
  • at least one allele of the nucleotide sequence of the coding region of the GLO-I gene is point-mutated (between adenine at position 79 and cytosine at position 80).
  • Adenine insertion resulting in a frame-shifted gene abnormality, and a nucleotide substitution mutation that causes a homozygous mutation (Glu ⁇ Ala) of the 111th amino acid in the amino acid sequence of GLO-I (SEQ ID NO: 6)
  • Glu ⁇ Ala a homozygous mutation of the 111th amino acid in the amino acid sequence of GLO-I
  • the blood GLO-I activity is about 50% lower than that in a healthy person.
  • the blood GLO-I activity is in a healthy person. It has been confirmed that it is about 15 to 20% lower than that of JP-A-2009-39088.
  • the gene abnormality is detected by (i) a method in which PCR is performed in a region containing a gene abnormality and detected by the SSCP method, (ii) PCR is performed in a region containing the gene abnormality, and a restriction enzyme for the PCR product is detected.
  • compositions of the present invention can exert an excellent effect on the treatment of schizophrenia, and a gene encoding sRAGE or sRAGE or a RAGE inhibitor is an active ingredient for the treatment of schizophrenia.
  • the present invention provides a pharmaceutical composition for treating schizophrenia containing the aforementioned sRAGE, a gene encoding sRAGE, or a RAGE inhibitor. Therefore, the present invention provides a method for treating schizophrenia, which comprises administering sRAGE, a gene encoding sRAGE, or a RAGE inhibitor to a schizophrenic patient.
  • sRAGE or a gene encoding sRAGE may be a pharmaceutically acceptable salt or It can be used in the state of a hydrate or the like, and may be used in a state that has been subjected to appropriate chemical modification in consideration of storage stability as a therapeutic agent, and is not particularly limited.
  • the sRAGE used as an active ingredient of the pharmaceutical composition of the present invention is as follows.
  • esRAGE protein full length or partial fragment of the amino acid sequence represented by SEQ ID NO: 4.
  • a partial fragment having the amino acid sequence shown in SEQ ID NO: 4 and having binding activity with AGEs can be used.
  • the metalloproteinase-cleaved RAGE has the amino acid sequence from 1 to 315 in the amino acid sequence of the esRAGE protein (SEQ ID NO: 4).
  • the amino acid sequence of sRAGE refers to the amino acid sequence shown in SEQ ID NO: 4 or the amino acid sequence from 1 to 315 of the amino acid sequence shown in SEQ ID NO: 4.
  • the binding activity with AGEs can be measured by a reporter gene assay system, an immunological assay, or the like (details will be described later).
  • esRAGE gene full length or partial fragment of the base sequence shown in SEQ ID NO: 3.
  • the partial fragment has the base sequence shown in SEQ ID NO: 3 and, when translated, has a binding activity to AGEs (for example, the region from 11 to 1054 in the base sequence shown in SEQ ID NO: 3 (coding region)) Can be used.
  • the metalloproteinase-cleaved RAGE gene has the 1st to 955th base sequence of the base sequence of the esRAGE gene (SEQ ID NO: 3) or the 11th to 955th base sequence as a coding region.
  • the above sRAGE mutant can also be used.
  • “Mutant” refers to a protein having an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of sRAGE and having sRAGE activity, or in the amino acid sequence of sRAGE. It means a protein having at least 80% homology and having sRAGE activity.
  • the mutant form of sRAGE is about 80% or more, preferably 90% or more, more preferably about 80% or more of the amino acid sequence shown in SEQ ID NO: 4 or its amino acid sequence Nos. 1 to 315, or the amino acid sequence of these partial peptides.
  • examples thereof include an amino acid sequence having 95% or more, more preferably about 98% or more homology, and having sRAGE activity.
  • Homology can be performed using a homology search site using the Internet.
  • homology searches such as FASTA, BLAST, and PSI-BLAST can be used in Japan DNA Data Bank (DDBJ).
  • DDBJ Japan DNA Data Bank
  • one or more (for example, one) in the amino acid sequence shown in SEQ ID NO: 4 (or the amino acid sequence of Nos. 1 to 315 thereof) Or an amino acid sequence in which a mutation such as deletion, insertion, substitution or addition, or a combination mutation thereof has occurred in a few amino acids, and an amino acid sequence of a protein having sRAGE activity.
  • ⁇ ⁇ ⁇ ⁇ 1 to 10 (preferably 1 to 5) of the above sRAGE amino acid sequence (amino acid sequence shown in SEQ ID NO: 4, amino acid sequence 1 to 315 of SEQ ID NO: 4, or a partial peptide thereof) (Preferably 1 to 3) amino acid sequences deleted, and (ii) 1 to 10 (preferably 1 to 5, more preferably 1 to 3) amino acids in the amino acid sequence of sRAGE Added amino acid sequence, (iii) amino acid sequence in which 1 to 10 (preferably 1 to 5, more preferably 1 to 3) amino acids are inserted into the amino acid sequence of sRAGE, (iv) in the amino acid sequence of sRAGE An amino acid sequence in which 1 to 10 amino acids (preferably 1 to 5, more preferably 1 to 3 amino acids) are replaced with other amino acids, (v) an amino acid sequence combining (i) to (iv) above Etc.
  • sRAGE activity refers to the activity of capturing AGEs in vivo and suppressing AGEs-RAGE signaling, that is, sRAGE binds to AGEs that are ligands and competes with RAGE receptors on the cell membrane surface. And the activity of suppressing the cellular response by AGEs-RAGE signaling, which is substantially equivalent to the activity of the protein having the amino acid sequence shown in SEQ ID NO: 4, such as 50% or more, more preferably 90%. It means having activity of more than%.
  • SRAGE activity can be measured using, for example, an affinity chromatography method (AGE binding Assay) (Yonekura et al., Biochem J.; 15; 370 (Pt 3): 1097-1109, 2003) Biacore method.
  • affinity chromatography method AGE binding Assay
  • a polynucleotide encoding sRAGE for example, the base sequence shown in SEQ ID NO: 3 or the sequence of its coding region, the base sequence encoding the metalloproteinase cleavage type or the coding region thereof Hybridizes under stringent conditions to a sequence (numbers 1 to 955 or 11 to 955 of SEQ ID NO: 3), or a partial sequence thereof, or a sequence complementary to these sequences or partial sequences; and A polynucleotide encoding a protein having sRAGE activity is included.
  • stringent conditions include, for example, “2 ⁇ SSC, 0.1% SDS, 50 ° C.”, “2 ⁇ SSC, 0.1% SDS, 42 ° C.”, “1 ⁇ SSC, 0.1%
  • “2 ⁇ SSC, 0.1% SDS, 65 ° C.”, “0.5 ⁇ SSC, 0.1% SDS, 42 ° C.”, “0.2 ⁇ SSC, 0.1% SDS, The conditions such as “65 ° C.” can be mentioned.
  • a person skilled in the art can appropriately set conditions such as DNA concentration, length of DNA, reaction time, etc. in addition to such conditions as salt concentration and temperature of the buffer.
  • the polynucleotide to be hybridized is at least 70%, preferably 80%, more preferably 90% (for example, 95%) with respect to the base sequence encoding sRAGE or a partial sequence thereof, or a base sequence complementary thereto.
  • a polynucleotide containing a base sequence having the identity of 99% or more can be mentioned.
  • proteins and genes can be obtained by ordinary genetic engineering techniques or from known databases using, for example, nucleic acid synthesis, peptide synthesis, and gene expression techniques using microorganisms (Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989) etc.).
  • the target protein can also be produced using a cell-free protein synthesis system that does not use any living cells.
  • a cell-free protein synthesis can be performed using a commercially available kit. Examples include reagent kits PROTEIOS TM (Toyobo), TNT TM System (Promega), synthesizer PG-Mate TM (Toyobo), RTS (Roche Diagnostics) and the like.
  • the target protein can be purified by appropriately selecting means such as chromatography.
  • the RAGE inhibitor used as an active ingredient of the pharmaceutical composition of the present invention includes a compound that promotes down-regulation of RAGE, a RAGE blocker, a substance that inhibits AGE action, and the like.
  • examples of compounds that promote RAGE down-regulation include thiazolidinediones (Marx et al., Diabetes 53: 2662-2668, 2004), and RAGE blockers such as low molecular weight heparin (Myint KM. Et al., Diabetes. 2006). Sep; 55 (9): 2510-22), ⁇ -lipoic acid (Bierhaus A. et al., Diabetes. 1997 Sep; 46 (9): 1481-90), phenylpyrrole derivatives and the like.
  • phenylpyrrole derivative examples include 2-phenylpyrrole, 3-phenylpyrrole, and the like, but the phenylpyrrole derivative described in JP-A-2009-46403 can also be used.
  • Candesartan or Olmesartan Qiuling F. et.al., Nephrol Dial Transplant (2004) 19: 3012-3020; Fujita M.
  • a pharmaceutically acceptable salt is not particularly limited as long as it has a therapeutic or ameliorating effect on schizophrenia and is pharmaceutically acceptable.
  • hydrohalide eg, hydrofluoride, hydrochloride, hydrobromide, hydroiodide
  • inorganic acid salt eg, sulfate, nitrate, perchlorate
  • organic carboxylates eg acetate, oxalate, maleate, tartrate, fumarate, citrate, etc.
  • organic sulfonates eg Methanesulfonate, trifluoromethanesulfonate, ethanesulfonate, benzenesulfonate, etc.
  • amino acid salts eg aspartate, glutamate, etc.
  • quaternary amine salts alkali metal salts (eg sodium salt, potassium) Salts), and alkaline earth metal salts
  • alkali metal salts e
  • the pharmaceutical composition of the present invention can contain other components in addition to sRAGE and RAGE inhibitor.
  • the other components include various pharmaceutically acceptable components (such as various pharmaceutically acceptable carriers) required depending on the usage (form of use) of the pharmaceutical composition.
  • Other components can be appropriately contained within a range in which the effect exhibited by sRAGE is not impaired.
  • the blending ratio of sRAGE and the types and blending ratios of other components can be appropriately set according to known methods for preparing a therapeutic drug for schizophrenia. .
  • compositions of the present invention are carriers generally used in drug production, such as excipients, fillers, extenders, diluents, binders, wetting agents, disintegrants, lubricants, surfactants, dispersants, buffers.
  • composition By using one or more of such carriers, pharmaceuticals in the form of tablets, pills, powders, granules, injections, solutions, capsules, troches, elixirs, suspensions, emulsions or syrups, etc.
  • a composition can be prepared. These pharmaceutical compositions can be administered orally or parenterally.
  • various excipients such as microcrystalline cellulose, sodium citrate, calcium carbonate, dipotassium phosphate and glycine can be used together with a disintegrant, a binder and the like.
  • the disintegrant include starch, alginic acid, and certain types of silicate double salts.
  • the binder include polyvinylpyrrolidone, sucrose, gelatin, and gum arabic.
  • lubricants such as magnesium stearate, sodium lauryl sulfate, and talc are very effective for tablet formation.
  • an emulsifier and a suspending agent may be used in combination, if necessary, and used together with water, ethanol, propylene glycol, glycerin, etc., and diluents that combine them.
  • Other forms for parenteral administration include injections that contain one or more active substances and are prescribed by conventional methods.
  • an injection it can be produced by dissolving or suspending sRAGE at a predetermined concentration in a pharmaceutically acceptable carrier such as physiological saline or commercially available distilled water for injection.
  • a pharmaceutically acceptable carrier such as physiological saline or commercially available distilled water for injection.
  • the injection thus prepared can be administered once to several times per day for schizophrenic patients requiring treatment.
  • the dose can be appropriately set depending on the weight and symptoms of the patient and the individual administration route.
  • the dose may vary depending on the sensitivity of the patient to be treated, the way the drug is prescribed, the period of administration, and the interval between administrations. In some cases, the dose may be higher or lower than the set range (described later). The amount may be appropriate.
  • parenteral administration examples include intravenous injection, subcutaneous injection, and intradermal injection, and intravenous injection is preferable.
  • injections can be prepared as non-aqueous diluents (for example, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol), suspensions, or emulsions.
  • non-aqueous diluents for example, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol
  • suspensions or emulsions.
  • Such sterilization of the injection can be performed by filtration sterilization through a bacteria-retaining filter, blending of a bactericidal agent, or irradiation.
  • the injection is made into a sterile solid composition by freeze-drying method or the like, and can be used as a form of preparation for use by dissolving in sterile distilled water for injection or other solvent before use.
  • SRAGE can exert various excellent effects on the treatment of schizophrenia and can be used as an active ingredient of a gene therapy preparation for schizophrenia. That is, the present invention provides a pharmaceutical composition for treating schizophrenia containing the sRAGE gene.
  • a method of administering a vector in which a nucleic acid is incorporated may be mentioned.
  • the vector include adenovirus vectors, adeno-associated virus vectors, herpes virus vectors, vaccinia virus vectors, retrovirus vectors, and lentivirus vectors. It can administer efficiently by using these viral vectors.
  • a commercially available gene transfer kit (for example, product name: Adeno Express, manufactured by Clontech) can also be used.
  • the pharmaceutical composition of the present invention when used as a gene therapy agent, it is also possible to introduce the composition into a phospholipid vesicle such as a liposome and administer the vesicle.
  • a phospholipid vesicle such as a liposome
  • an endoplasmic reticulum holding the sRAGE gene is introduced into a predetermined cell by the lipofection method. Then, the obtained cells are administered, for example, intravenously or intraarterially.
  • the dose for oral administration is 1 mg to 1000 mg per person per day, preferably 10 mg to 500 mg.
  • parenteral administration including gene therapy agent
  • 100 ⁇ g / day per person is used.
  • Screening method comprises a step of detecting a binding between AGE and RAGE in the presence of a test substance and selecting a substance that inhibits the binding between AGE and RAGE.
  • test substance to be screened are not particularly limited, but are preferably compounds having affinity for AGE or RAGE. “Having affinity” means that a test substance binds to AGE or RAGE with a specific dissociation constant.
  • test substance examples include compounds derived from natural or synthetic low molecular compound libraries, gene library expression products (peptides, proteins, etc.), natural or synthetic oligonucleic acids, natural or synthetic peptide libraries. Derived from peptides, antibodies, bacteria-derived substances (substances released by metabolism from bacteria, etc.), microorganisms, plant cell extracts, animal cell extracts, culture solutions (culture supernatants of microorganisms, plant cells, animal cells, etc.) Examples include compounds, compounds in soil, compounds included in random phage peptide display libraries, and the like. These compounds may be novel compounds or known compounds. Furthermore, as the test substance, a compound that has been appropriately modified or mutated by chemical, physical, or biochemical means can be used. Further, the test substance may be a compound identified by a pharmacophore search or a structure comparison program using a computer. Furthermore, candidate substances, especially compounds, may form salts and hydrates.
  • the screening method of the present invention can be carried out using cells that produce AGE or RAGE, or cell preparations of these cells, and AGE or RAGE can also be used in a purified form.
  • Examples of the “cell preparation” include cell cultures, cultured cell disruptions, cytoplasm fractionated from cultured cells, organelles such as nuclei, and the like.
  • Examples of AGE or RAGE-producing cells include endothelial cells, pericytes, and A549 cell lines, and these cells are expressed by introducing at least one of the AGE gene or RAGE gene. May be. Gene transfer methods are well known in the art and can be easily performed (Sambrook et al.,, Molecular Cloning, A Laboratory Manual 2nd ed., (Cold Spring Harbor Laboratory Press (1989)).
  • the step of detecting the binding between AGE and RAGE or the signal transduction activity of RAGE can be measured using a reporter gene assay system as an index.
  • a reporter gene is a marker gene that is incorporated into DNA to examine the transcriptional activity of promoters and enhancers, and is not particularly limited as long as it can measure the expression level thereof. Those that can be quantified are preferred. Examples of reporter genes include luciferase gene, CAT (chloramphenicol acetyltransferase) gene, ⁇ -Gal ( ⁇ -galactosidase) gene, GFP (green fluorescent protein) gene, and GUS ( ⁇ -glucuronidase) gene. It is done.
  • reagent for detecting the reporter gene product necessary reagents are selected from a substrate for detecting the reporter product, a cell fixing solution, a cell lysate, and a buffer for diluting the sample.
  • the substance obtained by the screening method of the present invention can be used as a pharmaceutical composition for treating schizophrenia.
  • the pharmaceutical composition the above-mentioned section “5.
  • Pharmaceutical composition” can be referred to.
  • the underlined portion indicates the primer design location
  • the capital letter notation indicates the exon region
  • “g” surrounded by a frame indicates the polymorphism.
  • the primer for gene analysis was designed after optimizing PCR conditions based on the NM_001136 sequence [Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 1, mRNA] (Fig. 1). .
  • Primer sequences and PCR conditions are as follows. Forward primer (RAGEex9,10-F1v2): tcacctgaggtagggagttc (SEQ ID NO: 7) Reverse primer (RAGEex9,10-R1): gaacgacaacgtgccgcatt (SEQ ID NO: 8) PCR was performed using a reaction solution having the following composition and cycle conditions (Table 2).
  • esRAGE was lower in the high PEN group than in the normal PEN group (Fig. 3).
  • the esRAGE of schizophrenia without pentosidine accumulation (Fig. 4, "Norm PEN GLO1 Glu / Glu”) was not significantly different from that of healthy controls, but schizophrenic patients with pentosidine accumulation (Fig. 4).
  • “High PEN GLO1 Glu / Glu”) a case with no GLO1 mutation (Glu / Glu type) showed a more significant decrease in esRAGE (P ⁇ 0.05).
  • the decrease in esRAGE was more prominent in the case of heterozygotes with a GA genotype of RGAEc.992-6G> A (P ⁇ 0.01).
  • a fluorescent dye for example, using Cy3 and Cy5
  • Serum concentrations of (iv) esRAGE were significantly positively correlated with Accession Nos. AY55625, AY755627, and NM_172197.
  • the plasma concentration of pentosidine was significantly negatively correlated with Accession No. NM_172197. Therefore, by measuring MN_172197 (advanced glycosylation end product-specific receptor (AGER), transcript variant 2, mRNA), it seems possible to predict the correlation (increase or decrease) between pentosidine and esRAGE (using the RAGE gene) Can be used as a diagnostic marker).
  • AGER advanced glycosylation end product-specific receptor
  • the blood concentration of AGEs elimination system esRAGE was positively correlated with the expression level of AGEs effect system RAGE, and the blood level of AGEs was negatively correlated with the expression level of AGEs effect system RAGE. That is, when the blood concentration of esRAGE acting in the direction of eliminating AGEs (suppressing the function of AGEs) increases, the expression level of AGEs effect system (causes the physiological function of AGEs) is increased. When the blood concentration of AGEs increased, a negative correlation (that is, that RAGE was down-regulated) was observed with the expression level of RAGE that causes AGEs physiological function.
  • the glycation end product receptor gene AGER (also referred to as “RAGE gene”) was subjected to mutation search using the PCR method.
  • AGER glycation end product receptor gene
  • NM_001136.3 Homo sapiens advanced glycosylation
  • AGER end product-specific receptor
  • transcript variant 1 mRNA
  • FIG. 8 the underlined portion indicates the primer design location, the capital letter notation indicates the exon region, and “c” surrounded by a frame indicates the polymorphism.
  • the primer sequences and PCR conditions used for searching for mutations in the RAGE gene are as follows. Forward primer (RAGEex7,8-F2): 5'-cacactgcagtcggagctaa (SEQ ID NO: 11) Reverse primer (RAGEex7,8 read R1): 5'-tgtaggttccctggtcctga (SEQ ID NO: 12) PCR was performed using a reaction solution having the following composition and cycle conditions (Table 6).
  • AGER NM_001136.3, c.992-6G> A was found to be significantly associated with soluble RAGE content (FIG. 9).
  • samples with a CT genotype of c.692-23C> T as heterozygotes showed a significant decrease in soluble RAGE compared to CC wild-type samples (ANOVA, Tukey's Multiple Comparison Test, P ⁇ 0.01).
  • the soluble RAGE of 8 cases with CT and GA genotypes of c.692-23C> T and c.992-6G> A as heterozygotes averaged 134.3 ⁇ 63.46 pg / mL, and CC and GG wild It was reduced by approximately 53% compared to the soluble RAGE amount (average 284.4 ⁇ 150.6 pg / mL) in 98 cases with type (FIG. 9).
  • This result showed that the amount of soluble RAGE can be predicted using the genotype of c.692-23C> T as an index.
  • soluble RAGE is produced as a splicing isoform, a new variant present at the exon / intron junction of AGER showed a significant association with a decrease in soluble RAGE. It was revealed that genetic factors were involved.
  • the method of the present invention is useful for detecting or evaluating schizophrenia.
  • Sequence number 7 Synthetic DNA Sequence number 8: Synthetic DNA SEQ ID NO: 11: synthetic DNA SEQ ID NO: 12: synthetic DNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurosurgery (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Psychiatry (AREA)
  • Food Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un procédé, et analogue, destiné à la détection de la schizophrénie et permettant une détection facile et rapide de la présence de schizophrénie à un degré supérieur de certitude. Le procédé de détection de la schizophrénie est caractérisé par la mesure de la quantité de récepteurs de produits finaux sécrétoires de glycation avancée dans un échantillon biologique, et l'association du résultat de la mesure obtenu et la schizophrénie.
PCT/JP2011/061068 2010-05-14 2011-05-13 Procédé de détection de la schizophrénie WO2011142460A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2012514848A JP5840124B2 (ja) 2010-05-14 2011-05-13 統合失調症の検出方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2010112545 2010-05-14
JP2010-112545 2010-05-14

Publications (1)

Publication Number Publication Date
WO2011142460A1 true WO2011142460A1 (fr) 2011-11-17

Family

ID=44914511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2011/061068 WO2011142460A1 (fr) 2010-05-14 2011-05-13 Procédé de détection de la schizophrénie

Country Status (2)

Country Link
JP (1) JP5840124B2 (fr)
WO (1) WO2011142460A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018030452A1 (fr) * 2016-08-12 2018-02-15 岡本　尚 Marqueur diagnostique de la schizophrénie et des troubles associés, et application de ce marqueur diagnostique
JP2020511174A (ja) * 2016-11-22 2020-04-16 ヤンセン ファーマシューティカ エヌ．ベー． 再発のリスクがある統合失調患者を特定する方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009039088A (ja) * 2007-07-17 2009-02-26 Tokai Univ 統合失調症の検査および治療

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009039088A (ja) * 2007-07-17 2009-02-26 Tokai Univ 統合失調症の検査および治療

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ARAI MAKOTO ET AL.: "Enhanced Carbonyl Stress in a Subpopulation of Schizophrenia", ARCH GEN PSYCHIATRY, vol. 67, no. 6, June 2010 (2010-06-01), pages 589 - 597, XP008124052, DOI: doi:10.1001/archgenpsychiatry.2010.62 *
MAKOTO ARAI ET AL.: "Togo Shicchosho no Byoin to Byotai ni Kansuru Taisha Cascade Bunshigun no Kenkyu", ANNUAL REPORT OF PHARMACOPSYCHIATRY RESEARCH, 22 March 2011 (2011-03-22), pages 71 - 72 *
STEINER JOHANN ET AL.: "A New Pathophysiological Aspect of S100B in Schizophrenia: Potential Regulation of S100B by Its Scavenger Soluble RAGE", BIOL PSYCHIATRY, vol. 65, 2009, pages 1107 - 1110, XP026143672, DOI: doi:10.1016/j.biopsych.2008.10.044 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018030452A1 (fr) * 2016-08-12 2018-02-15 岡本　尚 Marqueur diagnostique de la schizophrénie et des troubles associés, et application de ce marqueur diagnostique
JP2020511174A (ja) * 2016-11-22 2020-04-16 ヤンセン ファーマシューティカ エヌ．ベー． 再発のリスクがある統合失調患者を特定する方法
US11723569B2 (en) 2016-11-22 2023-08-15 Janssen Pharmaceutica Nv Methods of identifying schizophrenia patients at risk for relapse

Also Published As

Publication number Publication date
JPWO2011142460A1 (ja) 2013-07-22
JP5840124B2 (ja) 2016-01-06

Similar Documents

Publication Publication Date Title
De Roeck et al. The role of ABCA7 in Alzheimer’s disease: evidence from genomics, transcriptomics and methylomics
Reitz et al. Alzheimer disease: epidemiology, diagnostic criteria, risk factors and biomarkers
JP6254125B2 (ja) 蛋白尿腎疾患の病因における可溶性ｕＰＡＲの役割
Claverie-Martin et al. URAT1 and GLUT9 mutations in Spanish patients with renal hypouricemia
Stiburkova et al. Novel homozygous insertion in SLC2A9 gene caused renal hypouricemia
JP6628226B2 (ja) 痛風発症素因の評価方法
US20070015183A1 (en) Biomarkers for huntington's disease
EP1888783B1 (fr) Kcnn3 servant de cible diagnostique et therapeutique pour la maladie d'alzheimer
Stiburkova et al. Hereditary renal hypouricemia type 1 and autosomal dominant polycystic kidney disease
Ataç et al. G82S polymorphism of receptor for advanced glycation end products gene and serum soluble RAGE levels in mild cognitive impairment and dementia of Alzheimer's type patients in Turkish population
US8871443B2 (en) Schizophrenia-related isoform of KCNH2 and development of antipsychotic drugs
JP5840124B2 (ja) 統合失調症の検出方法
US20050158733A1 (en) EGR genes as targets for the diagnosis and treatment of schizophrenia
WO2014110628A1 (fr) Gène et ses mutations associées à des troubles de convulsion
US11041205B2 (en) Molecular targets for ALS and related disorders
US20060172295A1 (en) Genes associated with schizophrenia adhd and bipolar disorders
Hu et al. Association between SCN5A R225Q variant and dilated cardiomyopathy: potential role of intracellular pH and WNT/β-catenin pathway
US8067158B2 (en) Methods and compositions for the diagnosis and treatment of schizophrenia
WO2013112676A1 (fr) Isoforme de knch2 associée à la schizophrénie et développement de médicaments antipsychotiques
US8110348B2 (en) Methods and compositions for the diagnosis and treatment of schizophrenia
US20180291437A1 (en) Methods for detecting enhanced nmda receptor function and uses thereof
JP2009540851A (ja) パーキンソン病の処置および診断におけるｇｐｒｃ変異体の同定および使用
KR20230004597A (ko) 신경퇴행성질환 치료제에 대한 반응을 평가하기 위한 방법 및 조성물
US20140187593A1 (en) Diagnostic test and treatment for a neurological disorder
Gu Genetic and epigenetic studies of diabetes and diabetic nephropathy with focus on the IGF-IGFBP axis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11780716

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2012514848

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11780716

Country of ref document: EP

Kind code of ref document: A1