WO2011136462A1 - 증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 - Google Patents
증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 Download PDFInfo
- Publication number
- WO2011136462A1 WO2011136462A1 PCT/KR2010/009601 KR2010009601W WO2011136462A1 WO 2011136462 A1 WO2011136462 A1 WO 2011136462A1 KR 2010009601 W KR2010009601 W KR 2010009601W WO 2011136462 A1 WO2011136462 A1 WO 2011136462A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mutation
- primer
- gene
- amplification
- adjacent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Definitions
- the present invention is a composition for detecting a gene comprising a PCR primer (PCR primer) commonly used and a blocking primer modified competitively at one end thereof, a mutant gene comprising the step of performing a PCR using the same It relates to a detection method (mutant enrichment with terminal-modified oligonucleotide PCR, hereinafter referred to as MEMO-PCR) and a diagnostic method for mutation-related diseases using the same.
- PCR primer PCR primer
- MEMO-PCR mutant enrichment with terminal-modified oligonucleotide PCR
- mutations in specific genes have been identified in several tumors. Such mutations include TP53 gene or KRAS gene mutation in various solid tumors, BRAF gene mutation in thyroid cancer and colorectal cancer, EGFR gene mutation in lung cancer and colorectal cancer, JAK2 gene mutation in chronic myeloproliferative disease, and acute myeloid leukemia. And NPM1 gene mutations. Many of these mutations have properties that call for specific positions in the gene.
- Detecting such tumor-specific mutations is very useful for diagnosing tumors, determining treatment policy, and determining the presence of residual tumors after treatment.
- methods for detecting tumor-specific mutations by genetic methods have been developed and used, and typical methods include direct sequencing, allele-specific PCR, and restriction enzyme fragment length. Restriction Fragment Length Polymorphism (RFLP), Taqman probe method, amplification refractory mutation system (ARMS) -PCR, denaturing HPLC (dHPLC), and real-time PCR fall short.
- Important requirements for tumor-specific mutation detection include: (1) sensitivity to detect a low percentage of mutant DNA in normal DNA, and (2) erroneous determination of normal DNA as mutant DNA. It has specificity to minimize the false positive rate as much as possible.
- the present inventors have confirmed that the sensitivity and specificity is excellent when performing a mutation test using the amplification inhibitory primer with a PCR primer used in general, and completed the present invention.
- An object of the present invention is to provide a composition for detecting a mutant gene comprising a front primer, a rear primer, and an amplification inhibitor.
- the primers adjacent to the mutation site of the front or rear primers comprise nucleotides of complementary nucleotide sequences with sites other than the mutated sites in the genes in the sample, and the amplification inhibitors are mutated in the nucleotide sequences of the wild type genes in the genes in the sample.
- Nucleotides of the base sequence complementary to the base sequence of the wild-type gene corresponding to the site one end comprises a nucleotide having the same base sequence as the terminal site adjacent to the mutation site of the primer adjacent to the mutation site, and other The termini include nucleotides modified with one or more attachments selected from the group consisting of C3-18 spacer, biotin, di-deoxynucleotide triphosphate, ethylene glycol, amine and phosphate.
- Another object of the present invention to provide a kit for detecting a mutant gene comprising the composition.
- Still another object of the present invention is to perform a polymerase chain reaction using a front primer, a rear primer, and an amplification inhibitor upon a gene sample including a gene mutation site to be detected; And it provides a mutant gene detection method comprising the step of identifying a mutation for the obtained polymerase chain reaction product.
- Still another object of the present invention is to provide a method for diagnosing a mutant disease using the above method.
- the present invention provides a method for effectively detecting a mutant DNA present in a small amount, and can be used to diagnose a DNA mutation-related disease such as a tumor by using the same.
- an example of the present invention provides a diagnostic technique having high sensitivity and high specificity by selectively amplifying mutant DNA using amplification inhibitors in a PCR reaction.
- Figure 1 schematically shows the detection process of normal DNA and mutant DNA using the general primer (front primer, rear primer) and amplification inhibitor of the present invention. Mismatches of the amplification inhibitor and the target mutant sequence lower the affinity, thereby increasing the possibility of binding the general primer to enable amplification of the mutant sequence.
- Figure 2 schematically shows the position of the general primer.
- Figure 3 schematically shows the position of the primer upon amplification suppression.
- Figure 4 is a case of sequencing the DNA after the EGFR mutant DNA (1: 1000) by using the amplification inhibitor primer PCR after the sample was diluted with normal DNA and the nucleotide sequence analysis using only the primer The comparison is shown.
- Figure 5 is a DNA having a mutation in the normal DNA for 1: shows that although in the samples diluted to 1:10 and 1 -2 wild-type peaks appear, the hybrid peak is present in a sample diluted to 1:10 -4 .
- FIG. 7 is a graph showing the detection sensitivity according to the concentration ratio of the amplification inhibitor and the general primer.
- the x-axis shows the amount of amplification inhibitors per 10 pmol of the general primer. As the amount of amplification inhibitor was increased, the sensitivity was improved, and the ratio between the amplification inhibitor and the general primer reached a stagnation at 5: 1.
- Figure 8 shows the detection sensitivity according to the melting temperature (Tm; °C) of the wild-type sequence and the general primer double helix.
- Figure 9 shows the detection sensitivity according to the melting temperature (Tm; °C) of the wild-type sequence and the amplification inhibition primer double helix.
- Figure 10 shows the detection sensitivity according to the overlapping site length (bp) of the amplification inhibition primer and the general primer.
- Figure 11 shows the detection sensitivity according to the melting temperature (Tm) of the wild-type sequence and the amplification inhibition primer double helix and the binding temperature of the PCR reaction (59 °C in this experiment).
- FIG. 12 shows that when the mutant sequence and the mismatch amplification inhibitor have a high melting temperature (Tm-mismatch), they do not melt at the PCR binding temperature (59 ° C. in this experiment), resulting in low sensitivity.
- FIG. 13 shows a close association of sensitivity and difference between Tm Tm-mismatch ( ⁇ Tm) through detection of BRAF V600E, JAK2 V617F, and EGFR T790M mutations.
- ⁇ Tm Tm Tm-mismatch
- Figure 14 shows that ⁇ Tm is closely related to sensitivity in detecting mutations in KRAS codon 12. The larger ⁇ Tm, the higher the sensitivity.
- Figure 15 shows that amplification inhibitors with high melting temperatures (Tm) for wild-type sequences generally have good sensitivity to small deletion / insertion mutations.
- Figure 16 shows the suitability of MEMO for quantitative real-time PCR and HRM analysis. Continuous dilution samples containing EGFR T790M mutations detected by quantitative real-time PCR analysis using DNA-containing fluorescent dyes showed different fluorescence curves depending on the concentration of the mutant allele.
- FIG. 18 shows higher in dilutions with higher mutant allele concentrations (1.0 ⁇ 10 0 , 1.0 ⁇ 10 ⁇ 1 , and 1.0 ⁇ 10 ⁇ 2 ) compared to the melting temperature (83.7 ° C.) of the normal sample in HRM analysis. Samples with melting temperatures (84.3-84.4 ° C.), while with low mutant allele concentrations ( ⁇ 1.0 ⁇ 10 ⁇ 3 ), show the melting curves of the hybrids.
- FIG. 19 shows sequencing of the Amplicons with the HRM analysis (ie shows homozygous mutant peaks in samples with higher mutant allele concentrations and samples with low mutant allele concentrations). Hybrid peaks in
- FIG. 20 shows 15-bp deletion of EGFR exon 19 at 1.0 ⁇ 10 ⁇ 6 dilution in MEMO-PCR and sequence fragment analysis comprising fluorescent primers.
- Figure 21 confirms the 4-bp insertion of NPM1 exon 12 at 1.0 ⁇ 10 ⁇ 5 dilution in MEMO-PCR and sequence fragment analysis comprising fluorescent primers.
- Figure 22 shows the increase in sensitivity in MEMO-PCR and pyrosequencing in specimens with KRAS mutations.
- A KRAS G12S at 1.0 x 10 -2
- B KRAS G12C at 5.0 x 10 -3
- C KRAS G12D at 5.0 x 10 -2
- D KRAS G12V at 5.0 x 10 -3
- E KRAS G12A at 5.0 x 10 -2
- KRAS G13D at 2.0 x 10 -2 .
- FIG. 23 shows different BRAF V600E detection results using MEPO-PCR with DPO-based ARMS-PCR, conventional sequencing, and sequencing in fine needle aspirate (FNA) samples from patients with thyroid tumors. All three methods detected the BRAF V600E mutation in patients with PTC.
- FIG. 24 shows different BRAF V600E detection results using MEMO-PCR with DPO-based ARMS-PCR, conventional sequencing, and sequencing in fine needle aspirate (FNA) samples from patients with thyroid tumors.
- DPO-based ARMS-PCR showed a cloudy mutation band, while conventional sequencing showed a nearly invisible mutation peak, whereas in MEMO-PCR method, homozygous mutation peaks were easily detected. It became.
- FIG. 25 shows different BRAF V600E detection results using MEPO-PCR with DPO-based ARMS-PCR, conventional sequencing, and sequencing in fine needle aspirate (FNA) samples from patients with thyroid tumors. It was negative for ARMS-PCR and conventional sequencing and was judged only positive when using the MEMO-PCR method.
- Figure 26 shows the general primers used for the detection of EGFR, BRAF and JAK mutations and the sensitivity achieved using each amplification inhibitor.
- FIG. 27 shows the sensitivity achieved using the general primer and each amplification inhibitor used for TP53 mutation detection.
- FIG. 28 shows the sensitivity achieved using the general primer and each amplification inhibitor used for KRAS mutation detection.
- FIG. 29 shows the sensitivity achieved using the general primers and each amplification inhibitory primer used for the detection of EGFR and NPM1 insertion and deletion mutations.
- the present invention is to develop a method for effectively detecting the tumor-specific mutant DNA present in low concentrations to be clinically used for diagnosis of the tumor, determination of treatment policy, detection of residual cancer after treatment.
- the present invention performs a PCR reaction using a pair of general PCR primers and amplification inhibitory primers competitive with any one of them, thereby selectively amplifying mutant DNA to provide a high sensitivity and high specificity diagnostic technology. It is characterized by.
- amplification inhibitors bind strongly to wild-type sequences but affinity for mutant sequences is significantly reduced due to mismatches.
- the decrease in the binding capacity of the amplification inhibitory primers makes it possible to selectively amplify the mutant sequence by the general primer (FIG. 1).
- MEMO-PCR Mutant enrichment with terminal-modified oligonucleotide PCR is evaluated for its ability to detect common cancer mutations in the EGFR, KRAS, BRAF, TP53, JAK2, and NPM1 genes. It was. By performing downstream sequencing analysis in conjunction with MEMO-PCR, it was observed that sensitivity can be achieved in the range of 10 ⁇ 1 to 10 ⁇ 7 (FIGS. 6-15).
- a PCR amplification method was used as a means of selectively amplifying and testing a mutation-specific gene, and this method PCR reaction of amplification inhibitory primer having a nucleotide sequence complementary to that of a wild-type gene. It is a method of suppressing amplification of wild type gene by adding together.
- REMS-PCR, Locked Nucleic Acid (LNA), and Peptide Nucleic Acid (PNA) have been developed using amplification inhibitors.
- LNA Locked Nucleic Acid
- PNA Peptide Nucleic Acid
- COLD-PCR is not satisfactory amplification rate, there was a weak point to the change in temperature.
- Such one-terminal modified oligonucleotide has the advantage that it can be manufactured at a price 10 to 20 times lower than conventional LNA or PNA.
- the main feature of the present invention is a method of detecting mutant DNA present at low concentrations using PCR inhibition using one-terminal modified oligonucleotides, which has the same or better efficiency as the existing LNA and PNA methods. It is much cheaper. In addition, it is not susceptible to changes in temperature compared to COLD-PCR, and has the advantage of high amplification of mutations.
- Tm Melting temperature
- ⁇ T difference value
- composition for detecting a mutant gene comprising a front primer, a rear primer, and an amplification inhibitor
- the primers adjacent to the mutant sites in the front or rear primers comprise nucleotides of the base sequence complementary to sites other than the mutated sites in the gene in the sample,
- the amplification inhibitor comprises a nucleotide of the base sequence complementary to the base sequence of the wild-type gene corresponding to the mutation site in the base sequence of the wild-type gene of the gene in the sample, one end is adjacent to the mutation site of the primer adjacent to the mutation site A nucleotide having the same nucleotide sequence as the terminal site, and the other terminal is modified by one or more attachments selected from the group consisting of C3-18 spacer, biotin, di-deoxynucleotide triphosphate, ethylene glycol, amine and phosphate Nucleotides.
- the composition relates to a composition, characterized in that for carrying out a polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the present invention relates to a kit for detecting a gene mutation comprising the composition.
- the present invention provides a method for preparing a polymer sample comprising: performing a polymerase chain reaction using a front primer, a rear primer, and an amplification inhibitor upon a gene sample including a gene mutation site to be detected; And identifying a mutation with respect to the obtained polymerase chain reaction product,
- the primers adjacent to the mutant sites in the front or rear primers comprise nucleotides of the base sequence complementary to sites other than the mutated sites in the gene in the sample,
- the amplification inhibitor comprises a nucleotide of the base sequence complementary to the base sequence of the wild-type gene corresponding to the mutation site in the base sequence of the wild-type gene of the gene in the sample, one end is a mutation site of the primer adjacent to the mutation site Nucleotides having the same nucleotide sequence as the adjacent terminal region, the other terminal being modified with one or more attachments selected from the group consisting of C3-18 spacer, biotin, di-deoxynucleotide triphosphate, ethylene glycol, amine and phosphate It relates to a mutant gene detection method comprising a nucleotide.
- the present invention relates to a method for diagnosing a mutant disease using the above method.
- sample refers to a gene sample including a site of gene mutation to be detected.
- all bio-derived samples capable of genetic analysis including nuclear and / or mitochondria, include endogenous or exogenous genes (eg, pathogenic bacteria and cells, tissues, organs, body fluids, etc.) extracted from them, or And / or virus).
- the cells, tissues, organs, body fluids, etc. may be taken from a patient of a mammal (eg, humans, primates, rodents, etc.), and the cells may include cells of a single cell animal such as a virus or bacteria.
- the gene sample may be extracted from cells of a patient to be diagnosed, and in case of remaining tumor test after tumor treatment, the gene sample may be a cancer cell of a patient who received tumor treatment. It may be extracted from, in the case of detecting drug-resistant strains may be extracted from strains such as bacteria or viruses.
- the gene in the sample includes a target gene (full-length gene) in which the gene mutation to be detected exists, or a portion including a gene mutation site in the target gene, wherein the portion including the gene mutation includes a gene mutation site.
- a target gene full-length gene
- the portion including the gene mutation includes a gene mutation site.
- primer refers to a short nucleic acid sequence that can form base pairs with complementary templates with nucleic acid sequences having short free three-terminal hydroxyl groups and that serves as a starting point for template strand copying. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. In addition, primers are sense and antisense nucleic acids having 7 to 50 nucleotide sequences, which may incorporate additional features that do not change the basic properties of the primers serving as the starting point for DNA synthesis.
- forward primer and reverse primer means a general primer (general primer) which is commonly used for amplification of a gene sample including a gene mutation to be detected.
- front and back primers can be easily determined according to the gene mutations to be detected by those skilled in the art and the gene containing the mutation.
- the length of the anterior primer and the posterior primer is 10 to 50 bp, preferably 15 to 35 bp of oligonucleotide having a nucleotide sequence complementary to the contiguous 10 to 50 bp region. It can be designed as.
- wild type gene refers to an allele that appears to be the most common in nature or designated any normal. Means a normal gene for the purpose of the present invention, the embodiment used a normal gene of EGFR, BRAF, JAK2, TP53, KRAS, NPM1, but is not limited thereto.
- mutant gene refers to a change in the structure of the DNA constituting the gene changes the appearance or properties of the gene.
- mutant genes of EGFR, BRAF, JAK2, TP53, KRAS, NPM1 were used, but not limited thereto.
- the term "primer adjacent to the mutation site” or “mutant adjacent primer” is located closer to the mutation site of the front primer and the rear primer, and does not include the mutation site to be detected in the gene in the sample. It is characterized in that it is designed to have a sequence complementary to the 10 to 50 bp, preferably 15 to 35 bp site a certain distance from.
- the distance between the mutation site adjacent primer and the mutation site is 1 to 30, preferably 1 to 20 bp, more preferably 1 to 9 bp (Fig. 6).
- the longer distance from the mutation site of the front and rear primers means that the amplification region to be amplified is about 5 to 1,000,000 bp, preferably about 5 to 100,000 bp, more preferably about 5 to 5000 bp. It may be 10 to 50 bp, preferably 15 to 35 bp of oligonucleotides designed to be.
- amplification inhibitor includes the following features:
- the base sequence of the wild type gene includes nucleotides of the base sequence complementary to the base sequence of the wild gene corresponding to the mutation site. Therefore, the wild type gene is inhibited from being amplified by binding to the wild type gene and interrupting the binding of the general primer.
- the gene having a mutation is to bind the general primer specifically to amplify the gene to play a role of increasing the detection sensitivity and specificity of the mutant gene.
- One end of the amplification inhibitory primer comprises a nucleotide having the same base sequence as the terminal region adjacent to the mutation site of the primer adjacent to the mutation site. If the primer adjacent to the mutation site is the front primer, the one end is the 5 'end and if it is the posterior primer, the one end is the 3' end.
- Nucleotide having the same nucleotide sequence as the terminal region adjacent to the mutation site of the primer adjacent to the mutation site refers to the nucleotide of the overlapping site with the primer adjacent to the mutation site, the gene having the mutation is a primer adjacent to the mutation site Nucleotides are sequentially amplified at the terminal region adjacent to the mutation site of the primer, but the wild type gene is competitively linked to one terminal of the amplification inhibitory primer instead of the terminal region of the primer adjacent to the mutation. It cannot be amplified.
- the nucleotide having the same nucleotide sequence as the terminal region adjacent to the mutation site of the primers adjacent to the mutation site is 3 bp or more, for example, 3 to 50 bp, 3 to 35 bp, 5 to 50 bp, or 5 to 35 bp. Preferably 3 to 13 bp. If less than 3bp does not obtain sufficient sensitivity (Fig. 10).
- the end of the amplification inhibitor is characterized in that the amplification by the PCR is blocked. If the primer adjacent to the mutation site is the front primer, the other end is the 3 'end and if the back primer is the other end, the other end is the 5' end.
- the terminal modification may include a C3-18 spacer (a structure in which 3-18 carbons are continuously connected) (eg, a C3-spacer; a structure in which three carbons are continuously connected) and a C6 spacer ( C6-spacer; structure of 6 carbons connected in series), C12 spacer (C12-spacer; structure of 12 carbons connected in series), C18 spacer (C18-spacer; structure of 18 carbons connected in series), biotin (Biotin), di-deoxynucleotide triphosphate (di-deoxynucleotide triphosphate (ddNTP), ethylene glycol (ethylene glycol), amine (amine) and phosphate (phosphate), etc. It may be.
- a C3-18 spacer a structure in which 3-18 carbons are continuously connected
- a C3-spacer a structure in which three carbons are continuously connected
- a C6 spacer C6-spacer; structure of 6 carbons connected in series
- C12 spacer C12-
- the inhibition efficiency of 3'-modification using C3 spacer, phosphate, and C6 amine was examined, and similar sensitivity was shown between them (Example 2).
- the inhibitory amplification primers are modified at the ends, and thus cannot amplify the wild-type genes bound like the general primers.
- the present invention competitively reacts a commonly used forward primer, a posterior primer pair, and an amplification inhibitory primer so that in the wild type gene, the amplification inhibitory primer is preferentially bound to perform gene amplification by the anterior primer and the posterior primer.
- the amplification inhibitory primer is preferentially bound to perform gene amplification by the anterior primer and the posterior primer.
- Such a mutant gene detection composition may be for performing PCR.
- PCR is a method of amplifying a specific target genetic material to be detected.
- RNA is synthesized using reverse transcriptase and polymerized using template as a template.
- Reverse transcriptase polymerase chain reaction (RT-PCR), which performs enzyme chain reaction, and real-time polymerase chain reaction that simultaneously detect amplification products while amplifying DNA using fluorescent materials.
- the melting temperature of the mutant adjacent primer and the amplification inhibitor may be an important factor.
- the melting temperature (Tm) of the mutant adjacent primers competing with the amplification inhibitors is 65 ° C. or less, preferably 62 ° C. or less, such as 55 to 65 ° C., or 55 to 62 ° C., Preferably it is 55 to 62 °C, or 58 to 62 °C (Fig. 8), the melting temperature of the primer to suppress the amplification is 0 °C or more, preferably 2 °C or more than the melting temperature of the primer adjacent to the mutation site , 0 to 12 ° C., preferably 2 to 12 ° C. higher (FIG. 9).
- the binding temperature of the polymerase chain reaction of the composition is preferably lower than the melting temperature of the wild-type gene and the amplification inhibition primer double helix and higher than the melting temperature of the mutant gene and the amplification inhibition primer double helix (Figs. 11 to 15).
- the amplification inhibitor of the amplification inhibitor Since the binding ability is significantly lowered and thus loses competition with the general primer, the possibility of binding the generic primer is increased to enable amplification of the mutant sequence, thereby improving the ability to distinguish between a mutation and a normal sequence. This effect may be greater when the melting temperature (Tm-mismatch) of the mutant sequence and the mismatch amplification inhibitor is lower than the annealing temperature of the PCR reaction (FIGS. 13 and 14).
- PCR conditions for example, the following conditions can be set.
- PCR conditions can be variously modified according to the desired reaction, and these optimum conditions are those that can be easily adopted by those skilled in the art.
- the molar concentration ratio of the primer and the amplification inhibitor adjacent to the mutation site in the composition is 1: 5 to 1:50 characterized in that the composition.
- the sensitivity increases as the concentration of the amplification inhibitor is increased, and if the amplification inhibitor is about 1 times or more, the desired detection efficiency can be obtained. It appears that there is no difference, and it is good that it is 1 time or more, or 5 times or more.
- the upper limit of the amplification inhibitor primer concentration relative to the mutant neighboring primer concentration (mol) is not particularly limited, and can be used up to about 50 times in consideration of the economical use of the sample.
- the concentration of the amplification inhibitor primer is the mutation neighbor primer concentration. It may be 1 to 50 times, for example 1 to 10 times, 5 to 50 times or 5 to 10 times based on (mol) (FIG. 7).
- the use concentration of the front and rear primers (mol) is not particularly limited and may be, for example, 1:50 to 50: 1, specifically 1:10 to 10: 1, and more specifically 1: 5 to 5: 1.
- the present invention is not limited thereto, and in consideration of the reaction efficiency and the economical efficiency of the sample to be used, it is preferable to use 1: 2 to 2: 1, for example, in the same ratio.
- the term “mutation” includes all kinds of nuclear and / or mitochondrial gene mutations without particular limitation, and includes point mutations and small insertions / deletion (eg, insertions of 1-50 bp or Fruiting), and the like.
- the types of gene mutations detectable by the present invention are not particularly limited, and may be any type of mutations, for example, tumor specific mutations (useful for the diagnosis of tumors), mitochondrial mutations (useful for the diagnosis of mitochondrial diseases), Or mutations that confer drug resistance to pathogenic bacteria and / or viruses (especially useful for detecting drug resistant strains of pathogenic bacteria and / or viruses present in low concentrations and for diagnosing such pathogenic bacteria and / or virus related diseases). However, it is not limited thereto.
- the tumor specific mutations include, for example, thyroid cancer, gastric cancer, colon cancer, lung cancer, skin cancer, esophageal cancer, oral cancer, pancreatic cancer, biliary tract cancer, liver cancer, laryngeal cancer, uterine cancer, ovarian cancer, breast cancer, prostate cancer, brain tumor, nerve cell cancer, bone tumor, etc. It may be a mutation specific to a tumor selected from the group consisting of various solid cancers and blood cancers including myeloproliferative diseases and leukemias, and may be applicable to viral infections, mitochondrial diseases, and the like, but is not limited thereto.
- Such tumor specific mutations include, for example, Kirsten rat sarcoma 2 viral oncogene homolog (NM_004985) gene, APC (Adenomatous polyposis coli; NM_000038), Murine sarcoma viral (v-raf) oncogene homolog B1; NM_004333), BRCA1 (BRAS1) Breast cancer-1 gene; NM_007295), BRCA2 (Breast cancer-2, early onset; NM_000059), CDH1 (Cadherin-1 (E-cadherin; uvomorulin); NM_004360), CDKN2A (Cyclin-dependent kinase inhibitor 2A (p16, inhibits) CDK4); NM_000077), CTNNB1 (Catenin (cadherin-associated protein), beta 1, 88kD; NM_001098209), CYLD1 (Cylindromatosis gene; NM_015247), EGFR (Epidermal
- coli homolog of, 1; NM_000249), MSH2 (mutS, E. coli, homolog of, 2; NM_000251), MSH6 (MutS, E. coli, homolog of, 6; NM_000179), NF1 (Neurofibromin (neurofibromatosis, type I); NM_001128147), NF2 (Merlin; NM_181825 ), NOTCH1 (Notch, Drosophila, homolog of, 1, translocation-associated; NM_017617), NPM1 (Nucleophosmin 1 (nucleolar phosphoprotein B23, numatrin); NM_001037738), NRAS (Neuroblastoma RAS viral (v-ras) oncogene homolog; NM_002524) , NTRK3 (Neurotrophic tyrosine kinase, receptor, type 3; NM_002530), PALB2 (Partner and local
- the tumor specific mutations include, for example, EGFR (L858R, T790M and Del15), BRAF (V600E), JAK (V617F), TP53 (R175H, R248Q / R248W, R273H / R273C), KRAS (G123 / G12C, G12D, G12A, G13D) and NPMI (Ins4) may be selected from the group consisting of, but is not limited thereto.
- the bacterial and / or viral diseases are diseases caused by various bacterial and / or viral infections, typically hepatitis, cholecystitis, pancreatitis, gastritis, enteritis, cystitis, nephritis, pyelonephritis, dermatitis, myositis, vaginitis, urethritis, and prostatitis , Pneumonia, bronchitis, pharyngitis, rhinitis, keratitis, iris, conjunctivitis, otitis media, meningitis, encephalitis, and the like.
- Mutations related to the diagnosis of the disease are tyrosine-methionine-aspartate- associated with lamivudine drug resistance.
- Drug-resistant mutations of the hepatitis B virus including aspartate (YMDD) motifs, or resistance sites (for example, point mutations in codons 528 and codons 529 in the hepatitis B gene), or S antigens associated with vaccine immunity failure It may be a mutation of the gene and the like, but is not limited thereto. According to the present invention, even when a virus having the mutation is present at a very low concentration, it can be effectively detected.
- Mitochondrial diseases include, but are not limited to, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke (MELAS), myclonic epilepsy with Ragged Red Fibers (MERRF), and chronic progressive external ophthalmoplegia (CPEO). Mutations related to the diagnosis of this disease may be point mutations commonly found in MELAS, MERRF, CPEO, etc., and such mutations are well known in the art.
- the "mutation site in the gene” refers to the site where the gene mutation to be detected occurs.
- the step of identifying the mutation may be by any mutation identification method commonly used, and there is no particular limitation.
- any mutation identification method commonly used, and there is no particular limitation.
- direct sequencing Taqman probe method, melting temperature analysis, allele-specific PCR, restriction fragment length polymorphism RFLP, ARMS (amplification refractory mutation system), allele-specific enzymatic amplification (ASPCR), allele-specific amplification (ASA), PCR amplification of specific alleles (PASA), PAMSA PCR amplification of multiple specific alleles, COP (competitive) oligonucleotide priming (E-PCR), enriched PCR (E-PCR), mutant-enriched PCR (ME-PCR), mismatch amplification mutation assay (MAMA), mutant allele specific amplification (MASA), antiprimer quenching-based real-time PCR ), Restriction endonuclease mediated selective PCR (REMS-PCR), artificial introduction of a restriction site (AIRS), peptide nu
- Another aspect of the present invention provides a method for diagnosing a genetic mutation-related disease such as a tumor, mitochondrial disease, or a bacterial and / or viral disease by performing the above genetic mutation detection method.
- the gene mutation detection method is performed on a genetic sample obtained from the patient and the patient is identified when the gene mutation is identified.
- the patient can be diagnosed with a disease associated with the gene mutation.
- the type of disease that can be diagnosed by the method of diagnosing a gene mutation-related disease according to the present invention is determined according to the gene mutation to be detected, and may be any type of gene mutation-related disease.
- a tumor thyroid cancer, stomach cancer, and colon cancer Lung cancer
- skin cancer esophageal cancer
- oral cancer pancreatic cancer
- biliary tract cancer liver cancer
- laryngeal cancer uterine cancer
- ovarian cancer breast cancer, prostate cancer
- brain tumor nerve cell cancer, bone cancer, etc.
- Mitochondrial disease may include, but is not limited to, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke (MELAS), myconic epilepsy with Ragged Red Fibers (MERRF), and chronic progressive external ophthalmoplegia (CPEO). It doesn't happen.
- Patients subject to mutation detection and tumor diagnosis of the present invention may be mammals, such as humans, primates, rodents, etc., and the genetic sample may be a whole DNA sample isolated from the patient, a sample from which only the corresponding gene in which the mutation to be detected is present, or the It may include about 5 to 1,000,000 bp, preferably about 5 to 100,000 bp, more preferably about 5 to 5000 bp of the polynucleotide including the site of the mutation in the gene.
- tumor cell lines cancer cell line; HEL, JAK2 mutant cell line; Mia PaCa, KRAS mutant cell line; H1975, EGFR mutant cell line; SNU-790, BRAF mutant cell line
- CCRF-CEM Kasumi-1, MIA PaCa-2, H1975 and SNU-1196, TP53 mutant cell lines
- patient samples NPMI mutant cell lines
- all cell lines obtained from the American Type Culture Collection or the Korea Cell Line Bank and are not well known EGFR Cell lines with T790M mutations were obtained from the Department of Hematology and Oncology of Samsung Medical Research Institute) and DNA from peripheral blood of normal (29-year-old healthy) women.
- Binding Buffer (Roche Diagnostics, Mannheim, Germany) and 40ul of Proteinase K (Roche Diagnostics) were mixed in each sample, and then incubated at 70 ° C for 10 minutes. Here, 100ul of isopropanol was added and mixed well. A filter tube (High Filter tube, Roche Diagnostics) was put into a collection tube, the prepared sample sample was transferred thereto, and centrifuged at 8000 g for 1 minute.
- the filter tube was removed from the collection tube and the filtered liquid was discarded and the removed filter tube was placed in a new collection tube.
- 500 ul of Wash Buffer (Roche Diagnostics) was added thereto and centrifuged at 8000 g for 1 minute. The Wash Buffer addition and centrifugation were repeated once more. Rotate for 10 seconds at maximum centrifugal force to remove remaining Wash Buffer.
- the filter tube was placed in a new microtube and 200 ul of prewarmed Elution Buffer (Roche Diagnostics) was added and centrifuged at 8000 g for 1 minute. The DNA thus extracted was stored frozen until used for testing.
- PCR amplification was performed using two general primers (front primer and rear primer) and one amplification inhibitor.
- the amplification inhibitor contained a target mutant portion and overlapped with one general primer.
- 26 to 29 show the general primer and the amplification inhibitory primer used for the detection of EGFR, BRAF, JAK2, TP53, KRAS, NPM1 gene mutations.
- the 3 ′ end of each amplification inhibitor was further modified with C3 spacer, phosphate, or C6 amine (both Bioneer, Korea) according to the manufacturer's instructions.
- the C3 spacer was used for the amplification inhibitor.
- the polymerase chain reaction method was performed using the DNA sample prepared in Example 1.
- the primer used was described in each Example.
- the amplification product of the gene obtained by the polymerase chain reaction was confirmed by amplification success using electrophoresis.
- the amplified product was treated with Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems), and then subjected to sequencing with ABI Prism 3100 Genetic Analyzer. The result was compared with the normal base sequence by the Sequencher program to confirm the presence of mutations.
- the following three primers were prepared for a sample sample obtained by diluting (1: 1000) the DNA extracted from the H1975 tumor cell line among the cell lines prepared in Example 1 with normal DNA (with the consent of a normal person). 4 shows the results of PCR analysis using the method and conditions of Example 3 in comparison with the case of using only the general primer.
- Posterior primer 5'-cacatatccccatggcaaac-3 '(SEQ ID NO: 2)
- Primer for amplification inhibition 5'-GCAGCTCATCACGCAGCTC-3 '(SEQ ID NO: 3; end of 3' is modified with C3 spacer,
- the normal primers of SEQ ID NOS: 1 and 2 and SEQ ID NO: 3 were prepared by diluting the mutant DNA per normal DNA at 1.0 ⁇ 10 0 , 1.0 ⁇ 10 ⁇ 1 , 1.0 ⁇ 10 ⁇ 2 , 1.0 ⁇ 10 ⁇ 3 ratios. After PCR using amplification inhibitors together, the nucleotide sequence was analyzed (FIG. 5). The absence of wild-type peaks was observed at dilution ratios of 1.0 ⁇ 10 0 , 1.0 ⁇ 10 ⁇ 1 , 1.0 ⁇ 10 ⁇ 2 , and the presence of heterozygous peaks at higher ratios of 1.0 ⁇ 10 ⁇ 4 . It could be observed. In other words, the higher the ratio of mutant DNA per normal DNA, the higher the sensitivity.
- Detection sensitivity was defined as "lowest dilution concentration among those with 20% or more mutation peaks observed in sequencing".
- the distance between the general primer (front primer) and the mutation position is 1 to 9 bases is appropriate, there was no significant difference in sensitivity in this range.
- the molar concentration of the amplification inhibitor to the mutant neighboring primer concentration was 1 to 10 times using the following four primer sets.
- the detection sensitivity was measured according to the method of Example 3 while changing to.
- Anterior primer 5'-CAAGCATTTGGTTTTAAATTATGG-3 '(SEQ ID NO: 5)
- Posterior primer 5'-tgaaaaggccagttattccaa-3 '(SEQ ID NO: 14)
- Inhibitors for amplification 5'-GGAGTATGTGTCTGTGGAGACGAG-3 '(SEQ ID NO: 15; 3' end is modified with C3 spacer).
- Anterior primer 5'-CTGAATATAAACTTGTGGTAGTTGGAG-3 '(SEQ ID NO: 16)
- Posterior primer 5'-ttgaaacccaaggtacatttca-3 '(SEQ ID NO: 21)
- Primer for amplification inhibition 5'-TAGTTGGAGCTGGTGGCGTAG-3 '(SEQ ID NO: 22; 3' terminus is modified with C3 spacer).
- Posterior primer 5'-cacatatccccatggcaaac-3 '(SEQ ID NO: 28)
- Primer for amplification inhibition 5'-GCAGCTCATCACGCAGCTC-3 '(SEQ ID NO: 29; 3' end is modified with C3 spacer).
- Posterior primer 5'- ctgatttttgtgaatactgggaact -3 '(SEQ ID NO: 61)
- Amplification inhibitory primers 5'-ggtgattttggtctagctacagTga3-3 '(SEQ ID NO: 93; 3' terminus is modified with C3 spacer).
- the detection sensitivity was measured by the method of Example 3 while changing the melting temperature of the amplification inhibitor to 58 to 70 °C using the following three primer sets. Tumor cell lines and primers used were summarized in Tables 8 to 10 below, and the results obtained are shown in FIG. 9.
- the sensitivity tends to increase as the melting temperature (Tm) of the amplification inhibitor is generally higher, it is preferable to set higher than the melting temperature of the general primer shown in Figure 8 Appeared.
- Tm melting temperature
- Tm-mismatch melting temperature
- the mutation sequence and Tm-mismatch value of the mismatched amplification suppressor double helix were very low compared to the melting temperature (Tm) value of the double-helix double-stranded amplification inhibitor, Since the binding ability is significantly lowered, and the competition with the general primer is increased, the possibility of binding the general primer is increased to enable amplification of the mutant sequence, thereby improving the ability to distinguish between the mutation and the normal sequence.
- Sensitivity may be greater when the Tm-mismatch of the mutation sequence and the mismatch amplification inhibitor is lower than the annealing temperature of the PCR reaction.
- Mutation sequences and mismatched amplification inhibitors should be separated during the binding step, but if the melting temperature (Tm-mismatch) of the mutation sequences and mismatched amplification inhibitors is higher than the binding temperature, the amplification inhibitors are mutated DNA. It is recommended that the melting temperature of the mutant sequence and the double helix of the amplification suppressor is lower than the binding temperature of the PCR reaction because it is attached to the hindered binding of the general primer.
- the sensitivity was higher when the melting temperature (Tm) of the normal sequence and the double helix of the amplification inhibitor was higher than the binding temperature (59 ° C) of the PCR reaction, but the sensitivity was lowered at a higher melting temperature (Tm) (Fig. 11). ).
- the present inventors calculated the melting temperature of the mutant sequence and the double helix at the time of mismatch amplification suppressor (Tm-mismatch) using the neighbor joining algorithm with reference to Santa Lucia et al.
- Table 11 shows the best sensitivity obtained from MEMO-PCR and downstream sequencing using different primer sets.
- the detection sensitivity was measured by the method of Example 2 using the following three primer sets. Tumor cell lines and primers used were summarized in Tables 12 to 14 below, and the results obtained are shown in FIG. 10.
- the length of the overlap (overlap) region of the amplification inhibition primer and the general front primer is 1 or 2 bases because it does not obtain sufficient sensitivity, it can be seen that it is preferably at least 3 bases.
- MEMO can potentially be used for quantitative real-time PCR and / or HRM analysis.
- samples in which DNA with EGFR T790M mutation was diluted with normal DNA from 1.0 ⁇ 10 0 to 1.0 ⁇ 10 ⁇ 4
- PCR reactions were tested using AccuPower® HF PCR PreMix (Bioneer), including hot-start, high-fidelity polymerase, buffers, and reagents (final concentrations: KCl 300 mM, MgCl 2 25 mM and dNTP 0.3 mM).
- the reaction mixture contains 200ng of DNA, 10pmol of general primer, and 50pmol of inhibitory primer (in Figure 7, the amount of amplification inhibitor was optimized to 50pmol.).
- PCR was performed using a 9600 thermal cycler (Applied Biosystems).
- the polymerase chain reaction was performed under the following conditions (hereinafter, the same conditions were also applied to the examples).
- HRM combined with real-time PCR was performed using Rotor-Gene Q (Qiagen) in the presence of BEBO dye (TATAA Biocenter). DNA samples with sequential dilution of EGFR T790M were amplified with amplification inhibitor T790M-B6.
- the change in the threshold cycle (Ct) value was within 0.6, an acceptable range.
- the mutation concentration is high, it passes the threshold even if only a few cycles (Ct) are turned.
- the mutation concentration is low, more cycles are required to amplify and pass the threshold. This result shows that the present invention can be usefully used for quantitative analysis according to the Ct value.
- the final product was suitable for HRM analysis because a few mutant alleles were amplified equally or more than when compared to normal alleles via MEMO-PCR.
- dilutions containing higher amounts of mutant DNA resulted in higher melting temperatures (83.7 ° C.) than normal samples (83.7 ° C.).
- Tm, 84.3-84.4 ° C. presumably because of the greater stability of the mutant homoduplex.
- Samples with low mutant DNA concentrations ⁇ 1.0 ⁇ 10 ⁇ 3 ) showed heterozygous peaks, identical to the sequencing results (FIGS. 18 and 19).
- Fluorescence PCR and fragment analysis can detect small insertion / deletion mutations using size-based isolation.
- the MEMO method was performed for the detection of two hot-focus mutations in the EGFR and NPM1 genes.
- Fluorescence PCR was performed by deleting 15-bp at EGFR exon 19 and inserting 4-bp at NPM1 exon 12.
- General primers DEL15-F and NPM1-F were labeled 5′-FAM. Amplicon sections were analyzed by ABI Prism 3130xl Genetic Analyzer using GeneScan Software (Applied Biosystems).
- Mutations in the EGFR gene are important molecular markers for targeted therapies in lung cancer, and occur in exon 19, with about 15-bp deletions occurring in about half of the cases.
- the amplification inhibitors were designed to include virtually all known exon 19 mutations and the best set of highly sensitive primers to detect up to 1.0 ⁇ 10 ⁇ 6 dilution ratios of a few alleles by downstream fluorescent fragment analysis. As a result, an abnormal peak of 15 bp shorter than the normal peak appeared (FIG. 20).
- the NPM1 gene is the most commonly mutated gene in myeloid leukemia with a normal karyotype, which typically occurs as a 4-bp insertion into exon 12.
- a normal karyotype typically occurs as a 4-bp insertion into exon 12.
- an abnormal peak 4bp longer than the normal peak could be observed (FIG. 21).
- the optimal primer set was able to detect mutations up to 1.0 ⁇ 10 ⁇ 5 dilution of minority using MEMO-PCR and downstream fluorescent fragment analysis (FIG. 21).
- Pyrosequencing is a method used to detect sequence variations. It was used to analyze diluted samples with KRAS mutations. This was analyzed on a PSQ96MA (Biotage) machine using PyroMark ® Gold Q96 Reagents (Qiagen). PCR reaction was performed using the amplification inhibitory primer (KRAS-B2) and the bio-labeled general primer (Fig. 27).
- Sensitivity was identified as 1.0 x 10 -2 , 5.0 x 10 -3 , 5.0 x 10 -2 , 5.0 x 10 -3 , 5.0 x 10 -2 and 2.0 x 10 -2 , respectively (FIG. 22) and in control normal DNA No abnormal peaks were observed.
- DNA of 212 patients with thyroid nodules was extracted by ultrasonography. Cytomorphological overhaul was performed by professional pathologists. DNA samples were performed using DPO-based ARMS-PCR and conventional PCR sequencing using Seeplex® BRAF ACE Detection Kit (Seegene) as well as MEMO-PCR (using V500E-B5 amplification inhibitor) and downstream sequencing.
- BRAF V600E mutations are commonly observed in papillary thyroid cancers (50-90%) and their molecular detection is useful for diagnosis.
- Thyroid aspirate samples were obtained from 212 patients whose thyroid tumors were found by cytomorphological examination. These samples were also examined for BRAF V600E mutations using MEM0-PCR with downstream sequencing, ARMS-PCR with dual-priming oligonucleotides (DPO), and conventional PCR with downstream sequencing.
- DPO-based ARMS-PCR to the detection of BRAF V600E was found to be about 2.0 ⁇ 10 ⁇ 2 .
- MEMO-PCR and sequencing including sequencing showed positive results in all ARMS-PCR-positive samples and mutations were detected in 15 additional samples that were not detected in ARMS-PCR and conventional PCR.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
일반적으로 사용되는 PCR 시발체(PCR primer)와, 이와 경쟁적이고 일 말단이 변형된 증폭억제시발체(blocking primer)를 함께 이용하여 PCR을 수행하는 단계를 포함하는 유전자 돌연변이 검출 방법 및 이를 이용한 유전자 돌연변이 관련 질환의 진단 방법이 제공된다. 본 발명에 따르면, 정상 DNA 증폭이 차단되고 돌연변이를 가진 DNA만 선택적으로 증폭되어 검출 민감도 및 검출 특이성을 증진시킬 수 있다.
Description
본 발명은 일반적으로 사용되는 PCR 시발체(PCR primer) 및 이와 경쟁적이고 일 말단이 변형된 증폭억제시발체(blocking primer)를 포함하는 유전자 검출용 조성물, 이를 이용하여 PCR을 수행하는 단계를 포함하는 돌연변이 유전자 검출 방법(mutant enrichment with terminal-modified oligonucleotide PCR, 이하, MEMO-PCR 이라 한다) 및 이를 이용한 돌연변이 관련 질환의 진단 방법에 관한 것이다.
현재까지 여러 종양에 있어서 특정한 유전자의 돌연변이가 밝혀져 왔다. 이러한 돌연변이로 대표적인 것들은 여러 고형 종양에 있어서 TP53 유전자 혹은 KRAS 유전자 돌연변이, 갑상선암 및 대장암 등에 있어서 BRAF 유전자 돌연변이, 폐암 및 대장암에서 EGFR 유전자 돌연변이, 만성골수증식성질환에서 JAK2 유전자 돌연변이, 급성골수구성백혈병에서 NPM1 유전자 돌연변이 등이 있다. 이러한 돌연변이의 상당수는 유전자내 특정 위치에 호발하는 특성을 가지고 있다. 이에는 TP53 Arg175His/Arg248Gln/Arg273His, KRAS 코돈 12 및 13 돌연변이, BRAF Val600Glu 돌연변이, EGFR Leu858Arg/Thr790Met 돌연변이, JAK2 Val617Phe 돌연변이, NPM1 엑손 12 돌연변이 등이 있다.
이러한 종양 특이적인 돌연변이를 검출하는 것은 종양의 진단과 치료방침 결정 및 치료 후 잔류종양(residual tumor)의 존재여부 판단에 아주 유용하다. 이에 따라 종양 특이적인 돌연변이를 유전학적 방법으로 검출하는 검사법들이 개발되고 이용되어 오고 있으며, 대표적인 방법으로 직접염기서열분석법 (direct sequencing), 대립유전자특이증폭법(allele-specific PCR), 제한효소절편길이다형성 (Restriction Fragment Length Polymorphism; RFLP), Taqman 소식자(probe)법, ARMS(amplification refractory mutation system)-PCR, 변성(denaturing) HPLC (dHPLC), 및 real-time PCR fall short 등이 있다. 종양 특이적인 돌연변이 검출검사에서 중요하게 요구되는 사항으로는 (1) 정상 DNA 속에서 낮은 비율로 존재하는 돌연변이 DNA를 검출할 수 있는 민감도(sensitivity)와 (2) 정상 DNA를 돌연변이 DNA로 잘못 판정하는 위양성(false positive) 비율을 최대한 낮출 수 있는 특이도(specificity)를 갖추는 것이다.
그러나, 기존에 사용되었던 방법들은 민감도와 특이도에 있어서 만족할 만한 결과를 보여주지 못하였다. 직접염기서열분석법은 가장 특이도가 높아 위양성의 비율이 낮은 반면 20~30% 이상의 돌연변이 DNA가 존재할 경우에만 검출이 가능한 단점이 있다. 반면 대립유전자특이증폭법이나 제한효소절편길이다형성, Taqman 소식자법 등은 민감도는 높으나 특이도가 낮아 위양성의 문제점을 항상 가지고 있다.
따라서, 여전히 민감도와 특이도가 높은 검사법에 대한 수요가 높은 실정이다.
최근에는 돌연변이 유전자의 증폭을 가능하게 하는 PCR 단계의 혁신에 관심이 집중되어있다. 이는 서열분석과 같은 다운스트림 분석의 민감도 및 신뢰도를 크게 개선시킬 수 있다. 예를 들면, REMS-PCR(thermostable restriction endonuclease-mediated selective PCR) (Ward, R., et, al., 1998. Restriction endonuclease-mediated selective polymerase chain reaction: a novel assay for the detection of K-ras mutations in clinical samples. Am J Pathol 153:373-379.), PNA(peptide nucleic acid) (Sun, X et, al., 2002. Detection of tumor mutations in the presence of excess amounts of normal DNA. Nat Biotechnol 20:186-189.) 또는 LNA(locked nucleic acid) (Dominguez, P.L et, al., 2005. Wild-type blocking polymerase chain reaction for detection of single nucleotide minority mutations from clinical specimens Oncogene 24:6830-6834.)-매개 PCR 클램핑법, COLD-PCR(co-amplification at lower denaturation temperature PCR) (Li, J., et, al., 2008. Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nat Med 14:579-584.)등 이다.
REMS-PCR 및 PNA 또는 LNA-매개 PCR 클램핑법은 민감하고 신뢰도가 있었으나, 한정된 이용 가능성 및 고비용 때문에 적용이 제한되었다. 후자인 최근 개발된 COLD-PCR은 수행하기 간단하나, 증폭율이(3-100배) 만족스럽지 못하며, 온도의 미세한 변화에 약한 단점이 있다(Li, J., et, al., 2008. Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nat Med 14:579-584, Luthra, R., et, al., 2009. COLD-PCR finds hot application in mutation analysis. Clin Chem 55:2077-2078.).
이에, 본 발명자들은 일반적으로 사용되는 PCR 시발체와 함께 증폭억제시발체를 사용하여 돌연변이 검사를 하는 경우 민감도와 특이도가 우수함을 확인하고, 본 발명을 완성하였다.
본 발명의 목적은 전방시발체, 후방시발체, 및 증폭억제시발체를 포함하는 돌연변이 유전자 검출용 조성물을 제공하는 것이다.
상기 전방시발체 또는 후방시발체 중 돌연변이 부위에 인접하는 시발체는 시료 내의 유전자 중에 돌연변이된 부위 외의 부위와 상보적 염기 서열의 뉴클레오티드를 포함하고, 상기 증폭억제시발체는 시료 내의 유전자 중 야생형 유전자의 염기 서열 중에 돌연변이 부위에 해당되는 야생형 유전자의 염기 서열과 상보적인 염기 서열의 뉴클레오티드를 포함하며, 일 말단은 상기 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드를 포함하고, 타 말단은 C3-18 스페이서, 바이오틴, 디-데옥시뉴클레오타이드 트리포스페이트, 에틸렌글리콜, 아민 및 인산염으로 이루어진 군에서 선택된 1종 이상의 부착으로 변형된 뉴클레오티드를 포함한다.
본 발명의 다른 목적은 상기 조성물을 포함하는 돌연변이 유전자 검출용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 검출하고자 하는 유전자 돌연변이 부위를 포함하는 유전자 시료에 대하여 전방시발체, 후방시발체, 및 증폭억제시발체를 이용하여 중합효소 연쇄반응을 수행하는 단계; 및 상기 얻어진 중합효소 연쇄반응 산물에 대하여 돌연변이를 확인하는 단계를 포함하는 돌연변이 유전자 검출 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법을 이용한 돌연변이 질환의 진단 방법을 제공하는 것이다.
상기 언급한 바와 같이 본 발명은 미량으로 존재하는 돌연변이 DNA를 효과적으로 검출할 수 있는 방법을 제공하며, 이를 이용하여 종양 등의 DNA 돌연변이 관련 질환의 진단 등에 사용될 수 있다. 구체적으로, 본 발명의 일례는 증폭억제시발체를 PCR 반응에 이용하여 돌연변이 DNA를 선택적으로 증폭시켜 민감도가 높으면서 동시에 특이도도 높은 진단 기술을 제공한다.
도 1은 본 발명의 일반시발체(전방시발체, 후방시발체)와 증폭억제시발체를 사용하여 정상 DNA와 돌연변이 DNA의 검출 과정을 모식적으로 나타낸 것이다. 증폭억제시발체와 타겟 돌연변이 서열의 미스매치는 친화력을 낮춰 일반시발체의 결합 가능성을 증가시켜 돌연변이 서열의 증폭을 가능하게 한다.
도 2는 일반시발체의 위치를 모식적으로 나타낸 것이다.
도 3은 증폭억제시발체의 위치를 모식적으로 나타낸 것이다.
도 4는 EGFR 돌연변이를 가진 DNA를 정상 DNA로 희석(1:1000)한 검체를 증폭억제시발체를 이용하여 PCR한 후 염기서열 분석한 결과를 일반시발체만을 사용하여 PCR한 후 염기서열 분석한 경우와 비교하여 나타낸 것이다.
도 5는 정상 DNA 에 대하여 돌연변이를 가진 DNA를 1:1 및 1:10-2 로 희석한 표본에서 야생형 피크는 나타나지 않으나, 1:10-4 로 희석한 표본에서는 잡종 피크가 존재함을 나타낸 것이다.
도 6은 일반시발체와 돌연변이 위치간 거리(염기수)에 따른 검출 민감도를 나타낸 것이다.
도 7은 증폭억제시발체와 일반시발체의 농도비율에 따른 검출 민감도를 보여주는 그래프이다. x 축은 10pmol의 일반시발체 당 증폭억제시발체의 양을 나타낸 것으로 증폭억제시발체의 양이 증가함에 따라 민감도가 개선되었고, 증폭억제시발체와 일반시발체의 비율이 5:1에서 민감도가 정체기에 이른다.
도 8은 야생형 서열과 일반시발체 이중나선의 용융온도(Tm; ℃)에 따른 검출 민감도를 나타낸 것이다.
도 9는 야생형 서열과 증폭억제시발체 이중나선의 용융온도(Tm; ℃)에 따른 검출 민감도를 나타낸 것이다.
도 10은 증폭억제시발체와 일반시발체의 겹치는 부위 길이(bp)에 따른 검출 민감도를 나타낸 것이다.
도 11은 야생형 서열과 증폭억제시발체 이중나선의 용융온도(Tm)와 PCR 반응의 결합온도(본 실험에서는 59℃)에 따른 검출 민감도를 나타낸 것이다.
PCR 반응의 결합온도(본 실험에서는 59℃)보다 높을 때 더 높은 민감도가 얻어진 반면에, 더욱 높은 용융온도(Tm)에서는 민감도가 상실되었다.
도 12는 돌연변이 서열과 미스매치 증폭억제시발체가 높은 용융온도(Tm-mismatch)를 갖는 경우, PCR 결합 온도(본 실험에서는 59℃)에서 용융되지 않아, 그 결과 낮은(inferior) 민감도를 나타낸 것이다.
도 13은 BRAF V600E, JAK2 V617F, 및 EGFR T790M 돌연변이의 검출을 통해, Tm Tm-mismatch 사이의 차이(ΔTm)와 민감도의 밀접한 연관을 나타낸 것이다. ΔTm이 클수록 높은 민감도를 나타낸 것이다.
도 14는 KRAS 코돈 12의 돌연변이를 검출하는데 있어서, ΔTm은 민감성과 밀접한 관련이 있음을 나타낸 것이다. ΔTm이 클수록 높은 민감도를 나타낸 것이다.
도 15는 소규모 결실/삽입 돌연변이에 대해 일반적으로 야생형 서열에 대한 높은 용융온도(Tm)를 가진 증폭억제시발체가 우수한 민감도를 갖는다.
도 16은 정량적인 real-time PCR 및 HRM 분석에 대하여 MEMO의 적합성을 나타낸 것이다. DNA-포함 형광 염료를 사용한 정량적인 real-time PCR 분석을 통해 검출한 EGFR T790M 돌연변이를 포함하는 연속적인 희석 표본에서, 돌연변이 대립유전자의 농도에 따라 다른 형광 커브를 나타낸 것이다.
도 17은 정량적인 real-time PCR 및 HRM 분석을 네 번 시행하여 얻은 표준 커브로 1.0 x 100부터 1.0 x 10-3 (PCR 효율: 1.45)까지 희석범위에서 일차적인 상호관계(r2=0.991)를 나타낸 것이다.
도 18은 HRM 분석에서 정상 샘플의 용융온도(83.7℃)와 비교할 때 더 높은 돌연변이 대립유전자 농도(1.0 x 100, 1.0 x 10-1, 및 1.0 x 10-2)를 가진 희석물에서 더 높은 용융온도(84.3-84.4℃)를 나타내며, 반면에 적은 돌연변이 대립유전자 농도 (<1.0 x 10-3)를 가진 샘플은 잡종의 용융 커브를 나타낸다.
도 19는 엠프리콘(Amplicons)을 염기서열 분석한 결과, HRM 분석과 결과가 일치하였다(즉, 더 높은 돌연변이 대립유전자 농도를 가진 샘플에서 동형접합 돌연변이 피크를 나타내며, 낮은 돌연변이 대립유전자 농도를 가진 샘플에서 잡종 피크를 나타낸다.).
도 20은 형광 프라이머를 포함하는 MEMO-PCR 및 서열 단편 분석에서 1.0 x 10-6 희석시, EGFR 엑손 19의 15-bp 결실을 확인한 것이다.
도 21은 형광 프라이머를 포함하는 MEMO-PCR 및 서열 단편 분석에서 1.0 x 10-5 희석시, NPM1 엑손 12의 4-bp 삽입을 확인한 것이다.
도 22는 KRAS 돌연변이를 가진 표본에서 MEMO-PCR 및 pyrosequencing에서 민감도의 증가를 나타낸 것이다. (A) 1.0 x 10-2에서 KRAS G12S, (B) 5.0 x 10-3에서 KRAS G12C, (C) 5.0 x 10-2에서 KRAS G12D, (D) 5.0 x 10-3 에서 KRAS G12V, (E)5.0 x 10-2 에서 KRAS G12A 및 (F) 2.0 x 10-2 에서 KRAS G13D.
도 23은 갑상선 종양을 가진 환자로부터의 FNA(fine needle aspirate)샘플에서 DPO-기반의 ARMS-PCR, 통상적인 시퀀싱, 및 시퀀싱을 포함한 MEMO-PCR을 사용하여 서로 다른 BRAF V600E 검출 결과를 나타낸 것이다. PTC를 가진 환자에서 세 가지 방법 모두 BRAF V600E 돌연변이를 검출한 것이다.
도 24는 갑상선 종양을 가진 환자로부터의 FNA(fine needle aspirate)샘플에서 DPO-기반의 ARMS-PCR, 통상적인 시퀀싱, 및 시퀀싱을 포함한 MEMO-PCR을 사용하여 서로 다른 BRAF V600E 검출 결과를 나타낸 것으로, PTC를 가진 두 번째 환자에서 DPO-기반의 ARMS-PCR은 흐린 돌연변이 밴드를 나타냈고, 통상적인 시퀀싱은 거의 눈에 보이지 않는 돌연변이 피크를 나타낸 반면에 MEMO-PCR 방법에서는 동형접합의 돌연변이 피크가 쉽게 검출되었다.
도 25는 갑상선 종양을 가진 환자로부터의 FNA(fine needle aspirate)샘플에서 DPO-기반의 ARMS-PCR, 통상적인 시퀀싱, 및 시퀀싱을 포함한 MEMO-PCR을 사용하여 서로 다른 BRAF V600E 검출 결과를 나타낸 것으로, ARMS-PCR 및 통상적인 시퀀싱에 대해서는 음성이고 오로지 MEMO-PCR 방법을 사용했을 때만 양성으로 판단되었다.
도 26은 EGFR, BRAF 및 JAK 돌연변이 탐지에 사용되는 일반시발체 및 각 증폭억제시발체를 사용하여 달성되는 민감도를 나타낸 것이다.
도 27은 TP53 돌연변이 탐지에 사용되는 일반시발체 및 각 증폭억제시발체를 사용하여 달성되는 민감도를 나타낸 것이다.
도 28은 KRAS 돌연변이 탐지에 사용되는 일반시발체 및 각 증폭억제시발체를 사용하여 달성되는 민감도를 나타낸 것이다.
도 29는 EGFR 및 NPM1 삽입 및 결실 돌연변이의 탐지에 사용되는 일반시발체 및 각 증폭억제시발체를 사용하여 달성되는 민감도를 나타낸 것이다.
본 발명은 낮은 농도로 존재하는 종양 특이 돌연변이 DNA를 효과적으로 검출할 수 있는 방법을 개발하여 종양의 진단, 치료방침 결정, 치료 후 잔존암 검출 등에 임상적으로 이용하기 위하여 안출된 것이다.
본 발명은 한 쌍의 일반 PCR 시발체와 함께 이들 중 어느 하나와 경쟁적인 증폭억제시발체를 이용하여 PCR 반응을 수행함으로써, 돌연변이 DNA를 선택적으로 증폭시켜 민감도가 높으면서 동시에 특이도도 높은 진단 기술을 제공하는 것을 특징으로 한다.
구체적으로, 증폭억제시발체는 야생형 서열에 대해 강하게 결합하지만 돌연변이 서열에 대한 친화력은 미스매치(mismatches)로 인해 현저히 감소한다. 증폭억제시발체의 결합력의 감소는 일반시발체에 의해 돌연변이 서열을 선택적으로 증폭가능하게 한다(도 1).
일 말단 변형 증폭억제시발체에 의한 돌연변이 증폭기술(mutant enrichment with terminal-modified oligonucleotide PCR, MEMO-PCR)을 EGFR, KRAS, BRAF, TP53, JAK2, 및 NPM1 유전자에서 공통적인 암 돌연변이를 검출하는 능력으로 평가하였다. 다운스트림 시퀀싱 분석을 MEMO-PCR과 함께 결합하여 수행함으로써 민감도가 10-1부터 10-7 정도로 달성될 수 있음을 관찰하였다(도 6 내지 도 15).
본 발명에서는 돌연변이 특이 유전자를 선택적으로 증폭하여 검사하는 수단으로서 PCR 억제(clamping)법을 사용하였으며, 이 방법은 야생형 유전자의 염기서열과 상보적인 염기서열을 가지는 증폭억제시발체(blocking primer)를 PCR 반응에 같이 첨가하여 야생형 유전자의 증폭을 억제하는 방법이다. 이와 비슷한 방법으로 기존에 REMS-PCR, locked nucleic acid (LNA), Peptide nucleic acid (PNA) 등을 증폭억제시발체로 사용한 방법이 개발된 적이 있으나, 이와 같은 물질들은 제조가 까다롭고 비용이 매우 비싸 널리 사용되지 못하고 있었다. 또한, COLD-PCR은 증폭률이 만족스럽지 못하며, 온도의 변화에 취약한 단점이 있었다.
이에, 본 발명자들은 상기 단점을 해결하게 위해 연구한 결과, 일반 올리고뉴클레오티드의 일 말단부위를 변형만 하여도 동등한 효과를 낼 수 있음을 발견하였다. 이러한 일 말단 변형 올리고뉴클레오티드는 기존 LNA나 PNA에 비해서 10~20배 이상 저렴한 가격으로 제조할 수 있다는 이점이 있다.
본 발명의 주요 특징은 일 말단 변형 올리고뉴클레오티드를 이용한 PCR 억제법을 사용하여 낮은 농도로 존재하는 돌연변이 DNA를 검출하는 방법으로서, 기존 LNA 및 PNA를 이용한 방법과 동등하거나 보다 나은 효율을 가지면서도 비용은 훨씬 저렴하다는 점이다. 또한, COLD-PCR에 비하여 온도의 변화에 취약하지 아니하며, 돌연변이의 증폭률이 높은 장점을 가진다.
돌연변이 검출 효율을 높이기 위한 최적의 증폭억제시발체 용융온도(melting temperature, Tm)와 농도, PCR 온도, 증폭억제시발체와 일반시발체의 겹치는 부위, 및 Tm 과 Tm-mismatch의 차이값(ΔT)을 찾아내었다는 점도 또 다른 특징이다. 이러한 방법으로 기존 검사법보다 저렴하고 정확하게 종양 특이 유전자를 검사할 수 있다.
이하, 본 발명을 보다 상세히 설명한다.
상기 목적을 달성하기 위한 하나의 양태로서, 전방시발체, 후방시발체, 및 증폭억제시발체를 포함하는 돌연변이 유전자 검출용 조성물에 관한 것으로;
상기 전방시발체 또는 후방시발체 중 돌연변이 부위에 인접하는 시발체는 시료 내의 유전자 중에 돌연변이된 부위 외의 부위와 상보적 염기 서열의 뉴클레오티드를 포함하고,
상기 증폭억제시발체는 시료 내의 유전자 중 야생형 유전자의 염기 서열 중에 돌연변이 부위에 해당되는 야생형 유전자의 염기 서열과 상보적인 염기 서열의 뉴클레오티드를 포함하고, 일 말단은 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드를 포함하고, 타 말단은 C3-18 스페이서, 바이오틴, 디-데옥시뉴클레오타이드 트리포스페이트, 에틸렌글리콜, 아민 및 인산염으로 이루어진 군에서 선택된 1종 이상의 부착으로 변형된 뉴클레오티드를 포함한다.
상기 조성물은 중합효소 연쇄반응(PCR)을 수행하기 위한 것을 특징으로 하는 조성물에 관한 것이다.
또 하나의 양태로서, 본 발명은 상기 조성물을 포함하는 유전자 돌연변이 검출용 키트에 관한 것이다.
또 하나의 양태로서, 본 발명은 검출하고자 하는 유전자 돌연변이 부위를 포함하는 유전자 시료에 대하여, 전방시발체, 후방시발체, 및 증폭억제시발체를 이용하여 중합효소 연쇄반응을 수행하는 단계; 및 상기 얻어진 중합효소 연쇄반응 산물에 대하여 돌연변이를 확인하는 단계를 포함하고,
상기 전방시발체 또는 후방시발체 중 돌연변이 부위에 인접하는 시발체는 시료 내의 유전자 중에 돌연변이된 부위 외의 부위와 상보적 염기 서열의 뉴클레오티드를 포함하고,
상기 증폭억제시발체는 시료 내의 유전자 중 야생형 유전자의 염기 서열 중에 돌연변이 부위에 해당되는 야생형 유전자의 염기 서열과 상보적인 염기 서열의 뉴클레오티드를 포함하고, 일 말단은 상기 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드를 포함하고, 타 말단은 C3-18 스페이서, 바이오틴, 디-데옥시뉴클레오타이드 트리포스페이트, 에틸렌글리콜, 아민 및 인산염으로 이루어진 군에서 선택된 1종 이상의 부착으로 변형된 뉴클레오티드를 포함하는 돌연변이 유전자 검출 방법에 관한 것이다.
또 하나의 양태로서, 상기 방법을 이용한 돌연변이 질환의 진단 방법에 관한 것이다.
본 발명에서 용어, "시료"는 검출하고자 하는 유전자 돌연변이 부위를 포함하는 유전자 시료를 말한다. 구체적으로, 핵 및/또는 미토콘드리아를 포함하여 유전자 분석이 가능한 모든 생물-유래 시료로서, 세포, 조직, 기관, 체액 등, 또는 이들로부터 추출된 내인성 유전자 또는 외인성(exogenous) 유전자 (예컨대, 병원성 박테리아 및/또는 바이러스)일 수 있다. 상기 세포, 조직, 기관, 체액 등은 포유류 (예컨대, 인간, 영장류, 설치류 등)의 환자로부터 채취된 것일 수 있으며, 상기 세포는 바이러스 또는 박테리아 등의 단세포 동물의 세포를 포함할 수 있다. 예컨대, 유전자 돌연변이 검출을 통한 종양 진단을 위한 경우, 상기 유전자 시료는 진단 대상 환자의 세포로부터 추출된 것일 수 있고, 종양 치료 후 잔존 종양 검사를 위한 경우, 상기 유전자 시료는 종양 치료를 받은 환자의 암세포로부터 추출된 것일 수 있으며, 약제 내성 변이 균주 검출을 위한 경우에는 박테리아 또는 바이러스 등의 균주로부터 추출된 것일 수 있다.
상기 시료내의 유전자는 검출하고자 하는 유전자 돌연변이가 존재하는 표적 유전자 (전장 유전자), 또는 상기 표적 유전자 내의 유전자 돌연변이 부위를 포함하는 일부분을 포함하는 것으로, 상기 유전자 돌연변이를 포함하는 일부분은 유전자 돌연변이 부위를 포함하는 약 5 내지 1,000,000 bp, 바람직하게는 약 5 내지 100,000 bp, 더욱 바람직하게는 약 5 내지 5000 bp의 폴리뉴클레오타이드일 수 있다.
본 발명에서 용어, "프라이머"는 짧은 자유 3 말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 또한, 프라이머는 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산으로서, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.
본 발명에서 용어, "전방시발체(forward primer) 및 후방시발체(reverse primer)"는 검출하고자 하는 유전자 돌연변이를 포함하는 유전자 시료의 증폭에 통상적으로 사용되는 일반적인 시발체(일반시발체)를 의미한다. 이러한 전방시발체와 후방시발체는 관련 기술 분야의 통상의 지식을 가진 자가 검출하고자 하는 유전자 돌연변이 및 상기 돌연변이를 포함하는 유전자에 따라서 용이하게 결정할 수 있는 사항이다.
보다 구체적으로, 상기 전방시발체와 후방시발체의 길이는 연속하는 10 내지 50 bp, 바람직하게는 15 내지 35 bp 부위와 상보적인 염기서열을 갖는 10 내지 50 bp, 바람직하게는 15 내지 35 bp의 올리고뉴클레오타이드로서 설계될 수 있다.
본 발명에서 용어, "야생형 유전자"는 자연에서 가장 보편적으로 보이거나 또는 임의의 정상이라고 지정된 대립유전자를 말한다. 본 발명의 목적상 정상 유전자를 의미하며, 실시예에서는 EGFR, BRAF, JAK2, TP53, KRAS, NPM1의 정상 유전자를 사용하였으나, 이에 제한되지 않는다.
본 발명에서 용어, "돌연변이 유전자"는 유전자를 이루는 DNA의 구조에 변화가 생겨서 유전자의 모습이나 성질이 변한 것을 말한다. 실시예에서는 EGFR, BRAF, JAK2, TP53, KRAS, NPM1의 돌연변이 유전자를 사용하였으나, 이에 제한되지 않는다.
본 발명에서 용어 “돌연변이 부위에 인접하는 시발체” 또는 “돌연변이 인접 시발체” 는 전방시발체와 후방시발체 중 돌연변이 부위에 보다 가깝게 위치하는 것으로 상기 시료 내의 유전자 중에 검출하고자 하는 돌연변이 부위는 포함하지 않으면서 돌연변이 부위로부터 일정 거리 떨어진 10 내지 50 bp, 바람직하게는 15 내지 35 bp 부위와 상보적인 서열을 갖도록 설계되는 것을 특징으로 한다.
상기 돌연변이 부위 인접 시발체와 돌연변이 부위와의 거리는 1 내지 30, 바람직하게는 1 내지 20 bp, 더욱 바람직하게는 1 내지 9bp인 것이 좋다(도 6).
전방시발체와 후방시발체 중 돌연변이 부위에서 보다 먼 거리에 위치하는 것은 이에 의하여 증폭되는 증폭부위가 약 5 내지 1,000,000 bp, 바람직하게는 약 5 내지 100,000 bp, 더욱 바람직하게는 약 5 내지 5000 bp의 폴리뉴클레오타이드가 되도록 설계된 10 내지 50 bp, 바람직하게는 15 내지 35 bp의 올리고뉴클레오타이드일 수 있다.
본 발명에서 용어, "증폭억제시발체"는 하기 특징을 포함한다:
(A). 시료내의 유전자 중 야생형 유전자의 염기 서열 중에 돌연변이 부위에 해당되는 야생 유전자의 염기서열과 상보적인 염기서열의 뉴클레오티드를 포함한다. 따라서, 야생형 유전자에 결합하여 일반시발체의 결합을 방해함으로써 야생형 유전자가 증폭되는 것을 억제한다. 그러나, 돌연변이를 갖는 유전자에는 일반시발체가 특이적으로 결합하여 유전자를 증폭함으로써 돌연변이 유전자의 검출 민감도 및 특이성을 높이는 역할을 하는 것이다.
(B). 증폭억제시발체의 일 말단은 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드를 포함한다. 돌연변이 부위에 인접하는 시발체가 전방 시발체이면 상기 일 말단은 5' 말단이고 후방시발체이면 상기 일 말단은 3' 말단이다. 상기 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드는 돌연변이 부위에 인접하는 시발체와 중복되는 부위의 뉴클레오티드를 말하며, 돌연변이를 갖는 유전자는 상기 돌연변이 부위에 인접하는 시발체의 결합으로 이 시발체의 돌연변이 부위에 인접하는 말단 부위에 연속하여 뉴클레오티드가 증폭되나, 야생형 유전자에는 상기 돌연변이에 인접하는 시발체의 말단 부위 대신에 경쟁적으로 증폭억제시발체의 일 말단이 결합되어 있어 야생형 유전자는 증폭될 수 없다. 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드의 길이는 3 bp 이상이며, 예컨대, 3 내지 50 bp, 3 내지 35 bp, 5 내지 50 bp, 또는 5 내지 35 bp일 수 있다. 바람직하게는 3 내지 13bp일 수 있다. 3bp 미만인 경우 충분한 민감도를 얻지 못한다(도 10).
또한, (C). 상기 증폭억제시발체의 말단은 변형되어 PCR에 의한 증폭이 차단된 것을 특징으로 한다. 돌연변이 부위에 인접하는 시발체가 전방 시발체이면 상기 타 말단은 3' 말단이고 후방시발체이면 상기 타 말단은 5' 말단이다. 상기 말단 변형은 증폭억제시발체의 말단에 C3-18 스페이서(3-18개의 탄소가 연속적으로 연결된 구조물) (예컨대, C3-스페이서(C3-spacer; 3 개의 탄소가 연속으로 연결된 구조물), C6 스페이서(C6-spacer; 6 개의 탄소가 연속으로 연결된 구조물), C12 스페이서(C12-spacer; 12 개의 탄소가 연속으로 연결된 구조물), C18 스페이서(C18-spacer; 18 개의 탄소가 연속으로 연결된 구조물)), 바이오틴 (Biotin), 디-데옥시뉴클레오타이드 트리포스페이트(di-deoxynucleotide triphosphate, ddNTP), 에틸렌글리콜 (ethylene glycol), 아민(amine), 및 인산염(phosphate) 등으로 이루어진 군에서 선택된 1종 이상을 부착하여 수행하는 것일 수 있다. 본 발명에서는 C3 스페이서, 인산염, 및 C6 아민을 이용한 3'-변형의 억제 효율을 조사한 결과, 이들 사이에는 비슷한 민감도를 나타냈다(실시예 2). 증폭억제시발체는 말단이 변형되어 있어, 일반 시발체처럼 결합된 야생형 유전자를 증폭시키지 못한다.
앞서 설명한 바와 같이, 본 발명은 일반적으로 사용되는 전방시발체와 후방시발체 쌍과 증폭억제시발체를 경쟁적으로 반응시켜 야생형 유전자의 경우 증폭억제시발체가 우선적으로 결합하여 전방시발체 및 후방시발체에 의한 유전자 증폭이 이루어지지 못하게 하는 반면, 검출하고자 하는 돌연변이를 갖는 유전자에서는 상기 증폭억제시발체보다 전방시발체 및 후방시발체 중 돌연변이 부위 인접 시발체가 우선적으로 결합하여 정상적인 증폭이 일어나도록 하는 것이 중요하다.
이와 같은 돌연변이 유전자 검출용 조성물은 PCR을 수행하기 위한 것일 수 있다. 본 발명의 용어, "PCR" 은 검출을 원하는 특정 표적 유전물질을 증폭하는 방법으로 중합효소 연쇄반응의 변형 방법으로 RNA를 대상으로 역전사효소를 이용하여 complementary DNA를 합성하고, 이를 주형으로 이용하여 중합효소 연쇄반응을 시행하는 역전사 중합효소 연쇄반응(reverse transcriptase polymerase chain reaction, RT-PCR)과 형광물질을 사용하여 DNA를 증폭시키면서 증폭산물을 동시에 검출하는 실시간 중합효소 연쇄반응 등을 포함한다.
이와 같은 야생형 유전자와 돌연변이 유전자 간 상이한 반응 우선성을 달성하기 위하여 돌연변이 인접 시발체와 증폭억제시발체의 용융온도가 중요한 요인이 될 수 있다.
목적하는 반응을 달성하기 위하여, 증폭억제시발체와 경쟁관계에 있는 돌연변이 인접 시발체의 용융온도(Tm)은 65℃ 이하, 바람직하게는 62℃ 이하, 예컨대, 55 내지 65℃, 또는 55 내지 62℃, 바람직하게는 55 내지 62℃, 또는 58 내지 62℃인 것이 바람직하고(도 8), 증폭억제시발체의 용융온도는 상기 돌연변이 부위 인접 시발체의 용융온도보다 0℃ 이상, 바람직하게는 2℃ 이상, 예컨대, 0 내지 12℃, 바람직하게는 2 내지 12℃ 높은 것이 바람직하다(도 9).
또한, 상기 조성물의 중합효소 연쇄반응시 결합온도가 야생형 유전자와 증폭억제시발체 이중나선의 용융온도보다 낮고 돌연변이 유전자와 증폭억제시발체 이중나선의 용융온도보다 높은 것이 바람직하다(도 11 내지 도 15).
야생형 서열과 증폭억제시발체 이중나선의 용융온도(Tm) 값에 비해 매우 낮은 돌연변이 서열과 미스매치 증폭억제시발체 이중나선의 용융온도(Tm-mismatch)값을 갖는 경우, 돌연변이 서열에 대한 증폭억제시발체의 결합능력이 현저히 떨어지게 되어 일반시발체와의 경쟁에서 지게 되므로 일반시발체의 결합 가능성을 증가시켜 돌연변이 서열의 증폭이 가능하게 되어, 돌연변이와 정상서열의 구별능력이 향상된다. 이러한 효과는 돌연변이 서열과 미스매치 증폭억제시발체의 용융온도(Tm-mismatch)가 PCR 반응의 결합온도(annealing temperature)보다 낮을 때 더 커질 수 있다(도 13 및 14).
또한, 상기 PCR 조건도 최적화하는 것이 바람직한데, 예컨대, 아래의 조건으로 할 수 있다.
94℃, 5분 (1 회),
94℃, 30초 - 59 ℃, 30초 - 72 ℃, 30초 내지 60초(50 회),
72℃, 7분 (1회).
상기와 같은 PCR 조건은 목적하는 반응에 따라서 다양하게 변형 가능하며, 이러한 최적 조건은 관련 기술분야의 통상의 지식을 가진 자가 용이하게 채택할 수 있는 사항이다.
또한, 상기 조성물 내 상기 돌연변이 부위에 인접하는 시발체와 상기 증폭억제발체의 몰농도 비는 1:5 내지 1:50인 것을 특징으로 하는 조성물이다. 돌연변이 인접 시발체 농도(mol)를 기준으로, 증폭억제시발체의 농도가 증가할수록 민감도가 증가하고, 증폭억제시발체가 약 1배 이상이면 소망하는 검출 효율을 얻을 수 있고, 약 5배 이상인 경우 민감도에 큰 차이가 없는 것으로 나타나서, 1배 이상, 또는 5배 이상인 것이 좋다. 돌연변이 인접 시발체 농도(mol)에 대한 증폭억제시발체 농도의 상한값은 특별한 제한이 없으며, 시료 사용량의 경제성을 고려하여, 약 50배 정도까지 사용 가능하며, 예컨대, 증폭억제시발체의 농도는 돌연변이 인접 시발체 농도(mol)를 기준으로 1 내지 50배, 예컨대, 1 내지 10배, 5 내지 50배 또는 5 내지 10배일 수 있다(도 7).
전방시발체와 후방시발체의 사용 농도(mol)는 특별한 제한이 없으며, 예컨대 1:50 내지 50:1, 구체적으로 1:10 내지 10:1, 보다 구체적으로 1:5 내지 5:1로 할 수 있으나 이에 제한되는 것은 아니며, 반응 효율과 사용 시료의 경제성을 고려하여, 1:2 내지 2:1, 예컨대 동일 비율로 사용하는 것이 좋다.
본 발명에서 용어, "돌연변이"는 특별한 제한 없이 모든 종류의 핵 및/또는 미토콘드리아의 유전자 돌연변이를 포함하며, 점 돌연변이 및 소규모 삽입 또는 결실 (small insertion/deletion) (예컨대, 1-50 bp의 삽입 또는 결실) 등을 포함한다. 본 발명에 의하여 검출 가능한 유전자 돌연변이의 종류에는 크게 한정은 없으며, 모든 종류의 돌연변이일 수 있으며, 예컨대, 종양 특이적 돌연변이(종양의 진단에 유용), 미토콘드리아 돌연변이(미토콘드리아성 질환의 진단에 유용), 또는 병원성 박테리아 및/또는 바이러스에 약제 내성을 부여하는 돌연변이(특히, 낮은 농도로 존재하는 병원성 박테리아 및/또는 바이러스의 약제 내성 균주 검출 및 상기 병원성 박테리아 및/또는 바이러스 관련 질환의 진단에 유용) 등일 수 있으나, 이에 제한되는 것은 아니다.
상기 종양 특이적 돌연변이는 예컨대, 갑상선암, 위암, 대장암, 폐암, 피부암, 식도암, 구강암, 췌장암, 담도암, 간암, 후두암, 자궁암, 난소암, 유방암, 전립선암, 뇌종양, 신경세포암, 골종양 등 각종 고형암과 골수증식성 질환 및 백혈병을 포함한 혈액암 등으로 이루어진 군에서 선택된 종양에 특이적인 돌연변이일 수 있고, 바이러스 감염, 미토콘드리아 질환 등에도 적용가능하나, 이에 제한되는 것은 아니다.
상기 종양 특이적 돌연변이는 예컨대, KRAS (Kirsten rat sarcoma 2 viral oncogene homolog, NM_004985) 유전자, APC (Adenomatous polyposis coli; NM_000038), BRAF (Murine sarcoma viral (v-raf) oncogene homolog B1; NM_004333), BRCA1 (Breast cancer-1 gene; NM_007295), BRCA2 (Breast cancer-2, early onset; NM_000059), CDH1 (Cadherin-1 (E-cadherin; uvomorulin); NM_004360), CDKN2A (Cyclin-dependent kinase inhibitor 2A (p16, inhibits CDK4); NM_000077), CTNNB1 (Catenin (cadherin-associated protein), beta 1, 88kD; NM_001098209), CYLD1 (Cylindromatosis gene; NM_015247), EGFR (Epidermal growth factor receptor; NM_005228), ERBB2 (Avian erythroblastic leukemia viral (v-erb-b2) oncogene homolog 2; NM_004448), FAM123B (Family with sequence similarity 123, member B; NM_152424), FBXW7 (F-box and WD40 domain protein 7; NM_018315), FGFR3 (Fibroblast growth factor receptor-3; NM_022965), FLCN (Folliculin; NM_144606), FLT3 (fms-related tyrosine kinase-3; NM_004119), HRAS (Harvey rat sarcoma viral (v-Ha-ras) oncogene homolog; NM_005343), IDH1 (Isocitrate dehydrogenase, soluble; NM_005896), JAK2 (Janus kinase 2 (a protein-tyrosine kinase); NM_004972), SMCX (Selected cDNA on X, mouse, homolog of; NM_004187), MLH1 (mutL, E. coli, homolog of, 1; NM_000249), MSH2 (mutS, E. coli, homolog of, 2; NM_000251), MSH6 (MutS, E. coli, homolog of, 6; NM_000179), NF1 (Neurofibromin (neurofibromatosis, type I); NM_001128147), NF2 (Merlin; NM_181825), NOTCH1 (Notch, Drosophila, homolog of, 1, translocation-associated; NM_017617), NPM1 (Nucleophosmin 1 (nucleolar phosphoprotein B23, numatrin); NM_001037738), NRAS (Neuroblastoma RAS viral (v-ras) oncogene homolog; NM_002524), NTRK3 (Neurotrophic tyrosine kinase, receptor, type 3; NM_002530), PALB2 (Partner and localizer of BRCA2; NM_024675), PDGFRA (Platelet-derived growth factor receptor, alpha polypeptide; NM_006206), PIK3CA (Phosphatidylinositol 3-kinase, catalytic, alpha polypeptide; NM_006218), PTEN (Phosphatase and tensin homolog (mutated in multiple advanced cancers; NM_000314), RB1 (Retinoblastoma-1; NM_000321), RET (RET transforming sequence; oncogene RET; NM_020630), RUNX1 (Runt-related transcription factor 1 (aml1 oncogene); NM_001754), SMAD4 (Mothers against decapentaplegic, Drosophila, homolog of, 4; NM_005359), SOCS1 (Suppressor of cytokine signaling 1; NM_003745), STK11 (Serine/threonine protein kinase-11; NM_000455), TP53 (Tumor protein p53; NM_001126116), TSC1 (Hamartin (tuberous sclerosis 1 gene); NM_000368), UTX (Ubiquitously-transcribed TPR gene on X chromosome; NM_021140), VHL (VHL gene; NM_000551) 유전자로 이루어진 군에서 선택된 유전자에서 발생하는 돌연변이(종양 특이적 돌연변이)일 수 있으나, 이에 제한되는 것은 아니다.
보다 구체적으로, 상기 종양 특이적 돌연변이는 예컨대, EGFR(L858R, T790M 및 Del15), BRAF(V600E), JAK(V617F), TP53(R175H, R248Q/R248W, R273H/R273C), KRAS(G123/G12C, G12D, G12A, G13D) 및 NPMI(Ins4)로 이루어진 군에서 선택된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 박테리아 및/또는 바이러스 질환은 각종 박테리아 및/또는 바이러스 감염에 의한 질환으로 대표적으로 간염, 담낭염, 췌장염, 위염, 장염, 방광염, 신장염, 신우신염, 피부염, 근염, 질염, 요도염, 전립선염, 폐렴, 기관지염, 인후두염, 비염, 각막염, 홍채염, 결막염, 중이염, 뇌수막염, 뇌염 등을 들 수 있으며, 이 질환의 진단과 관련된 돌연변이는 대표적으로 라미부딘 (lamivudine) 약제 내성과 연관된 tyrosine-methionine-aspartate-aspartate (YMDD) motif, 또는 내성부위를 포함한 B형 간염 바이러스의 약제내성 돌연변이 (예를 들어, B형 간염 유전자 중 코돈 528 과 코돈 529에 존재하는 점 돌연변이), 또는, 백신 면역 실패와 관련된 S 항원 유전자의 돌연변이 등일 수 있으나, 이에 제한되는 것은 아니다. 본 발명에 의하는 경우, 상기 돌연변이를 갖는 바이러스가 아주 낮은 농도로 존재하는 경우에도 효과적으로 검출할 수 있다.
미토콘드리아 질환에는 대표적으로 MELAS (Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke), MERRF (Myoclonic Epilepsy with Ragged Red Fibers), CPEO (Chronic progressive external ophthalmoplegia) 등이 있으나 이에 제한된 것은 아니다. 이 질환의 진단과 관련된 돌연변이는 MELAS, MERRF, CPEO 등에서 흔하게 관찰되는 점 돌연변이들일 수 있으며, 이러한 돌연변이는 관련 기술 분야에 잘 알려져 있다.
상기 "유전자 중의 돌연변이 부위"는 상기 검출하고자 하는 유전자 돌연변이가 발생하는 부위를 의미한다.
상기 돌연변이를 확인하는 단계는 통상적으로 사용되는 모든 돌연변이 확인 방법에 의할 수 있으며, 특별한 제한은 없다. 예컨대, 염기서열분석법(direct sequencing), Taqman 소식자(probe)법, 용융온도분석법 (melting temperature analysis), 대립유전자특이 증폭법(allele-specific PCR), 제한효소절편길이다형성법(Restriction Fragment Length Polymorphism; RFLP), ARMS (amplification refractory mutation system), ASPCR (allele-specific enzymatic amplification), ASA (allele-specific amplification), PASA (PCR amplification of specific alleles), PAMSA PCR amplification of multiple specific alleles), COP (competitive oligonucleotide priming), E-PCR (enriched PCR), ME-PCR (mutant-enriched PCR), MAMA (mismatch amplification mutation assay), MASA (mutant allele specific amplification), aQRT-PCR (antiprimer quenching-based real-time PCR), REMS-PCR (restriction endonuclease mediated selective PCR), AIRS (artificial introduction of a restriction site), PNA (peptide nucleic acid), LNA (locked nucleic acid), WTB-PCR (wild-type blocking PCR), FLAG (fluorescent amplicon generation), RSM-PCR (restriction site mutation PCR), APRIL-ATM (amplification via primer ligation, at the mutation), PAP (pyrophosphate-activated polymerization), RMC (random mutation capture), CCM (chemical cleavage of mismatches), HRM (high-resolution melting), HET (heteroduplex analysis), SSCP (single-strand conformation polymorphism), DGGE (denaturing gradient gel electrophoresis), CDCE (constant denaturing capillary electrophoresis), dHPLC (denaturing HPLC), iFLP (inverse PCR-based amplified RFLP), COLD-PCR (coamplification at lower denaturation temperature PCR) 등으로 이루어진 군에서 선택된 1종 이상의 방법으로 돌연변이를 확인할 수 있으나 이에 제한되는 것은 아니다.
본 발명의 다른 양태는, 상기와 같은 유전자 돌연변이 검출 방법을 수행하여 유전자 돌연변이 관련 질환, 예컨대, 종양, 미토콘드리아 질환, 또는 박테리아 및/또는 바이러스성 질환을 진단하는 방법을 제공한다.
상기한 바와 같이, 상기 유전자 돌연변이는 종양 특이적이거나, 미토콘드리아 또는 약제 내성 박테리아 및/또는 바이러스에 특이적이므로 환자로부터 얻어진 유전자 시료에 대하여 상기 유전자 돌연변이 검출방법을 수행하여 해당 유전자 돌연변이가 확인되면 그 환자를 해당 유전자 돌연변이와 관련된 질환을 갖는 환자로 진단할 수 있다.
본 발명에 따른 유전자 돌연변이 관련 질환의 진단 방법으로 진단 가능한 질환의 종류는 검출대상 유전자 돌연변이에 따라 결정되며, 모든 종류의 유전자 돌연변이 관련 질환일 수 있으며, 예컨대, 종양의 경우, 갑상선암, 위암, 대장암, 폐암, 피부암, 식도암, 구강암, 췌장암, 담도암, 간암, 후두암, 자궁암, 난소암, 유방암, 전립선암, 뇌종양, 신경세포암, 골종양 등 각종 고형암과 골수증식성 질환 및 백혈병을 포함한 혈액암 등으로 이루어진 군에서 선택된 것일 수 있고, 박테리아 및/또는 바이러스성 질환의 경우, 각종 박테리아 및/또는 바이러스의 감염, 예컨대, 간염, 담낭염, 췌장염, 위염, 장염, 방광염, 신장염, 신우신염, 피부염, 근염, 질염, 요도염, 전립선염, 폐렴, 기관지염, 인후두염, 비염, 각막염, 홍채염, 결막염, 중이염, 뇌수막염, 뇌염 로 이루어진 군에서 선택된 것일 수 있으며, 미토콘드리아 질환의 경우, MELAS (Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke), MERRF (Myoclonic Epilepsy with Ragged Red Fibers), CPEO (Chronic progressive external ophthalmoplegia) 등일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 돌연변이 검출 및 종양 진단 대상 환자는 포유류, 예컨대 인간, 영장류, 설치류 등일 수 있으며, 유전자 시료는 상기 환자로부터 분리된 전체 DNA 시료, 검출대상 돌연변이가 존재하는 해당 유전자만 분리된 시료, 또는 상기 유전자 중 돌연변이가 존재하는 부위를 포함하는 약 5 내지 1,000,000 bp, 바람직하게는 약 5 내지 100,000 bp, 더욱 바람직하게는 약 5 내지 5000 bp의 폴리뉴클레오타이드를 포함하는 것일 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명한다. 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 제한되는 것은 아니다.
실시예 1: DNA 시료 준비
Roche사의 High Pure PCR Template Preparation Kit을 사용하며 다음의 단계를 수행하여 종양세포주 (cancer cell line; HEL, JAK2 돌연변이 세포주; Mia PaCa, KRAS 돌연변이 세포주; H1975, EGFR 돌연변이 세포주; SNU-790, BRAF 돌연변이 세포주; CCRF-CEM, Kasumi-1, MIA PaCa-2, H1975 및 SNU-1196, TP53 돌연변이 세포주; 환자샘플, NPMI 돌연변이 세포주; 모든 세포주는 American Type Culture Collection 또는 한국세포주은행에서 입수하고, 잘 알려지지 않은 EGFR T790M 변이를 가진 세포주는 삼성의학연구소의 혈액종양학과서 얻었다.)와 정상인(29세 건강한 여성)의 말초혈액으로부터 DNA를 추출하였다. 채취한 각각의 검체 200ul에 Binding Buffer (Roche Diagnostics, Mannheim, Germany) 200ul와 Proteinase K(Roche Diagnostics) 40ul를 넣고 혼합한 후, 70℃에서 10분간 인큐베이팅 하였다. 여기에, 이소프로판올 100ul을 넣고 잘 섞어주었다. 수집관(collection tube)에 필터 튜브(High Filter tube, Roche Diagnostics)를 넣고, 여기에 상기 준비된 검체 시료를 옮기고, 8000g에서 1분간 원심분리 하였다.
원심분리 후, 수집관에서 필터 튜브를 제거하고 여과된 액체를 버리고, 상기 제거된 필터 튜브를 새로운 수집관에 넣었다. 여기에 Wash Buffer(Roche Diagnostics) 500ul를 넣고 8000g에서 1분간 원심분리 하였다. 상기 Wash Buffer 첨가 및 원심분리 과정을 1회 더 반복하였다. 잔존하는 Wash Buffer를 제거하기 위해 최고 원심력으로 10초간 회전시켰다. 필터 튜브를 새로운 마이크로 튜브에 넣고 prewarmed Elution Buffer(Roche Diagnostics) 200ul를 가한 후 8000g에서 1분간 원심분리 하였다. 이와 같이 추출된 DNA는 검사에 사용하기까지 냉동 보관하였다.
실시예 2: 증폭억제시발체의 제작과 3' 변형
PCR 증폭은 2개의 일반시발체(전방시발체와 후방시발체)와 하나의 증폭억제시발체를 사용하였으며, 증폭억제시발체는 타겟 변이부분을 포함하고 있으며, 하나의 일반시발체와 겹쳐지게 구성하였다. 도 26 내지 도 29에 EGFR, BRAF, JAK2, TP53, KRAS, NPM1 유전자 돌연변이 탐지에 사용되는 일반시발체 및 증폭억제시발체를 나타내었다. 각 증폭억제시발체의 3’ 말단은 제조사의 지침에 따라 C3 스페이서, 포스페이트, 또는 C6 아민(모두 바이오니아, 한국)의 추가로 변형하였다. 각각에 대한 변형의 증폭억제 효율을 테스트한 결과 민감도에서 3개 변형에 있어서 큰 차이를 볼 수 없었다. 따라서, 이하 모든 실험에서 증폭억제시발체에 C3 스페이서를 사용하였다.
실시예 3: 중합효소 연쇄반응(PCR) 증폭
상기 실시예 1에서 준비한 DNA 시료를 이용하여 중합효소 연쇄반응법을 시행하였다. 사용한 시발체는 각 실시예에 기재하였다.
상기 실시예 1에서 준비된 DNA 시료 1 ul, 멸균증류수 16 ul, 3종류 시발체 각 1 ul, 및 AccuPower PCR Premix(바이오니아, 한국)를 혼합하여 다음의 조건에서 중합효소 연쇄반응을 실시하였다(이하, 다른 돌연변이 검출시에도 동일한 조건을 적용하였음).
< 중합효소 연쇄반응 조건 >
95℃, 5분 (1 회),
94℃, 30초 - 59 ℃, 30초 - 72 ℃, 30초 (50 회),
72℃, 7분 (1회).
상기 중합효소 연쇄반응으로 얻어진 유전자의 증폭산물을 전기영동법을 이용하여 증폭 성공여부를 확인하였다. 증폭산물을 Big Dye Terminator Cycle Sequencing Ready Reaction kit(Applied Biosystems)로 처리한 후, ABI Prism 3100 Genetic Analyzer로 염기서열분석을 하였다. 나온 결과를 Sequencher 프로그램으로 정상염기서열과 비교분석하여 돌연변이 존재 여부를 확인하였다.
실시예 4: 돌연변이 확인 시험
EGFR T790M 돌연변이 검출을 위하여, 실시예 1에서 준비된 세포주 중 H1975 종양세포주에서 추출한 DNA를 정상 DNA(정상인의 동의를 얻어 채취)로 희석(1:1000)한 검체 시료에 대하여 다음의 3종의 시발체를 사용하여 상기 실시예 3의 방법 및 조건으로 PCR 분석을 수행한 결과를 일반시발체만을 사용한 경우와 비교하여 도 4에 나타내었다.
- EGFR T790M 돌연변이 검출용 시발체 -
전방시발체: 5'-CACCGTGCAGCTCATCA-3' (서열번호 1)
후방시발체: 5'-cacatatccccatggcaaac-3' (서열번호 2)
증폭억제시발체: 5'-GCAGCTCATCACGCAGCTC-3' (서열번호 3; 3' 말단이 C3 스페이서로 변형됨,
도 4의 위쪽은 EGFR 돌연변이를 가진 DNA를 정상 DNA로 희석(1:1000)한 검체를 서열번호 1 및 2의 일반시발체만을 사용하여 PCR하여 염기서열 분석한 결과를 보여주는 것이고, 아래쪽은 서열번호 1 및 2의 일반시발체를 증폭억제시발체 (서열번호: 3)와 함께 사용하여 PCR한 후, 염기서열 분석한 결과를 보여주는 것이다. EGFR 돌연변이 위치에 정상 염기는 시토신(cytosine; --- 피크)이며 돌연변이 염기는 티미딘(thymidine; ㅡ 피크)이다.
도 4에서 확인되는 바와 같이, 일반시발체만을 사용하여 PCR한 후 염기서열을 분석한 경우, 돌연변이 DNA를 가진 시료에서 정상인 시토신 피크만 관찰되는 반면, 증폭억제시발체를 함께 사용하여 PCR한 후, 염기서열을 분석한 경우에는 돌연변이 피크가 정확하게 관찰되는 것을 확인할 수 있었다.
또한, 정상 DNA당 돌연변이 DNA를 1.0×100, 1.0×10-1, 1.0×10-2, 1.0×10-3 비율로 희석한 검체에서 상기 서열번호 1 및 2의 일반시발체 및 서열번호 3의 증폭억제시발체를 함께 사용하여 PCR한 후, 염기서열을 분석하였다(도 5). 1.0×100, 1.0×10-1, 1.0×10-2의 희석비율에서 야생형 피크의 부재를 관찰하였으며, 더 높은 비율로 희석된 1.0×10-4 비율에서 잡종피크의(heterozygous peak) 존재를 관찰할 수 있었다. 즉, 정상 DNA 당 돌연변이 DNA의 비율이 높을수록 민감도가 증가한다.
실시예 5: 최적의 검출 민감도를 위한 조건의 탐색
높은 검출 민감도를 얻기 위한 최적의 조건을 탐색하기 위하여, 다음과 같은 시험을 수행하였다. 검출 민감도는 "염기서열분석에서 돌연변이 피크가 20% 이상으로 관찰된 것들 중 가장 낮은 희석농도"로 정의하였다.
5-1: 일반시발체 위치에 따른 검출 민감도 시험
일반시발체와 돌연변이 위치간의 거리에 따른 검출 민감도를 알아보기 위하여, 일반 전방시발체와 돌연변이 위치 간 거리(염기수)를 변화시키면서 아래와 같은 시험을 수행하였다.
보다 구체적으로, JAK2 V617F, KRAS G12D, 및 EGFR T790M 돌연변이 위치와 일반 전방시발체와의 위치간 거리(염기수)에 따른 검출 민감도를 알아보기 위하여, 다음의 표 1 내지 표 3에 기재된 시발체를 사용하여 상기 실시예 3의 방법 및 조건으로 PCR한 후, 염기서열 분석을 수행하였다. 수행 결과 얻어진 검출 민감도를 아래의 표 1 내지 표 3 및 도 6에 나타내었다.
표 1 내지 표 3 및 도 6에서 알 수 있는 바와 같이, 일반시발체(전방시발체)와 돌연변이 위치간 거리가 1 내지 9 염기인 경우가 적당하며, 이 범위에서 민감도에 큰 차이가 없었다.
5-2: 일반시발체와 증폭억제시발체의 농도 비율에 따른 검출 민감도 시험
일반시발체 농도 대비 증폭억제시발체의 농도 비율에 따른 검출 민감도를 알아보기 위하여, 다음의 4종의 시발체 세트를 사용하여 돌연변이 인접 시발체 농도에 대한 증폭억제시발체 몰농도(molar concentration)를 1배 ~ 10배까지 변화시키면서 실시예 3의 방법에 따라서 검출 민감도를 측정하였다.
- JAK2 V617F 돌연변이 검출용 시발체 -
전방시발체: 5'-CAAGCATTTGGTTTTAAATTATGG-3' (서열번호 5)
후방시발체: 5'-tgaaaaggccagttattccaa-3' (서열번호 14)
증폭억제시발체: 5'-GGAGTATGTGTCTGTGGAGACGAG-3' (서열번호 15; 3' 말단이 C3 스페이서로 변형됨).
- KRAS G12D 돌연변이 검출용 시발체 -
전방시발체: 5'-CTGAATATAAACTTGTGGTAGTTGGAG-3' (서열번호 16)
후방시발체: 5'-ttgaaacccaaggtacatttca-3' (서열번호 21)
증폭억제시발체: 5'-TAGTTGGAGCTGGTGGCGTAG-3' (서열번호 22; 3' 말단이 C3 스페이서로 변형됨).
- EGFR T790M 돌연변이 검출용 시발체 -
전방시발체: 5'-CACCGTGCAGCTCATCA-3' (서열번호 23)
후방시발체: 5'-cacatatccccatggcaaac-3' (서열번호 28)
증폭억제시발체: 5'-GCAGCTCATCACGCAGCTC-3' (서열번호 29; 3' 말단이 C3 스페이서로 변형됨).
- BRAF V600E 돌연변이 검출용 시발체 -
전방시발체: 5'- cagtaaaaataggtgattttggtctagc -3' (서열번호 55)
후방시발체: 5'- ctgatttttgtgaatactgggaact -3' (서열번호 61)
증폭억제시발체: 5'-ggtgattttggtctagctacagTga3-3' (서열번호 93; 3' 말단이 C3 스페이서로 변형됨).
이와 같이 얻어진 결과를 도 7에 나타내었다. 도 7에서 알 수 있는 바와 같이, 일반시발체 대비 증폭억제시발체의 농도가 증가할수록 민감도가 증가하는 경향을 보이며 5배 이상의 농도에서는 민감도의 차이가 없었다. 따라서, 일반시발체 대비 5배 이상 농도로 증폭억제시발체를 첨가하는 것이 가장 좋은 결과를 보여준다고 할 수 있다.
5-3: 일반시발체의 용융온도에 따른 검출 민감도 시험
일반시발체의 용융온도에 따른 검출 민감도를 알아보기 위하여 다음의 3종의 시발체 세트를 사용하여 일반 전방시발체(돌연변이 인접 시발체)의 용융온도(melting temperature, Tm, ℃)를 58 내지 66℃로 변화시키면서 실시예 3의 방법으로 검출 민감도를 측정하였다. 사용된 종양세포주와 시발체를 아래의 표 4 내지 표 7에 정리하였으며, 얻어진 결과를 도 8에 나타내었다.
5-4: 증폭억제시발체의 용융온도에 따른 검출 민감도 시험
증폭억제시발체의 용융온도에 따른 검출 민감도를 알아보기 위하여 다음의 3종의 시발체 세트를 사용하여 증폭억제시발체의 용융온도를 58 내지 70 ℃로 변화시키면서 실시예 3의 방법으로 검출 민감도를 측정하였다. 사용된 종양세포주와 시발체를 아래의 표 8 내지 표 10에 정리하였으며, 얻어진 결과를 도 9에 나타내었다.
도 9에서 알 수 있는 바와 같이, 대체적으로 증폭억제시발체의 용융온도(Tm)가 높을수록 민감도가 증가하는 경향을 보이며, 도 8에 도시된 일반시발체의 용융온도보다 2℃ 이상 높게 설정하는 것이 바람직한 것으로 나타났다.
5-5: 용융온도(Tm) 및 돌연변이서열과 미스매치 증폭억제시발체의 용융온도(Tm-mismatch)에 따른 검출 민감도 시험
정상서열과 증폭억제시발체 이중나선의 용융온도(Tm) 값에 비해 매우 낮은 돌연변이서열과 미스매치 증폭억제시발체 이중나선의 용융온도(Tm-mismatch) 값을 갖는 경우, 돌연변이 서열에 대한 증폭억제시발체의 결합능력이 현저히 떨어지게 되어, 일반시발체와 경쟁에서 지게 되므로 일반시발체의 결합 가능성을 증가시켜 돌연변이 서열의 증폭이 가능하게 되어 돌연변이와 정상서열의 구별 능력이 향상된다. 정상서열과 증폭억제시발체 이중나선의 용융온도와, 돌연변이 서열과 미스매치 증폭억제시발체 이중나선의 용융온도의 차이인 ΔTm 값과 민감도의 관계를 실험한 결과, ΔTm이 적은 돌연변이(예를 들어, BRAF V600E)는 민감도가 적당한 반면, ΔTm이 큰 돌연변이(예를 들어, EGFR T790M)는 탁월한 민감도를 나타냈다. 이러한 경향은 KRAS 코돈 12 및 13의 다양한 돌연변이에서 더욱 명백하였다(도 13 및 도 14). 소규모 결실/삽입 돌연변이에서 일반적으로 정상서열에 대한 높은 Tm을 가진 증폭억제시발체가 우수한 민감도를 나타낸다(도 15).
돌연변이서열과 미스매치 증폭억제시발체의 용융온도(Tm-mismatch)가 PCR 반응의 결합온도(annealing temperature)보다 낮을 때 민감도가 더 커질 수 있다. 돌연변이서열과 미스매치된 증폭억제시발체는 결합단계 동안에 분리되어야 하나, 돌연변이서열과 미스매치된 증폭억제시발체의 용융온도(Tm-mismatch)가 결합온도 보다 높은 경우, 결합온도에서 증폭억제시발체는 돌연변이 DNA에 붙어 있게 되어 일반시발체의 결합을 방해하므로 돌연변이 서열과 증폭억제시발체 이중나선의 용융온도는 PCR 반응의 결합온도보다 낮은 것이 좋다.
실험결과, 정상서열과 증폭억제시발체 이중나선의 용융온도(Tm)가 PCR반응의 결합온도(59℃)보다 높을 때 민감도가 높으나, 오히려 더 높은 용융온도(Tm)에서는 민감도가 저하되었다(도 11).
본 발명자들은 돌연변이서열과 미스매치 증폭억제시발체 이중나선의 용융온도를(Tm-mismatch) SantaLucia et al을 참조하여 neighbor joining algorithm을 사용해 계산하였다.
돌연변이서열과 미스매치 증폭억제시발체의 용융온도(Tm-mismatch)가 PCR의 결합온도(60 ℃)를 초과하는 경우, 민감도의 손상을 동반하였다(도 12).
종합적으로, 표 11은 여러 종류의 프라이머 세트를 이용하여 MEMO-PCR 및 다운스트림 시퀀싱 결과 얻게된 최상의 민감도를 나타낸 것이다.
5-6: 증폭억제시발체와 일반시발체의 겹치는(overlap) 부위에 따른 검출 민감도 시험
증폭억제시발체와 일반시발체의 겹치는 부위의 길이(염기수)에 따른 검출 민감도를 알아보기 위하여 다음 3종의 시발체 세트를 사용하여 실시예 2의 방법으로 검출 민감도를 측정하였다. 사용된 종양세포주와 시발체를 아래의 표 12 내지 표 14에 정리하였으며, 얻어진 결과를 도 10에 나타내었다.
도 10에서 알 수 있는 바와 같이, 증폭억제시발체와 일반전방시발체의 겹치는(overlap) 부위의 길이가 1 또는 2 염기인 경우 충분한 민감도를 얻지 못하므로 3 염기 이상인 것이 바람직함을 알 수 있었다.
5-7: 정량화 및 HRM (high-resolution melting analysis) 위한 MEMO의 적용
MEMO는 잠재적으로 정량적인 real-time PCR 및/또는 HRM 분석에 사용할 수 있다. EGFR T790M 돌연변이를 가진 DNA를 정상 DNA로 희석한(1.0 x 100부터 1.0 x 10-4 까지) 검체에서 본 발명자들은 DNA-삽입 형광 염료를 사용해서 real-time PCR과 결합한 HRM 분석을 수행하였다.
PCR 반응은 hot-start, high-fidelity polymerase, 버퍼, 및 시약(final concentrations: KCl 300 mM, MgCl2 25 mM 및 dNTP 0.3 mM )을 포함한 AccuPower® HF PCR PreMix (Bioneer)을 사용하여 실험하였다. 반응혼합물은 200ng의 DNA와 10pmol의 일반시발체, 50pmol의 억제시발체를 포함한다(도 7에서 증폭억제시발체의 양을 50pmol로 최적화하였다.). PCR은 9600 thermal cycler (Applied Biosystems)를 사용하였다.
다음의 조건에서 중합효소 연쇄반응을 실시하였다(이하, 실시예에서도 동일한 조건을 적용하였음.).
<중합효소 연쇄반응 조건>
94℃, 5분(1회)
94℃, 30초-59℃, 30초-70℃, 60초(50회)
72℃, 7분(1회)
Real-time PCR과 결합한 HRM은 BEBO dye(TATAA Biocenter)가 있는 상태에서 Rotor-Gene Q(Qiagen)을 이용하여 수행하였다. 순차적으로 희석된 EGFR T790M의 변이를 가지고 있는 DNA 샘플은 증폭억제시발체 T790M-B6로 증폭하였다.
결과, 역치(treshold) 사이클(Ct) 수치의 변화는 허용할 수 있는 범위인 0.6 이내였다. 많은 양의 돌연변이 DNA를 포함하는 희석물에서 적은 양의 돌연변이를 포함하는 것보다 사이클 수치가 낮았고, 결과적으로, 표준 커브는 일차원적인 상호관계(linear correlation)를 증명하였다(r2=0.991; 도 16). 즉, 돌연변이농도가 높으면 적은 사이클(Ct)만 돌려도 역치를 통과하는 반면, 돌연변이 농도가 낮으면 보다 많은 싸이클을 돌려야 원하는 만큼 증폭이 되어 역치를 통과하게 되는 것이다. 이 결과는 본 발명이 Ct 값에 따른 정량분석에도 유용하게 이용될 수 있다는 것을 보여준다.
이 일차적인 관계는 1.0 x 100부터 1.0 x 10-3까지의 희석 범위에서 명백하였다(도 17). 따라서, 이 범위 내에서는 Ct값과 돌연변이 농도의 상관관계가 직선적이므로, Ct값에 따라 돌연변이 농도를 정확하게 예측할 수 있을 것이다. 그러나, 1.0 x 10-4 이하의 희석액에서는 명백하지 않았다. PCR 효율은 1.45로 일반적인 PCR 효율보다 낮았는데, 이는 아마도 정상 서열의 증폭 억제 때문일 것으로 추측된다.
소수의 돌연변이 대립유전자는 MEMO-PCR을 통해 정상 대립유전자와 비교할 때 동일하거나 더 과하게 증폭되어 있었기 때문에, 최종 산물은 HRM 분석에 적합하였다. EGFR T790M 돌연변이를 사용한 실시예에서 더 많은 양의 돌연변이 DNA(1.0 x 100, 1.0 x 10-1 및 1.0 x 10-2)를 포함한 희석물은 정상 샘플(83.7℃)에 비해 더 높은 용융온도(Tm, 84.3-84.4℃)를 가지는 것을 나타내는데, 이것은 아마도 돌연변이 동종이중나선의 더 큰 안정성 때문일 것이다. 낮은 돌연변이 DNA 농도(<1.0 x 10-3)를 가진 샘플은 시퀀싱 결과와 동일하게, 잡종 용융 피크(heterozygous peaks)를 나타냈다(도 18 및 도 19).
5-8: 형광 PCR의 개선된 수행 및 단편 분석
형광 PCR 및 단편 분석을 통해 사이즈-기반분리를 이용한 소규모 삽입/결실 돌연변이를 검출할 수 있다. MEMO 방법은 EGFR 및 NPM1 유전자에서 두 개의 hot-focus 돌연변이의 검출을 위해 수행하였다.
형광 PCR은 EGFR 엑손 19 에서 15-bp를 결실시키고 NPM1 엑손 12에서 4-bp를 삽입하여 수행하였다. 일반시발체(DEL15-F 와 NPM1-F)는 5’-FAM 라벨하였다. 앰프리콘 절편은 크기에 따라 GeneScan Software(Applied Biosystems)를 이용해서 ABI Prism 3130xl Genetic Analyzer으로 분석하였다.
EGFR 유전자의 돌연변이는 폐암에서 표적 치료에 중요한 분자적 마커이며, 엑손 19에서 발생하는데 약 절반의 사례에서 15-bp 결실이 일어난다. 증폭억제시발체는 사실상 알려진 모든 엑손 19 돌연변이를 포함하여 고안하였고, 다운스트림 형광 단편 분석에 의하여 소수의 대립유전자의 1.0 x 10-6 희석 비율까지 검출하는 민감도가 높은 최상의 시발체 세트를 고안하였다. 그 결과, 정상 피크보다 15bp가 짧은 비정상적인 피크가 나타났다(도 20).
NPM1 유전자는 정상 핵형을 가진 골수성 백혈병에서 가장 흔하게 돌연변이가 일어나는 유전자로, 이러한 돌연변이는 전형적으로 엑손 12에 4-bp의 삽입으로서 생긴다. 형광 PCR 및 단편분석 결과, 정상 피크보다 4bp 긴 비정상적 피크를 관찰할 수 있었다(도 21). 최적의 시발체 세트는 MEMO-PCR 및 다운스트림 형광 단편 분석을 이용해 소수(minority)의 희석비율 1.0 x 10-5까지의 돌연변이를 검출할 수 있음을 확인하였다(도 21).
5-9: 개선된 pyrosequencing의 수행
pyrosequencing은 서열 변이의 검출에 사용되는 방법으로, KRAS 변이를 가진 희석된 샘플을 분석하기 위해 사용하였다. 이는 PyroMark® Gold Q96 Reagents(Qiagen)을 사용하여 PSQ96MA(Biotage) 기계로 분석하였다. PCR 반응은 증폭억제시발체(KRAS-B2)와 비오틴이 붙은 일반시발체를 사용하였다(도 27).
본 발명자들은 KRAS G12S, G12C, G12D, G12V, G12A 및 G13D 돌연변이를 갖는 희석한 DNA에 대하여 상기 증폭억제시발체 및 비오틴-표지 일반시발체를 사용해 MEMO 방법을 pyrosequencing을 통해 검사하였다. 민감도는 각각 1.0 x 10-2, 5.0 x 10-3, 5.0 x 10-2, 5.0 x 10-3, 5.0 x 10-2 및 2.0 x 10-2로 확인되었고(도 22), 대조군 정상 DNA에서 어떠한 비정상적 피크도 관찰되지 않았다.
5-10: 다른 방법과의 임상적 확인 및 비교
임상적 이용성을 검토하기 위해, 초음파 검사에서 갑상선 결절을 가진 212명의 환자의 DNA를 추출하였다. 세포형태학적 정밀검사는 전문적인 병리학자들에 의해 수행하였다. DNA샘플들은 Seeplex® BRAF ACE Detection kit(Seegene)을 사용한 DPO-기반 ARMS-PCR 및 통상적 PCR 시퀀싱 뿐만 아니라 MEMO-PCR (V500E-B5 증폭억제시발체 사용)과 다운스트림 시퀀싱을 사용하여 수행하였다.
BRAF V600E 돌연변이는 젖꼭지모양의 갑상선 암(50 - 90%)에서 흔하게 관찰되고, 이의 분자적 검출은 진단에 유용하다. 갑상선 흡인물 표본은 세포형태학적 검사에서 갑상선 종양이 발견된 212명의 환자로부터 구했다. 이러한 표본을 또한 다운스트림 시퀀싱을 포함하는 MEM0-PCR, DPO(dual-priming oligonucleotides)를 사용한 ARMS-PCR, 및 다운스트림 시퀀싱을 포함하는 통상적인 PCR를 사용하여 BRAF V600E 돌연변이에 대해 검사하였다. BRAF V600E의 검출에 대한 DPO-기반의 ARMS-PCR의 민감도는 약 2.0 x 10-2로 나타났다. 시퀀싱을 포함하는 MEMO-PCR 및 염기서열 분석은 모든 ARMS-PCR-양성 샘플에서 양성의 결과로 나타났으며, ARMS-PCR 및 통상의 PCR에서 검출하지 못한, 15개의 추가적인 샘플에서 돌연변이를 검출하였다. 이 추가적인 샘플 중 6개는 PTC로 나타났고, 4개는 indermediate, 그리고 5개는 결정성의 종양형성으로 나타났다. 4개의 indeterminate 중 2개의 경우는 갑상선 적출술을 겪었고, 그리고 둘 다 조직학에 의해 PTC로 나타났다. 5개의 결정성의 종양형성 사례 중 하나는 수술을 겪었고 난포선종의 경우로 나타났다. PTC를 가진 한 환자는 ARMS-PCR에서 위음성(false-negative)으로 확인되었는데, 통상적인 PCR 및 염기서열 분석을 포함하는 MEMO-PCR에서는 양성의 분석 결과를 보였다(표 15). 즉, 시퀀싱을 포함하는 MEMO-PCR는 ARMS-PCR 및 통상의 PCR보다 높은 민감도와 특이도를 보임을 알 수 있었다.
Claims (25)
- 전방시발체, 후방시발체, 및 증폭억제시발체를 포함하는 돌연변이 유전자 검출용 조성물로서,상기 전방시발체 또는 후방시발체 중 돌연변이 부위에 인접하는 시발체는 시료 내의 유전자 중에 돌연변이된 부위 외의 부위와 상보적 염기 서열의 뉴클레오티드를 포함하고,상기 증폭억제시발체는 시료 내의 유전자 중 야생형 유전자의 염기 서열 중에 돌연변이 부위에 해당되는 야생형 유전자의 염기 서열과 상보적인 염기 서열의 뉴클레오티드를 포함하고, 일 말단은 상기 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드를 포함하고, 타 말단은 C3-18 스페이서, 바이오틴, 디-데옥시뉴클레오타이드 트리포스페이트, 에틸렌글리콜, 아민 및 인산염으로 이루어진 군에서 선택된 1종 이상의 부착으로 변형된 뉴클레오티드를 포함하는, 돌연변이 유전자 검출용 조성물.
- 제1항에 있어서, 상기 조성물은 중합효소 연쇄반응(PCR)을 수행하기 위한 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 돌연변이 부위에 인접하는 시발체와 돌연변이 부위와의 거리는 1 내지 9bp인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 조성물 내 상기 돌연변이 부위에 인접하는 시발체와 상기 증폭억제시발체의 몰농도비는 1: 5 내지 1: 50인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 돌연변이 부위에 인접하는 시발체의 융융온도(Tm)는 55 내지 65℃이고, 상기 증폭억제시발체의 융융온도는 상기 돌연변이 부위에 인접하는 시발체의 용융온도보다 2 내지 12℃ 높은 것을 특징으로 하는 조성물.
- 제2항에 있어서, 상기 조성물의 중합효소 연쇄반응시 결합온도가 야생형 유전자와 증폭억제시발체 이중나선의 용융온도보다 낮고 돌연변이 유전자와 증폭억제시발체 이중나선의 용융온도보다 높은 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 증폭억제시발체의 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드의 길이는 3 내지 13bp인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 전방시발체 및 후발시발체의 길이는 연속하는 10-50bp인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 증폭억제시발체의 길이는 연속하는 10-50bp인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 돌연변이는 점 돌연변이, 1-50bp의 삽입, 또는 1-50bp의 결실에 의한 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 돌연변이는 종양특이적 돌연변이, 병원성 박테리아 또는 바이러스의 약제 내성 돌연변이, 또는 미토콘드리아 돌연변이인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 돌연변이는 EGFR T790M, JAK2 V617F 및 KRAS G12D으로 이루어진 군으로부터 선택되는 돌연변이인 것을 특징으로 하는 조성물.
- 제1항 내지 제12항 중 어느 한 항의 조성물을 포함하는 돌연변이 유전자 검출용 키트.
- 검출하고자 하는 유전자 돌연변이 부위를 포함하는 유전자 시료에 대하여, 전방시발체, 후방시발체, 및 증폭억제시발체를 이용하여 중합효소 연쇄반응을 수행하는 단계; 및 상기 얻어진 중합효소 연쇄반응 산물에 대하여 돌연변이를 확인하는 단계를 포함하는 돌연변이 유전자 검출 방법으로서,상기 전방시발체 또는 후방시발체 중 돌연변이 부위에 인접하는 시발체는 시료 내의 유전자 중에 돌연변이된 부위 외의 부위와 상보적 염기 서열의 뉴클레오티드를 포함하고,상기 증폭억제시발체는 시료 내의 유전자 중 야생형 유전자의 염기 서열 중에 돌연변이 부위에 해당되는 야생형 유전자의 염기 서열과 상보적인 염기 서열의 뉴클레오티드를 포함하고, 일 말단은 상기 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드를 포함하고, 타 말단은 C3-18 스페이서, 바이오틴, 디-데옥시뉴클레오타이드 트리포스페이트, 에틸렌글리콜, 아민 및 인산염으로 이루어진 군에서 선택된 1종 이상의 부착으로 변형된 뉴클레오티드를 포함하는, 돌연변이 유전자 검출 방법.
- 제14항에 있어서, 상기 돌연변이 부위에 인접하는 시발체와 돌연변이 부위와의 거리는 1 내지 9bp인 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 증폭억제시발체의 농도는 돌연변이 부위에 인접하는 시발체의 몰농도 기준으로 5 내지 50배인 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 돌연변이 부위에 인접하는 시발체의 융융온도(Tm)는 55 내지 65℃이고, 상기 증폭억제시발체의 융융온도는 상기 돌연변이 부위에 인접하는 시발체의 용융온도보다 2 내지 12℃ 높은 것을 특징으로 하는 방법.
- 제14항에 있어서, 중합효소 연쇄반응시 결합온도가 야생형 유전자와 증폭억제시발체 이중나선의 용융온도보다 낮고 돌연변이 유전자와 증폭억제시발체 이중나선의 용융온도보다 높은 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 증폭억제시발체의 돌연변이 부위에 인접하는 시발체의 돌연변이 부위에 인접하는 말단 부위와 동일한 염기 서열을 가지는 뉴클레오티드의 길이는 3 내지 13bp인 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 전방시발체 및 후발시발체의 길이는 연속하는 10-50bp인 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 증폭억제시발체의 길이는 연속하는 10-50bp인 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 돌연변이는 점 돌연변이, 1-50bp의 삽입, 또는 1-50bp의 결실에 의한 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 돌연변이는 종양특이적 돌연변이, 병원성 박테리아 또는 바이러스의 약제 내성 돌연변이, 또는 미토콘드리아 돌연변이인 것을 특징으로 하는 방법.
- 제14항에 있어서, 상기 돌연변이는 EGFR T790M, JAK2 V617F 및 KRAS G12D으로 이루어진 군으로부터 선택되는 돌연변이인 것을 특징으로 하는 방법.
- 제14항의 돌연변이 유전자 검출 방법을 이용하여 돌연변이 질환을 진단하는 방법.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/643,990 US20130149695A1 (en) | 2010-04-27 | 2010-12-30 | Method for detecting genetic mutation by using a blocking primer |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2010-0039148 | 2010-04-27 | ||
| KR20100039148 | 2010-04-27 | ||
| KR10-2010-0119966 | 2010-11-29 | ||
| KR1020100119966A KR101312241B1 (ko) | 2010-04-27 | 2010-11-29 | 증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011136462A1 true WO2011136462A1 (ko) | 2011-11-03 |
Family
ID=44861725
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2010/009601 Ceased WO2011136462A1 (ko) | 2010-04-27 | 2010-12-30 | 증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2011136462A1 (ko) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2798078A4 (en) * | 2011-12-30 | 2015-10-07 | Jr-Kai Huang | METHOD AND SET OF PRIMERS FOR DETECTING MUTATION |
| WO2016167320A1 (ja) * | 2015-04-14 | 2016-10-20 | 凸版印刷株式会社 | 遺伝子変異の検出方法 |
| US10760118B2 (en) * | 2013-04-29 | 2020-09-01 | Qiagen Gmbh | Method for DNA amplification with a blocking oligonucleotide |
| CN112029833A (zh) * | 2020-08-25 | 2020-12-04 | 南昌五元生物科技有限公司 | 一种用于肿瘤类器官培养条件选择的ctnnb1基因突变的快速鉴定方法 |
| CN114787383A (zh) * | 2019-12-11 | 2022-07-22 | 基诺泰科有限公司 | 一种提高等位基因区分力的pcr方法及pcr试剂盒 |
-
2010
- 2010-12-30 WO PCT/KR2010/009601 patent/WO2011136462A1/ko not_active Ceased
Non-Patent Citations (4)
| Title |
|---|
| GIBBS ET AL.: "Detection of single DNA base differences by competitive oligonucleotide priming", NUCLEIC ACIDS RESEARCH, vol. 17, no. 7, 11 April 1989 (1989-04-11), pages 2437 - 2448 * |
| GLAAB ET AL.: "A novel assay for allelic discrimination that combines the fluorogenic 5' nuclease polymerase chain reaction (TaqMan) and mismatch amplification mutation assay", MUTATION RESEARCH, vol. 430, no. 1, 29 November 1999 (1999-11-29), pages 1 - 12 * |
| MORLAN ET AL.: "Mutation detection by real-time PCR: a simple, robust and highly selective method", PLOS ONE, vol. 4, no. 2, 25 February 2009 (2009-02-25), pages E4584 * |
| WATANABE ET AL.: "Use of a competitive probe in assay design for genotyping of the UGT1A1 *28 micro satellite polymorphism by the smart amplification process", BIOTECHNIQUES, vol. 43, no. 4, October 2007 (2007-10-01), pages 479 - 484 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2798078A4 (en) * | 2011-12-30 | 2015-10-07 | Jr-Kai Huang | METHOD AND SET OF PRIMERS FOR DETECTING MUTATION |
| AU2011384896B2 (en) * | 2011-12-30 | 2016-02-18 | Hong Jing Biotech Inc. | Method and primer set for detecting mutation |
| US10760118B2 (en) * | 2013-04-29 | 2020-09-01 | Qiagen Gmbh | Method for DNA amplification with a blocking oligonucleotide |
| WO2016167320A1 (ja) * | 2015-04-14 | 2016-10-20 | 凸版印刷株式会社 | 遺伝子変異の検出方法 |
| JPWO2016167320A1 (ja) * | 2015-04-14 | 2018-02-08 | 株式会社理研ジェネシス | 遺伝子変異の検出方法 |
| CN114787383A (zh) * | 2019-12-11 | 2022-07-22 | 基诺泰科有限公司 | 一种提高等位基因区分力的pcr方法及pcr试剂盒 |
| CN112029833A (zh) * | 2020-08-25 | 2020-12-04 | 南昌五元生物科技有限公司 | 一种用于肿瘤类器官培养条件选择的ctnnb1基因突变的快速鉴定方法 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101312241B1 (ko) | 증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 | |
| CN102119222B (zh) | 多核苷酸引物 | |
| WO2014073785A1 (ko) | 위용종 및 위암 특이적 메틸화 마커 유전자를 이용한 위용종 및 위암의 검출방법 | |
| WO2011055916A2 (ko) | 장암 진단을 위한 장암 특이적 메틸화 마커 유전자의 메틸화 검출방법 | |
| WO2017122896A1 (ko) | 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법 | |
| US11834707B2 (en) | Nucleic acid amplification blocker for detecting low-abundance mutation sequence and application thereof | |
| WO2012070861A2 (ko) | 위암 진단을 위한 위암 특이적 메틸화 바이오마커 | |
| WO2011136462A1 (ko) | 증폭억제시발체를 이용하는 유전자 돌연변이 검출 방법 | |
| CN1361829A (zh) | 利用特异性lna引物检测基因突变 | |
| WO2013133680A1 (ko) | 핫스타트 역전사반응 또는 핫스타트 역전사 중합효소 연쇄반응용 조성물 | |
| WO2015023146A1 (ko) | 전암병변의 검출방법 | |
| WO2016036172A1 (ko) | 단백질 키나제 억제제에 대한 감수성 예측용 바이오 마커 및 이의 용도 | |
| WO2021118288A1 (ko) | 대립 유전자의 구분성을 높이는 pcr 방법 및 pcr 킷트 | |
| WO2023085783A1 (ko) | 결핵균 검출 및 약물 내성 확인을 위한 유전자 증폭용 조성물 및 이의 용도 | |
| WO2019013451A1 (ko) | 유전자 변이 특이성이 증가된 dna 중합효소 및 이의 활성 증가용 pcr 버퍼 조성물 | |
| WO2017082503A1 (ko) | Bcr/abl 음성 골수증식종양 관련 유전자변이 다중검출용 펩티드핵산 프로브, 이를 포함하는 유전자변이 다중검출 조성물, 다중검출 키트 및 유전자변이 다중검출방법 | |
| WO2024043743A1 (ko) | Flt3 유전자 증폭용 조성물 및 이의 용도 | |
| WO2023146366A1 (ko) | Egfr 돌연변이 dna를 특이적으로 증폭할 수 있는 crispr/cas시스템 및 이의 용도 | |
| CN105734136B (zh) | 一种检测人braf基因突变的探针法及检测试剂盒 | |
| WO2020145711A1 (ko) | Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트 | |
| WO2013105801A1 (ko) | 만성 골수성 백혈병 융합 유전자형 타이핑용 프로브, 프라이머 및 이의 이용방법 | |
| WO2015105336A1 (ko) | 5'-플랩 엔도뉴클레이즈 활성이 억제된 dna 폴리머레이즈를 이용하여 실시간 중합효소 연쇄반응으로 돌연변이 유전자를 검사하는 방법 | |
| JP6653932B1 (ja) | 標的核酸領域内の基準配列に対する差異を検出する方法 | |
| WO2020145715A1 (ko) | Tert 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트 | |
| WO2011059285A2 (ko) | 지노타이핑 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10850828 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13643990 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10850828 Country of ref document: EP Kind code of ref document: A1 |














