WO2011113839A1 - Methode pour modifier la date de floraison d'une plante - Google Patents
Methode pour modifier la date de floraison d'une plante Download PDFInfo
- Publication number
- WO2011113839A1 WO2011113839A1 PCT/EP2011/053908 EP2011053908W WO2011113839A1 WO 2011113839 A1 WO2011113839 A1 WO 2011113839A1 EP 2011053908 W EP2011053908 W EP 2011053908W WO 2011113839 A1 WO2011113839 A1 WO 2011113839A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- prec31
- polynucleotide
- allele
- maize
- plant
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
Definitions
- a polynucleotide capable of hybridizing selectively with polynucleotide a) or b) above is a polynucleotide which when hybridized under stringent conditions with a nucleic acid library of the same plant (especially a DNA library genomic, or cDNA) produces a detectable hybridization signal at least 2 times higher, and preferably at least 5 times higher than the background with said polynucleotide, but produces no detectable signal with other sequences of said bank.
- the present invention also relates to recombinant DNA constructs comprising a polynucleotide as defined above.
- constructs are in particular expression cassettes, comprising a polynucleotide as defined above, under transcriptional control of a suitable promoter.
- expression cassettes may also contain other regulatory elements, in particular transcriptional regulatory elements such as terminators, amplifiers.
- transcriptional regulatory elements such as terminators, and in particular the 3'NOS terminator of nopaline synthase (Depicker et al., J. Mol Appl. Genet., 1, 561 -573, 1982 ), or the 3'CaMV terminator (Franck et al Cell, 21, 285-294, 1980, GenBank V00141).
- the present invention also relates to a method of selecting maize, or to a method of identifying maize that can be used in a selection scheme intended to obtain a maize having an early flowering date (earlier than the average date of flowering of the maize used in the selection scheme), characterized in that it comprises the search for an allele of the Prec31 gene having a mutation resulting in an anticipated flowering date of said corn, compared to a maize not having this allele. This process is directly related to the demonstration of the role of Prec31 in the early flowering date.
- a localized polymorphism is sought at nucleotide 5089 of SEQ ID No. 2.
- the nucleotide is a T
- the flowering is advanced.
- the polymorphism is a deletion
- the bloom is later.
- the presence of two polymorphisms is sought for nucleotides 5089 and 5025 of SEQ ID No. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5089 and 4961 of SEQ ID NO. 2. In another embodiment, the presence of two polymorphisms is sought for nucleotides 5025 and 4961 of SEQ ID NO: 2.
- the offspring is intended for animal feed, we will evaluate the characteristics of yield (search for a high and regular yield in dry matter tonnage per hectare), ingestibility and digestibility, when evaluates the "elite corn" nature. If the offspring is for the production of biofuels, such as biofuels or biogas, the maize with the highest energy efficiency after processing is evaluated.
- biofuels such as biofuels or biogas
- an elite maize is a corn gathering the maximum of agronomic characteristics necessary for an economic penetration of the target market.
- the evaluation of the elite character of maize is also done by the ability of the maize to combine / produce hybrids.
- the invention makes it possible to obtain a hybrid maize obtained by crossing two homozygous parent lines, said hybrid maize having a delta-Prec31 allele.
- This hybrid corn can be homozygous (if each homozygous parent has the Delta-Prec31 allele) or heterozygote for the allele.
- transgenic or mutant may contain one or more transgenes in addition to Prec31 inhibitory elements and delta-Prec31 allele. Mention can be made of transgenes conferring male sterility, male fertility, resistance to a herbicide (especially glyphosate, glufosinate, imidazolinone, sulfonylurea, L-phosphinotricin, triazine, benzonitrile), insect resistance (including a transgene encoding Bacillus thuringiensis toxin), tolerance to water stress. These plants can be obtained by crossing said plants of the invention with other plants containing said transgenes. Alternatively, plants can be co-transformed with an expression cassette containing several different transgenes, including those inhibiting Prec31.
- the invention relates to a method for obtaining a corn having an early flowering date, comprising introgressing the Delta-Prec31 allele in said corn, comprising the steps of:
- the lessons can be used to identify usable maize in a selection scheme for selecting maize with a date flowering earlier than the average flowering date of the maize used in the selection scheme, by searching for the presence of the delta-Prec31 allele
- the invention relates to the use of a plant, and in particular a corn according to the invention for the preparation of a composition intended for human or animal consumption, or for the preparation of biofuels or any other industrial application, as well as methods using such plants for such applications.
- This method makes it possible very quickly to obtain quasi-isogenic lines differing only in the locus carrying the modified allele, the descendants being tested to have a ratio genome as close as possible to that of the elite parent while having the allele that the we want to introgress.
- These tests are assisted by molecular markers (well known techniques, microsatellites, AFLP ). To try to appreciate the effect of the insertion at the earliest (obtaining homozygous plants), self-fertilization is carried out at the different intermediate stages of backcross.
- the precocity is thus evaluated on BC3S1 plants (3 backcrosses in an elite line, 1 self-fertilization).
- FF Female flowering
- the mutation therefore gives rise to a precociation of about 4 to 5 days, both for male flowering and for female flowering.
- a pair of primers can be used:
- SEQ ID NO: 6 GATTGCAGGACTCGATCAA, upstream of the insertion, and a primer of SEQ ID NO: 7: TTTAAC C C AAAC AC AAC AG G, downstream of the insertion.
- the specific OMuA SEQ ID No. 8 CTTCGTCCATAATGGCAATTATCTC primer of the endogenous transposable element is used. This primer is directed to the "outside" of the transposon.
- primers amplify a region of 754 nucleotides ranging from nucleotide 4803 to nucleotide 5556 of SEQ ID No. 2.
- the SNP most associated with the precocity is located at position 4961 of the reference sequence SEQ ID No. 2. It is very significant (associated with a pvalue of 5.1 ⁇ 10 -4 ) and has a precocious allele A of 25.94 "day. a late C allele of 25.94 ° day. The percentage of phenotypic variance associated with this locus is 5%.
- the reference sequence SEQ ID No. 2 provided to enable the polymorphisms of the Prec31 gene to be located has the polymorphisms of haplotype 2, and is therefore associated with early flowering.
- Example 3 Expression of Prec31 Tissue samples (apex, inner part of the sheath and outer part of the sheath) were harvested at different leaf stages and in particular at the 6.3-leaf stage, ie the flower transition stage ("switch"). flowering) which corresponds to that of the transition from the vegetative stage to the flower stage.
- switch flower transition stage
- Prec31 has been shown to have differential transcriptional expression between the inner sheath portion and the outer exposed portion of light. At the 6.3-leaf stage, the Prec31 gene is more strongly expressed in the outer part.
- This expression profile is the opposite of that of the id1 gene (INDETERMINATE 1) in corn (Colasanti et al, Cell, May 15, 3 (4): 593-603, 1998) known to induce flowering.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Physiology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/635,280 US20130198892A1 (en) | 2010-03-16 | 2011-03-15 | Method for modifying the blooming date of a plant |
CA2793131A CA2793131A1 (fr) | 2010-03-16 | 2011-03-15 | Methode pour modifier la date de floraison d'une plante |
EP11708284A EP2547772A1 (fr) | 2010-03-16 | 2011-03-15 | Methode pour modifier la date de floraison d'une plante |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP10305259.3 | 2010-03-16 | ||
EP10305259A EP2366791A1 (fr) | 2010-03-16 | 2010-03-16 | Méthode pour modifier la date de floraison d'une plante |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2011113839A1 true WO2011113839A1 (fr) | 2011-09-22 |
Family
ID=42562948
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2011/053908 WO2011113839A1 (fr) | 2010-03-16 | 2011-03-15 | Methode pour modifier la date de floraison d'une plante |
Country Status (4)
Country | Link |
---|---|
US (1) | US20130198892A1 (fr) |
EP (2) | EP2366791A1 (fr) |
CA (1) | CA2793131A1 (fr) |
WO (1) | WO2011113839A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112646015B (zh) * | 2021-01-22 | 2021-12-24 | 华中农业大学 | 改变玉米开花期的基因及方法 |
Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0242246A1 (fr) | 1986-03-11 | 1987-10-21 | Plant Genetic Systems N.V. | Cellules végétales résistantes aux inhibiteurs de la synthétase de glutamine, produites par génie génétique |
WO1997048819A1 (fr) | 1996-06-20 | 1997-12-24 | The Scripps Research Institute | Promoteurs du virus de la mosaique des nervures du manioc et leurs utilisations |
WO1999027085A2 (fr) | 1997-11-25 | 1999-06-03 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Procede de criblage en parallele de mutants d'insertion et son necessaire de mise en oeuvre |
WO2006010646A1 (fr) | 2004-07-30 | 2006-02-02 | Genoplante-Valor | Procede de production d'endonucleases a sensibilite elevee, nouvelles preparations d'endonucleases et leurs utilisations |
WO2006015045A2 (fr) * | 2004-07-29 | 2006-02-09 | Pioneer Hi-Bred International, Inc. | Procedes et compositions pour moduler la floraison et la maturite des plantes |
WO2006068432A1 (fr) | 2004-12-22 | 2006-06-29 | Posco | Regulateur de floraison, plante transgenique transformee au moyen dudit regulateur et methode de regulation de la floraison |
WO2008157370A2 (fr) * | 2007-06-15 | 2008-12-24 | Pioneer Hi-Bred International, Inc. | Gènes de formation d'une paroi secondaire à partir de maïs et leurs utilisations |
US20090094717A1 (en) * | 2007-10-03 | 2009-04-09 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics |
-
2010
- 2010-03-16 EP EP10305259A patent/EP2366791A1/fr not_active Ceased
-
2011
- 2011-03-15 US US13/635,280 patent/US20130198892A1/en not_active Abandoned
- 2011-03-15 CA CA2793131A patent/CA2793131A1/fr not_active Abandoned
- 2011-03-15 WO PCT/EP2011/053908 patent/WO2011113839A1/fr active Application Filing
- 2011-03-15 EP EP11708284A patent/EP2547772A1/fr not_active Withdrawn
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0242246A1 (fr) | 1986-03-11 | 1987-10-21 | Plant Genetic Systems N.V. | Cellules végétales résistantes aux inhibiteurs de la synthétase de glutamine, produites par génie génétique |
WO1997048819A1 (fr) | 1996-06-20 | 1997-12-24 | The Scripps Research Institute | Promoteurs du virus de la mosaique des nervures du manioc et leurs utilisations |
WO1999027085A2 (fr) | 1997-11-25 | 1999-06-03 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Procede de criblage en parallele de mutants d'insertion et son necessaire de mise en oeuvre |
WO2006015045A2 (fr) * | 2004-07-29 | 2006-02-09 | Pioneer Hi-Bred International, Inc. | Procedes et compositions pour moduler la floraison et la maturite des plantes |
WO2006010646A1 (fr) | 2004-07-30 | 2006-02-02 | Genoplante-Valor | Procede de production d'endonucleases a sensibilite elevee, nouvelles preparations d'endonucleases et leurs utilisations |
WO2006068432A1 (fr) | 2004-12-22 | 2006-06-29 | Posco | Regulateur de floraison, plante transgenique transformee au moyen dudit regulateur et methode de regulation de la floraison |
WO2008157370A2 (fr) * | 2007-06-15 | 2008-12-24 | Pioneer Hi-Bred International, Inc. | Gènes de formation d'une paroi secondaire à partir de maïs et leurs utilisations |
US20090094717A1 (en) * | 2007-10-03 | 2009-04-09 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics |
Non-Patent Citations (20)
Title |
---|
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
BLAZQUEZ ET AL., EMBO REP., vol. 2, no. 12, December 2001 (2001-12-01), pages 1078 - 82 |
BUCKLER EDWARD S ET AL: "The genetic architecture of maize flowering time.", SCIENCE (NEW YORK, N.Y.) 7 AUG 2009 LNKD- PUBMED:19661422, vol. 325, no. 5941, 7 August 2009 (2009-08-07), pages 714 - 718, XP002644778, ISSN: 1095-9203 * |
BUCKLER ET AL., SCIENCE, vol. 325, 2009, pages 714 - 718 |
CHICAS; MACINO, EMBO REPORTS, vol. 21, no. 11, 2001, pages 992 - 996 |
COLASANTI ET AL., CELL, vol. 3, no. 4, 15 May 1998 (1998-05-15), pages 593 - 603 |
DATABASE EMBL [online] 27 February 2009 (2009-02-27), "Zea mays full-length cDNA clone ZM_BFc0036J24 mRNA, complete cds.", XP002644776, retrieved from EBI accession no. EM_PL:BT066388 Database accession no. BT066388 * |
DATABASE UniProt [online] 23 September 2008 (2008-09-23), "SubName: Full=Putative uncharacterized protein;", XP002597800, retrieved from EBI accession no. UNIPROT:B4FRL7 Database accession no. B4FRL7 * |
DEPICKER ET AL., J. MOL. APPL. GENET., vol. 1, 1982, pages 561 - 573 |
DUCROCQ SÉBASTIEN ET AL: "Key impact of Vgt1 on flowering time adaptation in maize: evidence from association mapping and ecogeographical information.", GENETICS APR 2008 LNKD- PUBMED:18430961, vol. 178, no. 4, April 2008 (2008-04-01), pages 2433 - 2437, XP002644779, ISSN: 0016-6731 * |
FINER ET AL., PLANT CELL REPORT, vol. 11, 1992, pages 323 - 328 |
FRANCK ET AL., CELL, vol. 21, 1980, pages 285 - 294 |
FROMM ET AL., NATURE, vol. 319, 1986, pages 791 - 793 |
HANNON, NATURE, vol. 418, 2002, pages 244 - 251 |
ISHIDA ET AL., NATURE BIOTECHNOL., vol. 14, 1996, pages 745 - 50 |
KIM ET AL., PLANT PHYSIOL., vol. 145, no. 4, December 2007 (2007-12-01), pages 1484 - 94 |
KRENS ET AL., NATURE, vol. 296, 1982, pages 72 - 74 |
MCCALLUM ET AL., PLANT PHYSIOL., vol. 123, 2000, pages 439 - 442 |
MCELROY, MOL. GEN. GENET., vol. 231, 1991, pages 150 - 160 |
SALVI SILVIO ET AL: "Conserved noncoding genomic sequences associated with a flowering-time quantitative trait locus in maize.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 3 JUL 2007 LNKD- PUBMED:17595297, vol. 104, no. 27, 3 July 2007 (2007-07-03), pages 11376 - 11381, XP002644777, ISSN: 0027-8424 * |
Also Published As
Publication number | Publication date |
---|---|
US20130198892A1 (en) | 2013-08-01 |
CA2793131A1 (fr) | 2011-09-22 |
EP2366791A1 (fr) | 2011-09-21 |
EP2547772A1 (fr) | 2013-01-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1453980A2 (fr) | Polymorphismes du gene ccoaomt2 de mais, et leurs utilisations pour ameliorer la digestibilite des plantes | |
EP1395667B1 (fr) | Methode d'obtention de plante monocotyledone contenant un gene d'interet sans sequence auxiliaire etrangere | |
WO2013038376A1 (fr) | Augmentation de la recombinaison meiotique chez les plantes par inhibition de la proteine fancm | |
FR2919465A1 (fr) | Mais presentant une digestibilite amelioree | |
EP3110832B1 (fr) | Plantes a rendement accru et methode d'obtention de telles plantes | |
EP2087122B1 (fr) | Maïs presentant une bonne digestibilite et une resistance aux maladies | |
WO2011113839A1 (fr) | Methode pour modifier la date de floraison d'une plante | |
EP1276870B1 (fr) | Procede d'obtention de plantes presentant une resistance accrue a un stress hydrique | |
WO2009156496A1 (fr) | Methode d'amelioration des plantes | |
EP1556495A1 (fr) | Sequences peptidiques ppr capables de restaurer la fertilite male de plantes porteuses d un cytoplasme inducteur de sterilite male | |
FR2852326A1 (fr) | Obtention de plantes a digestibilite amelioree possedant une peroxydase inactive | |
FR2828694A1 (fr) | Utilisation d'associations entre au moins un polymorphisme de sequence nucleique du gene sh2 et au moins une caracteristique de qualite de la graine, dans des procedes de selection de plantes | |
FR2816320A1 (fr) | Utilisation d'un acide nucleique pour conferer a une plante une resistance a l'agression par un pathogene, et plante transformee avec un tel acide nucleique | |
WO2001055407A1 (fr) | Nouveau gene sgs2 de plante et son utilisation | |
FR2796395A1 (fr) | Nouveau gene sgs3 de plante et son utilisation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11708284 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 2793131 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
REEP | Request for entry into the european phase |
Ref document number: 2011708284 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2011708284 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13635280 Country of ref document: US |