WO2011072132A1 - Procédés de traitement d'états inflammatoires - Google Patents

Procédés de traitement d'états inflammatoires Download PDF

Info

Publication number
WO2011072132A1
WO2011072132A1 PCT/US2010/059699 US2010059699W WO2011072132A1 WO 2011072132 A1 WO2011072132 A1 WO 2011072132A1 US 2010059699 W US2010059699 W US 2010059699W WO 2011072132 A1 WO2011072132 A1 WO 2011072132A1
Authority
WO
WIPO (PCT)
Prior art keywords
gpr120
arrestin2
dsrna
compound
cells
Prior art date
Application number
PCT/US2010/059699
Other languages
English (en)
Inventor
Jerrold M. Olefsky
Da Young Oh
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2011072132A1 publication Critical patent/WO2011072132A1/fr
Priority to US13/493,241 priority Critical patent/US8987332B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/202—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having three or more double bonds, e.g. linolenic

Definitions

  • Sequence Listing which is a part of the present disclosure, includes a computer readable file "RUC_1 12WO_ST25.txt" generated by U.S. Patent & Trademark Office Patentin version 3.5 software comprising nucleotide and/or amino acid sequences of the present invention.
  • the subject matter of the Sequence Listing is incorporated herein by reference in its entirety.
  • the present teachings relate to methods of treating inflammatory conditions, including diabetes mellitus, by modulating P-arrestin2 and/or GPR120 mediated responses in a subject, as well as methods of screening compounds predicted to bind ⁇ - arrestin2 and/or GPR120.
  • GPCRs G protein-coupled receptors
  • the present teachings include methods of treating inflammation in a subject.
  • the method comprises administering a therapeutically effective amount of a compound that binds GPR120, the compound selectively activating a P-arrestin2-dependent signaling pathway of GPR120.
  • the compound that selectively activates a P-arrestin2-dependent signaling pathway is an co-3 fatty acid., including DHA and EPA.
  • the compound can selectively activate a P-arrestin2-dependent signaling pathway and not activate a ⁇ -arrestinl -dependent signaling pathway.
  • the inflammatory condition can be diabetes, an inflammatory condition is associated with obesity, and obesity.
  • the subject is an animal, particularly a human.
  • a method is also provided of treating an inflammatory condition associated with P-arrestin2 function.
  • the method comprises administering a therapeutically effective amount of a -arrestin2 modulating agent to a subject in need thereof.
  • the inflammatory condition can be diabetes, an inflammatory condition is associated with obesity, and obesity.
  • the compound that selectively activates a P-arrestin2-dependent signaling pathway is an co-3 fatty acid., including DHA and EPA. The compound can selectively activate a P-arrestin2-dependent signaling pathway and not activate a ⁇ -arrestinl -dependent signaling pathway.
  • the subject is an animal, particularly a human.
  • a method is also provided of treating an inflammatory condition associated with P-arrestin2 function and GPR120 function.
  • the method comprises administering a therapeutically effective amount of a P-arrestin2 modulating agent and a GPR120 modulating agent to a subject in need thereof.
  • the inflammatory condition can be diabetes, an inflammatory condition is associated with obesity, and obesity.
  • the compound that selectively activates a ⁇ - arrestin2-dependent signaling pathway is an co-3 fatty acid., including DHA and EPA. The compound can selectively activate a P-arrestin2-dependent signaling pathway and not activate a ⁇ -arrestinl -dependent signaling pathway.
  • the subject is an animal, particularly a human.
  • a method is provided of treating a p-arrestin2 mediated response.
  • the method comprises administering to a subject in need thereof a therapeutically effective amount of a compound predicted to bind GPR120, the compound selectively activating a P-arrestin2-dependent signaling pathway of said
  • the P-arrestin2 mediated response includes inflammation, including a lipopolysaccharide-induced inflammatory response and a TNFa-induced inflammatory response.
  • a method is also provided of inhibiting cytokine secretion.
  • the method comprising administering to a cell an effective amount of a compound predicted to bind GPR120, the compound selectively activating a beta-arrestin2- dependent signaling pathway of GPR120.
  • the P-arrestin2 mediated response includes inflammation, including a lipopolysaccharide-induced inflammatory response.
  • the cytokine secretion inhibited is a lipopolysaccharide- induced cytokine secretion.
  • a method is also provided of screening a compound predicted to bind GPR120 for P-arrestin2 biased activity.
  • the method comprises (a) administering to a subject an amount of a compound predicted to bind GPR120 sufficient to generate a physiological response, (b) evaluating at a first time said physiological response, (c) administering to said subject an effective amount of a dsRNA capable of binding a ⁇ - arrestin2 RNA, (d) allowing a period of time to pass sufficient for said dsRNA to substantially bind said P-arrestin2 RNA, and (e) evaluating at a second time said physiological response, wherein if said physiological response is reversed at said second time as compared to said first time, said compound predicted to bind GPR120 is a ⁇ - arrestin2 biased compound.
  • the physiological response relates to a lipopolysaccharide-induced inflammatory response. In various aspects, the physiological response relates to a TNF-a-induced inflammatory response. In various aspects, the physiological response relates to a lipopolysaccharide-induced cytokine secretion.
  • kits can comprise an effective amount of at least one dsRNA molecule capable of binding a P-arrestin2 RNA, and written indicia providing a user of said kit with instructions for using said kit in conjunction with the methods above.
  • the kit can further comprise cells suitable for use in evaluating a compound predicted to bind GPR120, and provided in an amount sufficient for use in evaluating said GPR120 ligand.
  • the cells can be mouse monocyte cells.
  • the mouse monocyte cells are from cell line Raw264.7.
  • a dsRNA is also provided for inhibiting functional p-arrestin2 protein expression in a cell.
  • the dsRNA comprising a sense strand and an antisense strand, wherein said antisense strand comprises a region of complementarity having a sequence substantially complementary to a P-arrestin2 target sequence, wherein said sense strand is substantially complementary to said antisense strand, and wherein said dsRNA, upon contact with a cell expressing functional P-arrestin2 protein, inhibits functional -arrestin2 protein expression.
  • the P-arrestin2 target sequence compries a sequence having SEQ ID NO. 2, or sequences complementary thereto.
  • a method is provided of inhibiting expression of a P-arrestin2 gene in a cell.
  • the method comprises introducing into the cell a dsRNA, wherein the dsRNA comprises two sequences that are compementary to each other and wherein a sense strand comprises a first sequence and an antisense strand comprises a second sequence comprising a region of complimentarity that is substantially
  • the dsRNA comprises a sequence selected having SEQ ID NO. 2, or sequences complementary thereto.
  • FIG. 1 Expression level of GPR120 and GPR120-mediated antiinflammatory response in RAW 264.7 cells.
  • A The mRNA expression pattern of various lipid sensing GPCRs is shown in adipose tissue
  • B CD1 lc+ bone marrow-derived dendritic cells (BMDCs), bone marrow-derived macrophages (BMDMs), IPMacs, 3T3-L1 preadipocytes, differentiated 3T3-L1 adipocytes, RAW 264.7 cells and L6 myocytes.
  • BMDCs bone marrow-derived dendritic cells
  • BMDMs bone marrow-derived macrophages
  • IPMacs IPMacs
  • 3T3-L1 preadipocytes differentiated 3T3-L1 adipocytes
  • RAW 264.7 cells and L6 myocytes.
  • Ribosomal protein S3 was used as internal control.
  • C Expression of GPR120 in SVF, adipocytes and hepatic Kupffer cells from chow (NC)- or HFD-fed mice was examined by q-PCR. Data are expressed as the mean ⁇ SEM of at least three independent experiments in triplicate. *, p ⁇ 0.05 versus NC.
  • D RAW 264.7 cells, transfected with scrambled (Scr) or GPR120 #2 siRNA (GPR120 KD), were treated with 100 ⁇ of GW9508 for 1 hr prior to LPS (100 ng/ml) treatment for 10 min and then subjected to western blotting. Left panel is a representative image from three independent experiments, and the scanned bar graph (right panel) shows fold induction over basal conditions.
  • FIG. 1 Omega-3 FA stimulates GPR120 and mediates anti-inflammatory effects.
  • A GPR120-mediated SRE-luc activity after treatment with various FAs (circles GPR120-GW9508; diamonds GPR120-DHA; triangles GPR120-EPA; squares GPR120- Palmitoleate; Xs GPR120-Oleic acid; empty diamonds GPR120-Arachidonic acid; empty circles GPR120-y-linoleic acid; asterics GPR120-Palmitic acid; empty squares GPR120- Myristic acid). Results are fold activities over basal. Each data point represents mean ⁇ SEM of three independent experiments performed in triplicate.
  • Black lines indicate SRE-luc activities without GPR120 transfection or with non-stimulating FAs.
  • DHA inhibits LPS- induced inflammatory signaling (B), cytokine secretion (C) and inflammatory gene mRNA expression level (D) in RAW 264.7 cells, but not in GPR120 knockdown cells.
  • B LPS- induced inflammatory signaling
  • C cytokine secretion
  • D inflammatory gene mRNA expression level
  • E and F GPR120 stimulation inhibits LPS-induced inflammatory response in WT primary macrophage.
  • Data are expressed as the mean ⁇ SEM of three independent experiments. *, p ⁇ 0.05 versus LPS treatment in scrambled siR A transfected cells or WT IPMacs. See also Fig. 9.
  • FIG. 1 GPR120 internalization with P-arrestin2 mediates antiinflammatory effects.
  • RAW 264.7 cells were transfected with siRNA as indicated and stimulated with or without 100 ⁇ of DHA 1 hr prior to LPS (100 ng/ml) treatment for 10 min and then subjected to western blotting.
  • B TNF-a secretion was measured in RAW 264.7 cell cultured media with or without RNA interference as indicated.
  • C C
  • HEK 293 cells were co-transfected with HA-GPR120 and ⁇ - arrestin2 » GFP to analyze GPR120 internalization after DHA stimulation for the indicated times. GPR120 (left column) and P-arrestin2 (middle column) were localized by confocal microscopy.
  • E Co-immunoprecipitation between GPR120 and P-arrestin2 with DHA stimulation for 30 min in RAW 264.7 cells and,
  • F HEK 293 cells (HA-GPR120 and ⁇ - arrestin2 » GFP), respectively. Lysate indicates 1/10 input in each experiment.
  • FIG. 4 GPR120 activation enhances GLUT4 translocation and glucose uptake.
  • A 3T3-L1 adipocytes were transfected with a dually tagged HA-GLUT4-GFP construct. Total GLUT4 expression was determined by GFP fluorescence, and GLUT4 translocation to the cell surface after 100 ng/ml insulin or 100 ⁇ DHA stimulation for 30 min was determined by indirect immunofluorescence of the HA-conjugated with Alexa 594 in fixed cells. Translocation following insulin stimulation was expressed as a percentage of the maximum response. Bar graph represents the mean ⁇ SEM data from four independent experiments. *, p ⁇ 0.05 vs. vehicle treatment.
  • Glucose uptake was measured in WT and GPR120 KO mouse primary adipose tissue and in (C-F) 3T3-L1 adipocytes ⁇ siRNA with the indicated treatment. Data are expressed as mean ⁇ SEM of three independent experiments in triplicate. *, p ⁇ 0.05 vs. basal activity. The indicated siRNA knockdown efficiency was validated by western blotting. See also Fig. 10.
  • FIG. 5 In vivo metabolic studies in GPR120 KO mice.
  • B Insulin concentration were measured at the indicated time points and
  • C area-under-curve analysis of the insulin data shows a significant difference between WT and GPR120 KO mice on NC.
  • D
  • FIG. Omega-3 FA enriched diet decreases inflammatory macrophage infiltration in adipose tissue.
  • FIG. 7 Ml and M2 inflammatory gene expression levels in adipose tissue from WT vs. GPR120 KO mice.
  • FIG 8 related to Figure 1. Validation of GPR120 siRNA knockdown efficiency.
  • A Relative gene expression level of GPR120 and GPR40 in IPMac, RAW 264.7 cells, and 3T3-L1 adipocytes by q-PCR.
  • B SiRNA transfection did not lead to an increase of IFN- ⁇ expression.
  • FIG. 9 related to Figures 2 and 3.
  • DHA-stimulated GPR120 inhibits TNF-a, TLR2 and TLR3-induced inflammation via a P-arrestin2 dependent mechanism.
  • A ERK1/2 phosphorylation stimulated by GPR120 activation in RAW 264.7 cells transfected with scrambled or GPR120 siRNA. Cells were treated with 100 ⁇ of DHA, a-linolenic acid or palmitic acid for 5 min. Left panel is a representative image from three independent experiments, and the scanned bar graph (right panel) shows fold induction over the vehicle treatment. Data are expressed as the mean ⁇ SEM of three independent experiments. *, p ⁇ 0.05 versus scrambled siRNA transfected cells.
  • FIG. 10 shows Akt phosphorylation in a GPR120-dependent manner.
  • A Differentiated 3T3-L1 adipocytes were transfected with scrambled or GPR120 siRNA and then 48 hr after siRNA transfection, cells were treated with 100 ⁇ of DHA 30 min prior to insulin (3 ng/ml) treatment for 7 min followed by western blotting with phosphorylated Akt (S473) antibody.
  • Left panel is a representative image from three independent experiments, and the scanned bar graph (right panel) shows fold induction over basal after normalization for total Akt. Data are expressed as the mean ⁇ SEM of three independent experiments. *, p ⁇ 0.05 versus basal.
  • FIG. 1 related to Figure 5.
  • WT or GPR120 KO mouse bone marrow (BM) was injected into irradiated WT C57B1/6 animals after 8 weeks for BM reconstitution, GPR120 was >90% reduced in circulating monocytes. Animals were then kept on either chow or switched to 60% HFD for 15 weeks ( ⁇ supplemention with ⁇ -3 FAs for 5 weeks).
  • BMT GPR120 KO animals on chow are insulin resistant compared to WT controls.
  • BMT GPR120 KO animals on HFD supplemented with co-3 FAs (+ ⁇ 3) are insulin resistant compared to WT controls. This effect is shown by decreased GIR, decreased IS-GDR, and a greater suppression of HGP in WT animals compared to KOs.
  • C GPR120 expression levels in various tissues. RPS3 was the internal control for normalization. GPR120 is not expressed in soleus, or EDL muscle.
  • D Glucose uptake is not altered by DHA treatment (100 ⁇ ) in L6 myocytes, compared to vehicle treated cells.
  • FIG. 13 related to Figures 5 and 7.
  • Omega-3 FAs decrease hepatic steatosis and metabolic gene expression, and increase M2 anti-inflammatory gene expression in liver.
  • A Hepatic TAG was measured by lipidomic analysis in WT and GPR120 KO mice. Hepatic TAG was decreased in HFD+co3-fed WT, but not in GPR120 KOs. Data represent mean ⁇ SEM.*, p ⁇ 0.05 and ⁇ - ⁇ per group.
  • B H&E staining of frozen sections of livers obtained from chow (NC), HFD and HFD+co3-fed WT and GPR120 KO mice.
  • FIG. 14 related to Figure 7.
  • G,” “C,” “A,” “T,” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymine, and uracil as a base, respectively. It will be understood, however, that the term “ribonucleotide” or “nucleotide” can also refer to a modified ribonucleotide, as further define below, or a surrogate replacement moiety.
  • guanine, cytosine, adenine, thymine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.
  • a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil.
  • nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequence of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.
  • Antisense Strand refers to the strand of a dsRNA which includes a region that is substantially complementary to a target sequence.
  • region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully
  • the mismatches are most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus. Most preferably, the mismatches are located within 6, 5, 4, 3, or 2 nucleotides of the 5' terminus of the antisense strand and/or the 3' terminus of the sense strand.
  • the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
  • Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing.
  • stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing.
  • Other conditions such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
  • sequences can be referred to as “fully complementary” with respect to each other herein.
  • first sequence is referred to as “substantially complementary” with respect to a second sequence herein
  • the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3, or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application.
  • a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer
  • oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary” for the purposes of the invention.
  • Complementary sequences may also include, or be formed entirely from, non- Watson-Crick base pairs and/or base pairs formed from natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.
  • Double-Stranded RNA or dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary, as defined above, nucleic acid strands.
  • the two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules.
  • the connecting RNA chain is referred to as a "hairpin loop” and the entire structure is referred to as a "short hairpin RNA" or "shRNA.”
  • the connecting structure is referred to as the "linker.”
  • the RNA strands may have the same or a different number of nucleotides.
  • a dsRNA may comprise one or more nucleotide overhangs.
  • nucleotide overhang refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of a dsRNA when a 3 '-end of one strand of the dsRNA extends beyond the 5 '-end of the other strand, or vice versa.
  • Bount or “blunt end” means that there are no unpaired nucleotides at that end of the dsRNA, i.e. no nucleotide overhang.
  • a “blunt ended" dsRNA is a dsRNA that has no nucleotide overhang at either end of the molecule.
  • compositions are pharmaceutically acceptable.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • “pharmaceutically acceptable carrier” refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered.
  • Such carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents. Water is a preferred carrier when a compound is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like.
  • a compound, if desired, can also combine minor amount of wetting or emulsifying agents, or pH buffering agents such as acetates, citrates, or phosphates.
  • Antibacterial agents such as a benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity such as sodium chloride or dextrose may also be a carrier.
  • “pharmaceutically acceptable salt” includes those salts of a pharmaceutically acceptable compound formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, and tartaric acids, and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, and procaine. If the compound is basic, salts may be prepared from pharmaceutically acceptable non-toxic acids including inorganic and organic acids. Such acids include acetic, benzene-sulfonic
  • besylate benzoic, camphorsulfonic, citric, ethenesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p-toluenesulfonic, and the like. Particularly preferred are besylate, hydrobromic, hydrochloric, phosphoric, and sulfuric acids. If the compound is acidic, salts may be prepared from pharmaceutically acceptable organic and inorganic bases.
  • Suitable organic bases include, but are not limited to, lysine, ⁇ , ⁇ '-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylene diamine, meglumine (N-methyl-glucamine) and procaine.
  • Suitable inorganic bases include, but are not limited to, alkaline and earth-alkaline metals such as aluminum, calcium, lithium, magnesium, potassium, sodium, and zinc. Methods for synthesizing such salts are known to those of skill in the art.
  • Sense Strand refers to the strand of a dsR A that includes a region that is substantially complementary to a region of the antisense strand.
  • siRNA and inhibit the expression of insofar as they refer to a ⁇ -arrestin gene, e.g. a P-arrestin2 gene, refer to at least the partial suppression of the expression of a ⁇ -arrestin gene as manifested by a reduction of the amount of mRNA transcribed from a ⁇ -arrestin gene which may be isolated from a first cell or group of cells in which a ⁇ -arrestin gene is transcribed and which has or have been treated such that the expression of a ⁇ -arrestin gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).
  • the degree of inhibition is usually expressed in terms of
  • the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to ⁇ -arrestin gene transcription, e.g. the amount of protein encoded by a ⁇ -arrestin gene which is secreted by a cell, or found in solution after lysis of such cells, or the number of cells displaying a certain phenotype, e.g. apoptosis or cell surface CFTR.
  • ⁇ -arrestin silencing may be determined in any cell expressing the target, either constitutively or by genomic engineering, and by any appropriate assay.
  • the methods provided in the Examples below shall serve as such reference.
  • Strand Comprising a Sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
  • a polynucleotide that is "substantially complementary" to at least part of a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest.
  • mRNA messenger RNA
  • a polynucleotide is complementary to at least part of a ⁇ -arrestin mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ⁇ -arrestin.
  • Target Sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a ⁇ -arrestin gene, including mRNA that is a product of RNA processing of a primary transcription product.
  • the target sequence of any given RNAi agent of the invention means an mRNA-sequence of X nucleotides that is targeted by the RNAi agent by virtue of the complementarity of the antisense strand of the RNAi agent to such sequence and to which the antisense strand may hybridize when brought into contact with the mRNA, wherein X is the number of nucleotides in the antisense strand plus the number of nucleotides in a single stranded overhang of the sense strand, if any.
  • therapeutically effective amount refers to those amounts that, when administered to a particular subject in view of the nature and severity of that subject's disease or condition, will have a desired therapeutic effect, e.g. an amount that will cure, prevent, inhibit, or at least partially arrest or partially prevent a target disease or condition.
  • Transformed Cell As used herein, the term "transformed cell” is a cell into which a vector has been introduced from which a dsRNA molecule may be expressed.
  • Treatment refers to relief from or alleviation of pathological processes mediated by ⁇ -arrestin expression.
  • the terms “treat”, “treatment”, and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition.
  • the present invention provides methods of treating a P-arrestin2 mediated and/or GPR120 mediated response in a subject.
  • the ⁇ -arrestin mediated and/or GPCR mediated response is inflammation.
  • the method can comprise administering to a subject in whom inflammation is to be treated a therapeutically effective amount of a compound predicted to bind a ⁇ - ⁇ 8 ⁇ 2 molecule and/or a G protein-coupled receptor, where the compound selectively activates a ⁇ -arrestin2-dependent signaling pathway of the GPCR.
  • a GenBank Gene ID No. 109689 and ⁇ -arrestinl has a GenBank Gene ID No. 216869.
  • the invention further provides that GPR120, a GPCR contemplated in the invention and having GenBank Accession No. NP 859529, is expressed in proinflammatory macrophages and is induced in macrophages and Kupffer cells in obesity. DHA and EPA, major omega-3 FAs (co-3 FAs) in fish oil, and GPR120 function as an co-3 FA
  • co-3 FAs exert robust and broad anti-inflammatory effects through GPR120 in macrophages.
  • an co-3 FA supplemented diet exerts both antiinflammatory and anti-diabetic/insulin sensitizing effects in obese mice, but is without effect in GPR120 KO mice.
  • the invention provides methods for treating conditions associated with inflammation and insulin sensitization including, but not limited to, diabetes and obesity.
  • Diseases and disorders that are characterized by P-arrestin2 and/or GPR120 biological activity may be treated with therapeutics that agonize GPR120 activity.
  • Agonists may be administered in a therapeutic or prophylactic manner.
  • Therapeutics that may be used include omega-3 fatty acids, analogs thereof and derivatives thereof, and other modulators that alter the interaction between GPR120 and its binding partners.
  • methods for screening for other agonists are provided herein, including in the Examples section.
  • the agonist can selectively activate a P-arrestin2 -dependent signaling pathway and not activate a ⁇ - arrestinl -dependent signaling pathway.
  • the agonist can selectively activate a -arrestin2-dependent signaling pathway and not activate a G protein-dependent signaling pathway.
  • the agonist can selectively activate a G protein-dependent signaling pathway and not activate a P-arrestin2-dependent signaling pathway.
  • Diseases and disorders that are characterized by decreased GPR120 levels or biological activity may be treated with therapeutics that increase (i.e., are agonists to) activity.
  • Therapeutics that upregulate activity may be administered therapeutically or prophylactically.
  • the invention provides a method for preventing, in a subject, a disease or condition associated with an aberrant GPR120 activity by administering an agent that modulates GPR120 activity.
  • aberrant activity includes inflammatory conditions, including diabetes, inflammatory condition is associated with obesity, and obesity.
  • Subjects at risk for a disease that is caused or contributed to by aberrant GPR120 expression or activity can be identified by, for example, an assay provided in the Examples section herein.
  • Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the GPR120 aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
  • a GPR120 agonist can be used to treat the subject.
  • the appropriate agent can be determined based on screening assays.
  • the subject can be an animal, and in particular a human.
  • Another aspect of the invention pertains to methods of modulating ⁇ - arrestin2 and/or GPR120 biological activity for therapeutic purposes.
  • the modulatory methods of the invention involve contacting a cell with an agent that modulates one or more of the activities of P-arrestin2 and/or GPR120 biological activity associated with the cell.
  • An agent that modulates p-arrestin2 and/or GPCR biological activity can be a naturally occurring cognate ligand of GPR120 such as an omega-3 fatty acid, a peptide, a GPR120 and/or P-arrestin2 peptidomimetic, dsRNA, small molecule, and the like.
  • Modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent) or in vivo (e.g., by administering the agent to a subject).
  • the invention provides methods of treating an individual afflicted with a disease or disorder characterized by expression or activity of a ⁇ -arrestin and/or GPCR.
  • the method involves
  • an agent e.g., an agent identified by a screening assay
  • agents that modulates e.g., up-regulates
  • GPR120 biological activity e.g., administering an agent (e.g., an agent identified by a screening assay), or combination of agents that modulates (e.g., up-regulates) -arrestin2 and/or GPR120 biological activity.
  • the inflammation being treated by the method is a lipopolysaccharide ("LPS") induced inflammatory response.
  • the inflammation being treated by the method is a TNF-a-induced inflammatory response.
  • the P-arrestin2 mediated response is cytokine secretion.
  • cytokines include, but are not limited to TNF-a and interleukin-6.
  • the method can comprise administering to a subject in whom cytokine secretion is sought to be inhibited a therapeutically effective amount of a compound predicted to bind GPR120, where the compound selectively activates a P-arrestin2- dependent signaling pathway of GPR120.
  • the cytokine secretion being inhibited is a lipopolysaccharide-induced cytokine secretion.
  • a method for screening compounds predicted to bind GPR120 in such a manner as to produce -arrestin2 biased activity includes administering to a subject an amount of a compound predicted to bind a GPCR sufficient to generate a physiological response, evaluating that response, administering to the subject an effect amount of an siRNA capable of binding a P-arrestin2 RNA, allowing the binding to occur, and then evaluating the response once again. If the physiological response is reversed at the time of the second evaluation, then the compound being evaluated is a P-arrestin2 biased compound.
  • the method for screening described above is provided, wherein the physiological response evaluated is a
  • the method for screening described above is provided, wherein the physiological response is a lipopolysaccharide-induced cytokine secretion.
  • agents that modulate functional P-arrestin2 and/or functional GPR120 are contemplated by certain aspects of the present invention. Such agents are useful in treating conditions associated with P-arrestin2 function and/or GPR120 function. Such agents are also useful for screening for P-arrestin2 biased ligands or other compounds for GPCRs. These agents are useful in both in vivo and in vitro screening methods.
  • Agents that decrease levels of functional P-arrestin2 can target functional P-arrestin2 or nucleotides encoding therefor, resulting in a descrease in P-arrestin2 activity.
  • the various classes of agents for use herein as agents that decrease levels of functional ⁇ - arrestin2 generally include, but are not limited to, RNA interference molecules, antibodies, small inorganic molecules, antisense oligonucleotides, and aptamers.
  • Agents that agonize functional GPCR, and specifically GPR120 can include the ⁇ -3 FAs identified herein.
  • Naturally occurring ⁇ -3 FAs are well known in the art.
  • modified co-3 FAs can be made by methods known in the art. See, e.g., Bailey 's Industrial Oil and Fat Products, Sixth Edition, Six Volume Set. Edited by
  • co-3 FAs having a biological activity useful in performing the methods of the invention can be indentified by employing the methods described herein.
  • RNA interference can be used to decrease the levels of functional P-arrestin2.
  • RNAi methods can utilize double-stranded RNAs, for example, small interfering RNAs (siRNA), short hairpin RNAs (shRNA), and micro RNAs (miRNA).
  • siRNA small interfering RNAs
  • shRNA short hairpin RNAs
  • miRNA micro RNAs
  • dsRNA molecule design programs using a variety of algorithms are known to the art (see e.g., Cenix algorithm, Ambion; BLOCK-iTTM RNAi Designer, Invitrogen; dsRNA Whitehead Institute Design Tools, Bioinofrmatics & Research
  • Traits influential in defining optimal dsRNA sequences include G/C content at the termini of the dsRNAs, T m of specific internal domains of the dsRNA, dsRNA length, position of the target sequence within the CDS (coding region), and nucleotide content of the 3' overhangs.
  • dsRNA molecules specific for functional P-arrestin2, and/or other related molecules with similar functions can effect the RNAi-mediated degradation of the target (P-arrestin2) mRNA.
  • a therapeutically effective amount of dsRNA specific for p-arrestin2 can be adminstered to patient in need thereof to treat a condition mediated by -arrestin2.
  • an effective amount of dsRNA molecule comprises an intercellular concentration at or near the site of misfolding from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of dsRNA can be administered.
  • the dsRNA can be administered to the subject by any means suitable for delivering the RNAi molecules to the cells of interest.
  • dsRNA molecules can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes, such as intravitreous injection.
  • RNAi molecules can also be administered locally (lung tissue) or systemically (circulatory system) via pulmonary delivery.
  • RNAi molecules can be used in conjunction with a variety of delivery and targeting systems, as described in further detail below.
  • dsRNA can be encapsulated into targeted polymeric delivery systems designed to promote payload internalization.
  • the dsRNA can generally be targeted to any stretch of less than 30 contiguous nucleotides, generally about 19-25 contiguous nucleotides, in the functional ⁇ - arrestin2 mRNA target sequences.
  • Exemplary siRNAs targeting ⁇ -arrestin 1 and 2 are provided in Table 1 and Table 2, below. Searches of the human genome database (BLAST) can be carried out to ensure that selected dsRNA sequence will not target other gene transcripts. Techniques for selecting target sequences for dsRNA are known in the art (see e.g., Reynolds et al. (2004) Nature Biotechnology 22(3), 326 - 330).
  • the sense strand of the present dsRNA can comprise a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA of functional P-arrestin2.
  • a target sequence on the target mRNA can be selected from a given cDNA sequence corresponding to the target mRNA, preferably beginning 50 to 100 nt downstream (i.e., in the 3' direction) from the start codon.
  • the target sequence can, however, be located in the 5' or 3' untranslated regions, or in the region nearby the start codon.
  • the dsRNA of the invention can comprise an RNA strand (the antisense strand) having a region which is less than 30 nucleotides in length, generally 19-25 nucleotides in length, and is substantially complementary to at least part of an mRNA transcript of a P-arrestin2 gene.
  • RNA strand the antisense strand
  • very low dosages of these dsRNA can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of a -arrestin2 gene.
  • the methods and compositions of the invention comprising these dsRNAs are useful for screening compounds for selective activating a P-arrestin2 pathway when binding a GPCR.
  • compositions containing dsRNA to inhibit the expression of a P-arrestin2 gene.
  • the pharmaceutical compositions of the invention comprise a dsRNA having an antisense strand comprising a region of complementarity which is less than 30 nucleotides in length, generally 19-25 nucleotides in length, and is substantially complementary to at least part of an RNA transcript of a P-arrestin2 gene, together with a pharmaceutically acceptable carrier.
  • These pharmaceutical compositions are useful in administering the dsRNA to an animal for use in animal models for screening compounds that can selectively activate a ⁇ - arrestin2 pathway when binding a GPCR.
  • compositions comprising the dsRNA of the invention together with a pharmaceutically acceptable carrier, as well as methods of using the compositions to inhibit expression of a ⁇ - arrestin2 gene.
  • dsRNA molecules for inhibiting the expression of a P-arrestin2 gene in a cell or mammal, wherein the dsRNA comprises an antisense strand comprising a region of complementarity that is complementary to at least a part of an mRNA formed in the expression of a P-arrestin2 gene, and wherein the region of complementarity is less than 30 nucleotides in length, generally 19-25 nucleotides in length.
  • the dsRNA has at least 5, at least 10, at least 15, at least 18, or at least 20 contiguous nucleotides per strand in common with at least one strand, but preferably both strands, of one of the dsRNAs shown in Tables 1 and 2.
  • Alternative dsRNAs that target elsewhere in the target sequence of one of the dsRNAs provided in Tables 1 and 2 can readily be determined using the target sequence and the flanking ⁇ - arrestin2 sequence.
  • the dsRNA comprises two RNA strands that are complementary to hybridize to form a duplex structure.
  • One strand of the dsRNA (the antisense strand) comprises a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of a P-arrestin2 gene
  • the other strand (the sense strand) comprises a region which is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
  • the duplex structure is between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 base pairs in length.
  • the region of complementarity to the target sequence is between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 nucleotides in length.
  • the dsRNA of the invention may further comprise one or more single-stranded nucleotide overhang(s). For example,
  • deoxyribonucleotide sequence "tt” or ribonucleotide sequence "UU” can be connected to the 3 '-end of both sense and antisense strands to form overhangs.
  • the dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.
  • dsRNAs comprising a duplex structure of between 20 and 23, but specifically 21 , base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001 , 20:6877- 6888). However, others have found that shorter or longer dsRNAs can be effective as well.
  • the dsRNA of the invention can contain one or more mismatches to the target sequence. If the antisense strand of the dsRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the dsRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to 5 nucleotides from either end, for example 5, 4, 3, 2, or 1 nucleotide from either the 5' or 3' end of the region of complementarity, and preferably from the 5'-end.
  • the dsRNA generally does not contain any mismatch within the central 13 nucleotides.
  • the methods described within the invention can be used to determine whether a dsRNA containing a mismatch to a target sequence is effective in inhibiting the expression of a P-arrestin2 gene. Consideration of the efficacy of dsRNAs with mismatches in inhibiting expression of a P-arrestin2 gene is important, especially if the particular region of complementarity in a p-arrestin2 gene is known to have polymorphic sequence variation within the population.
  • At least one end of the dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides.
  • dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties than their blunt-ended counterparts.
  • the present inventors have discovered that the presence of only one nucleotide overhang strengthens the interference activity of the dsRNA, without affecting its overall stability.
  • dsRNA having only one overhang has proven particularly stable and effective in vivo, as well as in a variety of cells, cell culture mediums, blood, and serum.
  • the single-stranded overhang is located at the 3'-terminal end of the antisense strand or, alternatively, at the 3'-terminal end of the sense strand.
  • the dsRNA may also have a blunt end, generally located at the 5 '-end of the antisense strand.
  • Such dsRNAs have improved stability and inhibitory activity, thus allowing administration at low dosages, i.e., less than 5 mg/kg body weight of the recipient per day.
  • the antisense strand of the dsRNA has a nucleotide overhang at the 3'-end, and the 5'-end is blunt.
  • one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
  • the dsRNA is chemically modified to enhance stability.
  • the nucleic acids of the invention may be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference.
  • Specific examples of preferred dsRNA compounds useful in this invention include dsRNAs containing modified backbones or no natural internucleoside linkages.
  • dsRNAs having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified dsRNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified dsRNA backbones include, for example,
  • phosphorothioates chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates,
  • thionoalkylphosphonates having normal 3'-5' linkages, 2 -5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5 -3' or 2'-5' to 5'-2'.
  • Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821 ; 5,541 ,316; 5,550,1 1 1 ; 5,563,253; 5,571 ,799; 5,587,361 ; and
  • Preferred modified dsR A backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl
  • internucleoside linkages mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • a dsRNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar backbone of a dsRNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular -CH 2- NH.CH 2- , -CH 2- N(CH 3 )-0-CH 2- [known as a methylene (methylimino) or MMI backbone], -CH 2- 0-N(CH 3 ).CH 2- , -CH 2 .N(CH 3 )-N(CH 3 )-CH 2- and -N(CH 3 ).CH 2 .CH 2- [wherein the native phosphodiester backbone is represented as -O.P.O.CH 2 .] of the above- referenced U.S. Pat. No.
  • Modified dsRNAs may also contain one or more substituted sugar moieties.
  • Preferred dsRNAs comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C ⁇ to Ci 0 alkyl or C 2 to Ci 0 alkenyl and alkynyl.
  • n and m are from 1 to about 10.
  • dsRNAs comprise one of the following at the 2' position: C
  • a preferred modification includes 2'-methoxyethoxy (2'-0.CH 2 CH 2 0CH 3 , also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxy-alkoxy group.
  • a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethylaminoethoxyethyl or 2'- DMAEOE), i.e., 2'-O.CH 2- O.CH 2- N(CH 2 ) 2 , also described in examples hereinbelow.
  • 2'-dimethylaminooxyethoxy i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group
  • 2'-DMAOE 2'- dimethylaminoethoxyethoxy
  • 2'-O.CH 2- O.CH 2- N(CH 2 ) 2 also described in examples hereinbelow.
  • dsRNAs may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine,
  • nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thi
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, DsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
  • These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2. degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., DsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp.
  • dsRNAs of the invention involves chemically linking to the dsRNA one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the dsRNA.
  • moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 199, 86, 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994 4 1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969- 973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651 -3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • the present invention also includes dsRNA compounds which are chimeric compounds.
  • dsRNA compounds are dsRNA compounds, particularly dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound.
  • dsRNAs typically contain at least one region wherein the dsRNA is modified so as to confer upon the dsRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the dsRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of dsRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter dsRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxydsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • the dsRNA may be modified by a non-ligand group.
  • a number of non-ligand molecules have been conjugated to dsRNAs in order to enhance the activity, cellular distribution or cellular uptake of the dsRNA, and procedures for performing such conjugations are available in the scientific literature.
  • Such non-ligand moieties have included lipid moieties, such as cholesterol (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S-tritylthiol
  • a thiocholesterol Olet al., Nucl.
  • Acids Res., 1990, 18:3777 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923).
  • Typical conjugation protocols involve the synthesis of dsRNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the dsRNA still bound to the solid support or following cleavage of the dsRNA in solution phase. Purification of the dsRNA conjugate by HPLC typically affords the pure conjugate.
  • a dsRNA for inhibiting functional ⁇ -arrestin protein expression in a cell, the dsRNA having a sense strand and an antisense strand.
  • the antisense strand includes a region of
  • the sense strand is substantially complementary to said antisense strand.
  • the dsRNA upon contact with a cell expressing functional ⁇ -arrestin protein, inhibits functional ⁇ -arrestin protein expression.
  • a ⁇ -arrestin target sequence includes a sequence selected from the group consisting of SEQ ID NO. 1 and SEQ ID NO. 2 or sequences complementary thereto.
  • Another aspect of the present invention provides a method for inhibiting expression of a ⁇ -arrestin gene in a cell.
  • the method includes introducing into the cell a dsRNA having two sequences that are compementary to each other.
  • a sense strand includes a first sequence and an antisense strand includes a second sequence having a region of complimentarity that is substantially complementary to at least a part of an mRNA encoding ⁇ -arrestin.
  • a method for inhibiting ⁇ -arrestin expression is provided, where the dsRNA used includes a sequence selected from the group consisting of SEQ ID NO. 1 and SEQ ID NO. 2, or sequences complementary thereto.
  • the dsRNA of the invention can also be expressed from recombinant viral vectors intracellularly in vivo.
  • the recombinant viral vectors of the invention comprise sequences encoding the dsRNA of the invention and any suitable promoter for expressing the dsRNA sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art.
  • the recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the dsRNA in a particular tissue or in a particular intracellular environment. The use of recombinant viral vectors to deliver dsRNA of the invention to cells in vivo is discussed in more detail below.
  • dsRNA of the invention can be expressed from a recombinant viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
  • Any viral vector capable of accepting the coding sequences for the dsRNA molecule(s) to be expressed can be used, for example vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like.
  • AV adenovirus
  • AAV adeno-associated virus
  • retroviruses e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus
  • herpes virus and the like.
  • the tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
  • lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
  • AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes.
  • an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2.
  • This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector.
  • AAV vectors which express different capsid protein serotypes are within the skill in the art; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791 -801 , the entire disclosure of which is herein incorporated by reference.
  • Preferred viral vectors are those derived from AV and AAV.
  • the dsRNA of the invention is expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector comprising, for example, either the U6 or HI RNA promoters, or the cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • a suitable AV vector for expressing the dsRNA of the invention a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.
  • Suitable AAV vectors for expressing the dsRNA of the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61 : 3096-3101 ; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63 : 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5, 139,941 ; International Patent Application No. WO
  • Antibodies can be used to decrease levels of functional -arrestin2.
  • Antibodies within the scope of the invention include, for example, polyclonal antibodies, monoclonal antibodies, antibody fragments, and antibody-based fusion molecules.
  • Antibodies can be altered or selected so as to achieve efficient antibody internalization. As such, the antibodies can more effectively interact with target intracellular molecules, such as functional p ⁇ arrestin2. Further, antibody-drug conjugates can increase the efficiency of antibody internalization. Efficient antibody internalization can be desirable for delivering functional P-arrestin2 specific antibodies to the intracellular environment for screening ligands or compounds predicted to bind GPCRs for selective activation of P-arrestin2 pathways. Conjugation of antibodies to a variety of agents that can facilitate cellular internalization of antibodies is known in the art (see generally Wu et al. (2005) Nat
  • aptamers that specifically recognize and bind to functional ⁇ - arrestin2 nucleotides or proteins can be used to decrease the level of functional P-arrestin2.
  • Aptamers are nucleic acids or peptide molecules selected from a large random sequence pool to bind to specific target molecule. The small size of aptamers makes them easier to synthesize and chemically modify and enables them to access epitopes that otherwise might be blocked or hidden. And aptamers are generally nontoxic and weak antigens because of their close resemblance to endogenous molecules. Generation, selection, and delivery of aptamers is within the skill of the art (see e.g., Lee et al. (2006) Curr Opin Chem Biol.
  • aptamers can finely discriminate between molecular variants.
  • Aptamers can also be used to temporally and spatially regulate protein function (e.g., functional P-arrestin2 function) in cells and organisms.
  • protein function e.g., functional P-arrestin2 function
  • the ligand-regulated peptide (LiRP) system provides a general method where the binding activity of intracellular peptides is controlled by a peptide aptamer in turn regulated by a cell-permeable small molecule (see e.g., Binkowski (2005) Chem & Biol.
  • aptamers can provide an effective means to decrease functional -arrestin2 levels by, for example, directly binding the functional P-arrestin2 mRNA and/or functional P-arrestin2 expressed protein.
  • Antisense nucleic acid molecules within the invention are those that specifically hybridize (e.g., bind) under cellular conditions to cellular mRNA and/or genomic DNA encoding, for example functional p-arrestin2 protein, in a manner that inhibits expression of that protein, e.g., by inhibiting transcription and/or translation.
  • Antisense molecules effective for decreasing functional p-arrestin2 levels, can be designed, produced, and administered by methods commonly known to the art (see e.g., Chan et al. (2006) Clinical and Experimental Pharmacology and Physiology 33(5-6), 533-540).
  • Ribozyme molecules designed to catalytically cleave target mRNA transcripts can also be used to decrease levels of functional P-arrestin2.
  • Ribozyme molecules specific for functional P-arrestin2 can be designed, produced, and administered by methods commonly known to the art (see e.g., Fanning and Symonds (2006) Handbook Experimental Pharmacology 173, 289-303G, reviewing therapeutic use of hammerhead ribozymes and small hairpin RNA).
  • Triplex-forming oligonucleotides can also be used to decrease levels of related molecules with similar activity (see generally, Rogers et al. (2005) Current Medicinal Chemistry 5(4), 319-326).
  • dsRNAs or other compounds for inhibiting functional -arrestin2 are used in animal models, these dsRNAs or other compounds must be effectively administered to the animals in question. Any suitable methods of administration may be used, and it is understood that many such methods of administration will be readily apparent to those of skill in the art upon reading this disclosure. [0120] Screening
  • another aspect of the invention is directed to a system for screening candidate agents predicted to bind GPCRs for selective activation of functional ⁇ - arrestin2 expression.
  • Assays can be performed on living mammalian cells, which more closely approximate the effects of a particular serum level of drug in the body. Studies using extracts offer the possibility of a more rigorous determination of direct agent/enzyme interactions. Exemplary screening methods are detailed in the examples, below.
  • screening is accomplished by administering to a subject an amount of a compound predicted to bind a GPCR sufficient to generate a physiological response, evaluating that response, administering to the subject an effect amount of a dsRNA (such as, for example, a siRNA) capable of binding a P-arrestin2 RNA, allowing the binding to occur, and then evaluating the response once again. If the physiological response is reversed at the time of the second evaluation, then the compound being evaluated is a P-arrestin2 biased compound.
  • the physiological response can be any response mediated by -arrestin2.
  • a reversal may include an increase of an observed physiological response, while with respect to other responses a reversal may include a decrease of an observed physiological response.
  • the physiological reponse may, for example, relate to a LPS-induced or TNF-a-induced inflammatory response, or may relate to a LPS-induced cytokine secretion.
  • the phrase "relate to" with respect to a physiological response can refer to an increase in the measured physiological response, a decrease in the measured physiological response, or any other measurable variation in the physiological response.
  • kits can include a compound of the present invention, optionally one or more ingredients for preparing a pharmaceutically acceptable formulation of the compound, and instructions for use (e.g., administration).
  • a kit can include a compound of the present invention, optionally one or more ingredients for preparing a pharmaceutically acceptable formulation of the compound, and instructions for use (e.g., administration).
  • different components of a compound formulation can be packaged in separate containers and admixed immediately before use.
  • Such packaging of the components separately can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the compound.
  • the pack may, for example, comprise metal or plastic foil such as a blister pack.
  • Such packaging of the components separately can also, in certain instances, permit long-term storage without losing activity of the components.
  • the different components can be packaged separately and not mixed prior to use.
  • the different components can be packaged in one combination for
  • Kits may include reagents in separate containers such as, for example, sterile water or saline to be added to a lyophilized active component packaged separately.
  • sealed glass ampules may contain lyophilized superoxide dismutase mimetics and in a separate ampule, sterile water, sterile saline or sterile each of which has been packaged under a neutral non-reacting gas, such as nitrogen.
  • Ampules may consist of any suitable material, such as glass, organic polymers, such as polycarbonate, polystyrene, ceramic, metal or any other material typically employed to hold reagents.
  • suitable containers include bottles that may be fabricated from similar substances as ampules, and envelopes that may consist of foil-lined interiors, such as aluminum or an alloy.
  • Other containers include test tubes, vials, flasks, bottles, syringes, and the like.
  • Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle.
  • Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to mix.
  • Removable membranes may be glass, plastic, rubber, and the like.
  • kits can be supplied with instructional materials. Instructions may be printed on paper or other substrate, and/or may be supplied as an electronic-readable medium, such as a floppy disc, mini-CD-ROM, CD-ROM, DVD-ROM, videotape, audio tape, and the like. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an Internet web site specified by the manufacturer or distributor of the kit, or supplied as electronic mail.
  • kits in another aspect of the present invention, includes an effective amount of at least one siR A molecule capable of binding a ⁇ -arrestin RNA, and written indicia providing a user of the kit with instructions for using the kit in accordance with one of the methods described herein.
  • the kit further includes cells suitable for use in evaluating a compound predicted to bind a GPCR in an amount sufficient to evaluate the compound.
  • the cells provided in the kit are mouse monocyte cells.
  • the mouse monocyte cells provided are from the cell line Raw 264.7.
  • Example 1 GPR120, Inflammation, Diabetes and Obesity
  • Fatty acids can function as endogenous ligands modulating inflammatory responses, but not all FAs work in the same way.
  • saturated FAs SFAs
  • unsaturated FAs are weakly pro-inflammatory or neutral
  • G)3-FAs can be anti-inflammatory (Lee et al., 2003; Calder, 2005; Solinas et al., 2007).
  • GPR40, 41 , 43, 84, and 120 GPR40, 41 , 43, 84, and 120. Based on its tissue expression pattern, GPR120 emerged as a receptor of particular interest. As seen in Fig.
  • GPR120 is the only lipid sensing GPCR which is highly expressed in adipose tissue, pro-inflammatory CD1 lc+ macrophages (BMDCs), mature adipocytes, and monocytic RAW 264.7 cells (Fig. 1A and I B).
  • BMDCs pro-inflammatory CD1 lc+ macrophages
  • Fig. 1A and I B monocytic RAW 264.7 cells
  • GPR120 is induced in the stromal vascular fraction (SVF) of adipose tissue (which contains the macrophages), as well as in hepatic Kupffer cells, during high fat diet (HFD) feeding in mice (Fig. 1 C).
  • GPR120 is also expressed in enteroendocrine L cells with negligible expression in muscle (Fig. 1 1 C), hepatocytes or other cell types (Hirasawa et al., 2005, Gotoh et al., 2007).
  • GPR120 signals via a Gaq/1 1 -coupled pathway and can respond to long chain FAs (Hirasawa et al., 2005).
  • Glaxo published GW9508 as a GPR40 selective agonist.
  • this compound was not specific and also stimulated GPR120 (Briscoe et al., 2006). Since macrophages and adipocytes do not express GPR40 (this was confirmed by repeated q-PCR and RT-PCR measures, Fig. 8A), GW9508 is a functional GPR120 specific compound in these cell types.
  • GW9508 treatment broadly and markedly repressed the ability of the TLR4 ligand LPS to stimulate inflammatory responses in RAW 264.7 cells (Fig. ID and E).
  • GW9508 inhibited LPS stimulated phosphorylation of ⁇ and JN , prevented ⁇ degradation, and inhibited TNF-a and IL-6 secretion. All of these effects of GW9508 were completely abrogated by siRNA mediated knockdown of GPR120 (Fig. ID, E and Fig. 8F).
  • GW9508 ligand we found that GW9508, the ⁇ -3 FAs (DHA and EPA) and palmitoleate (CI 6: ln7), all activated the SRE-luc reporter with an EC 50 of 1-10 ⁇ (Fig. 2 A), while SFAs were without effect. GW9508 and DHA were used at 100 ⁇ in all subsequent studies to achieve maximal action.
  • the co-3 FAs (DHA and oc-linolenic acid), and SFA (palmitic acid (C16:0)) activated ERK phosphorylation in RAW 264.7 cells, but only DHA- and a-linolenic acid-mediated ERK phosphorylation were abolished by GPR120
  • RNA interference was not affected by ⁇ -arrestin 1 , 2 or Gaq/1 1 knockdown.
  • ⁇ -arrestin2 knockdown DHA-mediated anti-inflammatory signaling was extinguished, while ⁇ -arrestinl and Gaq/1 1 knockdown were without effect (Fig. 3 A).
  • Fig. 3 A and Fig. 9 show that GPR120 stimulation inhibits both TLR4- and TNF-a mediated inflammatory responses. Since the TNF-a and TLR signaling cascades converge downstream of GPR120 activation, these results indicate that the site of GPR120- induced inhibition is either at, or upstream, of JNK/ ⁇ . LPS activates inflammation through the TLR4 pathway by engaging the serine kinase IRAK, leading to phosphorylation of transforming growth factor- ⁇ activated kinase 1 (TAK1) which is upstream of
  • TNF-a and TLR2/3 also leads to stimulation of TAK1 , resulting in activation of ⁇ and JNK (Takaesu et al., 2003).
  • ⁇ can translocate to a number of GPCRs where it mediates receptor internalization and signaling (Barak et al., 1997).
  • ⁇ can translocate to a number of GPCRs where it mediates receptor internalization and signaling (Barak et al., 1997).
  • Fig. 3D In the basal state, GPR120 was localized to the plasma membrane as assessed by immunostaining (red fluorescence, Fig. 3D), while ⁇ - arrestin2 exhibited a diffuse, largely cytoplasmic staining pattern (green, Fig. 3D).
  • TAK1 binding protein 1 TAK1 binding protein 1
  • Fig. 3H shows that LPS stimulation of RAW 264.7 cells causes TAB1/TAK1 association.
  • DHA treatment leads to the association of ⁇ - arrestin2 with TAB 1 (Fig. 3G) and largely blocks TAK1/TAB 1 association (Fig. 3H).
  • Fig. 9D To further examine the interaction site of p-arrestin2 and GPR120 or TAB1 , we pursued co- immunoprecipitation with a series of -arrestin2 truncation/deletion mutants.
  • GPR120 activation enhances glucose uptake in 3T3-L1 adipocytes.
  • GPR120 KO mice and WT littermates were evaluated on normal chow diet (NC). Body weights were similar in both groups, and as summarized in Fig. 5, glucose tolerance tests (GTT) showed a mild degree of impairment in GPR120 KO animals compared to WTs (Fig. 5A). More impressively, insulin secretion was more than 2-fold greater in the KO animals, and the combination of hyperinsulinemia and mild glucose intolerance indicates the presence of insulin resistance (Fig. 5B and C). This was confirmed by performing
  • hyperinsulinemic/euglycemic clamp studies in the chow fed WT and KO mice (Fig. 5D). These studies revealed a 31% decrease in the glucose infusion rate (GIR) required to maintain euglycemia in the KO mice. Since 70-80% of total body insulin stimulated glucose disposal is accounted for by skeletal muscle glucose uptake (Baron et al, 1988), the decreased insulin stimulated (IS)-glucose disposal rate (GDR) provides direct evidence for skeletal muscle insulin resistance in the KO mice. Likewise, the GPR120 KO mice exhibited a marked decrease in the ability of insulin to suppress hepatic glucose production (HGP), demonstrating the presence of hepatic insulin resistance.
  • HGP hepatic glucose production
  • the decreased GIR was -50% related to muscle and -50% due to liver insulin resistance, respectively. Since the chow diet contains exogenous ⁇ -3 FAs, we conclude that blunted ⁇ -3 FA signaling in the KO mice, accounts for the decreased insulin sensitivity.
  • WT and GPR120 KO mice were placed on 60% HFD for 15 weeks. At this point, separate groups of 15 mice each, were treated for five additional weeks with 60% HFD or an isocaloric HFD diet containing 27% fish oil supplementation enriched in ⁇ -3 FAs. This diet provided 50 and 100 mg of DHA and EPA, respectively, per mouse, per day. Fig.
  • 5E shows that administration of the co-3 FA diet led to improved insulin sensitivity with increased glucose infusion rates, enhanced muscle insulin sensitivity (increased IS-GDR), greater hepatic insulin sensitivity (increased HGP suppression), and decreased hepatic steatosis (Fig. 13A and B).
  • the ⁇ -3 FA diet was completely without effect in the GPR120 KO mice.
  • a separate group of WT mice were treated with the insulin sensitizing thiazolidinedione Rosiglitazone, and the effects of co-3 FAs were equal to or greater (HGP suppression) than the effects of this clinically used insulin sensitizing drug.
  • ⁇ -3 FA treatment had a beneficial effect on hepatic lipid metabolism, causing decreased liver triglycerides, DAGs, along with reduced SFA and co-6 FA content in the various lipid classes (Fig. 13A-C and Table 2).
  • the co-3 FA supplementation was entirely without effect, or much less effective, at reducing hepatic lipid levels in the GPR120 KOs.
  • BMT bone marrow transplantation
  • HFD led to a large but comparable increase in CD1 lb+ and CD1 lc+ ATM content in WT and GPR120 KO mice (Fig. 6B, middle panel).
  • Treatment with the co-3 FA-enriched HFD caused a striking decrease in CD1 lb+ and CD1 l c+ ATMs in WT mice, but was without effect in the GPR120 KO group (Fig. 6B, right panel).
  • the FACS analysis was fully consistent with the histological results.
  • CD1 lc+ ATM content was also greater in the GPR120 KOs on the chow diet relative to WT consistent with the insulin resistance in the KO animals.
  • Omega-3 FAs decrease Ml pro-inflammatory gene and increase M2 anti-inflammatory gene expression in adipose tissue
  • Ml inflammatory genes such as IL-6, TNF- , MCP-1 , IL- ⁇ ⁇ , iNOS, and CD1 lc was increased by HFD compared to chow diet in both genotypes, and was reduced in the co-3 FA treated WT mice, but not in the GPR120 KO mice. Even on chow diet, expression of several inflammatory genes was higher in GPR120 KOs compared to WT, consistent with the insulin resistance observed in the chow- fed KO mice.
  • siRNAs were obtained from Dharmacon. Sequences for GPR120, ⁇ - arrestinl/2, GLUT4 and Gaq/1 1 siRNA duplexes are available upon request. RAW 264.7 cells and 3T3-L1 adipocytes at day 8 from differentiation protocol were collected and electroporated with siRNAs as described previously (GENE PULSER, Bio-Rad) (Yoshizaki et al., 2009). Further experiments were performed after 48 hr of electroporation.
  • GMI Four-Color Real-Time System
  • Arginase 1 ATGGAAGAGACCTTCAGCTAC 27
  • Clec7a C-type lectin domain family 7, member a
  • MMR macrophage mannose receptor
  • HEK 293 and 3T3-L1 cells were maintained as described (Liao et al., 2007). Adipocytes were studied at 10-14 days post-differentiation. RAW 264.7 cells were maintained in 10% low endotoxin fetal bovine serum (Hyclone)/DMEM (1 g/1 of glucose). IPMacs were obtained from WT and GPR120 KO mice and cultured as described previously (Nguyen et al., 2007, Patsouris et al., 2009). L6 myoblast cells were maintained in 10% FBS/MEM until cells become confluent, and then changed medium to 2% serum contained MEM to differentiate into myocyte.
  • HE 293 cells were plated in 60 mm culture dish at day before transfection.
  • HA-tagged GPR120 or/and FLAG-tagged P-arrestin2 mutant were transfected using with Effectene reagent (Qiagen, Valencia CA) following as manufacturer's instructions.
  • Effectene reagent Qiagen, Valencia CA
  • cells were stimulated with 100 ⁇ DHA for 30 min (for interaction between GPR120 and P-arrestin2) or 1 hr (For endogenous TAB1 and P-arrestin2) before harvested cells subjected to immunoprecipitation and western blotting.
  • HEK 293 cells were co-transfected with SRE-luc and either mouse GPR120 or pcDNA3 control plasmid (without GPR120) in 24-well plate. Forty-eight hr after transfection, cells were treated with the indicated concentration of various fatty acids for 6 hr. Cells were harvested, and luciferase activities in the cell extracts were measured as previously described (Oh et al., 2005, Fan et al., 2009).
  • HA-GLUT4-eGFP expression vector were electroporated into day 8 post differentiated 3T3-L1 adipocytes for monitoring of GLUT4 translocation as previously described (Yoshizaki et al., 2007).
  • 3T3-L1 adipocytes were pretreated for 30 min with the indicated drug; and stimulated with 3 ng/ml of insulin for 30 min at 37°C.
  • L6 myocytes were pretreated for 30 min with 100 ⁇ DHA and then stimulated with 100 ng/ml of insulin for 30 min. Glucose uptake was measured as previously described
  • Epididymal fat pads were collected from chow fed WT and GPR120 KO mice, respectively and then mince them by razor blade into smaller pieces (1 -2 cubic mm size). The minced tissues were suspended in Hepes-phosphate salt buffer (Hepes, 10 mM, KCl 4 mM, NaCl 125 mM, KH 2 P0 4 0.8 mM, Na 2 HP0 4 1.3 mM, MgCl 2 ImM, CaCl 2 ImM) and briefly centrifuged at 400 x g. Supernatant was removed from the bottom with a 20 gauge needle syringe.
  • Hepes-phosphate salt buffer Hepes, 10 mM, KCl 4 mM, NaCl 125 mM, KH 2 P0 4 0.8 mM, Na 2 HP0 4 1.3 mM, MgCl 2 ImM, CaCl 2 ImM
  • the floating fat explants were washed once and add the Hepes- phosphate salt buffer as 25% vol/vol (for example, 0.5 ml explants + 1.5 ml buffer) to plate desired aliquot into 12-well plate.
  • the fat tissue explants were gently rotated at 37°C for 30 minutes and then pretreated with or without 100 ⁇ DHA for 30 minutes followed by 100 ng/ml of insulin treatment for 30 min to subject 2-DOG uptake assay.
  • [3H]-2-DOG (1 ⁇ / ⁇ ) was added for 10 min and then terminate the incubation by adding of 10 ⁇ Cytochalasin B.
  • collagenase (Type I; 5 mg/ml) solution was added to each well and incubated plate for another 30 min. Collagen digested sample were washed once and resuspended in IN NaOH. Transfer the rest to a vial and count for radioactivity.
  • Proteins from tissues or cell lysates were extracted with radioimmune precipitation buffer in the presence of phosphatase inhibitors and protease inhibitors (Roche Applied Science). Twenty ⁇ of proteins/lane were separated on a 10% polyacrylamide, precast SDS gel (Bio-Rad) followed by transfer on polyvinylidene difluoride membrane (Immobilon, Millipore), and western blotting was performed as described (Nguyen et al., 2005) with indicated antibodies.
  • lysates were incubated with 1 ⁇ g of anti-p-arrestin2, TAK1 antibody (Cell signaling), or GFP antibody (Santa Cruz Biotechnology) overnight at 4°C and immune complexes precipitated with Protein A/G- conjugated beads (Invitrogen). Beads were washed with PBS and resuspended in sample buffer. Lysates and immune complexes were separated by SDS-PAGE, subjected to western blotting.
  • TNF-a and IL-6 were directly quantified from RAW 264.7 cells with or without GPR120 knockdown, or IPMacs culture medium. Cells were treated with 100 ⁇ GW9508 or DHA for 1 hr prior to treat 100 ng/ml LPS for 6 hr and then collect medium from the cells and subjected to ELISA according to the manufacturer's instructions
  • BIOSOURCE For GLP-1 measurement, mouse blood was collected lhr after indicated diet feeding. Adequate inhibitors (protease inhibitors and Diprotin A as DPP IV inhibitor) were used while blood was collecting and then subjected to ELISA to the manufacturer's instructions (ALPCO, Salem, NH).
  • mice were euthanized and slowly perfused by intracardiac injection with 10 ml of 1% paraformaldehyde diluted in PBS. Finger nail sized fat pad samples were excised and blocked for 1 hr in 5% BSA in PBS with gentle rocking at RT. For detection of intracellular antigens, blocking and subsequent incubations were done in 5% BSA in PBS with 0.3% Triton X-100. Primary antibodies were diluted in blocking buffer to 0.5-1 ⁇ g/ml and added to fat samples for overnight at 4°C.
  • fluorochrome-conjugated secondary antibodies were added for 1 hr at RT. Fat pads were imaged on an inverted confocal microscope (Olympus Fluoview 1000). Anti-mouse antibodies used were against F4/80 and MGL1 (Abeam); Caveolinl (BD Biosciences).
  • In vitro chemotaxis assay was performed as previously described (Patsouris et al., 2009). Briefly, mature 3T3-L1 adipocytes, more than 99% of cells showing large lipids droplets (12 days after differentiation protocol initiation), were used for preparation of conditioned media. Treatment with the 100 ⁇ DHA for 6 hr was performed in serum-free DMEM cultured IPMacs. For the migration per se, 100,000 IPMacs from WT or GPR120 KO mice were used per condition. The IPMacs were placed in the upper chamber of an 8 ⁇ polycarbonate filter (24-transwell format; Corning, Lowell, MA), whereas adipocyte conditioned medium or MCP-1 treatment was placed in the lower chamber. After 3 hr of migration, cells were fixed in formalin and stained with 4', 6-diamidino-2-phenylindole and observed.
  • FACS Fluorescence-activated Cell Sorting
  • Epididymal fat pads were weighed, rinsed in phosphate-buffered saline, and then minced in FACS buffer (phosphate-buffered saline plus 1% BSA).
  • Adipocytes and stromal vascular cells were prepared from collagenase digested adipose tissue as described previously (Nguyen et al., 2007). FACS analysis of stromal vascular cells for macrophage content and subtypes were performed as previously described (Nguyen et al., 2007).
  • GTT Glucose tolerance tests
  • Glucose infusion rate was adjusted until steady-state blood glucose (120 mg/dl, ⁇ 5 mg/dl) was achieved.
  • the mouse were exsanguinated by cardiac puncture (>1 ml, whole blood collected), and tissues were harvested, mass recorded, and preserved as required for future analysis.
  • clamp studies were performed on WT animals on 60% HFD for 15 weeks.
  • BMT bone marrow transplantation
  • DHA and EPA concentrations in plasma TG and liver total TAG were measured by Lipomics, Inc. (West Sacramento, CA).
  • the lipids were extracted from plasma and tissues in the presence of authentic internal standards using chloroform mixed with methanol (2: 1 vol/vol) (Folch et al., 1957) and individual lipid classes were separated by HPLC (Cao et al., 2008).
  • Lipid class fractions were transesterified in 1% sulfuric acid (in methanol) in a sealed vial with nitrogen at 100°C for 45 min.
  • Fatty acid methyl esters were extracted from the mixture with hexane containing 0.05% butylated hydroxytoluene, and readied for gas chromatography under nitrogen.
  • fatty acid methyl esters were separated and quantified by capillary gas chromatography equipped with a 30 m DB-88MS capillary column and a flame-ionization detector.
  • GPR120 functions as an co-3 FA receptor/sensor in pro-inflammatory macrophages and mature adipocytes.
  • DHA and EPA the major natural co-3 FA constituents of fish oil
  • GPR120-mediated anti-inflammation involves inhibition of TAKl through a P-arrestin2/TAB 1 dependent effect. Since chronic tissue inflammation is an important mechanism causing insulin resistance (Xu et al., 2003, Shoelson et al., 2007, Schenk et al., 2008), the anti-inflammatory actions of ⁇ -3 FAs exert potent insulin sensitizing effects.
  • GPR120 The in vivo anti-inflammatory and insulin sensitizing effects of co-3 FAs are dependent on expression of GPR120, as demonstrated in studies of obese GPR120 KO animals and WT littermates.
  • GPR120 is highly expressed in pro-inflammatory macrophages and functions as an co-3 FA receptor, mediating the anti-inflammatory effects of this class of FAs to inhibit both the TLR2/3/4 and the TNF-a response pathways and cause systemic insulin sensitization.
  • GPR120 is a Gaq/1 1-coupled receptor, and since it is expressed in enteroendocrine L cells, past interest in this receptor has focused on its potential ability to stimulate L cell GLP-1 secretion.
  • GPR120 is highly expressed in pro-inflammatory, Ml -like macrophages and mature adipocytes, with negligible expression in muscle, pancreatic ⁇ -cells, and hepatocytes (Gotoh et al., 2007).
  • GPR120 expression is highly induced in ATMs as well as resident liver macrophages (Kupffer cells).
  • TAKl activation stimulates both the ⁇ /NFKB and JNK/ API pathways, and the TLR and TNF-a signaling pathways converge at this step.
  • Our data show that stimulation of GPR120 specifically inhibits TAKl phosphorylation and activation providing a common mechanism for the inhibition of both TLR and TNF-a signaling.
  • Beta-arrestins can serve as important adaptor and scaffold molecules mediating the functions of a number of different GPCRs, as well as other receptor subtypes (Miller and Lefkowitz, 2001).
  • the C-terminal region of GPR120 contains several putative P-arrestin2 binding motifs ((S/T)X4-5(S/T); Cen et al., 2001), but whether ⁇ -arrestins play any role in GPR120 function was unknown.
  • P-arrestin2 binding motifs (S/T)X4-5(S/T); Cen et al., 2001)
  • ⁇ -arrestins play any role in GPR120 function was unknown.
  • activation of GPR120 by DHA stimulation leads to association of the receptor with P-arrestin2, but not ⁇ -arrestinl , and that the anti-inflammatory effects of GPR120 are completely P-arrestin2 dependent.
  • Functional immunocytochemical studies showed that DHA stimulation leads to recruitment of P-arrestin2 to the plasma membrane where it co-localizes with GPR120.
  • TAB 1 is the activating protein for TAK1 and our results show that following DHA-stimulated internalization of the GPR120/p-arrestin2 complex, ⁇ - arrestin2 can now associate with TAB 1 , as measured in co-immunoprecipitation experiments; only full-length p-arrestin2 was capable of interacting with GPR120 and TAB1. This apparently blocks the association of TAB 1 with TAK1 , inhibiting TAK1 activation and downstream signaling to the ⁇ /NFKB and JNK/AP1 system.
  • GPR120 is not expressed in muscle, and DHA did not stimulated glucose uptake in L6 myocytes (Fig. 1 1C and 1 ID).
  • acute administration of DHA had no stimulatory effects on IS-GDR (Fig. 1 IE). This reports the conclusion that the in vivo stimulatory effects of DHA on GDR are related to anti-inflammation, and that the glucose transport stimulatory effects in adipocytes contribute little to the overall phenotype.
  • DHA treatment inhibited the ability of primary WT macrophages to migrate towards adipocyte CM. This could be due to DHA-induced decreased chemokine secretion or down regulation of chemokine receptors, or both.
  • DHA by signaling through GPR120, can mediate heterologous desensitization of other GPCR chemokine receptors.
  • M2 markers such as IL-10, arginase 1 , MGL1 , Ym-1 , Clec7a, and MMR.
  • M2 markers such as IL-10, arginase 1 , MGL1 , Ym-1 , Clec7a, and MMR.
  • co-3 FAs can redirect ATMs from an Ml to an M2 polarization state.
  • these mechanisms account for the decreased inflammatory state.
  • the in vivo anti-inflammatory actions of ⁇ -3 FAs are consistent with the insulin sensitizing effects of these agents and are fully dependent on the presence of GPR120, indicating a causal relationship.
  • CE Cholesterol ester
  • DAG diacylgiycerol
  • FFA free fatty acid
  • LYPC lysophosphatidylcholine
  • PC phosphatidylcholine
  • PE phosphatitylethanolamine
  • Dietary DHA is rapidly esterified into chylomicrons during the process of gastrointestinal absorption, and is also packaged into VLDL triglycerides by the liver. DHA can also be esterified into phospholipids and cholesterol esters associated with circulating lipopoproteins and only a small proportion ( ⁇ 5%) of total plasma DHA is found in the FFA pool.
  • co-3 FAs are cleaved from circulating triglycerides where they can act as ligands or be taken up by peripheral tissues (Polozova and Salem Jr., 2007).
  • GPR120 functions as an co-3 FA receptor/sensor and mediates robust and broad anti-inflammatory effects, particularly in macrophages.
  • GPR120 couples to P-arrestin2 which is followed by receptor endocytosis and inhibition of TAB 1 -mediated activation of TAK1 , providing a mechanism for inhibition of both the TLR and TNF-a pro-inflammatory signaling pathways.
  • TAB 1 receptor endocytosis
  • TAB 1 TAB 1 -mediated activation of TAK1
  • GW9508 was purchased from Tocris bioscience (Ellisville, MO) and DHA was from Cayman chemical (Ann Arbor, MI). All other chemicals were purchased from Sigma unless mentioned otherwise.
  • mice were switched to an isocaloric HFD-containing 27% menhaden fish oil replacement (wt/wt; menhaden fish oil: 16% EPA (C20:5n3), 9%, DHA (C22:6n3), Research Diet) (Jucker et al., 1999, Neschen et al., 2007) and fed for 5 weeks. Mice received fresh diet every 3rd day, and food
  • beta-arrestin2 as a G protein-coupled receptor-stimulated regulator of NF- kappaB pathways. Mol Cell 14, 303-317.
  • Phenotypic switching of adipose tissue macrophages with obesity is generated by spatiotemporal differences in macrophage subtypes. Diabetes 57, 3239-3246.
  • TAK1 is critical for IkappaB kinase-mediated activation of the NF-kappaB pathway. J Mol Biol 326, 105-1 15.
  • Bone marrow-specific Cap gene deletion protects against high-fat diet-induced insulin resistance. Nat Med 13, 455-462.
  • Myosin 5a is an insulin-stimulated Akt2 (protein kinase Bbeta) substrate modulating GLUT4 vesicle translocation. Mol Cell Biol 27, 5172-5183.
  • SIRT1 exerts anti -inflammatory effects and improves insulin sensitivity in adipocytes. Mol Cell Biol 29, 1363-1374.

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des procédés de traitement d'une réponse à médiation par la ß-arrestine2 et/ou GPR 120 chez un sujet. La réponse à médiation par la ß-arrestine2 et/ou GPR 120 peut être une inflammation, notamment le diabète, une inflammation associée à l'obésité et l'obésité. Les procédés peuvent comprendre l'administration à un sujet d'une quantité thérapeutiquement efficace d'un composé prévu pour se lier à une molécule de ß-arrestine2 et/ou GPR 120, le composé activant de manière sélective une voie de signalisation dépendante de la ß-arrestine2 de GPR 120.
PCT/US2010/059699 2009-12-09 2010-12-09 Procédés de traitement d'états inflammatoires WO2011072132A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/493,241 US8987332B2 (en) 2009-12-09 2012-06-11 Methods of treating inflammatory conditions

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US28508609P 2009-12-09 2009-12-09
US61/285,086 2009-12-09
US37760110P 2010-08-27 2010-08-27
US61/377,601 2010-08-27
US37962610P 2010-09-02 2010-09-02
US61/379,626 2010-09-02

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/493,241 Continuation US8987332B2 (en) 2009-12-09 2012-06-11 Methods of treating inflammatory conditions

Publications (1)

Publication Number Publication Date
WO2011072132A1 true WO2011072132A1 (fr) 2011-06-16

Family

ID=44145916

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/059699 WO2011072132A1 (fr) 2009-12-09 2010-12-09 Procédés de traitement d'états inflammatoires

Country Status (2)

Country Link
US (1) US8987332B2 (fr)
WO (1) WO2011072132A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014011926A1 (fr) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comportant des statines, des biguanides et d'autres agents pour réduire un risque cardiométabolique
WO2015125085A1 (fr) 2014-02-19 2015-08-27 Piramal Enterprises Limited Composés pouvant être utilisés à titre d'agonistes de gpr120
WO2016125182A1 (fr) 2015-02-05 2016-08-11 Piramal Enterprises Limited Composés contenant une séquence de liaison carbone-carbone en tant qu'agonistes gpr120
WO2017158355A1 (fr) * 2016-03-15 2017-09-21 Queen Mary University Of London Méthode de traitement de l'obésité
US10214521B2 (en) 2014-09-11 2019-02-26 Piramal Enterprises Limited Fused heterocyclic compounds as GPR120 agonists
US10273230B2 (en) 2014-07-25 2019-04-30 Piramal Enterprises Limited Substituted phenyl alkanoic acid compounds as GPR120 agonists and uses thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10682397B2 (en) * 2015-12-04 2020-06-16 Massachusetts Institute Of Technology Methods of treating fragile X syndrome and related disorders

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060026702A1 (en) * 2002-03-19 2006-02-02 Duke University Phosphoinositide 3-kinase mediated inhibition of GPCRs
WO2007134613A1 (fr) * 2006-05-24 2007-11-29 Rheoscience A/S Modulation de l'activité des gpr120 dans les adipocytes/tissu graisseux
WO2008074839A2 (fr) * 2006-12-19 2008-06-26 Ablynx N.V. Séquences d'acides aminés dirigées contre les gpcr et polypeptides les contenant pour le traitement de maladies et de troubles liés au gpcr
US20090274730A1 (en) * 2007-10-25 2009-11-05 Revalesio Corporation Compositions and methods for treating inflammation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060026702A1 (en) * 2002-03-19 2006-02-02 Duke University Phosphoinositide 3-kinase mediated inhibition of GPCRs
WO2007134613A1 (fr) * 2006-05-24 2007-11-29 Rheoscience A/S Modulation de l'activité des gpr120 dans les adipocytes/tissu graisseux
WO2008074839A2 (fr) * 2006-12-19 2008-06-26 Ablynx N.V. Séquences d'acides aminés dirigées contre les gpcr et polypeptides les contenant pour le traitement de maladies et de troubles liés au gpcr
US20090274730A1 (en) * 2007-10-25 2009-11-05 Revalesio Corporation Compositions and methods for treating inflammation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"Acta Pharmalogica Sinica", 19 March 2011 (2011-03-19), Retrieved from the Internet <URL:http://www.chinaphar.com/1671-4083/2009.htm> *
LATTIN ET AL.: "G-protein-coupled receptor expression, function, and signaling in macrophages.", J OF LEUKOCYTE BIOL., vol. 82, 2007, pages 16 - 32 *
SANGIOVANNI ET AL.: "The role of omega-3 long-chain polyunsaturated fatty acids in health and disease of the retina.", PROGRESS IN RETINAL AND EYE RESEARCH., vol. 24, 2005, pages 87 - 138 *
WANG ET AL.: "Fenoterol, a Beta-2-adrenoceptor agonist, inhibits LPS induced membrane-bound CD14, TLR4/CD14 complex, and inflammatory cytokines production through B-arrestin-2 in THP -1 cell line.", ACTA PHARRNALOGICA SINICA, vol. 30, November 2009 (2009-11-01), pages 1522 - 1528 *
ZHANG ET AL.: "Beta-Arrestinl and Beta-arrestin2 are differentially required for phosphorylation-dependent and -independent intemalization of d-opioid receptors.", J OF NEUROCHEMISTRY., vol. 95, 2005, pages 169 - 178 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014011926A1 (fr) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comportant des statines, des biguanides et d'autres agents pour réduire un risque cardiométabolique
WO2015125085A1 (fr) 2014-02-19 2015-08-27 Piramal Enterprises Limited Composés pouvant être utilisés à titre d'agonistes de gpr120
US10227360B2 (en) 2014-02-19 2019-03-12 Piramal Enterprises Limited Compounds for use as GPR120 agonists
US10273230B2 (en) 2014-07-25 2019-04-30 Piramal Enterprises Limited Substituted phenyl alkanoic acid compounds as GPR120 agonists and uses thereof
US10214521B2 (en) 2014-09-11 2019-02-26 Piramal Enterprises Limited Fused heterocyclic compounds as GPR120 agonists
WO2016125182A1 (fr) 2015-02-05 2016-08-11 Piramal Enterprises Limited Composés contenant une séquence de liaison carbone-carbone en tant qu'agonistes gpr120
WO2017158355A1 (fr) * 2016-03-15 2017-09-21 Queen Mary University Of London Méthode de traitement de l'obésité
US10925849B2 (en) 2016-03-15 2021-02-23 Queen Mary University Of London Method of treatment of obesity
US12023313B2 (en) 2016-03-15 2024-07-02 Queen Mary University Of London Method of treatment of obesity

Also Published As

Publication number Publication date
US20120295975A1 (en) 2012-11-22
US8987332B2 (en) 2015-03-24

Similar Documents

Publication Publication Date Title
US8987332B2 (en) Methods of treating inflammatory conditions
Talukdar et al. GPR120 is an omega-3 fatty acid receptor mediating potent anti-inflammatory and insulin-sensitizing effects
KR20210010529A (ko) 안지오텐시노젠(AGT) iRNA 조성물 및 이들의 사용 방법
US8906875B2 (en) Methods of treating vascular inflammatory disorders
US20130150431A1 (en) Mir-33 inhibitors and uses thereof
Kawasaki et al. Blockade of B-cell-activating factor signaling enhances hepatic steatosis induced by a high-fat diet and improves insulin sensitivity
US11319368B2 (en) Treatment of hepatotoxicity with IL-11 antibody
US20210177940A2 (en) Treatment and prevention of metabolic diseases
WO2014122660A1 (fr) Inhibiteurs de cd14 en tant que traitement efficace pour l&#39;infection par vhc
Wang et al. Pentraxin-3 is a TSH-inducible protein in human fibrocytes and orbital fibroblasts
Jin et al. Babam2 negatively regulates osteoclastogenesis by interacting with Hey1 to inhibit Nfatc1 transcription
WO2014209947A2 (fr) Méthodes et compositions permettant d&#39;inhiber le trpv4
WO2006068133A1 (fr) Procede de suppression de l’expression de nfat2
US20200182860A1 (en) Methods for identifying therapeutic agents which interact with stk24
US9732346B2 (en) SiRNA targeting PRK2, which is hepatitis C virus therapeutic agent
US8815799B2 (en) Inhibiting striated muscle activator of RHO (stars) to improve glycemic control
US20110015123A1 (en) Modulation of GLUT4 Gene Promoter activity BY AHNAK
KR101668954B1 (ko) ＨＣＶ ＩＲＥＳ를 표적으로 하는 Ｃ형 간염 바이러스 치료제 siRNA
EA047713B1 (ru) Лечение гепатотоксичности
JP2008245581A (ja) カルパイン遺伝子をノックダウンする核酸
KR20050012082A (ko) 노화세포의 생물학적 기능 회복 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10836687

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10836687

Country of ref document: EP

Kind code of ref document: A1