WO2011071632A2 - Promoteur insm1 modifié pour la thérapie génique d'une tumeur neuroendocrine et les diagnostics - Google Patents

Promoteur insm1 modifié pour la thérapie génique d'une tumeur neuroendocrine et les diagnostics Download PDF

Info

Publication number
WO2011071632A2
WO2011071632A2 PCT/US2010/055844 US2010055844W WO2011071632A2 WO 2011071632 A2 WO2011071632 A2 WO 2011071632A2 US 2010055844 W US2010055844 W US 2010055844W WO 2011071632 A2 WO2011071632 A2 WO 2011071632A2
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
insml
expression construct
insm1
cells
Prior art date
Application number
PCT/US2010/055844
Other languages
English (en)
Other versions
WO2011071632A3 (fr
Inventor
Mary B. Breslin
Michael S. Lan
Original Assignee
Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College filed Critical Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College
Priority to US13/505,823 priority Critical patent/US9090907B2/en
Publication of WO2011071632A2 publication Critical patent/WO2011071632A2/fr
Publication of WO2011071632A3 publication Critical patent/WO2011071632A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/32—Vector systems having a special element relevant for transcription being an silencer not forming part of the promoter region
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/40—Vector systems having a special element relevant for transcription being an insulator

Definitions

  • This invention is for the treatment and/or diagnosis of human neuroendocrine tumors using an expression construct comprising the nucleic acid sequence from the human insulinoma-associated 1 (INSM1) promoter (nucleotides -1661 to +40 bp or portion thereof) and one or more elements selected from neuron restrictive silencer elements and insulator elements.
  • the construct can contain a suicide or toxin gene for treatment of tumors and/or a reporter gene for visualization or detection.
  • the construct may be linked directly with a reporter gene for diagnosis of neuroendocrine tumors.
  • Insulinoma-associated 1 is a transcriptional repressor protein that is required for the development of the endocrine pancreas, adrenal gland, basal neuronal progenitor cells in the neocortex, and the monoaminergic neurons in the hindbrain (1).
  • INSM1 expression is restricted to early fetal development in neuronal and endocrine tissues (2-6).
  • INSMl mRNA is despite its absence in normal adult tissues, it is strongly expressed in tumors of neuroendocrine origin such as small cell lung carcinoma (SCLC), medullablastoma, neuroblastoma, medullary thyroid carcinoma, insulinoma, retinoblastoma, pheochromocytoma, and pituitary tumors (7-9).
  • SCLC small cell lung carcinoma
  • medullablastoma neuroblastoma
  • neuroblastoma medullary thyroid carcinoma
  • insulinoma retinoblastoma
  • pheochromocytoma pituitary tumors
  • Adenoviral vectors are one of the most widely exploited viral delivery systems for gene therapy due to their ability to infect a wide range of host cells and the minimal risk associated with the use of a non-replicating form of the virus.
  • the adenovirus genome is easily manipulated and with the deletion of the El and E3 genes allows for the incorporation of up to 7.5 kilobase pairs of exogenous sequence.
  • one major drawback of adenovirus is host mediated immunity to the virus.
  • the liver is most susceptible to toxic side effects.
  • the most effective construct was the nAChR NRSE element positioned downstream of the INSMl promoter. This construct increased the tissue specificity of the INSMl promoter without a significant decrease in its activity.
  • a construct using the chicken HS4 ⁇ -globin insulator element was shown to work as expected. Linking the construct to a reporter gene allows for detection of the placement of the viral vector, and can be used for diagnosing neuroendocrine tumors.
  • these constructs when placed in a viral vector can be used for treatment and diagnosing of neuroendocrine tumors.
  • Fig. 1 illustrates the effect of modifications to the INSMl promoter on the luciferase reporter gene activity at 24 hours post transfection as compared to the controls in non-neuronal human cells, i.e., in HepG2 (hepatocellular carcinoma), HEK-293 (embryonic kidney), Cos7* (African green monkey kidney), or U87MG (glioblastoma) cells. All transfections were performed in triplicate on at least three occasions.
  • Fig. 2 illustrates the effect of various INSMl promoter modifications on luciferase activity as compared to a control in several human lung cancer cell lines, i.e., in BEAS (normal bronchial epithelial cells), NCI-H23 (lung adenocarcinoma cells), SHP-77 (small cell lung cancer; SCLC) and NCI-H1155 (large-cell neuroendocrine carcinoma; LCNEC). All transient transfections were normalized with TK-renilla and performed in triplicate on three separate occasions.
  • BEAS normal bronchial epithelial cells
  • NCI-H23 lung adenocarcinoma cells
  • SHP-77 small cell lung cancer
  • NCI-H1155 large-cell neuroendocrine carcinoma
  • FIG. 3 illustrates the effect of various modified INSMl promoter luciferase constructs at 24 hr post transfection as compared to a control in INSMl positive tumors, i.e., in INSMl positive human tumor cell lines, IMR-32 (neuroblastoma), Y79 (retinoblastoma), and TT (medullary thyroid carcinoma). All transfections were performed in triplicate on at least three separate occasions.
  • Fig. 4A is a schematic diagram of configuration of the INSMl promoter HSV-
  • Tk-Luciferase 2 gene in the adenovirus genome Tk-Luciferase 2 gene in the adenovirus genome.
  • Fig. 5A illustrates the in vivo imaging on days 0, 3, 5, 7, 11 and 13 to monitor the progression of INSMl promoter viral gene therapy and effect on tumor size in Mouse #2 injected initially with IX 10 7 NCI-H1155 red fluorescent SCLC cells to visualize a tumor mass, and then given a single intratumoral injection of IX 10 9 ifu (infection units) of the Ad- INSMlp-HSV-tklRES-Luc2 virus. The location and size of the tumor mass is visualized suing the red fluorescence of the SCLC cells.
  • Fig. 5B illustrates the in vivo imaging on days 0, 3, 5, 7, 1 1 and 13 to monitor the progression of I SMl promoter viral gene therapy in Mouse #2 injected initially with IX 10 7 NCI-HI 155 red fluorescent SCLC cells, and then given a single intratumoral injection of 1X10 9 ifu of the Ad-LNSMlp-HSV-tklRES-Luc2 virus. Prior to imaging in Fig. 5B, the mice were given a 100 ⁇ intraperitoneal injection of 15 mg/ml D-luciferin to detect luciferase activity.
  • Fig. 6A illustrates the in vivo imaging on days 0, 3, 5, 7, 11 and 13 to monitor the progression of INSMl promoter viral gene therapy and effect on tumor size in Mouse #3 injected initially with IX 10 7 NCI-H1155 red fluorescent SCLC cells to visualize a tumor mass, and then given a single intratumoral injection of 1X10 9 ifu of the Ad-INSMlp-HSV- tklRES-Luc2 virus. The location and size of the tumor mass is visualized suing the red fluorescence of the SCLC cells.
  • Fig. 6B illustrates the in vivo imaging on days 0, 3, 5, 7, 1 1 and 13 to monitor the progression of INSMl promoter viral gene therapy in Mouse #3 injected initially with IX 10 7 NCI-HI 155 red fluorescent SCLC cells, and then given a single intratumoral injection of 1X10 9 ifu of the Ad-INSMlp-HSV-tklRES-Luc2 virus. Prior to imaging in Fig. 6B, the mice were given a 100 ⁇ intraperitoneal injection of 15 mg/ml D-luciferin to detect luciferase activity.
  • FIG. 7A illustrates the in vivo imaging showing the biodistribution of two different constructs, Ad-SV40Luc2 and Ad-INSMlpLuc2 virus in naive animals at 24 hr following a sing le IX 10 9 ifu of either Ad-SV40Luc2 or Ad-INSMlp-Luc2 virus injected intraperitoneally into BALB/c mice.
  • the animals were given 100 ⁇ 15 mg/ml D-luciferin and imaged for luminescence signal and X-ray.
  • Fig. 7B illustrates the in vivo imaging showing the biodistribution of two different constructs, Ad-SV40Luc2 and Ad-INSMlpLuc2 virus in naive animals at 48 hr following a single 1X10 9 ifu of either Ad-SV40Luc2 or Ad-INSMlp-Luc2 virus injected intraperitoneally into BALB/c mice.
  • the animals were given 100 ⁇ 15 mg/ml D-luciferin and imaged for luminescence signal and X-ray.
  • Fig. 8 illustrates the amount of luciferase activity (normalized against total protein from each tissue) from mice injected with either the Ad-SV40Luc2 or the Ad- INSMlpLuc2 virus as found in various animal tissue homogenates forty eight hours following initial virus injection. The animals were sacrificed, tissues removed, homogenized in a luciferase assay buffer, and luciferase activity was measured.
  • Fig. 9 is a schematic diagram of several new configurations of the INSM1 promoter luciferase constructs: C or control is the original configuration of the viral constructs; CI is the whole transgene cloned in the opposite orientation with the addition of the 2XAchR NRSE elements; C2 is the original promoter construct with a HS4 chicken ⁇ - globin insulator; M2 contains two upstream copies of the HS4 chicken ⁇ -globin insulator and the 2XAchR NRSEs; and M3 contains the INSMlp 2XAchR NRSE cloned in the opposite orientation and flanked on both sides by the HS4 insulator elements.
  • Fig. 10 illustrates the % luciferase assay in several INSMl negative cell lines
  • Fig. 12A illustrates the in vitro luciferase activity in tumor slices obtained from male nude mice ten days after injection with 1X10 7 NCI-H1155 red fluorescent tumor cells, and luciferase activity measured 24 hours after the tumor slices were infected with 4X10 8 ifu Ad-CMV-LacZ, Ad-SV40-Luc2, Ad-INSMlp-Luc2, or Ad-INSMlp-HSV- tkIRES-Luc2 viruses and after 10 min incubation in the presence of 5 ⁇ 3 mg/ml D-luciferin substrate.
  • the graph is the average of the relative light units as measured from the plate reader (not corrected for fluorescence).
  • Fig. 12B illustrates the in vitro luciferase activity in tumor slices obtained from male nude mice ten days after injection with 1X10 7 NCI-H1155 red fluorescent tumor cells, and luciferase activity measured 24 hours after the tumor slices were infected with 4X10 8 ifu Ad-CMV-LacZ, Ad-SV40-Luc2, Ad-INSMlp-Luc2, or Ad-INSMlp-HSV- tkIRES-Luc2 viruses and after 10 min incubation in the presence of 5 ⁇ 3 mg/ml D-luciferin substrate.
  • the graph represents the luciferase activity divided by the mean fluorescence of the tumor slice for normalization.
  • NRSEs were placed in the construct either directly upstream or downstream of the INSMl promoter sequence.
  • the most effective construct was the nAChR NRSE element positioned downstream of the INSMl promoter. This construct increased the tissue specificity of the INSMl promoter without a significant decrease in its activity.
  • We have successfully tested the modified INSMl promoter for suicide gene therapy by linking it to a toxin for tumor therapy, the herpes simplex virus -thymidine kinase gene.
  • constructs with an insulator element with the INSMl promoter to decrease the interference of the viral genome on its expression.
  • a construct using the chicken HS4 ⁇ -globin insulator element was successfully tested. Linking the construct to a reporter gene allows for detection of the localization of the viral vector, and can be used for diagnosing neuroendocrine tumors.
  • constructs that do not decrease the INSMl promoter activity but significantly augment the tumor specificity of the promoter We have shown that these constructs when placed in a viral vector can be used for treatment and diagnosing of neuroendocrine tumors.
  • NRSE neuron-restrictive silencer element
  • NRSF neuron-restrictive silencer factor
  • NRSE neuron-restrictive silencer element
  • NRSE elements when bound by its cognate protein, the neuron restrictive silencing factor, NRSF, can strongly repress transcription in non-neuronal cells as well as allow transcription of the same gene in neuronal cells.
  • Examples of neuronal restrictive silencer elements include those derived either from the mouse nicotinic acetylcholine receptor (nAChR) or the rat superior cervical ganglion 10 (SCG10) promoters. Multiple neuronal genes have been shown to be repressed by NRSF protein via a NRSE element located in their promoter regions.
  • neuronal genes repressed by NRSF in non-neuronal cells include protocadherin, tryptophan hydroxylase-2, mu opioid receptor, tyrosine hydroxylase, N-methyl-D-aspartate receptor 2B, proprotein convertase 2, glutamate receptor 2, GluR2, arginine vasopressin, brain-derived neutrophic factor, neural-specific type II sodium channel, and dopamine beta hydroxylase genes.
  • insulator element is a
  • DNA segment that has the ability to protect genes from inappropriate signals originating from the surrounding environment by acting as a physical barrier or boundary.
  • An insulator element blocks the interaction between a promoter and enhancers when it is inserted between them, or it confers expression of integrated foreign genes independent of their position in the chromatin.
  • the 5 ' HS4 element derived from the chicken ⁇ -globin locus (the first insulator identified in vertebrates), has been used with success to improve heterologous construct expression in transgenic animals.
  • the chicken ⁇ -globin HS4 insulator element has been shown to block the actions of enhancer elements in addition to functioning as a physical boundary that can prevent the spread of gene silencing (14-20).
  • the insulator element is used to prevent the adenoviral sequences from potentially interrupting the IN SMI promoter activity and to prevent the interference from the viral backbone with respect to the tissue selectivity of the promoter incorporated into the viral vectors.
  • reporter gene refers to a gene, usually a foreign or modifed gene, that is added to a construct and is expressed due to the promoter in the construct and the expression allows easy identification of cells or tissues that have taken up the construct.
  • Common reporter genes include the gene that encodes jellyfish green fluorescent protein, which causes cells that express it to glow green under UV light, and the firefly luciferase gene which causes light emission when its substrate luciferin is added. Reporter genes are often placed downstream of the promoter region and in the proximity of the gene of interest to ensure that they are expressed together and not separated by crossover events.
  • toxin gene refers to a gene that encodes a toxin that is capable of being readily produced either under the regulatory control of the I SMl promoter.
  • a "toxin” is a gene product(s) that causes or leads to the destruction or incapacitation of a cell. This definition is intended to include the induction of indigenous events leading to cell death, such as apoptosis or necrosis.
  • a "toxin” may, for example, be a compound that induces conditional lethality, i.e., cell death requires both expression of a conditional toxin gene (for example, thymidine-kinase) and the exogenous administration of a compound (for example, ganciclovir or acyclovir) that together produce a lethal effect.
  • a conditional toxin gene for example, thymidine-kinase
  • a compound for example, ganciclovir or acyclovir
  • a suitable toxin may be one of the many toxic peptides known in the art.
  • the toxin should be capable of killing tumor cells or, optionally, the toxin may also kill neighboring cells, a "bystander" effect, but it should not have substantial systemic effects.
  • toxins include without limitation synthetic and natural lytic peptides, cholera toxin, diphtheria toxin, Psuedomonas toxin, ricin toxin, cecropins, defensins, sarcotoxins, melittins, and magainins.
  • One suicide gene therapy uses the gene herpes simplex virus thymidine kinase and ganciclovir.
  • viral vector refers to a virus that is competent to infect a mammalian host cell and can be used to deliver the construct to the target cells or tumor or to an animal systemically.
  • a viral vector is the first generation E1/E3 deleted non-replicating Ad5 vector, but other forms of viral delivery systems are known and could be used.
  • One of the disadvantages of the non- replicating adenovirus is the lack of persistence in vivo and one embodiment could be the use of a conditionally replicating oncolytic adenovirus.
  • Additional examples of viral delivery systems include viruses that would result in more permanent expression such as lentivirus or adeno-associated virus (AAV). The advantage to these two viral systems is that they can be manipulated to alter their tropism for different cell types making them a more flexible platform.
  • Neuroendocrine tumors that can be treated or diagnosed using the described construct include without limitation retinoblastoma, medullablastoma, neuroblastoma, small cell lung carcinoma, non-small cell carcinoma with neuroendocrine phenotype, carcinoid, insulinoma, pheochromocytoma, medullary thyroid carcinoma, pituitary tumors, prostate carcinoma, and retinoblastoma tumors.
  • the unmodified INSMl promoter- luciferase construct was used as the control vector for all comparisons.
  • NRSE neuronal restrictive silencer element
  • SCG10 superior cervical ganglion 10
  • nAchR nicotinic acetylcholine receptor
  • All synthetic oligonucleotides were commercially synthesized by Eurofins MWG Operon Inc. (Huntsville, Alabama), and included a Kpn I half-site and a Bglll restriction site at both ends of the two tandem copies of the SCG10 or n(AchR) NRSE element.
  • the oligonucleotide sequence for the SCG10 NRSE element was as follows: 5'- cagatct(TTCAGCACCACGGAGAGTGCC)(TTCAGCACCACGGAGAGTGCC)aagcttggtac -3' (SEQ ID NO: l) and the reverse complement 5'-caagcttaga (GGCACTCTCCGTGGTGCTGAA) (GGCACTCTCCGTGGTGCTGAA) agatctggtac-3 ' (SEQ ID NO:2).
  • the oligonucleotides generated for the n(AchR) NRSE were the sense 5'- cagatct (TTCAGCACCACGGACAGCGCTC) (TTCAGCACCACGGACAGCGCTC)aagcttggtac-3 ' (SEQ ID NO:3) and reverse complement 5'- caagctt(GAGCGCTGTCCGTGGTGCTGAA)(GAGCGCTGTCCGTGGTGCTGAA)agatctg gtac-3 ' (SEQ ID NO:4).
  • the oligonucleotides were annealed by heating at 95°C for 5 minutes and slow cooled at 1 °C/minute in a PCR machine (iCycler; BioRad, Hercules, California) to generate double strand products.
  • the ends of the double strand 2XNRSE oligonucleotides were phosphorylated with T 4 polynucleotide kinase in the presence of ATP to facilitate ligation.
  • the oligonucleotides were ligated at room temperature using T 4 DNA ligase (NEB) into the pGL3B-INSMl promoter Kpnl-treated vector to create the 2XNRSE up constructs.
  • the double strand oligonucleotides were digested with Bglll, purified by phenol/chloroform extraction followed by ethanol precipitation.
  • the Bglll digested oligonucleotides were ligated at room temperature with the pGL3B-INSMl promoter Bglll treated vector to generate the 2XNRSE down modified INSMl promoter constructs.
  • H/O enhancer into the INSMl promoter luciferase reporter constructs.
  • the DNA element derived from the CT/CGRP gene known as the H/O enhancer was synthesized and included a Kpnl and Bglll sites in the linker region with 2 tandem repeats of the H/O enhancer sequence, sense oligonucleotides 5' cagatctGGCAGCTGTGCAAATCCTaagcttggtac 3 ' (SEQ ID NO:5) and reverse compliment primer 5' caagcttAGGATTTGCACAGCTGCCagatctggtac 3 (SEQ ID NO:6) .
  • the INSMl promoter region (-34 to -27bp) spanning the putative TATA-like element was mutated using the Quik Change II Site-Directed Mutagenesis Kit (Stratagene) with the oligonucleotides 5' CTCCCCCCGTATAAAAGGAGCGGCTG 3 ' (SEQ ID NO:7) and the reverse compliment to convert the sequence into a consensus TATA-binding site (TTAAAAGG to TATAAAAG).
  • the bold nucleotides are the position of the changes that were incorporated into the INSMl promoter sequence.
  • Constructs incorporating either an insulator and/or NRSE element were generated to determine if they would enhance the specificity of the INSM1 promoter driven cancer gene therapy.
  • Fig. 9 is a schematic showing the four constructs created as described below.
  • the pGL3 vector was digested with Sma I and treated with calf intestinal alkaline phosphatase (New England Biolabs, Ipswich, Massachusetts) to prevent self ligation of the vector and the -1661/+40bp INSMl promoter is cloned into the Sma I site of the pGL3 basic luciferase vector (Promega). The orientation was verified by restriction digest and DNA sequencing.
  • the 2X nAChR NRSE element was cloned by digesting the pGL3 INSMl promoter construct with Bgl II and inserting the 2X nAChR NRSE downstream of the INSMl promoter (adjacent to the +40 bp region).
  • luciferase gene was removed by Nco I/Sal I double digest and replaced with the luciferase 2 (Nco I/Sal I) gene from the pGL4 (Promega) vector creating the ClLuc2 construct (Fig. 9).
  • One copy of the HS4 ⁇ -globin insulator element was digested with Kpn I from the pJC13-l vector (obtained from Dr. Gary Felsenfeld, National Institutes of Health), and ligated upstream of the 5' end of the INSMl promoter by digestion of the pGL3 -INSMl promoter-Luc2 vector with Kpnl creating construct C2Luc2 (Fig. 9).
  • the final construct generated contained the INSMl promoter-2XNRSE element-Luc2 gene that is flanked on the 5' end of the INSMl promoter with one copy of the HS4 insulator element at the Kpn I site as described above.
  • a second copy of the HS4 insulator element was inserted into the Xba I site at the 3' end of the luciferase 2 gene by digestion with Xbal of the INSMl luciferase vector and the HS4 insulator pNI vector (obtained from Dr. Gary Felsenfeld, National Institutes of Health) to create the M3Luc2 construct (Fig. 9).
  • the only two constructs that lack the 2XNRSE modification are the original control INSMlpLuc2 and the C2Luc2 constructs.
  • the modified DNA constructs were purified by CsCl gradient and quantitated using a GE nanovue spectrophotometer.
  • Transient Transfection for Reporter gene assays All human cells lines were obtained from American Type Culture Collection (ATCC) (Manassass, VA) and were cultured in Royal Parks Memorial Institute (RPMI) 1640 or Dulbecco's modified eagle's media (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in a 37°C incubator with 5% CO 2 . All cell culture media was obtained from Mediatech (Manassass, VA) unless otherwise noted. Twenty-four hours prior to transient transfection, the cells were seeded at 75,000 cells/well in a 24-well culture dish.
  • ATCC American Type Culture Collection
  • RPMI Royal Parks Memorial Institute
  • DMEM Dulbecco's modified eagle's media
  • FBS fetal bovine serum
  • penicillin/streptomycin penicillin/streptomycin
  • Transient transfections included 400 ng pGL3B-INSMlp control or INSMl p-modified constructs and 100 ng TK- Renilla control plasmid (Promega, Madison, Wisconsin) for normalization of transfection efficiency. DNA was mixed at a ratio of 1 :2 with TransFectin Lipid reagent (BioRad, Hercules, California) in Gibco Optimem (Invitrogen, Carlesbad, California) for 30 minutes prior to addition to the wells. All transfections were done in triplicate on at least three separate occasions to confirm the experimental results.
  • the cells were collected, washed once in 1XPBS, and the cell pellet was resuspended in a final volume of 100 ⁇ of PBS. Twenty-five microliters of the cell suspension was mixed one to one with Dual Glo luciferase reagent (Promega; Madison, Wisconsin) and incubated at room temperature for 10 minutes in a white 96-well plate. The luciferase activity was measured using a TopCount NXT microplate scintillation and luminescence reader (Packard Instrument Company, Meriden, Connecticut).
  • Ad5 virus for gene therapy studies the INSMl promoter Luc2 constructs were transferred into the pShuttle plasmid backbone (Stratagene; Agilent Technologies, Santa Clara, California).
  • the CI, C2, M2, and M3 Luciferase 2 constructs were digested with Cla I to remove the various HS4 insulator INSMlpromoter 2XNRSE luciferase 2 expression cassette from the pGL3 vector backbone.
  • the Cla I site was filled-in with Klenow (New England Biolabs) enzyme.
  • the pShuttle vector was prepared by digestion with EcoRV and treated with calf intestinal alkaline phosphatase (New England Biolabs) to prevent self ligation of the vector backbone.
  • the INSMl promoter with the 2XNRSE element was removed from the pGL3 vector with Cla I/HindIII and the ends filled-in by Klenow (New England Biolabs).
  • the pShuttle vector containing the HSVtk gene was prepared by digestion with EcoRV followed by calf intestinal alkaline phosphatase (CIP, NEB). Insulator elements were inserted into the Kpn I site or both the Kpnl and Xba I sites of the pShuttle vector to generate CITK, C2TK, M2TK, and M3TK constructs.
  • the rNSMlpromLuc2 or INSMl promHSVtk pShuttle constructs were digested with Pme I and treated with calf intestinal alkaline phosphatase (New England Biolabs).
  • the linearized pShuttle constructs were electroporated into BJ5183 Ad-1 electrocompetent E. coli cells (40 ⁇ 1, Stratagene; Agilent Technologies, Santa Clara, California) in a 0.2 cm cuvette with a BioRad electroporator with the settings 2.5 kV, 200 ohms, and 25 ⁇ .
  • the kanamycin resistant colonies were screened for the recombination between the pShuttle vector and Ad5 genome.
  • Positive clones are transformed into XL- 10 Gold chemically competent cells (Stratagene; Agilent Technologies, Santa Clara, California) and DNA purified using a Qiagen Midi prep kit (Qiagen, Valencia, California).
  • Recombinant adenovirus DNA is linearized with Pac I and transfected into Ad-293 producer cells with Fugene6 lipid reagent 1 : 1 DNA lipid ratio (Roche Applied Science, Indianapolis, Indiana).
  • the cells were collected and subjected to three rounds of freeze-thaw-lysis to release the viral particles.
  • the viral supernatant was reinfected into Ad-293 cells (human embryonic kidney, Agilent Technologies, Santa Clara, CA) for at least two more rounds of amplification.
  • the final round of amplification was done with 30-150 cm tissue culture dishes and the viral lysate was purified on a CsCl gradient. The viral supernatant was dialyzed to remove the CsCl before use. The final viral amplification was titered using the Adeno-X-Rapid Titer Kit (Clontech, Mountain View, California) and stored at -70° C.
  • the cells were seeded at 20,000-40,000 cells per well in a 96 well dish.
  • the cells are treated with 0, 50, 100, or 200 MOI (multiplicity of infection) of each Ad- HSVtk virus.
  • MOI multiple of infection
  • GCV ganciclovir
  • MTS assay Promega; Madison, Wisconsin
  • TNSM1 positive cell lines H69, HI 155, SHP-77, H727, Y79, WERI-Rbl, D283, IMR-32, TT, SK-N-BE(2)
  • MOI 100 Ad-RSV-HSVtk, AdlNSMl control, Adl SMl CITk, AdlNSMl C2Tk, AdINSMlM2Tk, and AdI SMlM3Tk.
  • the cells were collected and lysed in RIPA buffer (1% NP-40, 1% sodium deoxycholate, 0.1% SDS, 150 mm NaCl, 10 mm Tris-Cl pH 7.4) containing complete protease inhibitor cocktail (Roche Applied Science, Indianapolis, Indiana).
  • RIPA buffer 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, 150 mm NaCl, 10 mm Tris-Cl pH 7.4
  • the cells were sonicated and centrifuged to clear the lysate.
  • the protein lysates were quantitated using a Pierce BCA protein assay kit (Thermo Fisher Scientific, Rockford, Illinois), and equal amounts of total protein were loaded in each well on a 12% SDS-PAGE gel. The gel was transferred to nitrocellulose membrane.
  • the membrane was incubated with a 1 : 1000 dilution of rabbit anti-HSV thymidine kinase antibody (Dr. W. Summers, Yale University) in 5% nonfat milk/TBS, followed by incubation with a 1 : 10,000 dilution of goat anti-rabbit horse radish peroxidase (HRP) secondary antibody (BioRad, Hercules, California). Finally, the membrane is incubated with ImmunStar HRP substrate (BioRad, Hercules, California) and imaged using a Kodak Gel Logic 2200 imager (Carestream Health, Woodbridge, Connecticut).
  • HRP horse radish peroxidase
  • a pure population of HI 155 cherry cells was obtained by sorting on a fluorescence activated cell sorter (FACS) and expanding the fluorescent cells in culture.
  • the mice were divided into groups of three mice, and were injected with 1X10 9 ifu adenovirus either via intratumoral or intraveneous into the tail vein. Forty eight hours post virus injection, the mice were imaged on a Kodak In Vivo FX multispectral imager (Carestream Health, Woodbridge, Connecticut). Prior to imaging, the animals were injected intraperitoneal with 100 ⁇ 15 mg/ml D-luciferin.
  • the animals were immobilized with isoflurane (2-4% by inhalation) for imaging using the program X-ray 2 minutes, luminescence 10 minute acquisition, and fluorescence 30 seconds acquisition. Following imaging, the animals were euthanized by CO 2 inhalation and the heart, lungs, liver, kidney, spleen, pancreas, and tumors were removed and frozen in l-5mls Glo-lysis buffer (Promega).
  • the tissues were homogenized with a tissue homogenizer and centrifuged to clear the homogenate. Total tissue protein was determined by a Pierce BCA protein assay kit (Thermo Fisher Scientific, Rockford, Illinois) and 300 ⁇ g total protein per tissue was used to determine luciferase activity. The luciferase activity was measured using a Steady-Glo® Luciferase Assay Kit (Promega, Madison, Wisconisn).
  • the tumors were injected with 1X10 6 HI 155 Red tumor cells subcutaneously into the hind flanks and allowed to grow for 7-10 days.
  • the tumors were injected with 1X10 9 ifu virus particles with both the Ad-INSMlp-HSVtk and Ad-INSMlpLuc2 containing constructs to simultaneously visualize the location/expression pattern of the virus and to determine the killing effect of the cancer gene therapy.
  • the animals received daily intraperitoneal injections of ganciclovir (50mg/kg body weight). Elimination of the tumor cells was measured manually by caliper and visually by injection of 100 ⁇ 15mg/ml D-luciferin followed immediately by image analysis with the Kodak In vivo FX multispectral imager as described above. The animal's tumors were followed for 2 weeks and the tumor growth or regression was measured every other day.
  • Reporter Gene Assay in vitro diagnostics Tumor biopsy will be weighed and placed into 96 well culture dishes. Tumors will be infected with IX 10 8 ifu adenovirus particles for 24 hours. Five ⁇ 3mg/ml D-luciferin will be added directly to the well, incubated at room temperature for 10 minutes and the firefly luciferase 2 activity measured on the TopCounter (Packard instruments). Alternatively, TNSM1 promoter adenovirus constructs containing Metridia luciferase as the reporter gene will be used.
  • Equal weight tumor samples will be simultaneously infected with IX 10 8 ifu each Ad-INSMlprom-MetLuc and Ad-RSV-secreted alkaline phosphatase (SEAP) virus for normalization. Twenty-four hours later, the supernatant will be collected and the Met luciferase and SEAP activity sequentially measured using the Ready-To-Glow Secreted reporter assay (Clontech).
  • SEAP alkaline phosphatase
  • the existing INSMl promoter region has been modified to incorporate DNA elements from other tissue selective genes that have silenced expression of neuronal genes in non-neuronal cells.
  • the first modification of the existing INSMl promoter region was addition of two tandem copies of the neuronal restrictive silencer elements (NRSEs) derived from the mouse nicotinic acetylcholine receptor (nAChR) or the rat superior cervical ganglion 10 (SCGIO) promoters either directly upstream or downstream of the INSMl promoter sequence.
  • NRSEs neuronal restrictive silencer elements
  • the NRSE elements when bound by the cognate protein, the neuron restrictive silencing factor, NRSF, can strongly repress transcription in non-neuronal cells as well as allow transcription of the same gene in neuronal cells.
  • the various INSMl promoter constructs as described above were transiently transfected into HepG2 (hepatocellular carcinoma), HEK-293 (embryonic kidney), Cos7* (African green monkey kidney), or U87MG (glioblastoma) cells. These cell lines do not express detectable levels of INSMl mRNA.
  • the relative activity of the modified INSMl promoter- luciferase constructs were compared directly to the control unmodified INSMl promoter. Cells were assayed twenty four hours post transfection using the Dual-Glo luciferase reagent (Promega).
  • a TK-renilla luciferase construct was included in all the wells for normalization of transfection efficiency. All transfections were performed in triplicate on at least three occasions. The results are shown in Fig. 1.
  • HEK-293 kidney cells resulted in a reduction by 80-85% relative to the unmodified promoter constructs.
  • inclusion of the NRSE resulted in the reduction by 70-80% in the U87MG glioblastoma cells.
  • the net reduction in expression observed from the NRSE-INSMl promoter constructs shows a clear benefit to the alteration of the INSMl promoter to reduce any "leaky” or undesirable expression from the INSMl promoter region in off-target cells.
  • the effect of the modified INSMl promoter on INSMl expressing cell lines was determined to see if the changes negatively affect the promoter in target cell types.
  • One of the most prevalent and aggressive forms of neuroendocrine tumors is small cell lung cancer (SCLC).
  • SCLC small cell lung cancer
  • transient transfections were performed in a "normal" human bronchial epithelial cell line, BEAS, a human lung adenocarcinoma cell line, NCI-H23, and two human SCLC cell lines SHP-77 and NCI-H1155.
  • the control INSMl promoter luciferase construct was compared with the modified promoter constructs.
  • nAChR down only modestly reduced promoter activity by 10- 20% in the INSMl positive SCLC cell lines.
  • Re-evaluation of the 6 non-neuronal cell lines HepG2, HEK-293, Cos7, U87MG, BEAS, and H23 revealed that the n(AchR) NRSE downstream modification reduced the INSMl promoter activity more dramatically than the other NRSE modifications.
  • the dramatic suppression by 80-95% in non-neuronal or non-target cells would be beneficial to improve the safety of the suicide gene therapy approach.
  • INSMl promoter in other INSMl positive neuroendocrine tumor cell lines the unmodified and modified INSMl promoter luciferase activity was compared in IMR-32 human neuroblastoma, Y79 human retinoblastoma, and TT human medullary thyroid carcinoma cell lines. Cells were assayed twenty four hours post transfection with the Dual-Glo luciferase kit (Promega). All transfections were performed in triplicate on at least three separate occasions. The results are shown in Fig. 3. Overall the various NRSE modifications lowered the INSMl promoter activity by 10-60%.
  • the 2X n(AchR) down construct activity showed only a modest reduction of the promoter activity in the IMR-32 (10%) and Y79 (15%) cells.
  • the n(AchR) NRSE down construct in the medullary thyroid carcinoma TT cells showed a modest increase (120%) in promoter activity.
  • INSMl promoter region was shown to significantly enhance the safety of the INSMl promoter driven suicide gene therapy by reducing activity in non-desirable cells. At the same the modification had a minimal impact on the strength, activity, and specificity of the INSMl promoter in neuroendocrine tumor cells.
  • the sequence responsible for cell-specific expression of the CT/CGRP gene was characterized and designated the H/O enhancer.
  • the H/O enhancer consists of an overlapping basic helix loop helix (bHLH) binding site and an octamer binding site (24;25). Therefore, this element was also used to modify the INSM1 promoter activity as described in Example 1, and tested for its effect in various endocrine and/or neuroendocrine carcinoma cells as described above for the other modified INSM1 promoters (Examples 1-4). The results for the various cell types are shown in Figs. 1-3.
  • H/O enhancer was not so successful. Disappointingly in all cell types tested, including non-neuronal (HepG2, HEK-293, U87MG, BEAS, H23) and neuroendocrine cells (SHP-77, HI 155, IMR-32, Y79, and TT), inclusion of the H/O enhancer caused a reduction to the overall TNSM1 promoter activity, as shown in Figs. 1-3.
  • the INSM1 promoter sequence revealed that it consists of 66% GC nucleotides and does not contain a consensus TATA box a common characteristic of GC rich promoter sequences.
  • a consensus TATA sequence recruits the TATA binding protein (TBP) as well as a host of accessory factors necessary for transcription initiation including the recruitment of RNA polymerase II.
  • TBP TATA binding protein
  • a sequence in the INSM1 promoter resembles a TATA binding site but contains a few nucleotide alterations as compared to the consensus. Therefore, an exchange of this non-conserved site into a consensus TATA box was conducted to analyze the effect on the increased rate of transcription initiation on the INSM1 promoter and thus on the increased rate in the overall promoter activity.
  • the TNSM1 sequence between nucleotides -34 to -27 base pairs were altered by site-directed mutagenesis and confirmed correct by sequence analysis as described in Example 1.
  • the TATA modification was tested in a panel of INSM1 positive and negative cell lines as described above in Examples 1-4. As shown in Figs. 1-3, the substitutions made to resemble a consensus TATA binding site did not show any significant change to the overall activity of the INSM1 promoter in any of the cell types analyzed. [0052] Overall, the n(AchR) NRSE downstream element gave the best profile.
  • the INSMl promoter with the n(AchR) NRSE activity was barely measurable (5% of control) and significantly reduced in the kidney, glioma, and normal lung epithelial cells. Conversely, despite a slight decrease 10-20% in the overall INSMl promoter activity in the INSMl positive tumor cells the benefit of the reduction of the off-target activity in non-expressing cells far outweighs the small decrease observed.
  • Ad-INSMlp-HSV-tk IRESLuc2 (Control).
  • Fig. 1 A first generation E1/E3 deleted non-replicating Ad5 vector was used, but other forms of viral delivery systems could be used.
  • the unmodified 1.7 kilobase pair INSMl promoter was linked directly with the herpes simplex virus thymidine kinase gene (the toxin) and firefly luciferase gene (separated by an internal ribosomal entry site and incorporated into the adenoviral genome, creating Ad-INSMlp-HSV-tk IRESLuc2 (Control).
  • Fig. 1 A first generation E1/E3 deleted non-replicating Ad5 vector was used, but other forms of viral delivery systems could be used.
  • the unmodified 1.7 kilobase pair INSMl promoter was linked directly with the herpes simplex virus thymidine kinase gene (the toxin) and firefly luciferase gene
  • FIG. 4A is a schematic diagram showing the configuration of the INSMl promoter HSV-Tk-Luciferase 2 gene in the adenovirus genome.
  • Inclusion of the firefly luciferase 2 gene allowed the simultaneously monitoring of the promoter activity and the relative killing effect using a noninvasive in vivo imaging system (e.g., Kodak Multispectral In Vivo FX).
  • SCLC cell lines were used for the tumors since this tumor represents one of the more prevalent neuroendocrine tumor for treatment.
  • the NCI-H1 155 cells were transduced with a lentivirus expressing red Cherry fluorescent protein as described in Example 1. The fluorescent cells were sorted using a fluorescence activated cell sorter to obtain a pure population.
  • the animals were immobilized using isoflurane inhalation anesthesia prior to imaging.
  • the animals were imaged for red fluorescent signal to set a baseline for the tumor on Day 0 prior to the start of therapy (Figs. 5A and 6A).
  • the animals received a ⁇ intraperitoneal injection of 15mg/ml D-luciferin substrate.
  • the animals were then photographed for fluorescence, luminescence, and X-ray to establish an anatomical reference for the animals (Figs. 5B and 6B). Results for Mouse #2 and Mouse #3 are shown in Figs. 5 and 6, respectively.
  • Figs. 7A and 7B The animals were imaged for luminescence and with X-ray for an anatomical reference, and the results shown in Figs. 7A (24 hr) and 7B (48 hr).
  • Fig. 7A no luciferase signal was detected from either the PBS or Ad-INSMlp-Luc2 mice
  • Fig. 7A a strong signal from the lower abdomen around the liver and kidney region was readily detected from the Ad-SV40p-Luc2 animal
  • Fig. 7B center mouse.
  • Insulators are DNA elements that have the ability to protect genes from inappropriate signals originating from the surrounding environment by acting as a physical barrier or boundary.
  • the chicken ⁇ -globin HS4 insulator element has been shown to block the actions of enhancer elements in addition to functioning as a physical boundary that can prevent the spread of gene silencing (20;27-32).
  • Shown in Fig. 9 are the constructs that have been cloned into the luciferase reporter vector (pGL4 Promega) and transferred into the adenoviral backbone (Ad-Easy XL, Agilent) that either alter the location of the INSMl promoter constructs and/or include insulator elements.
  • Transient transfections were performed as described above to test the constructs in vitro to determine if the insulator and/or the insulator and the NRSE sequences protect the INSMl promoter without intervening with its activity and specificity.
  • the constructs tested include the original INSMl promoter (CLuc2; Control), the INSMl promoter containing the NRSE that is cloned in the opposite orientation with respect to the original control (ClLuc2; CI), the INSMl promoter with the HS4 insulator at 5' end (C2Luc2; C2), the INSMl promoter and 2XNRSE with two tandem copies of the HS4 insulator at the 5' end (M2Luc2; M2) and the INSMl promoter containing the NRSE cloned in the opposite orientation and flanked on both the 5' and 3 ' ends with the HS4 insulator (M3Luc2; M3).
  • a panel of INSMl negative cells lines (liver (HepG2), kidney (Cos7 and
  • the activity of the C2Luc2 construct was similar to the original INSMl promoter construct in the presence of the HS4 insulator sequence. Consequently, this indicates that inclusion of the insulator sequence does not alter the INSMl promoter activity or specificity.
  • all of the NRSE containing constructs i.e., ClLuc2, M2Luc2, and M3Luc2
  • the CI and M3 constructs maintained the same activity as the control in the H69 and HI 155 cells.
  • the M3 constructs had a 1.5-3 fold higher activity (Fig.
  • mice The control (Ad-TNSMlpLuc2) or C2Luc2 (Ad-HS4ins-TNSMlpLuc2) viruses were injected into tumor bearing mice as described above in Examples 1 and 7. Eight-week- old male nude mice (three groups of three mice each) were injected subcutaneously with 1X10 6 NCI-H1155 Cherry fluorescent tumor cells into the hind flanks and grown for 10-14 days. Following tumor establishment, the animals were injected via intravenous (IV), intraperitoneal (IP), or intratumoral (IT) injection with IX 10 9 ifu Ad-control or Ad-C2Luc2 virus.
  • IV intravenous
  • IP intraperitoneal
  • IX 10 9 ifu Ad-control or Ad-C2Luc2 virus.
  • the other tissues did not show luciferase activity significantly higher than the non-specific background activity.
  • the Ad-C2Luc2 group had no detectable luciferase activity in the Spleen, and the luciferase activity was reduced by -40% in the Lung and Kidney relative to the Ad-TNSMl Luc2 control (Fig. 1 1, white bars).
  • the Ad-INSMl Luc2 control virus had the strongest luciferase activity in the spleen, followed by the pancreas, and the lung (Fig. 11, hatched bars).
  • the Ad-C2 Luc2 activity was completely abolished in both the spleen and pancreas and reduced by 60% compared to Ad-INSMl Luc2 control in the lung (Fig. 1 1, hatched bars).
  • the IT animals with the Ad-INSMl Luc2 control virus showed the spleen with the highest activity excluding the tumor, followed by the lung, the pancreas, and the kidney (Fig. 11, black bars).
  • the activity in the spleen was reduced by 75%, the pancreas activity was completely abolished, but the level in the lung remained the same.
  • the kidney was slightly higher than the control group (Fig. 1 1, black bars).
  • the most important observation for the IT group was that the tumor maintained the highest activity, indicating that the insulator element does not interfere with the INSM1 promoter specificity or activity. Therefore, this clearly demonstrates that the HS4 insulator located between the LITR and the INSM1 promoter can significantly reduce or eliminate any potential transcriptional interference from the adenoviral sequences in vivo and at the same time not alter the INSM1 promoter activation in the tumor cells.
  • the spleen was the only tissue that was significantly high.
  • the Ad-C2Luc2 construct clearly demonstrated that the incorporation of the insulator element between the INSM1 promoter and the adenoviral backbone eliminated the activation in spleen. Therefore, the new configuration of the INSM1 promoter element in the adenoviral backbone with the incorporation of both the HS4 insulator element and nAChR NRSE elements will significantly improve the specificity of the INSM1 promoter driven cancer gene therapy.
  • Ad-ClLuc2 and Ad-M3Luc2 viruses are in the final stages of amplification and will be tested as shown above for C2 in mice shortly.
  • Complementary HSVtk viruses are also currently being developed as described in Example 1. Given the results obtained in animals, without wishing to be bound by this theory, it is believed that the adenovirus construct with the most promising outcome will be the Ad-M3Luc2 and Ad- M3HSVTk because it includes the 2XNRSE n(AchR) element and the expression cassette is flanked on both sides by the HS4 insulator elements. Additionally, the I SMl promoter has been located further away from the potentially interfering LITR adenoviral sequence.
  • Ad-INSMl HSVtk constructs will be tested first in vitro to determine their "killing" efficiency in a panel of INSMl positive cell lines as described above in Example 1. The final step will be to verify the in vivo anti-tumor efficacy in nude mice as described above and in Examples 1 and 7.
  • Another application for the modified INSMl promoter is as a diagnostic tool for the identification or verification of the presence of neuroendocrine tumors either from a biopsy specimen or to detect a tumor in a patient.
  • an in vitro assay was performed using methods described in Example 1 and below. Using either the Ad-INSMl p-Luc2 or Ad-INSMl p-HSV-tkIRESLuc2 (suicide gene) constructs, the luciferase activity was compared to the Ad-CMV-LacZ negative control and the Ad-SV40- Luc2 positive controls in the NCI-H1155 xenograft tumor specimen.
  • NCI-H1 155 red fluorescent tumor cells were injected subcutaneously into the hind flank of a male nude mouse. The tumors were allowed to form for 10 days. Following tumor formation, the animals were anesthetized; and the xenograft tumors were removed. Using a razor blade, small tumor pieces were cut and placed into a white, 96-well culture dish with RPMI 1640 media containing 10% fetal bovine serum (FBS). The tumor slices were infected with 4X10 8 ifu Ad-CMV-LacZ, Ad-SV40-Luc2, Ad- INSMlp-Luc2, or Ad-rNSMlp-HSV-tkIRES-Luc2 viruses.
  • Ad-CMV-LacZ Ad-SV40-Luc2
  • Ad- INSMlp-Luc2 Ad-rNSMlp-HSV-tkIRES-Luc2 viruses.
  • Figs. 12A and 12B The data was graphed in two different ways for comparison, and the results shown in Figs. 12A and 12B. The first graph indicated the average of the duplicate wells relative to light unit measurement for each of the treatment groups (Fig. 12A). In the second approach, the luciferase readings were normalized against the fluorescence readings to account for any differences in activity due to the size of the tumor slice size (Fig. 12B).
  • a neuroendocrine tumor should be detected based on the activation of the reporter gene.
  • the Ad-I SMlpLuc2 and the Ad-I SMlp-HSV-tkIRESLuc2 constructs both showed similar levels of luciferase activity in the tumor slice, and was as strong if not stronger than the activity measured for the Ad-SV40-Luc2 virus.
  • the overall relative luciferase activity between the non-corrected and fluorescence corrected samples was almost identical (Figs. 12A and 12B).
  • the suicide gene could serve a dual purpose.
  • Several radiolabed [ 18 F]-labeled nucleotide analogs are currently available for the detection of HSV- tk activity (33).
  • the radioactive nucleotide analogs for HSV-1 thymidine kinase will be administered, and the tumor cell expressing HSV-tk from the I SMl promoter sequence will become phosphorylated and trapped leading to a quantifiable amount of radionucleotide accumulating within the tumor mass that could be visualized using a positron emission tomography (PET) scan or other known detector.
  • PET positron emission tomography
  • the newly modified INSMl promoter constructs containing the HS4 insulator and the 2XNRSE n(AchR) element will be used and linked directly with the HSVTk gene or the luciferase2 (Promega) or Metridia luciferase enzymes for in vitro diagnostics (Clontech). It is expected that these new constructs will perform equal to or better than described above for the Ad-TNSMlp-HSV-tkIRESLuc2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Une modification de la région existante du promoteur INSMl a été découverte, ladite modification contenant des éléments d'ADN qui réduisent au silence l'expression des gènes neuronaux dans les cellules non neuronales et augmentant l'efficacité et la sécurité d'emploi du promoteur INSMl dans le traitement des tumeurs. Une de ces modifications comprenait l'ajout d'une ou de deux copies en tandem d'éléments silenceurs limités au tissu neural (NRSE) dérivés soit du récepteur murin de l'acétylcholine nicotinique (nAChR), soit des promoteurs du ganglion cervical supérieur 10 de rat (SCGl0). Ces NRSE ont été insérés dans la construction d'expression, soit directement en amont ou en aval de la séquence du promoteur INSMl. La construction d'expression la plus efficace était l'élément NRSE nAChR inséré en aval du promoteur INSMl. Cette construction d'expression a augmenté la spécificité tissulaire du promoteur INSMl sans réduire significativement son activité. De plus, le promoteur INSMl modifié a été inséré dans un vecteur viral, l'adénovirus 5. Des constructions contenant un élément isolateur, l'élément isolateur de la β-globine HS4 de poulet, avec le promoteur INSMl se sont avérées réduire l'interférence du génome viral sur son expression. Des constructions qui ne diminuent pas l'activité du promoteur mais augmentent significativement sa spécificité tumorale ont été conçues. La liaison de cette construction à un gène rapporteur a permis de détecter la position du vecteur viral, et cette détection peut être utilisée pour diagnostiquer ou localiser des tumeurs neuroendocrines.
PCT/US2010/055844 2009-11-09 2010-11-08 Promoteur insm1 modifié pour la thérapie génique d'une tumeur neuroendocrine et les diagnostics WO2011071632A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/505,823 US9090907B2 (en) 2009-11-09 2010-11-08 Modified INSM1-promoter for neuroendocrine tumor therapy and diagnostics

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US25931109P 2009-11-09 2009-11-09
US61/259,311 2009-11-09

Publications (2)

Publication Number Publication Date
WO2011071632A2 true WO2011071632A2 (fr) 2011-06-16
WO2011071632A3 WO2011071632A3 (fr) 2011-10-06

Family

ID=44146108

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/055844 WO2011071632A2 (fr) 2009-11-09 2010-11-08 Promoteur insm1 modifié pour la thérapie génique d'une tumeur neuroendocrine et les diagnostics

Country Status (2)

Country Link
US (1) US9090907B2 (fr)
WO (1) WO2011071632A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112213486A (zh) * 2020-10-16 2021-01-12 上海交通大学医学院附属仁济医院 胰岛素瘤相关蛋白1作为诊断或预后评估前列腺神经内分泌小细胞癌的标志物的用途

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017075395A1 (fr) * 2015-10-28 2017-05-04 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Vecteurs adénoviraux à spécificité tumorale et leurs utilisations thérapeutiques

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6893867B1 (en) * 1999-12-23 2005-05-17 Keith A. Webster Molecular switch for regulating mammalian gene expression
WO2008039937A2 (fr) * 2006-09-27 2008-04-03 Novarx Blocage d'une expression génique dans des cellules eukariotes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005500833A (ja) 2001-06-25 2005-01-13 ブアズーボ・アンパルトセルスカブ 腫瘍学薬物の革新

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6893867B1 (en) * 1999-12-23 2005-05-17 Keith A. Webster Molecular switch for regulating mammalian gene expression
WO2008039937A2 (fr) * 2006-09-27 2008-04-03 Novarx Blocage d'une expression génique dans des cellules eukariotes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
REN, X.-W. ET AL.: 'A tumor-specific conditionally replicative adenovirus vec tor expressing TRAIL for gene therapy of hepatocellular carcinoma' CANCER GE NE THERAPY vol. 13, 2006, pages 159 - 168 *
WANG, H.-W. ET AL.: 'INSM1 Promoter-Driven Adenoviral Herpes Simplex Virus Th ymidine Kinase Cancer Gene Therapy for the Treatment of Primitive Neuroectod ermal Tumors' HUMAN GENE THERAPY vol. 20, no. 11, 04 September 2009, pages 1308 - 1318 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112213486A (zh) * 2020-10-16 2021-01-12 上海交通大学医学院附属仁济医院 胰岛素瘤相关蛋白1作为诊断或预后评估前列腺神经内分泌小细胞癌的标志物的用途

Also Published As

Publication number Publication date
WO2011071632A3 (fr) 2011-10-06
US9090907B2 (en) 2015-07-28
US20120316225A1 (en) 2012-12-13

Similar Documents

Publication Publication Date Title
US8658778B2 (en) hTMC promoter and vectors for the tumor-selective and high-efficient expression of cancer therapeutic genes
JP2018113971A (ja) 腫瘍選択的ｅ１ａおよびｅ１ｂ変異体
JP2008532519A (ja) 遺伝子発現のインビボ画像化に関する方法および組成物
WO1999006576A1 (fr) Sequence stimulatrice de la kallicreine glandulaire chez l'homme, vecteurs comprenant cette sequence et procedes d'utilisation de ces derniers
CN107043774B (zh) 一种嵌合强启动子及其用途
Yamamura et al. Identification of the transcriptional regulatory sequences of human calponin promoter and their use in targeting a conditionally replicating herpes vector to malignant human soft tissue and bone tumors
EP2391722B1 (fr) Vecteurs adénoviraux non ad5 et procédés et utilisations associés
US11246896B2 (en) Tumor-specific adenovirus vectors and therapeutic uses
CN109715813A (zh) 腺病毒载体
JP2007525949A (ja) 自己プロセッシング性ペプチド切断部位を含む細胞特異的複製適格ウィルス・ベクター
US9090907B2 (en) Modified INSM1-promoter for neuroendocrine tumor therapy and diagnostics
KR20190070890A (ko) 재조합 아데노바이러스 및 이를 포함하는 줄기세포
CA2423833C (fr) Virus diriges sur des cellules et des tissus hypoxiques
WO2005089123A2 (fr) Traitement anticancereux a base d'adn
US7285414B2 (en) Viruses targeted to hypoxic cells and tissues
Akerstrom et al. Modifications to the INSM1 promoter to preserve specificity and activity for use in adenoviral gene therapy of neuroendocrine carcinomas
AU2001294793A1 (en) Viruses targeted to hypoxic cells and tissues
US20230390320A1 (en) Cancer-specific trans-splicing ribozyme expressing immune checkpoint inhibitor, and use thereor
EP1469077B1 (fr) Vecteur d'expression/replication specifique de cellule
O'Bryan Generation of an Oncolytic Adenovirus Targeting the CXCR4 and CXCR7 Chemokine Receptors in Breast Cancer
Del Papa Assessing the Oncolytic Capacity of Conditionally Replicating Adenovirus Armed with p14 Fusion Associated Small Transmembrane Protein and the Adenovirus Death Protein
Sajib Multilevel Targeting of Canine Adenovirus Type 2 (CAV2) to Expand Oncolytic Virotherapy in Canine Tumors
US8263398B2 (en) Promoter and viral vector containing the same
US20040101825A1 (en) Viruses targeted to hypoxic cells and tissues
Hay et al. Adenoviral vectors incorporating multiple targeting and efficacy strategies to eliminate breast cancer metastases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10836386

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13505823

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 10836386

Country of ref document: EP

Kind code of ref document: A2