WO2011038575A1 - Traitement faisant appel à des anticorps inédits - Google Patents

Traitement faisant appel à des anticorps inédits Download PDF

Info

Publication number
WO2011038575A1
WO2011038575A1 PCT/CN2010/001530 CN2010001530W WO2011038575A1 WO 2011038575 A1 WO2011038575 A1 WO 2011038575A1 CN 2010001530 W CN2010001530 W CN 2010001530W WO 2011038575 A1 WO2011038575 A1 WO 2011038575A1
Authority
WO
WIPO (PCT)
Prior art keywords
prp
antibody
human
binding
antibodies
Prior art date
Application number
PCT/CN2010/001530
Other languages
English (en)
Inventor
Lizhen Wang
Original Assignee
Glaxo Wellcome Manufacturing Pte Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Glaxo Wellcome Manufacturing Pte Ltd filed Critical Glaxo Wellcome Manufacturing Pte Ltd
Publication of WO2011038575A1 publication Critical patent/WO2011038575A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2872—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against prion molecules, e.g. CD230
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention provides novel methods of treatment of Alzheimer's disease, and novel isolated antibodies for use in these methods. There is also provided a method of treating Alzheimer's disease with anti-PrP c antibodies which block the binding of ⁇ oligomer to the cellular prion protein PrP c .
  • AD Alzheimer's disease
  • Citron M (2002) Nat. Neurosci 5, Suppl 1055-1057
  • the earliest stages of the disease are characterized by a progressive loss of memory with associated cognitive decline, and language and behavioural deficits.
  • patients develop global amnesia and have greatly reduced motor function.
  • Death typically occurs 9 years following diagnosis and is often associated with other conditions, typically pneumonia (Davis K.L. and Samuels S.C. (1998) in Pharmacological Management of Neurological and Psychiatric Disorders eds Enna S.J. and Coyle J.T. (McGraw- Hill, New York pp267-316)).
  • ⁇ -amyloid ⁇ -amyloid
  • the ⁇ peptide is known to be produced by sequential cleavages of the membrane- bound beta amyloid precursor protein ("APP") in a process known as regulated intramembrane proteolysis ("RIP").
  • APP membrane- bound beta amyloid precursor protein
  • RIP regulated intramembrane proteolysis
  • the most abundant form of the ⁇ peptide is ⁇ 40, while in Alzheimer's disease patients, there is an increase in ⁇ 42 level and therefore ⁇ 42 to ⁇ 40 ratio.
  • the ⁇ 42 peptide is the most abundant species within Alzheimer's disease plaques and is thought to play a critical role in Alzheimer's disease (McGowan et al. (2005) Neuron 47:191-199).
  • the ⁇ peptide can form soluble aggregates or insoluble aggregates, which can be fibrillar.
  • the prefilbriliar, soluble ⁇ oligomers have been shown to be critical in the synaptic dysfunction in Alzheimer's disease. Studies have shown that the ⁇ 42 oligomers are neurotoxic in vitro (Hartley et al. (1999) J. Neurosci. 19:8876-8884) and suppress hippocampal long-term potentiation (LTP) (Walsh et al, (2002) Nature 416:535-539). In addition, they cause dendritic spine retraction from pyramidal cells and impair spatial memory in rodents (Lacor et al. (2007) J. Neurosci. 27:796-807; Lesne et al. (2006) Nature 440:352-357).
  • PrP c cellular prion protein
  • Results showed that the 6D1 1 antibody, with an epitope binding to the 93-109 amino acid region of PrP c , and the 8G8 antibody, with an epitope binding to the 95-1 0 amino acid region of PrP c , blocked the binding of ⁇ oligomers to PrP c .
  • the other five antibodies tested with epitopes binding to the 37-44, 32-69 or 105-125 amino acid regions or the C-termina! half of PrP c , did not block the binding of ⁇ 42 oligomers to PrP°.
  • a full-length human PrP polypeptide was reported to have the following amino acid sequence and has the Genbank accession number AAA60182:
  • the polypeptide sequences of PrPs from several other species have also been identified.
  • the PrPs from various species all contain an octapeptide repeat region in the N-terminus in which the octapeptide motif P(H/Q)GGG ⁇ - T)WGQ is repeated 4 or 5 times.
  • the octapeptide repeat region corresponds to amino acids 51-91 of a human PrP shown above as SEQ ID NO:1 and amino acids 60-91 of a hamster PrP shown above as SEQ ID NO:2.
  • SAF32 blocks the binding of ⁇ 42 oligomer to PrP c .
  • SAF32 is a mouse monoclonal antibody raised against proteinase K- treated and formic acid denatured scrapie-associated fibrils from Syrian hamster-infected brain (Cat#189720, Cayman).
  • the SAF32 antibody binds to the octapeptide repeat region of PrP c (Feraudet et al, J. Bioi. Chem. (2005) 280:12 11247).
  • a method for the treatment of Alzheimer's disease in a human subject comprising administering to the subject an anti-PrP c antibody which binds specifically to an epitope consisting essentially of a polypeptide fragment selected from the octapeptide repeat region of a PrP° polypeptide.
  • the invention provides a method for the treatment of Alzheimer's disease in a human subject, comprising administering to the subject an anti-PrP c antibody which binds specifically to at least one amino acid within the octapeptide repeat region of a PrP c polypeptide.
  • the invention provides a method for the treatment of Alzheimer's disease in a human subject, comprising administering to the subject an anti-PrP c antibody, which binds specifically to an epitope within a PrP° polypeptide, wherein the epitope comprises at least one amino acid within a region defined by amino acids 51-91 , 51-76, 59-89, 59-90 or 60-91 of SEQ ID NO:1.
  • the anti-PrP c antibody binds specifically to an epitope within a human PrP c polypeptide (SEQ ID NO:1), wherein the epitope comprises at least one amino acid within a region defined by amino acids 59-89 or 60-91 of SEQ ID NO;1.
  • the anti-PrP c antibody is an isolated human, humanized or chimeric antibody or an antigen-binding fragment thereof. In one embodiment, the anti-PrP c antibody useful in the method of the present invention is a monoclonal antibody.
  • Anti-PrP c antibodies useful in the method of the present invention include SAF32, humanized or chimeric versions thereof, analogs thereof, and antigen-binding fragments thereof, as well as antibodies which bind to the same epitope as SAF32, humanized or chimeric versions thereof, analogs thereof, and antigen-binding fragments thereof.
  • Anti-PrP c antibodies useful in the method of the present invention also include antibodies which compete with SAF32 for binding to PrP . Competition for binding may be measured by routine methods known in the art, such as by competition ELISA or BIAcore. Further, the person skilled in the art appreciates that in order for an antibody or fragment (antibody or fragment A) to compete with antibody SAF34 (antibody B) for a specific binding site (of PrP°), antibody A must be present in a sufficient amount to have an effect in said assay. For example, antibody A and antibody B may be present in equimolar amounts. If antibody A is a competing antibody, the presence of antibody A may reduce the binding of antibody B to PrP c in an ELISA assay by more than 10%, 20%, 30%, 40% or 50%.
  • a competing antibody may reduce the binding of antibody B to plate-bound PrP c , whereas a non-anti-PrP c -specific control does not.
  • PrP c may be bound to an immunoassay plate.
  • surface plasmon resonance may be used to determine competition between antibodies.
  • the anti-PrP c antibody useful in the method of the present invention binds specifically to an epitope consisting essentially of a polypeptide fragment selected from amino acids 51-91 , 59-89, 59-90, 60-91 or 60-95 of SEQ ID NO: 1 or amino acids 60-91 of SEQ ID NO: 2.
  • the method of the present invention comprises administering to the subject an anti-PrP c antibody which binds specifically to an epitope consisting essentially of a polypeptide fragment selected from the octapeptide repeat region of a PrP c polypeptide, wherein the PrP c polypeptide is selected from the group consisting of the human, hamster, mouse, rat, bovine and ovine PrP c polypeptides.
  • the method of the present invention inhibits suppression of long term potentiation in a human subject.
  • the method of the present invention improves acute memory retention in a human subject.
  • the method of the present invention improves spatial memory performance in a human subject.
  • the present inventors have shown that the octapeptide repeat region of PrP c is important for ⁇ 42 oligomer binding.
  • the octapeptide repeat region of a PrP c polypeptide is a region in the N-terminal of the PrP c polypeptide in which the octapeptide motif P(H/Q)GGG ⁇ - /T)WGQ is repeated 4 or 5 times.
  • the octapeptide repeat region corresponds to amino acids 51 -91 of a human PrP (SEQ ID NO; 1 ) and amino acids 60-91 of a hamster PrP (SEQ ID NO: 2).
  • the present invention provides a human, humanized or chimeric antibody, or a fragment thereof, wherein the antibody or fragment binds to an epitope of PrP c that contains at least one amino acid residue within the octapeptide repeat region and which is capable of blocking the interaction between ⁇ 42 oligomer and PrP c .
  • the binding may be measured by, inter alia, peptide ELISA, surface plasmon resonance (BIAcore) or phage display.
  • the invention provides a humanized or chimeric antibody or fragment thereof comprising at least one of the complementarity determining regions (CDRs) of SAF32.
  • the humanized or chimeric antibody of this embodiment may comprise at least CDRH3 of SAF32, and optionally also at least one, two or all five of CDRH1 , CDRH2, CDRL1, CDRL2, and CDRL3 of SAF32.
  • the invention provides an antibody which competes with SAF32 for binding to PrP c .
  • the antibodies 3B5, 4F2, SAF15, SAF32, SAF33, SAF34, SAF35 and SAF37 are, independently or together, the antibodies 3B5, 4F2, SAF15, SAF32, SAF33, SAF34, SAF35 and SAF37 (and optionally also BAR238) (described by Feraudet et al, J. Biol. Chem. (2005) 280:12 11247).
  • the antibody is preferably human, humanized or chimeric.
  • a method for identifying antibodies or antibody fragment suitable for use in the treatment of Alzheimer's disease comprising the steps of: a) screening a plurality of independent antibody populations to determine the ability of each antibody population to: i) bind to the octapeptide repeat region of PrP c , ii) block the binding of ⁇ 42 oligomer to PrP c ; and
  • a method of manufacturing a medicament for the treatment of Alzheimer's disease comprising formulating an anti-PrP c antibody or antigen-binding fragment of the present invention and one or more excipients into a pharmaceutically acceptable formulation.
  • This method may comprise the preliminary steps of identifying an antibody, as described above, and/or of recombinantly producing such an antibody.
  • a method for the treatment of Alzheimer's disease in a human subject comprising administering to the subject a polypeptide comprising at least 8 contiguous amino acids from a polypeptide defined by amino acids 51-91 , 59-89, 59-90 or 60-91 of SEQ ID NO:1.
  • the anti-PrP c antibodies, antigen-binding fragments, their humanized, human or chimeric variants, and analogs, of the present invention may be used in a method of treatment of Alzheimer's disease, the method comprising administering a safe and effective dose of the antibodies of the present invention to a patient in need thereof.
  • Figure 1A shows a Western blot of the ⁇ 42 oligomer preparation detected with 6E10
  • Figure 1 B shows a size exclusion chromatography analysis of the ⁇ 42 oligomer preparation.
  • Figure 2A shows the immunochemistry data and Figures 2B and 2C show the FACS analysis data of the binding of ⁇ 42 oligomer to the various human and mouse PrP c peptides expressed on COS-7 cells.
  • Figure 3 shows that SAF32 binds to the 51-76aa, 79-92aa and full-length human PrP c peptide constructs.
  • Figure 4A shows that SAF32 and 6D11 block the binding of ⁇ 42 oligomer to PrP c
  • Figure 4B shows the immunochemistry data, showing that control IgG fails to block oligomer binding
  • Figure 5 shows the binding kinetics of SAF32 and 6D1 to a human PrP c peptide construct.
  • the invention is based on the discovery that the octapeptide repeat region of PrP c is important for ⁇ 42 oligomer binding.
  • the inventors have shown that the anti-PrP c antibody SAF32, which binds to the octapeptide repeat region of PrP c , blocks the binding of ⁇ 42 oligomer to PrP c with a greater potency than the 6D1 1 antibody.
  • a previous study identified the 93-109 amino acid region of PrP c , which 6D1 1 binds to, as a principal site for ⁇ 42 oligomer binding and for mediating the pathological actions of the ⁇ 42 oligomer.
  • Blocking the binding of the ⁇ 42 oligomer to the octapeptide repeat region of PrP c therefore provides a promising therapeutic method for inhibiting suppression of long term potentiation, for improving acute memory retention and spatial memory performance, and for treating Alzheimer's disease.
  • the anti-PrP c antibodies useful in the method of the present invention are capable of inhibiting, partially or fully, binding of ⁇ 42 oligomer to the octapeptide repeat region of PrP c . Binding of ⁇ 42 oligomer to PrP c can be determined by methods routine in the art, for instance, immunochemistry or in an assay such as that described in the Examples herein.
  • the anti-PrP c antibodies may have an IC50 of 50 ⁇ g/ml or less, 25 ⁇ g ml or less, • ⁇ g/ml or less, 5 ⁇ g ml or less, or 2 ⁇ g/m ⁇ or less. In an embodiment, the antibody has an IC 50 of less than ⁇ ⁇ g/m ⁇ , less than 0 ⁇ g/m(, less than 0.25 ⁇ g ml J or less than O. ⁇ g/ml.
  • isolated means that the antibodies are removed from the environment in which they may be found in nature, for example, they may be purified away from substances with which they would normally exist in nature. These antibodies may be substantially pure, in that the mass of protein in a sample would by constituted of at least 50% or at least 80% antibody.
  • the anti-PrP c antibodies of the present invention may be "intact antibodies".
  • Intact antibodies are usually heteromultimeric glycoproteins comprising at least two heavy and two light chains. Aside from IgM, intact antibodies are heterotetrameric glycoproteins of
  • each light chain is linked to a heavy chain by one covalent disulfide bond while the number of disulfide linkages between the heavy chains of different immunoglobulin isotypes varies.
  • Each heavy and light chain also has intrachain disulfide bridges.
  • Each heavy chain has at one end a variable domain (V H ) followed by a number of constant regions.
  • Each light chain has a variable domain (V L ) and a constant region at its other end; the constant region of the light chain is aligned with the first constant region of the heavy chain and the light chain variable domain is aligned with the variable domain of the heavy chain.
  • the light chains of antibodies from most vertebrate species can be assigned to one of two types called Kappa and Lambda based on the amino acid sequence of the constant region.
  • human antibodies can be assigned to five different classes, IgA, IgD, IgE, IgG and Ig .
  • IgG and IgA can be further subdivided into subclasses, igG1 , lgG2, lgG3 and lgG4; and lgA1 and lgA2.
  • Species variants exist with mouse and rat having at least lgG2a, lgG2b.
  • variable domain of the antibody confers binding specificity upon the antibody with certain regions displaying particular variability called complementarity determining regions (CDRs).
  • CDRs complementarity determining regions
  • FR framework regions
  • the variable domains of intact heavy and light chains each comprise four FR connected by three CDRs.
  • the CDRs in each chain are held together in close proximity by the FR regions and with the CDRs from the other chain contribute to the formation of the antigen binding site of antibodies.
  • the constant regions are not directly involved in the binding of the antibody to the antigen but exhibit various effector functions such as participation in antibody dependent cell-mediated cytotoxicity (ADCC), phagocytosis via binding to Fey receptor, half-life/clearance rate via neonatal Fc receptor (FcRn) and complement dependent cytotoxicity via the C1q component of the complement cascade.
  • ADCC antibody dependent cell-mediated cytotoxicity
  • FcRn neonatal Fc receptor
  • C1q component of the complement cascade complement dependent cytotoxicity via the C1q component of the complement cascade.
  • the human lgG2 constant region has been reported to essentially lack the ability to activate complement by the classical pathway or to mediate antibody-dependent cellular cytotoxicity.
  • the !gG4 constant region has been reported to lack the ability to activate complement by the classical pathway and mediates antibody-dependent cellular cytotoxicity only weakly. Antibodies essentially lacking these effector functions may be termed 'non-lytic' antibodies.
  • the anti-PrP c antibodies of the present invention may be "human antibodies".
  • Human antibodies may be produced by a number of methods known to those of skill in the art. Human antibodies can be made by the hybridoma method using human myeloma or mouse-human heteromyeloma cell lines see Kozbor J. (1984) Immunol 133:3001 and Brodeur, Monoclonal Antibody Production Techniques and Applications, pp51-63 (Marcel Dekker Inc. 1987).
  • Phage display technology can be used to produce human antibodies (and fragments thereof), see McCafferty (1990) Nature 348:552-553 and Griffiths AD et al. (1994) EMBO 13:3245-3260.
  • the anti-PrP° antibodies of the present invention may be "chimeric" or "humanized” antibodies.
  • the use of intact non-human antibodies in the treatment of human diseases or disorders carries with it the now well established problems of potential immunogenicity especially upon repeated administration of the antibody: that is the immune system of the patient may recognise the non-human intact antibody as non-self and mount a neutralising response.
  • various techniques have been developed over the years to overcome these problems and generally involve reducing the composition of non-human amino acid sequences in the intact therapeutic antibody whilst retaining the relative ease in obtaining non-human antibodies from an immunised animal e.g. mouse, rat or rabbit. Broadly two approaches have been used to achieve this.
  • the first are chimeric antibodies, which generally comprise a non-human (e.g. rodent such as mouse) variable domain fused to a human constant region. Because the antigen-binding site of an antibody is localised within the variable regions the chimeric antibody retains its binding affinity for the antigen but acquires the effector functions of the human constant region and is therefore able to perform effector functions. Chimeric antibodies are typically produced using
  • DNA encoding the antibodies e.g. cDNA
  • DNA encoding the antibodies is isolated and sequenced using conventional procedures (e.g. by using oligonucleotide probes that are capable of binding specifically to genes encoding the H and L chain variable regions of the antibody of the invention).
  • the DNA may be modified by substituting the coding sequence for human L and H chains for the corresponding non-human (e.g. murine) H and L constant regions see e.g. Morrison (1984) PNAS 81 :6851.
  • the second approach involves the generation of humanised antibodies wherein the non- human content of the antibody is reduced by humanizing the variable regions.
  • Two techniques for humanisation have gained popularity.
  • the first is humanisation by CDR grafting.
  • CDRs build loops close to the antibody's N-terminus where they form a surface mounted in a scaffold provided by the framework regions.
  • Antigen-binding specificity of the antibody is mainly defined by the topography and by the chemical characteristics of its CDR surface. These features are in turn determined by the conformation of the individual CDRs, by the relative disposition of the CDRs, and by the nature and disposition of the side chains of the residues comprising the CDRs.
  • a large decrease in immunogenicity can be achieved by grafting only the CDRs of a non-human (e.g. murine) antibody ("donor" antibody) onto a suitable human framework
  • human V regions showing the greatest sequence homology (typically 60% or greater) to the non-human donor antibody maybe chosen from a database in order to provide the human framework (FR).
  • the selection of human FRs can be made either from human consensus or individual human antibodies. Where necessary key residues from the donor antibody are substituted into the human acceptor framework to preserve CDR
  • humanisation maybe achieved by a process of "veneering".
  • a statistical analysis of unique human and murine immunoglobulin heavy and light chain variable regions revealed that the precise patterns of exposed residues are different in human and murine antibodies, and most individual surface positions have a strong preference for a small number of different residues (see Padlan E.A. et al, (1991 ) Mol. Immunol.28:489-498 and Pedersen J.T. et al. (1994) J. ol. Biol. 235:959-973). Therefore it is possible to reduce the immunogenicity of a non-human Fv by replacing exposed residues in its framework regions that differ from those usually found in human antibodies.
  • One aspect of the present invention is, therefore, humanized antibodies comprising one or more, or all, of the CDRs found in SAF32.
  • the anti-PrP c antibodies of the present invention may be "antibody fragments".
  • a therapeutic antibody which is an antigen binding fragment.
  • Such fragments may be functional antigen binding fragments of intact and/or humanised and/or chimeric antibodies such as Fab, Fd, Fab', F(ab') 2 , Fv, ScFv fragments of the antibodies described supra.
  • the fragments may also be human, camellid or shark or other species, single variable domain antibodies or larger constructs comprising them. Fragments lacking the constant region lack the ability to activate complement by the classical pathway or to mediate antibody-dependent cellular cytotoxicity.
  • fragments are produced by the proteolytic digestion of intact antibodies by, e.g., papain digestion (see for example, WO 94/29348) but may be produced directly from recombinant ⁇ transformed host cells.
  • papain digestion see for example, WO 94/29348
  • ScFv see Bird et al. (1988) Science 242:423-426.
  • antibody fragments may be produced using a variety of engineering techniques as described below,
  • Fv fragments appear to have lower interaction energy of their two chains than Fab fragments.
  • peptides Bord et al. (1988) Science 242:423-426, Huston et al. PNAS. 85:5879-5883
  • disulphide bridges Glockshuber et al. (1990) Biochemistry 29:1362-1367)
  • knockshuber et al. (1990) Biochemistry 29:1362-1367 and "knob in hole” mutations
  • ScFv fragments can be produced by methods well known to those skilled in the art see Whitlow et al. (1991 ) Methods companion Methods Enzymol.
  • ScFv may be produced in bacteria! cells such as E.Coli but are more typically produced in eukaryotic cells.
  • One disadvantage of ScFv is the monovalency of the product, which precludes an increased avidity due to polyvalent binding, and their short half-life. Attempts to overcome these problems include bivalent (ScFv') 2 produced from ScFV containing an additional G terminal cysteine by chemical coupling (Adams et al. (1993) Can. Res 53:4026-4034 and McCartney et al. (1995) Protein Eng.
  • ScFv can be forced to form multimers by shortening the peptide linker to between 3 to 12 residues to form "diabodies", see Holliger et ai. PNAS (1993), 90, 6444-6448. Reducing the linker still further can result in ScFV trimers ("triabodies”, see Kortt et al. ( 997) Protein Eng, 10:423-433) and tetramers ("tetrabodies", see Le Gall et al.
  • ScFV ScFv-Sc-Fv tandems
  • (ScFV) 2 may also be produced by linking two ScFv units by a third peptide linker, see Kurucz ef al. (1995) J. Immol.154:4576-4582.
  • Bispecific diabodies can be produced through the noncovalent association of two single chain fusion products consisting of V H domain from one antibody connected by a short linker to the V L domain of another antibody, see Kipriyanov et al. (1998), Int. J. Can. 77:763-772.
  • the stability of such bispecific diabodies can be enhanced by the introduction of disulphide bridges or "knob in hole” mutations as described supra or by the formation of single chain diabodies (ScDb) wherein two hybrid ScFv fragments are connected through a peptide linker see Kontermann et a/ (1999) J. Immunol. Methods 226:179-188.
  • Tetravalent bispecific molecules are available by e.g. fusing a ScFv fragment to the CH3 domain of an IgG molecule or to a Fab fragment through the hinge region see Coloma ef al (1997) Nature Biotechnol. 15:159-163.
  • tetravalent bispecific molecules have been created by the fusion of bispecific single chain diabodies (see Alt et al. ( 999) FEBS Lett. 454: 90-94.
  • Smaller tetravalent bispecific molecules can also be formed by the dimerization of either ScFv-ScFv tandems with a linker containing a helix-loop-helix motif (DiBi miniantibodies, see Muller ef al (1998) FEBS Lett. 432:45-49) or a single chain molecule comprising four antibody variable domains (V H and V L ) in an orientation preventing intramolecular pairing (tandem diabody, see Kipriyanov et al. (1999) J.Mol.Biol. 293:41-56).
  • Bispecific F(ab')2 fragments can be created by chemical coupling of Fab' fragments or by heterodimerization through leucine zippers (see Shalaby et al. (1992) J.Exp. ed. 175:217-225 and Kostelny ef al. (1992),
  • the anti-PrP c antibodies of the present invention may comprise other modifications to enhance or change their effector functions.
  • the interaction between the Fc region of an antibody and various Fc receptors (FcyR) is believed to mediate the effector functions of the antibody which include antibody-dependent cellular cytotoxicity (ADCC), fixation of complement, phagocytosis and half-life/clearance of the antibody.
  • ADCC antibody-dependent cellular cytotoxicity
  • fixation of complement phagocytosis
  • half-life/clearance of the antibody Various modifications to the Fc region of antibodies of the invention may be carried out depending on the desired effector property.
  • human constant regions which essentially lack the functions of a) activation of complement by the classical pathway; and b) mediating antibody-dependent cellular cytotoxicity include the lgG4 constant region, the lgG2 constant region and lgG1 constant regions containing specific mutations as for example mutations at positions 234, 235, 236, 237, 297, 318, 320 and/or 322 disclosed in EP0307434 (WO8807089), EP 0629 240 (WO9317105) and WO 2004/014953.
  • Antibodies comprising these constant regions may be termed 'non-lytic' antibodies.
  • Human Fey receptors include FcyR (I), FcyRlla, FcyRllb, FcyRIIla and neonatal FcRn. Shields ef at. (2001 ) J.Biol.Chem. 276:6591-6604 demonstrated that a common set of !gG1 residues is involved in binding all FcyRs, while FcyRII and FcyRII I utilize distinct sites outside of this common set.
  • One group of lgG1 residues reduced binding to all FcyRs when altered to alanine: Pro-238, Asp-265, Asp-270, Asn-297 and Pro-239. All are in the IgG CH2 domain and clustered near the hinge joining CH1 and CH2.
  • FcyRI utilizes only the common set of [gG1 residues for binding
  • FcyRII and FcyRIII interact with distinct residues in addition to the common set.
  • Alteration of some residues reduced binding only to FcyRII (e.g. Arg-292) or FcyRIII (e.g. GIu-293).
  • Some variants showed improved binding to FcyRII or FcyRIII but did not affect binding to the other receptor (e.g., Ser-267Ala improved binding to FcyRII but binding to FcyRIII was unaffected).
  • Other variants exhibited improved binding to FcyRII or FcyRIII with reduction in binding to the other receptor (e.g.
  • Ser-298Ala improved binding to FcyRIII and reduced binding to FcyRII).
  • FcyRllla the best binding igG1 variants had combined alanine substitutions at Ser-298, Glu-333 and Lys-334.
  • the neonatal FcRn receptor is believed to be involved in protecting IgG molecules from degradation and thus enhancing serum half life and the transcytosis across tissues (see Junghans R.P (1997) Immunol. Res.16:29-57 and Ghetie ei a/ (2000) Annu.Rev.lmmunol. 18:739-766).
  • Human lgG1 residues determined to interact directiy with human FcRn include [Ie253, Ser254, Lys288, Thr307, Gln311 , Asn434 and His435.
  • the therapeutic antibody of the invention may incorporate any of the above constant region modifications.
  • the therapeutic antibody essentially lacks the functions of a) activation of complement by the classical pathway; and b) mediating antibody-dependent cellular cytotoxicity
  • the present invention provides therapeutic antibodies of the invention having any one (or more) of the residue changes detailed above to modify half-life/clearance and/or effector functions such as ADCC and/or complement dependent cytotoxicity and/or complement lysis.
  • the therapeutic antibody has a constant region of isotype human lgG1 with alanine (or other disrupting) substitutions at positions 235 (e.g., L235A) and 237 ⁇ e.g., G237A) (numbering according to the EU scheme outlined in Kabat).
  • glycosylation variants of the antibodies of the invention include glycosylation variants of the antibodies of the invention. Glycosylation of antibodies at conserved positions in their constant regions is known to have a profound effect on antibody function, particularly effector functioning, such as those described above, see for example, Boyd ef al (1996) Mol. Immunol. 32:1311-1318.
  • Glycosylation variants of the therapeutic antibodies of the present invention wherein one or more carbohydrate moiety is added, substituted, deleted or modified are contemplated.
  • the anti-PrP c antibodies of the present invention may be produced by methods known to the man skilled in the art.
  • Antibodies of the present invention may be produced in transgenic organisms such as goats (see Pollock ef al. (1999) J.lmmunol.Methods 231 :147-157), chickens (see Morrow KJJ (2000) Genet.Eng.News 20:1 -55), mice (see Pollock ef al ibid) or plants (see Doran PM (2000) Curr.Opinion Biotechnol. 1 1 : 199-204, Ma JK-C (1998) Nat.Med. 4:601 -606, Baez J ef al.
  • Antibodies may also be produced by chemical synthesis. However, antibodies of the invention are typically produced using recombinant eel! culturing technology well known to those skilled in the art.
  • a polynucleotide encoding the antibody is isolated and inserted into a repiicable vector such as a plasmid for further propagation or expression in a host cell.
  • a repiicable vector such as a plasmid for further propagation or expression in a host cell.
  • One useful expression system is a glutamate synthetase system (such as sold by Lonza Biologies), particularly where the host cell is CHO or NS0 (see below).
  • Polynucleotide encoding the antibody is readily isolated and sequenced using conventional procedures (e.g. oligonucleotide probes).
  • Vectors that may be used include plasmid, virus, phage, transposons, minichromsomes of which plasmids are a typical embodiment, Generally such vectors further include a signal sequence, origin of replication, one or more marker genes, an enhancer element, a promoter and transcription termination sequences operably linked to the light and/or heavy chain
  • Polynucleotide encoding the light and heavy chains may be inserted into separate vectors and introduced (e.g. by transformation, transfection, electroporation or transduction) into the same host cell concurrently or sequentially or, if desired both the heavy chain and light chain can be inserted into the same vector prior to such introduction.
  • Antibodies of the present invention maybe produced as a fusion protein with a heterologous signal sequence having a specific cleavage site at the N terminus of the mature protein.
  • the signal sequence should be recognised and processed by the host cell.
  • the signal sequence may be an alkaline phosphatase, penicillinase, or heat stable enterotoxin II leaders
  • yeast secretion the signal sequences may be a yeast invertase leader, factor leader or acid phosphatase leaders see e.g. WQ90/13646.
  • viral secretory leaders such as herpes simplex gD signal and native immunoglobulin signal sequences (such as human Ig heavy chain) are available.
  • the signal sequence is ligated in reading frame to polynucleotide encoding the antibody of the invention.
  • Selection marker Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins e.g. ampicillin, neomycin, methotrexate or tetracycline or (b) complement auxotrophic deficiencies or supply nutrients not available in the complex media or (c) combinations of both.
  • the selection scheme may involve arresting growth of the host cells that contain no vector or vectors. Cells, which have been successfully transformed with the genes encoding the therapeutic antibody of the present invention, survive due to e.g. drug resistance conferred by the co-delivered selection marker.
  • One example is the DHFR-selection system wherein transformants are generated in DHFR negative host strains (eg see Page and Sydenham (1991 ) Biotechnology 9: 64-68). In this system the DHFR gene is co-delivered with antibody
  • DHFR inhibitor methotrexate is also employed to select for transformants with DHFR gene amplification.
  • DHFR gene amplification results in concomitant amplification of the desired antibody sequences of interest.
  • CHO cells are a particularly useful cell line for this DHFR/methotrexate selection and methods of amplifying and selecting host cells using the DHFR system are well established in the art see Kaufman R.J. et al. (1982) J.Mol.Biol.
  • Suitable promoters for expressing antibodies of the invention are operably linked to DNA polynucleotide encoding the antibody.
  • Promoters for prokaryotic hosts include phoA promoter, beta-lactamase and lactose promoter systems, alkaline phosphatase, tryptophan and hybrid promoters such as Tac.
  • Promoters suitable for expression in yeast cells include 3- phosphoglycerate kinase or other glycolytic enzymes e.g.
  • Inducible yeast promoters include alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, metallothionein and enzymes responsible for nitrogen metabolism or maltose/galactose utilization.
  • Promoters for expression in mammalian cell systems include RNA polymerase ll promoters including viral promoters such as polyoma, fowlpox and adenoviruses (e.g. adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus (in particular the immediate early gene promoter), retrovirus, hepatitis B virus, actin, rous sarcoma virus (RSV) promoter and the early or late Simian virus 40 and non-viral promoters such as EF-1 alpha (Mizushima and Nagata (1990) Nucleic Acids Res. 18(17):5322.
  • the choice of promoter may be based upon suitable compatibility with the host cell used for expression.
  • enhancer elements can be included instead of or as well as those found located in the promoters described above.
  • suitable mammalian enhancer sequences include enhancer elements from globin, elastase, albumin, fetoprotein, metallothionine and insulin.
  • an enhancer element from a eukaroytic cell virus such as SV40 enhancer, cytomegalovirus early promoter enhancer, polyoma enhancer, baculoviral enhancer or murine lgG2a locus (see WO04/009823).
  • enhancers are typically located on the vector at a site upstream to the promoter, they can also be located elsewhere e.g. within the untranslated region or downstream of the polyadenylation signal.
  • the choice and positioning of enhancer may be based upon suitable compatibility with the host cell used for expression.
  • polyadenylation signals are operably linked to polynucleotide encoding the antibody of this invention. Such signals are typically placed 3' of the open reading frame.
  • signals include those derived from growth hormones, elongation factor-1 alpha and viral (eg SV40) genes or retroviral long terminal repeats.
  • pol denylation/termination signals include those derived from the phosphoglycerate kinase (PGK) and the alcohol dehydrogenase 1 (ADH) genes.
  • PGK phosphoglycerate kinase
  • ADH alcohol dehydrogenase 1
  • polyadenylation/termination sequences may be based upon suitable compatibility with the host cell used for expression. Other methods/elements for enh anced yields
  • codon usage of the antibody of this invention thereof can be modified to accommodate codon bias of the host cell such to augment transcript and/or product yield (eg Hoekema A et al. (1987) Mo! Cell Biol. 7(8):2914-24),
  • codon bias of the host cell such to augment transcript and/or product yield (eg Hoekema A et al. (1987) Mo! Cell Biol. 7(8):2914-24)
  • the choice of codons may be based upon suitable compatibility with the host cell used for expression.
  • Suitable host cells for cloning or expressing vectors encoding antibodies of the invention are prokaroytic, yeast or higher eukaryotic cells.
  • Suitable prokaryotic cells include eubacteria e.g. enterobacteriaceae such as Escherichia e.g. E.Coli (for example ATCC 31 ,446; 31 ,537; 27,325), Enterobacter, Erwinia, Klebsiella Proteus, Salmonella e.g. Salmonella typhimurium, Serratia e.g. Serratia marcescans and Shigella as well as Bacilli such as B.subfilis and
  • B.licheniformis (see DD 266 710), Pseudomonas such as P.aeruginosa and Streptomyces.
  • yeast host cells Saccharomyces cerevisiae, schizosaccharomyces pombe, Kluyveromyces (e.g. ATCC 16,045; 12,424; 24178; 56,500), yarrowia (EP402, 226), Pichia Pastoris (EP183, 070, see also Peng et al (2004) J.Biotechnoi. 108:185-192), Candida, Trichoderma reesia (EP244, 234 ⁇ , Penicillin, Tolypocladium and Aspergillus hosts such as A.nidulans and A.niger are also contemplated.
  • host ceils of the present invention are vertebrate cells.
  • Suitable vertebrate host cells include mammalian cells such as COS-1 (ATCC No.CRL 1650) COS-7 (ATCC CRL 1651), human embryonic kidney line 293, , PerC6 (Crucell), baby hamster kidney cells (BHK) (ATCC CRL.1632), BHK570 (ATCC NO: CRL 10314), 293 (ATCC NO.CRL 1573), Chinese hamster ovary cells CHO (e.g.
  • CHO-K1 ATCC NO: CCL 61 , DHFR minus CHO cell line such as DG44 (Uriaub et al, Somat Cell Mol Genet (1986) Vol 12 pp555-566), particularly those CHO cell lines adapted for suspension culture, mouse Sertoli cells, monkey kidney cells, African green monkey kidney cells (ATCC CRL-1587), HELA cells, canine kidney cells (ATCC CCL 34), human lung cells (ATCC CCL 75), Hep G2 and myeloma or lymphoma cells e.g. NS0 (see US 5,807,715), Sp2/0, Y0.
  • DG44 Ultraaub et al, Somat Cell Mol Genet (1986) Vol 12 pp555-566
  • a stably transformed host cell comprising a vector encoding a heavy chain and/or light chain of the therapeutic antibody as described herein.
  • host cells comprise a first vector encoding the light chain and a second vector encoding said heavy chain.
  • Such host cells may also be further engineered or adapted to modify quality, function and/or yield of the antibody of this invention.
  • Non-limiting examples include expression of specific modifying (eg glycosylation) enzymes and protein folding chaperones. Cell Culturing Methods.
  • Host cells transformed with vectors encoding the therapeutic antibodies of the invention may be cultured by any method known to those skilled in the art. Host cells may be cultured in spinner flasks, shake flasks, roller bottles, wave reactors (eg System 1000 from
  • stirred tank reactors or bag reactors eg Wave Biotech, Somerset, New Jersey USA
  • stirred tankers are adapted for aeration using e.g. spargers, baffles or low shear impellers.
  • bubble columns and airlift reactors direct aeration with air or oxygen bubbles maybe used.
  • a cell protective agent such as pluronic F-68 to help prevent cell damage as a result of the aeration process.
  • microcarriers may be used as growth substrates for anchorage dependent cell lines or the cells maybe adapted to suspension culture (which is typical).
  • the culturing of host cells, particularly vertebrate host cells may utilise a variety of operational modes such as batch, fed-batch, repeated batch processing (see Drapeau et al (1994) cytotechnology 15: 103- 109), extended batch process or perfusion culture.
  • recombinantly transformed mammalian host cells may be cultured in serum-containing media such media comprising fetal calf serum (FCS), it is preferred that such host cells are cultured in serum -free media such as disclosed in Keen et al (1995) Cytotechnology 17:153-163, or commercially available media such as ProCHO-CDM or UltraCHOTM (Cambrex NJ, USA), supplemented where necessary with an energy source such as glucose and synthetic growth factors such as recombinant insulin.
  • FCS fetal calf serum
  • serum -free media such as disclosed in Keen et al (1995) Cytotechnology 17:153-163, or commercially available media such as ProCHO-CDM or UltraCHOTM (Cambrex NJ, USA), supplemented where necessary with an energy source such as glucose and synthetic growth factors such as recombinant insulin.
  • the serum-free culturing of host cells may require that those cells are adapted to grow in serum free conditions.
  • One adaptation approach is to culture such host cells in serum containing media and repeatedly exchange 80% of the culture medium for the serum-free media so that the host cells learn to adapt in serum free conditions (see e.g. Scharfenberg K et al (1995) in Animal Cell technology: Developments towards the 21st century (Beuvery E.C. ef al eds), pp619-623, Kluwer Academic publishers).
  • Antibodies of the invention secreted into the media may be recovered and purified from the media using a variety of techniques to provide a degree of purification suitable for the intended use.
  • the use of therapeutic antibodies of the invention for the treatment of human patients typically mandates at least 95% purity as determined by reducing SDS-PAGE, more typically 98% or 99% purity, when compared to the culture media comprising the .
  • cell debris from the culture media is typically removed using centrifugation followed by a clarification step of the supernatant using e.g. microfiltration, ultrafiltration and/or depth filtration.
  • the antibody can be harvested by microfiltration, ultrafiltration or depth filtration without prior centrifugation.
  • dialysis and get electrophoresis and chromatographic techniques such as hydroxyapatite (HA), affinity chromatography ⁇ optionally involving an affinity tagging system such as polyhistidine) and/or hydrophobic interaction chromatography (HIC, see US 5429746) are available.
  • the antibodies of the invention are captured using Protein A or G affinity chromatography followed by further chromatography steps such as ion exchange and/or HA chromatography, anion or cation exchange, size exclusion chromatography and ammonium sulphate precipitation.
  • various virus removal steps are also employed (e.g. nanofiltration using e.g. a DV-20 filter).
  • a purified (typically monoclonal) preparation comprising at least 10mg/ml or greater e.g. 100mg/ml or greater of the antibody of the invention is provided and therefore forms an embodiment of the invention. Concentration to 100mg/ml or greater can be generated by ultracentnfugation.
  • such preparations are substantially free of aggregated forms of antibodies of the invention.
  • Bacterial systems are particularly suited for the expression of antibody fragments. Such fragments are localised intracellular ⁇ or within the periplasma. Insoluble periplasmic proteins can be extracted and refolded to form active proteins according to methods known to those skilled in the art, see Sanchez er a/ (1999) J.Biotechnol. 72:13-20; Cupit PM er a/ (1999) Lett. Appl. Microbiol. 29:273-277,
  • An analog is an amino acid sequence modified by at least one amino acid, wherein said modification can be chemical or a substitution or a rearrangement of a few amino acids (i.e., no more than 10), which modification permits the amino acid sequence to retain the biological characteristics, e.g., antigen specificity and high affinity, of the unmodified sequence.
  • (siient) mutations can be constructed, via substitutions, when certain endonuclease restriction sites are created within or surrounding CDR-encoding regions.
  • the present invention contemplates the use of analogs of the antibodies of the invention. It is well known that minor changes in amino acid or nucleic acid sequences may lead eg to an allelic form of the original protein which retains substantially similar properties.
  • analogs of the antibodies of the invention includes those in which the CDRs in the hypervariable region of the heavy and light chains are at least 75% homologous, preferably at least 80% homologous, preferably at least 90 % homologous and more preferably at least 95 % homologous to the CDRs of SAF32 or the humanised, chimeric or human antibodies contemplated herein.
  • compositions for use in the treatment of human diseases and disorders such as those outlined above.
  • compositions further comprise a pharmaceutically acceptable (i.e. inert) carrier as known and called for by acceptable pharmaceutical practice, see e.g. Remingtons Pharmaceutical
  • compositions for injection e.g. by intravenous, intraperitoneal, intradermal, subcutaneous, intramuscular or intraportal
  • suitable buffers such as sodium acetate trihydrate
  • Pharmaceutical compositions for injection are suitably free of visible particulate matter and may comprise from 1 mg to 10g of therapeutic antibody, typically 5mg to 1g, more specifically 5mg to 25mg or 50mg of antibody. Methods for the preparation of such pharmaceutical compositions are well known to those skilled in the art.
  • compositions comprise from 1mg to 0g of therapeutic antibodies of the invention in unit dosage form, optionally together with instructions for use.
  • Pharmaceutical compositions of the invention may be lyophilised (freeze dried) for reconstitution prior to administration according to methods well known or apparent to those skilled in the art.
  • a chelator of metal ions including copper such as citrate (e.g. sodium citrate) or EDTA or histidine, may be added to the pharmaceutical composition to reduce the degree of metal- mediated degradation of antibodies of this isotype, see EP0612251.
  • Pharmaceutical compositions may also comprise a solubiliser such as arginine base, a detergent/anti- aggregation agent such as polysorbate 80, and an inert gas such as nitrogen to replace vial headspace oxygen. Clinical Uses.
  • the methods of the invention are for the treatment of Alzheimer's disease.
  • the invention encompasses any suitable delivery method for the anti-PrP c antibodies to a selected target tissue.
  • the anti-PrP c antibodies used in the methods of the present invention may be directly infused into the brain.
  • Effective doses and treatment regimes for administering the antibody of the invention are generally determined empirically and are dependent on factors such as the age, weight and health status of the patient and disease or disorder to be treated. Such factors are within the purview of the attending physician. Guidance in selecting appropriate doses may be found in e.g. Smith ef a/. (1977) Antibodies in human diagnosis and therapy, Raven Press, New York.
  • PrP c preparations For protein expression and purification, cDNAs encoding the human full-length prion protein (PrP c ) were synthesized by nucleotide oligomer assembly and cloned into pTT5 vector as Fc fusion constructs between EcoRI and Hindi 11 sites. The plasmids were transiently transfected into HEK293-6E cells and cultured in serum-free medium (Freestyle medium from Invitrogen). Four days post transfection, the culture medium was collected and the PrP-Fc fusion proteins were purified on a Protein G column, The concentration of the protein was measured by Nanodrop spectrophotometer, and the purity of the proteins was checked by PAGE gel and Western analysis.
  • PrP c human full-length prion protein
  • PrP constructs were synthesized by nucleotide oligomer assembly and cloned into Bglll and Sail sites of p!RES-AcGFP vector: full-!ength human PrP c (hPrP FL), full-length mouse PrP c (mPrP FL), truncated human PrP c (hPrP ⁇ 32-106, hPrP ⁇ 50- 110, hPrP ⁇ 50-90, hPrP ⁇ 50-75, hPrP ⁇ 90-1 10), truncated mouse PrP c (mPrP ⁇ 32-106, mPrP ⁇ 50-1 10, mPrP ⁇ 50-90, mPrP ⁇ 50-75, mPrP ⁇ 90-1 0).
  • RNAi 512 and scramble RNAi were designed according to published sequences (Pfeifer et al.). Another target sites for RNAi, 638 was selected using programs. The sequences of the nucleotides were: 512-AGAACAACTTCGTGCACGACT; 638- GTACTACAGGCCGGTGGATCA; 436-GTACCCATAATCAGTGGAACA; scramble- CGAACAATCAATGCGTGCCTA. Oligonucleotides were cloned into the pLVX-shRNA2 Vector, a lentiviral expression vector (Clontech). Fluorescent ZsGreenl was co-expressed with ShRNA as an indicator of transduction efficiency. ⁇ 42 oligomer preparations
  • ⁇ 42 oligomer was prepared using synthetic peptides following published protocols (Lauren et al. (2009) Nature 457: 1128-1132). Briefly, HFIP pre-treated ⁇ 42 peptides were first dissolved in anhydrous dimethyl sulfoxide (DMSO) to 5 mM, added next to F12 medium to a final concentration of 100 ⁇ . After incubation at 22°C for sixteen hours, fibrillar ⁇ 42 was then removed by centrifugation at 14,000 g for ten minutes. For experiments, ⁇ 42 oligomer was further diluted to indicated concentrations using F12 medium.
  • DMSO dimethyl sulfoxide
  • SEC size exclusion chromatography
  • COS-7 cells were cultured in Dulbecco's Modified Eagles Medium (DMEM) containing 10% fetal bovine serum (invitrogen) and 2 mM GluTAMAX. Ceils were seeded at 1 x 10 5 cells/well in six- well plates and transiently transfected with indicated vectors by FuGene HD (Roche) following the manufacturer's protocol.
  • DMEM Dulbecco's Modified Eagles Medium
  • invitrogen 10% fetal bovine serum
  • GluTAMAX 2 mM GluTAMAX
  • COS-7 cells were seeded at a density of 1 x 10 5 cells/well in six-well plates and transiently transfected with various PrP c and control constructs.
  • cells were dissociated by 0.2% EDTA and seeded at a density of 2 x 10 4 cells/well in 24-we!l culture plates.
  • F12 medium Invttrogen
  • Unbound ⁇ 42 oligomers were removed by extensive wash with F12 medium.
  • Cells were then fixed with 4% formaldehyde for fifteen minutes at RT.
  • Oligomers were detected by 6E10 at 4°C over night, followed by Aiexa Fluor 546 Goat-anti-mouse IgG secondary antibody. Signals of oligomeric ⁇ 42 peptides were visualized by Olympus fluorence microscope. For anti-PrP antibody blocking experiment, COS-7 cells were first incubated with indicated antibodies at different concentration for one hour at RT, followed by 0.5 ⁇ ⁇ 42 oligomers for another one hour and a half.
  • COS-7 cells were transiently transfected with various PrP° and control constructs for two days. Cells were dissociated in PBS containing 0.2% EDTA. Living COS-7 cells were then suspended in F12 medium at 5 x 10 5 and incubated with 0.25 ⁇ ⁇ 42 oligomers for one hour and a half at RT. After extensive wash with F12 medium, cell surface bound ⁇ 42 oligomers were detected by 6E10 (1 :1000, Covance), followed by APC-conjugated secondary antibodies. To assess the cell surface protein expression level of different PrP c , anti-PrP c -C terminal antibody 6H4 (1 :1000, Prionic) were used. Cells were analyzed by a FACS Calibur cytometer (BD
  • Pretreated ELISA plates were coated with human PrP c -Fc recombinant protein or one of the human PrP c peptide constructs 32-50aa, 51-76aa, 79-92aa, 93-109aa and 175-190aa in pH 9.6 carbonate buffer (Na 2 C0 3 15 mM, NaHC0 3 35 mM) at 4°C for 18 hours. After removing unbound peptides or protein, the coated plates were blocked by 200 ⁇ blocking buffer (PBS containing 1% BSA and 0.5% Tween-20) at 37°C for one hour. SAF32 (100 ⁇ ) diluted to 1 :10000 in blocking buffer was added and the plates were allowed to stand at 37°C for two hours.
  • pH 9.6 carbonate buffer Na 2 C0 3 15 mM, NaHC0 3 35 mM
  • Optical density (OD) of the wells was determined using MultiSkan ASCENT (thermon) at a test wavelength of 450 nm and a reference wavelength of 650 nm.
  • ⁇ - ⁇ 42 oligomers Eight ⁇ g of ⁇ - ⁇ 42 oligomers (rPeptide) were incubated with 30 ⁇ NeutrAvidinTM Agarose Resins (Pierce) at 4°C for two hours, followed by extensive wash to remove unbound biotin- ⁇ 42 oligomers.
  • Human PrP c -Fc recombinant protein was amine coupled to CM5 chip (GE, BR-1006-68) at the levels of 200 RU.
  • HBS-EP buffer with various concentrations of anti-PrP c antibodies was flowed through at 30 ⁇ /min for 600 (SAF32) or 120 (6D11) seconds and dissociated for 1200 (SAF32) or 600 (6D11 ) seconds.
  • Regeneration was performed by injecting 10 mM glycine-HCI buffer (pH1.7) at 10 ⁇ /min for 180 seconds and stabilizing for another 120 seconds. The assays were performed at 25°C. Results were analyzed with Biacore T100 evaluation software ver 2.0.
  • Cortical neurons from 18-day-old embryonic Sprague-Dawley rats were isolated by a standard enzyme treatment protocol. Briefly, cortices were dissociated in DMEM medium and seeded (5 x 10 4 cells/well) in poly-D-lysine coated 96-well plates. Neurobasal medium with 2% B27 and 2 mM GluTAMAX was replaced every three to four days. Treatment with 5-fluoro-5'-deoxyuridine (1 0 ⁇ g/m ⁇ ) on the third day after seeding was used to block cell division of non-neuronal cells. The cultures were maintained at 37°C degree in a 5% C0 2 humidified atmosphere.
  • MTT assay was done following the standard protocol. In brief, medium was replaced with neurobasal medium without phenol red. MTT dye (1 5 ⁇ /well) was then applied to the culture. After four hours incubation at 37°C, 100 ⁇ per well stop/stabilization solution was applied to the culture and incubated for at least one hour at 37°C. Absorbance was measured using a microplate reader Multiscan Ascent (ThermoFisher). Reagents
  • the ⁇ 42 oligomers prepared were characterized by Western blot and size exclusion chromatography (SEC).
  • Figure 1 A shows a representative Western blot analysis of ⁇ 42 oligomer preparation.
  • Figure 1 B shows a representative size exclusion chromatography graph of ⁇ 42 oligomer separation.
  • the central cluster region (aa95-110) was reported to be involved in the interaction between PrP and ⁇ 42 oligomer (Lauren et al., (2009) Nature 457: 1128-1132).
  • h/mPrP c deletion mutants ⁇ 90-110, ⁇ 50-75, ⁇ 50-90, ⁇ 50-110, ⁇ 32-106 to evaluate ⁇ 42 oligomer binding versus full length hPrP, using FACS approach (Fig 2B, data shown is for the ⁇ 32- 06 mutant, wherein the rightmost peak is full length hPrP).
  • SAF32 was reported to have an epitope within the octapeptide repeat region of PrP ⁇ Feraudet et al. (2005) J. Biol. Chem. 280: 11247-11258).
  • PrP c did not contribute to oligomer-mediated neuronal loss
  • 6D11 and SAF32 were performed to validate the presence of high expression levels of PrP in cortical and hippocampus culture at 10 DIV by western blot using 6D1 1.
  • the specificity of anti-PrP c antibody was confirmed by absence of immunoreactive bands in the brain extracts of PrP 0 -/- mice.
  • Cortical neurons were treated with oligomer at 5 ⁇ for 48h in the presence or absence of either anti-PrPC antibodies (6D1 1 and SAF32) or anti- ⁇ antibody, 6E10.
  • Anti-PrP c shRNA targeting 3 different sites in the Prnp mRNA were tested by infecting primary cortical neurons. Efficient transduction was detected with more than 90% of neurons transduced at an MOI of 100.
  • One of the ientiviral shRNA vectors (512) decreased expression of PrP c by more than 90% in cortical neuron after 4 days infection. In contrast, infection of neurons with scrambled shRNA had no significant effect.
  • Cortical neurons infected with LVPrPshRNA or scramble shRNA were treated with ⁇ 42 oligomer ⁇ , 2 ⁇ and 5 ⁇ and assessed for cell viability by MTT assay.
  • PrP c knockdown did not attenuate the neuronal loss induced by oligomers. Although this could indicate that neuronal loss induced by ⁇ 42 oligomer is not mediated through PrP c , it could also be explained by the use of a relatively high concentration of ⁇ 42 oligomer (5 ⁇ in the antibody study), combined with the incomplete knockdown of PrP expression by the ShRNA. In this respect, previous studies studying similar effects of ⁇ 42 oligomers were carried out at nanomolar concentrations of ⁇ 42 oligomer (Lauren et al. (2009) Nature 457: 1128-1 132).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention concerne des méthodes inédites de traitement de la maladie d'Alzheimer, ainsi que des anticorps isolés inédits pouvant être utilisés dans le cadre desdites méthodes. L'invention concerne également une méthode de traitement de la maladie d'Alzheimer faisant appel à des anticorps anti-PrPc qui bloquent la liaison de l'oligomère Aβ à la protéine cellulaire du prion PrPc.
PCT/CN2010/001530 2009-09-30 2010-09-29 Traitement faisant appel à des anticorps inédits WO2011038575A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US24717709P 2009-09-30 2009-09-30
US61/247,177 2009-09-30

Publications (1)

Publication Number Publication Date
WO2011038575A1 true WO2011038575A1 (fr) 2011-04-07

Family

ID=43825511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2010/001530 WO2011038575A1 (fr) 2009-09-30 2010-09-29 Traitement faisant appel à des anticorps inédits

Country Status (1)

Country Link
WO (1) WO2011038575A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150322143A1 (en) * 2010-10-15 2015-11-12 The Board Of Regents Of The University Of Texas System Antibodies that bind amyloid oligomers
WO2017178288A1 (fr) * 2016-04-15 2017-10-19 Medimmune Limited Anticorps anti-prp et leurs utilisations
US10266585B2 (en) 2009-08-28 2019-04-23 The Board Of Regents Of The Univerity Of Texas System Methods of treating brain injury
WO2020123884A1 (fr) * 2018-12-13 2020-06-18 Goetzl Edward J Exosomes dérivés de neurones et leurs biomarqueurs pour le diagnostic, le pronostic et le traitement d'un traumatisme craniocérébral et de la maladie d'alzheimer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002049662A2 (fr) * 2000-12-21 2002-06-27 Mcgill University Procede de protection des cellules contre l'apoptose et analyses visant a identifier des agents modulant l'apoptose
DE10104279A1 (de) * 2001-01-31 2002-08-01 Heinz Langhals Kompetitive Prionen-Reagenzien und ihre Anwendung in Diagnostik und Therapie
US6528269B1 (en) * 1998-06-22 2003-03-04 Case Western Reserve University Immunological agents specific for prion protein (PRP)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6528269B1 (en) * 1998-06-22 2003-03-04 Case Western Reserve University Immunological agents specific for prion protein (PRP)
WO2002049662A2 (fr) * 2000-12-21 2002-06-27 Mcgill University Procede de protection des cellules contre l'apoptose et analyses visant a identifier des agents modulant l'apoptose
DE10104279A1 (de) * 2001-01-31 2002-08-01 Heinz Langhals Kompetitive Prionen-Reagenzien und ihre Anwendung in Diagnostik und Therapie

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FERAUDET,CECILE ET AL.: "Screening of 145 anti-PrP monoclonal antibodies for their capacity to inhibit PrPSc replication in infected cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 280, no. 12, 25 March 2005 (2005-03-25), pages 11247 - 11258, XP002590033, DOI: doi:10.1074/JBC.M407006200 *
LAUREN,JUHA ET AL.: "Cellular prion protein mediates impairment of synaptic plasticity by Amyloid- beta oligomers", NATURE, vol. 457, no. 7233, 26 February 2009 (2009-02-26), pages 1128 - 1132, XP009120514, DOI: doi:10.1038/nature07761 *
PERRIER,VERONIQUE ET AL.: "Anti-PrP antibodies block PrP replication in prion-infected cell cultures by accelerating PrPo degradation", J NEUROCHEM, vol. 89, no. 2, April 2004 (2004-04-01), pages 454 - 463, XP002504981, DOI: doi:10.1111/J.1471-4159.2004.02356.X *
PERRIER,VERONIQUE ET AL.: "Anti-PrP antibodies block PrPsc replication in prion-infected cell cultures by accelerating PrPC degradation", J NEUROCHEM, vol. 89, no. 2, April 2004 (2004-04-01), pages 454 - 463, XP002504981, DOI: doi:10.1111/J.1471-4159.2004.02356.X *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10266585B2 (en) 2009-08-28 2019-04-23 The Board Of Regents Of The Univerity Of Texas System Methods of treating brain injury
US20150322143A1 (en) * 2010-10-15 2015-11-12 The Board Of Regents Of The University Of Texas System Antibodies that bind amyloid oligomers
US9895429B2 (en) * 2010-10-15 2018-02-20 The Board Of Regents Of The University Of Texas System Antibodies that bind amyloid oligomers
WO2017178288A1 (fr) * 2016-04-15 2017-10-19 Medimmune Limited Anticorps anti-prp et leurs utilisations
US10808034B2 (en) 2016-04-15 2020-10-20 Medimmune Limited Anti-PrP antibodies and uses thereof
WO2020123884A1 (fr) * 2018-12-13 2020-06-18 Goetzl Edward J Exosomes dérivés de neurones et leurs biomarqueurs pour le diagnostic, le pronostic et le traitement d'un traumatisme craniocérébral et de la maladie d'alzheimer

Similar Documents

Publication Publication Date Title
AU2008334637B2 (en) Antigen binding proteins
AU2007233831B2 (en) Antibodies against amyloid-beta peptide
WO2020168554A1 (fr) Fragment fc modifié, anticorps le comprenant et son application
JP5850860B2 (ja) Ｃｄ１２７結合タンパク質
US8858943B2 (en) Antigen binding proteins
KR20110103431A (ko) 미오스타틴 결합 단백질
JP6904616B2 (ja) 緑内障治療のための配列相同性を有するファミリー、メンバーａ５抗体の用途
TW200848428A (en) Novel antibodies
WO2011038575A1 (fr) Traitement faisant appel à des anticorps inédits
JP2023535840A (ja) 抗原結合タンパク質
RU2575095C2 (ru) Гуманизированное антитело против олигомера бета-амилоида

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10819804

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10819804

Country of ref document: EP

Kind code of ref document: A1