WO2011036889A1

WO2011036889A1 - Heterocyclic compound

Info

Publication number: WO2011036889A1
Application number: PCT/JP2010/005771
Authority: WO
Inventors: 和義麻生; 倫代望月; 正太郎三浦; 稔博今枝; 昌志豊福
Original assignee: 武田薬品工業株式会社
Priority date: 2009-09-25
Filing date: 2010-09-24
Publication date: 2011-03-31

Abstract

Disclosed is a heterocyclic compound which has an effect of enhancing AMPA receptor function. Specifically disclosed is a compound represented by formula (I₀) or a salt thereof. (In the formula, R^a represents an optionally substituted C_1-6 alkyl group; X₀ represents a -CH₂- group or the like; Y₀ represents a -CR^cR^d- group or the like; R^b represents a hydrogen atom or the like; R^c and R^d may be the same or different and each represents a hydrogen atom; ring A₀ represents a thiophene ring which may have a substituent, or the like; ring D₀ represents an optionally substituted heterocyclic ring which contains, as a ring constituent atom, one heteroatom that is selected from among an oxygen atom and a nitrogen atom; and m represents 0 or 1.)

Description

Heterocyclic compounds

The present invention relates to a heterocyclic compound, in particular, a heterocyclic compound having an AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptor function enhancing action.

Glutamate is the most abundant excitatory neurotransmitter in the mammalian central nervous system. Glutamate has an important role in the regulation of cognition, mood, and motor function, and these processes become unstable in psychiatric and neurological disorders. Glutamate receptors are classified into ion channel receptors and G protein-coupled receptors, and the ion channel receptors are further α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors. N-methyl-D-aspartate (NMDA) receptor, kainic acid (KA) receptor. (Non-Patent Document 1)
The AMPA receptor is a type of receptor for the excitatory neurotransmitter glutamate and was named based on the selective activation of AMPA by AMPA. The AMPA receptor is composed of four subunits (GluR1, GluR2, GluR3, GluR4). There are homomeric receptors composed of homologous subunits and heteromeric receptors composed of heterogeneous subunits. It has been reported that the physiological properties of AMPA receptors vary depending on the subunits that comprise them. (Non-patent documents 1, 2, 3)
The importance of AMPA receptors in brain physiology is well known, and compounds having an AMPA receptor function enhancing action are expected to be useful as preventive or therapeutic agents for mental disorders, neurodegenerative diseases, memory disorders, sleep disorders, etc. ing. (Non-Patent Documents 4 and 5)

As such compounds,
Patent Document 1 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect | action represented by these is disclosed.
Patent Document 2 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 3 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 4 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 5 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 6 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 7 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 8 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 9 includes a general formula.

(R ² and X ³ may form a 5- to 7-membered ring)
The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 10 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.

However, development of a heterocyclic compound having an AMPA receptor function enhancing action is still desired.

International Publication No. 2007/107539 Pamphlet International Publication No. 2008/003452 Pamphlet International Publication No. 2008/053031 Pamphlet International Publication No. 2008/110656 Pamphlet International Publication No. 2008/113795 Pamphlet International Publication No. 2008/148836 Pamphlet International Publication No. 2008/148832 Pamphlet International Publication No. 2009/062930 Pamphlet International Publication No. 2009/147167 pamphlet International Publication No. 2009/119088 Pamphlet

The present invention relates to a heterocyclic compound having an AMPA receptor function-enhancing action (AMPA receptor function potentiator (AMPA receptor receptor potentiator); The purpose is to provide positive allosteric modulator, positive allosteric activator of AMPA receptor).

The inventors of the present invention describe a compound represented by the following formula (I) or a salt thereof (sometimes referred to herein as compound (I)) and a compound represented by the following formula (I ₀ ). Alternatively, the salt thereof (sometimes referred to as compound (I ₀ ) in the present specification) has been found to have an AMPA receptor function enhancing action, and as a result of further studies, the present invention has been completed.
Compound (I) is included within the range of compound (I ₀ ).

That is, the present invention provides the compounds, medicaments, methods, uses and the like described in the following [1] to [22].
[1]
Formula (I ₀ )

[Where:
R ^a represents a C _1-6 alkyl group which may be substituted with a halogen atom,
X ₀ represents —CH ₂ —, —O—, or —NR ^b —,
Y ₀ represents —CR ^c R ^d — or —NH—,
R ^b represents a hydrogen atom, a C _1-6 alkyl group, a C _1-6 alkyl-carbonyl group optionally substituted with a halogen atom, or a C _1-6 alkoxy-carbonyl group,
R ^c and R ^d are the same or different and each represents a hydrogen atom or a C _1-6 alkyl group,
L ₀ represents —CH (R ^e ) —W ^a —, or —W ^b —
R ^e represents a hydrogen atom or a C _1-6 alkyl group,
W ^a is
1) Joining hands,
2) -CONH-,
3) -CONHCH _2- ,
4) -NHCONHCH _2- ,
5) -NHCONH-,
6) -NHCO-,
7) -CH ₂ NHCO-,
8) -CH = CH-,
9) -C≡C-,
10) C _2-6 alkylene,
11) Phenylene,
12) Thiophenediyl,
13) 1,3,4-thiadiazolediyl,
14) 1,2,4-oxadiazoldiyl, or
15) represents 1,3,4-oxadiazoldiyl,
W ^b is
1) piperidine diyl,
2) pyrrolidine diyl, or
3) indicates azetidine diyl,
Each A ₀ ring may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring,
13) Thienopyrimidone ring,
14) pyrazolopyrimidine ring, or
15) represents an imidazopyrimidine ring,
Ring D ₀ represents an optionally substituted further heterocyclic ring containing one heteroatom selected from an oxygen atom and a nitrogen atom as a ring constituent atom;
m is 0 or 1. ]
Or a salt thereof.
[2]
Formula (I)

[Where:
R ¹ represents a methyl group which may be substituted with a halogen atom,
X represents —O— or —NR ² —;
R ² represents a hydrogen atom, a C _1-6 alkyl group, or a C _1-6 alkyl-carbonyl group which may be substituted with a halogen atom,
L represents a bond, —CONH—, or —CONHCH ₂ —
Each ring A may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring, or
13) Indicates a thienopyrimidone ring. ]
Or a salt thereof.
[3]
The compound of the above-mentioned [2], wherein X is —O—, or a salt thereof.
[4]
The compound of the above-mentioned [2], wherein L is -CONH-, or a salt thereof.
[5]
R ^a represents a methyl group substituted with a halogen atom,
R ^b represents a C _1-6 alkyl group,
W ^a is
1) Joining hands,
2) -CONH-,
3) -NHCONH-,
4) -NHCO-,
5) -CH ₂ NHCO-,
6) -CH = CH-,
7) -C≡C-,
8) C _2-6 alkylene,
9) 1,3,4-thiadiazolediyl,
10) 1,2,4-oxadiazoldiyl, or
11) represents 1,3,4-oxadiazoldiyl,
W ^b represents azetidinediyl,
A ₀ ring is
(a) a halogen atom,
(b) a C _1-6 alkyl group optionally substituted with a halogen atom or a hydroxy group,
(c) a C _1-6 alkoxy group,
(d) a C _1-6 alkoxy-carbonyl group,
(e) a pyrrolidinyl-carbonyl group, and
(f) each substituted with 1 to 3 substituents selected from carbamoyl groups,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) benzene ring,
5) imidazopyridine ring,
6) Triazolopyridine ring,
7) pyrazolopyrimidine ring, or
8) represents an imidazopyrimidine ring,
Partial structure of formula (I ₀ )

But

(In the formula, R ^X represents a hydrogen atom, a hydroxy group, or an oxo group, X ₀ and Y ₀ are as defined above, and ring D ₁ is selected from an oxygen atom and a nitrogen atom as a ring constituent atom. A heterocycle containing one heteroatom).
The compound of the said [1] which shows the part represented by these, or its salt.
[6]
R ^a represents a methyl group substituted with a halogen atom,
X ₀ represents —CH ₂ — or —O—;
Y ₀ represents —CH ₂ — or —NH—;
R ^e represents a hydrogen atom,
W ^a is
1) -CONH-,
2) 1,3,4-thiadiazolyl,
3) 1,2,4-oxadiazolyl, or
4) represents 1,3,4-oxadiazolyl,
W ^b represents azetidinediyl,
A ₀ ring is
(a) a halogen atom,
(b) a C _1-6 alkyl group which may be substituted with a halogen atom,
(c) a C _1-6 alkoxy group, and
(d) substituted with 1 to 3 substituents selected from carbamoyl groups,
1) tetrahydrobenzothiophene ring,
2) benzene ring,
3) imidazopyridine ring,
4) Triazolopyridine ring,
5) pyrazolopyrimidine ring, or
6) The compound of the above-mentioned [1], which represents an imidazopyrimidine ring, and m is 1, or a salt thereof.
[7]
2-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6,7-tetrahydro-1 -Benzothiophene-3-carboxamide or a salt thereof.
[8]
N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6 -Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide, or a salt thereof.
[9]
1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazol-5-yl} methyl)- 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
[10]
1- {1- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl} -3- (trifluoro Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
[11]
3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazol-5-yl } Methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridine, or a salt thereof.
[12]
1-({3- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -1,2,4-oxadiazole- 5-yl} methyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
[13]
A prodrug of the compound of the above-mentioned [1] or a salt thereof.
[14]
The pharmaceutical containing the compound of the said [1] or its salt, or its prodrug.
[15]
The medicament according to the above [14], which is an AMPA receptor function enhancer.
[16]
The medicament according to [14] above, which is a prophylactic or therapeutic drug for depression, schizophrenia, or attention deficit hyperactivity disorder.
[17]
A method for enhancing AMPA receptor function, comprising administering an effective amount of the compound according to [1] above or a salt thereof, or a prodrug thereof to a mammal.
[18]
A method for preventing or treating depression, schizophrenia, or attention deficit / hyperactivity disorder, which comprises administering an effective amount of the compound or salt thereof, or prodrug thereof according to [1] to a mammal. Method.
[19]
Use of the compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof for producing an AMPA receptor function potentiator.
[20]
Use of the compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder.
[21]
The compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof, for use in enhancing AMPA receptor function.
[22]
The compound or a salt thereof, or a prodrug thereof according to the above [1] for the prevention or treatment of depression, schizophrenia, or attention deficit hyperactivity disorder.

The present invention also provides the compounds, medicaments, methods, uses and the like described in [1 ′] to [11 ′] below.
[1 ']
Formula (I)

[Where:
R ¹ represents a methyl group which may be substituted with a halogen atom,
X represents —O— or —NR ² —;
R ² represents a hydrogen atom, a C _1-6 alkyl group, or a C _1-6 alkyl-carbonyl group which may be substituted with a halogen atom,
L represents a bond, —CONH—, or —CONHCH ₂ —
Each ring A may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring, or
13) Indicates a thienopyrimidone ring. ']
Or a salt thereof.
[2 ']
The compound according to [1 ′] above, wherein X is —O—.
[3 ']
The compound according to [1 ′] above, wherein L is —CONH—.
[4 ']
A prodrug of the compound according to [1 ′] above.
[5 ']
The pharmaceutical containing the compound as described in said [1 '], or its prodrug.
[6 ']
The medicament according to [5 ′] above, which is an AMPA receptor function enhancer.
[7 ']
The medicament according to [5 ′] above, which is a prophylactic or therapeutic drug for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).
[8 ']
A method for enhancing AMPA receptor function, comprising administering an effective amount of the compound or prodrug thereof according to [1 ′] to a mammal.
[9 ']
A method for preventing or treating depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), comprising administering an effective amount of the compound or prodrug thereof according to [1 '] to a mammal Method.
[10 ']
Use of the compound according to the above [1 ′] or a prodrug thereof for producing an AMPA receptor function potentiator.
[11 ']
Use of the compound according to the above [1 ′] or a prodrug thereof for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).

According to the present invention, there is provided a compound having an AMPA receptor function enhancing action and useful as a preventive or therapeutic agent for depression, schizophrenia, attention deficit hyperactivity disorder (ADHD) and the like.

In this specification, the hydrogen atom in the chemical structural formula may be omitted in accordance with the custom in the chemical field.

In the present specification, examples of the “halogen atom” include a fluorine atom, a chlorine atom, a bromine atom and an iodine atom.
In the present specification, unless otherwise specified, the “optionally halogenated” or “halogeno” may include one or more (eg, 1 to 3) halogen atoms as a substituent. Means good.

In the present specification, unless otherwise specified, examples of the “alkyl (group)” include C _1-6 alkyl (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkyl (group)” include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, Neopentyl and hexyl are mentioned.
In the present specification, unless otherwise specified, examples of the “C _1-6 alkyl (group)” include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, neopentyl, And hexyl.
In the present specification, unless otherwise specified, the “optionally halogenated C _1-6 alkyl (group)” means a C _1-6 alkyl (group) _optionally substituted with a halogen atom. Specific examples thereof include trifluoromethyl.

In the present specification, unless otherwise specified, examples of the “alkenyl (group)” include C _2-6 alkenyl (group).
In the present specification, unless otherwise specified, examples of the “C _2-6 alkenyl (group)” include vinyl, 1-propen-1-yl, 2-propen-1-yl, isopropenyl, 2-butene. 1-yl, 4-penten-1-yl, and 5-hexen-1-yl.

In the present specification, unless otherwise specified, examples of the “alkynyl (group)” include a C _2-6 alkynyl group. Examples of “C _2-6 alkynyl (group)” include ethynyl, 1-propyn-1-yl, 2-propyn-1-yl, 4-pentyn-1-yl, and 5-hexyn-1-yl. Is mentioned.
In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkyl-C _2-6 alkynyl (group)” include cypropyl ethynyl.

In the present specification, unless otherwise specified, as the “non-aromatic cyclic hydrocarbon group”, for example, each may be condensed with one or more (preferably one or two) hydrocarbon rings. C _3-7 cycloalkyl (group), C _3-7 cycloalkenyl (group), and C _4-10 cycloalkadienyl (group).
Examples of the “hydrocarbon ring” include the “non-aromatic hydrocarbon ring” and the “aromatic hydrocarbon ring”.

Unless otherwise specified, in this specification, examples of the “C _3-7 cycloalkyl (group)” include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.
In the present specification, unless otherwise specified, examples of the “C _3-6 cycloalkyl (group)” include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkenyl (group)” include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, and cycloheptenyl.

Unless otherwise specified, in this specification, examples of the “C _4-10 cycloalkadienyl (group)” include cyclobutadienyl, cyclopentadienyl, cyclohexadienyl, cycloheptadienyl, cycloocta Dienyl, cyclononadienyl, and cyclodecadienyl are included.

In the present specification, unless otherwise specified, the “aromatic cyclic hydrocarbon group” may be monocyclic, bicyclic, or tricyclic.
In the present specification, unless otherwise specified, examples of the “aromatic cyclic hydrocarbon group” include C _6-14 aryl (group).
In this specification, unless otherwise specified, examples of the “C _6-14 aryl (group)” include phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, and 2 -Anthril.

In the present specification, unless otherwise specified, examples of the “C _7-16 aralkyl (group)” include benzyl, phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, Examples include 3-phenylpropyl, 4-phenylbutyl, 5-phenylpentyl, 2-biphenylylmethyl, 3-biphenylylmethyl, and 4-biphenylylmethyl.

In the present specification, unless otherwise specified, examples of the “C _6-14 aryl-C _2-6 alkenyl (group)” include styryl.

In this specification, unless otherwise specified, examples of the “C _1-7 alkylene (group)” (ie, C _1-6 alkanediyl group) include, for example, methylene, ethylene, trimethylene, tetramethylene, 2-butenylene, Examples include 2-methyltetramethylene, pentamethylene, and hexamethylene.
Unless otherwise specified, in this specification, examples of the “C _2-7 alkylene (group)” include an alkylene (group) having 2 to 7 carbon atoms in the “C _1-7 alkylene (group)”. Examples of the “C _1-3 alkylene (group)” include alkylene (group) having 1 to 3 carbon atoms in the “C _1-7 alkylene (group)”.
Unless otherwise specified, in this specification, examples of the “C _2-6 alkenylene (group)” include —CH═CH—, —CH═C (CH ₃ ) —, —C (CH ₃ ) ═CH. —, —CH═CH—CH ₂ —, —CH ₂ —CH═CH—, —C (CH ₃ ) ₂ —CH═CH—, —CH ₂ —CH═CH—CH ₂ —, —CH ₂ —CH ₂ —CH═CH—, —CH═CH—CH═CH—, —CH═CH—CH ₂ —CH ₂ —CH ₂ —, —CH═C (C ₂ H ₅ ) —).
Unless otherwise specified, in this specification, examples of the “C _2-3 alkenylene (group)” include, for example, the alkenylene (group) having 2 to 3 carbon atoms in the “C _1-6 alkenylene (group)”. Is mentioned.
Unless otherwise specified, in this specification, examples of the “C _2-6 alkynylene (group)” include —C≡C—, —CH ₂ —C≡C—, —CH ₂ —C≡C—CH. (CH ₃ ) —, —CH ₂ —C≡C—CH ₂ —CH ₂ —.

In the present specification, unless otherwise specified, the “heterocyclic group” (and the heterocyclic moiety in the substituent) is a non-aromatic heterocyclic group or an aromatic heterocyclic group (ie, a heteroaryl group). .
In the present specification, unless otherwise specified, the “heterocyclic group” may be monocyclic, bicyclic, or tricyclic.
In the present specification, unless otherwise specified, the “heterocyclic group” means, for example, a 3 to 14-membered heterocyclic group containing 1 to 4 heteroatoms selected from an oxygen atom, a sulfur atom and a nitrogen atom. is there.

In the present specification, unless otherwise specified, the “non-aromatic heterocyclic group” may be saturated or unsaturated.
In the present specification, unless otherwise specified, examples of the “non-aromatic heterocyclic group” include a 3 to 14-membered non-aromatic heterocyclic group.
In the present specification, unless otherwise specified, the “3- to 14-membered non-aromatic heterocyclic group” is selected from, for example, an oxygen atom, a sulfur atom and a nitrogen atom which may be condensed with a 5- or 6-membered ring. 3 to 6-membered non-aromatic heterocyclic group containing 1 to 4 heteroatoms.
Unless otherwise specified, in this specification, examples of the “3- to 6-membered non-aromatic heterocyclic group containing 1 to 4 heteroatoms selected from an oxygen atom, a sulfur atom and a nitrogen atom” include tetrahydrofuryl , Oxazolidinyl, imidazolinyl (eg, 1-imidazolinyl, 2-imidazolinyl, 4-imidazolinyl), aziridinyl (eg, 1-aziridinyl, 2-aziridinyl), azetidinyl (eg, 1-azetidinyl, 2-azetidinyl), pyrrolidinyl (eg, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl), piperidinyl (eg, 1-piperidinyl, 2-piperidinyl, 3-piperidinyl), azepanyl (eg, 1-azepanyl, 2-azepanyl, 3-azepanyl, 4-azepanyl) Azocanyl (eg 1-azocanyl, 2-azocanyl, 3-azo Canyl, 4-azocanyl), piperazinyl (eg, 1,4-piperazin-1-yl, 1,4-piperazin-2-yl), diazepinyl (eg, 1,4-diazepin-1-yl, 1,4- Diazepin-2-yl, 1,4-diazepin-5-yl, 1,4-diazepin-6-yl), diazocanyl (eg, 1,4-diazocan-1-yl, 1,4-diazocan-2-yl) 1,4-diazocan-5-yl, 1,4-diazocan-6-yl, 1,5-diazocan-1-yl, 1,5-diazocan-2-yl, 1,5-diazocan-3-yl ), Tetrahydropyranyl (eg, tetrahydropyran-4-yl), morpholinyl (eg, 4-morpholinyl), thiomorpholinyl (eg, 4-thiomorpholinyl), 2-oxazolidinyl, dihydrofuryl, dihydro Ranil, and dihydroquinolyl, and 2,3-dihydro -1H- imidazo [1,2-a] imidazol-1-yl.
In the present specification, unless otherwise specified, examples of the “5- or 6-membered ring” include a hydrocarbon ring having 5 or 6 carbon atoms (eg, cyclopentane, cyclohexane, cyclopentene, cyclohexene, cyclopentadiene, cyclohexadiene, Benzene) and 5- or 6-membered heterocycles.
In the present specification, unless otherwise specified, examples of the “5- or 6-membered heterocycle” include 5- or 6-membered “heterocycle”.
In the present specification, unless otherwise specified, “a 3- to 6-membered non-aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from an oxygen atom, a sulfur atom and a nitrogen atom fused with a 5- or 6-membered ring” Examples of the “group” include 2,3-dihydro-1H-imidazo [1,2-a] benzoimidazol-1-yl.

In the present specification, unless otherwise specified, examples of the “aromatic heterocyclic group” include a 5- or 6-membered monocyclic aromatic heterocyclic group and a 5- to 10-membered aromatic condensed heterocyclic group. Can be mentioned.

In the present specification, unless otherwise specified, examples of the “5- or 6-membered monocyclic aromatic heterocyclic group” include pyrrolyl (eg, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl), furyl ( Examples, 2-furyl, 3-furyl), thienyl (eg, 2-thienyl, 3-thienyl), pyrazolyl (eg, 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl), imidazolyl (eg, 1-imidazolyl, 2 -Imidazolyl, 4-imidazolyl), isoxazolyl (eg, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl), oxazolyl (eg, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl), isothiazolyl (eg, 3-isothiazolyl, 4-isothiazolyl, 5-isothiazolyl), thiazolyl (eg, 2-thiazolyl, 4-thiazolyl, 5 Thiazolyl), triazolyl (eg, 1,2,3-triazol-4-yl, 1,2,4-triazol-3-yl), oxadiazolyl (eg, 1,2,4-oxadiazol-3-yl), 1,2,4-oxadiazol-5-yl), thiadiazolyl (eg, 1,2,4-thiadiazol-3-yl, 1,2,4-thiadiazol-5-yl), tetrazolyl, pyridyl (eg, Oxygen atoms such as 2-pyridyl, 3-pyridyl, 4-pyridyl), pyridazinyl (eg, 3-pyridazinyl, 4-pyridazinyl), pyrimidinyl (eg, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl), and pyrazinyl And a 5- or 6-membered monocyclic aromatic heterocyclic group containing 1 to 4 heteroatoms selected from a sulfur atom and a nitrogen atom.

Unless otherwise specified, in this specification, examples of the “5- to 10-membered aromatic condensed heterocyclic group” include isoindolyl (eg, 1-isoindolyl, 2-isoindolyl, 3-isoindolyl, 4-isoindolyl, 5 -Isoindolyl, 6-isoindolyl, 7-isoindolyl), indolyl (eg, 1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), benzo [b] furanyl (Eg, 2-benzo [b] furanyl, 3-benzo [b] furanyl, 4-benzo [b] furanyl, 5-benzo [b] furanyl, 6-benzo [b] furanyl, 7-benzo [b] furanyl ), Benzo [c] furanyl (eg, 1-benzo [c] furanyl, 4-benzo [c] furanyl, 5-benzo [c] furanyl) Benzo [b] thienyl (eg, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 4-benzo [b] thienyl, 5-benzo [b] thienyl, 6-benzo [b] thienyl, 7 -Benzo [b] thienyl), benzo [c] thienyl (eg 1-benzo [c] thienyl, 4-benzo [c] thienyl, 5-benzo [c] thienyl), indazolyl (eg 1-indazolyl, 2 -Indazolyl, 3-indazolyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (eg, 1-benzoimidazolyl, 2-benzimidazolyl, 4-benzoimidazolyl, 5-benzimidazolyl), 1,2-benzo Isoxazolyl (eg, 1,2-benzisoxazol-3-yl, 1,2-benzisoxazol Lu-4-yl, 1,2-benzisoxazol-5-yl, 1,2-benzisoxazol-6-yl, 1,2-benzisoxazol-7-yl), benzoxazolyl (eg, 2-benzoxazolyl, 4-benzoxazolyl, 5-benzoxazolyl, 6-benzoxazolyl, 7-benzoxazolyl), 1,2-benzisothiazolyl (eg, 1,2 -Benzoisothiazol-3-yl, 1,2-benzisothiazol-4-yl, 1,2-benzisothiazol-5-yl, 1,2-benzisothiazol-6-yl, 1,2-benzo Isothiazol-7-yl), benzothiazolyl (eg, 2-benzothiazolyl, 4-benzothiazolyl, 5-benzothiazolyl, 6-benzothiazolyl, 7-benzothiazolyl), isoquino Ryl (eg, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl), quinolyl (eg, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl), cinnolinyl (eg, 3-cinnolinyl, 4-cinnolinyl, 5-cinnolinyl, 6-cinnolinyl, 7-cinnolinyl, 8-cinnolinyl), phthalazinyl (eg, 1-phthalazinyl, 4-phthalazinyl, 5-phthalazinyl, 6-phthalazinyl, 7-phthalazinyl, 8 -Phthalazinyl), quinazolinyl (eg, 2-quinazolinyl, 4-quinazolinyl, 5-quinazolinyl, 6-quinazolinyl, 7-quinazolinyl, 8-quinazolinyl), quinoxalinyl (eg, 2-quinoxalinyl, 3-quinoxalinyl, 5-quinoxalinyl, 6 -Quinoxalinyl, 7-Quinoxa Nyl, 8-quinoxalinyl), pyrazolo [1,5-a] pyridyl (eg, pyrazolo [1,5-a] pyridin-2-yl, pyrazolo [1,5-a] pyridin-3-yl, pyrazolo [1] , 5-a] pyridin-4-yl, pyrazolo [1,5-a] pyridin-5-yl, pyrazolo [1,5-a] pyridin-6-yl, pyrazolo [1,5-a] pyridine-7 -Yl), imidazo [1,2-a] pyridyl (eg, imidazo [1,2-a] pyridin-2-yl, imidazo [1,2-a] pyridin-3-yl, imidazo [1,2- a] Pyridin-5-yl, imidazo [1,2-a] pyridin-6-yl, imidazo [1,2-a] pyridin-7-yl, and imidazo [1,2-a] pyridin-8-yl ) Etc. selected from oxygen, sulfur and nitrogen atoms Aromatic 5-10 membered containing one to four B atoms condensed heterocyclic group.

In the present specification, unless otherwise specified, examples of the “alkoxy (group)” include C _1-6 alkoxy (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkoxy (group)” include methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy, Neopentyloxy and hexyloxy are mentioned.

Unless otherwise specified, in this specification, examples of the “C _3-7 cycloalkyloxy (group)” include cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, and cyclohexyloxy.

Unless otherwise specified, in this specification, examples of the “C _6-14 aryloxy (group)” include phenyloxy, 1-naphthyloxy, and 2-naphthyloxy.

In the present specification, unless otherwise specified, examples of the “C _7-16 aralkyloxy (group)” include benzyloxy and phenethyloxy.

In the present specification, unless otherwise specified, examples of the “alkyl-carbonyloxy (group)” include C _1-6 alkyl-carbonyloxy (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkyl-carbonyloxy (group)” include acetoxy and propionyloxy.

In the present specification, unless otherwise specified, examples of the “alkoxy-carbonyloxy (group)” include C _1-6 alkoxy-carbonyloxy (group).
In the present specification, examples of the “C _1-6 alkoxy-carbonyl (group)” include methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, and tert-butoxycarbonyl.

In the present specification, unless otherwise specified, examples of the “mono-alkyl-carbamoyloxy (group)” include mono-C _1-6 alkyl-carbamoyloxy (group).
In the present specification, unless otherwise specified, examples of the “mono-C _1-6 alkyl-carbamoyloxy (group)” include methylcarbamoyloxy and ethylcarbamoyloxy.

In the present specification, unless otherwise specified, examples of the “di-alkyl-carbamoyloxy (group)” include di-C _1-6 alkyl-carbamoyloxy (group).
In the present specification, unless otherwise specified, examples of the “di-C _1-6 alkyl-carbamoyloxy (group)” include dimethylcarbamoyloxy and diethylcarbamoyloxy.

In the present specification, unless otherwise specified, examples of the “C _6-14 aryl-carbonyloxy (group)” include benzoyloxy and naphthylcarbonyloxy.

In the present specification, unless otherwise specified, examples of the “mono- or di-C _6-14 aryl-carbamoyloxy (group)” include phenylcarbamoyloxy and naphthylcarbamoyloxy.

In this specification, unless otherwise specified, examples of the heterocyclic moiety of “heterocyclic-oxy (group)” include those similar to the above-mentioned “heterocyclic group”. As the “heterocycle-oxy (group)”, specifically, for example, a 3 to 14-membered heterocycle-oxy (group) having 1 to 5 heteroatoms selected from a nitrogen atom, a sulfur atom, and an oxygen atom Is mentioned.

In the present specification, unless otherwise specified, examples of the aromatic heterocyclic moiety of “aromatic heterocyclic-oxy (group)” include “aromatic heterocyclic group” as an example of the above-mentioned “heterocyclic group”. And the like. As the “aromatic heterocycle-oxy (group)”, specifically, for example, a 5- to 14-membered aromatic heterocycle having 1 to 5 heteroatoms selected from a nitrogen atom, a sulfur atom, and an oxygen atom— An oxy (group) is mentioned.

In the present specification, unless otherwise specified, examples of the “C _1-6 alkylsulfonyloxy group” include methylsulfonyloxy and ethylsulfonyloxy.

In the present specification, unless otherwise specified, examples of the “halogeno C _1-6 alkylsulfonyloxy group” include halogenomethylsulfonyloxy and halogenoethylsulfonyloxy.

Unless otherwise specified, in this specification, examples of the “alkylsulfanyl (group)” include C _1-6 alkylsulfanyl (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkylsulfanyl (group)” include methylsulfanyl, ethylsulfanyl, propylsulfanyl, isopropylsulfanyl, butylsulfanyl, sec-butylsulfanyl, and tert- Butylsulfanyl is mentioned.

In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkylsulfanyl (group)” include cyclopropylsulfanyl, cyclobutylsulfanyl, cyclopentylsulfanyl, and cyclohexylsulfanyl.

In the present specification, unless otherwise specified, examples of the “C _6-14 arylsulfanyl (group)” include phenylsulfanyl, 1-naphthylsulfanyl, and 2-naphthylsulfanyl.

In the present specification, unless otherwise specified, examples of the “C _7-16 aralkylsulfanyl (group)” include benzylsulfanyl and phenethylsulfanyl.

Unless otherwise specified, in this specification, examples of the heterocyclic moiety of “heterocycle-sulfanyl (group)” include those similar to the aforementioned “heterocyclic group”. As the “heterocycle-sulfanyl (group)”, specifically, for example, a 3 to 14-membered heterocycle-sulfanyl (group) having 1 to 5 heteroatoms selected from a nitrogen atom, a sulfur atom, and an oxygen atom Is mentioned.

In the present specification, unless otherwise specified, examples of the “alkyl-carbonyl (group)” include C _1-6 alkyl-carbonyl.
In the present specification, unless otherwise specified, examples of the “C _1-6 alkyl-carbonyl (group)” include acetyl, propionyl, and pivaloyl.

In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkyl-carbonyl (group)” include cyclopropylcarbonyl, cyclopentylcarbonyl, and cyclohexylcarbonyl.

Unless otherwise specified, in this specification, examples of the “C _6-14 aryl-carbonyl (group)” include benzoyl, 1-naphthoyl, and 2-naphthoyl.

In the present specification, unless otherwise specified, examples of the “C _7-16 aralkyl-carbonyl (group)” include phenylacetyl and 3-phenylpropionyl.

Unless otherwise specified, in this specification, examples of the heterocyclic moiety of “heterocycle-carbonyl (group)” include those similar to the above-mentioned “heterocyclic group”. Specific examples include a 3 to 14-membered heterocyclic-carbonyl (group) having 1 to 5 heteroatoms selected from a nitrogen atom, a sulfur atom, and an oxygen atom, and more specifically, for example, Picolinoyl, nicotinoyl, isonicotinoyl, 2-thenoyl, 3-thenoyl, 2-furoyl, 3-furoyl, 1-morpholinylcarbonyl, 4-thiomorpholinylcarbonyl, aziridin-1-ylcarbonyl, aziridin-2-ylcarbonyl Azetidin-1-ylcarbonyl, azetidin-2-ylcarbonyl, pyrrolidin-1-ylcarbonyl, pyrrolidin-2-ylcarbonyl, pyrrolidin-3-ylcarbonyl, piperidin-1-ylcarbonyl, piperidin-2-ylcarbonyl, Piperidin-3-ylcarbonyl, azepan-1-ylcarboni Azepan-2-ylcarbonyl, azepan-3-ylcarbonyl, azepan-4-ylcarbonyl, azocan-1-ylcarbonyl, azocan-2-ylcarbonyl, azocan-3-ylcarbonyl, azocan-4-ylcarbonyl, 1,4-piperazin-1-ylcarbonyl, 1,4-piperazin-2-ylcarbonyl, 1,4-diazepan-1-ylcarbonyl, 1,4-diazepan-2-ylcarbonyl, 1,4-diazepan 5-ylcarbonyl, 1,4-diazepan-6-ylcarbonyl, 1,4-diazocan-1-ylcarbonyl, 1,4-diazocan-2-ylcarbonyl, 1,4-diazocan-5-ylcarbonyl, 1 , 4-diazocan-6-ylcarbonyl, 1,5-diazocan-1-ylcarbonyl, 1,5-dia Kang-2-ylcarbonyl, and 1,5-diazocan-3-ylcarbonyl and the like.

In the present specification, unless otherwise specified, examples of the “optionally esterified carboxy (group)” include carboxy, optionally substituted alkoxy-carbonyl, and optionally substituted C _{6- 14} aryloxy-carbonyl, optionally substituted C _7-16 aralkyloxy-carbonyl, optionally substituted silyloxy-carbonyl (eg, TMS-O—CO—, TES—O—CO—, TBS—O) -CO-, TIPS-O-CO-, TBDPS-O-CO-) and the like.

In the present specification, unless otherwise specified, examples of the “alkoxy-carbonyl (group)” include “C _1-6 alkoxy-carbonyl (group)”.
In the present specification, unless otherwise specified, examples of the “C _1-6 alkoxy-carbonyl (group)” include methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, and tert-butoxycarbonyl.

In the present specification, unless otherwise specified, examples of the “C _6-14 aryloxy-carbonyl (group)” include phenoxycarbonyl.
In the present specification, unless otherwise specified, examples of the “C _7-16 aralkyloxy-carbonyl (group)” include benzyloxycarbonyl and phenethyloxycarbonyl.

In the present specification, unless otherwise specified, examples of the “alkylsulfonyl (group)” include C _1-6 alkylsulfonyl (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkylsulfonyl (group)” include methylsulfonyl and ethylsulfonyl.

Unless otherwise specified, in this specification, examples of the “C _3-7 cycloalkylsulfonyl (group)” include cyclopropylsulfonyl, cyclobutylsulfonyl, cyclopentylsulfonyl, and cyclohexylsulfonyl.

In the present specification, unless otherwise specified, examples of the “C _6-14 arylsulfonyl (group)” include phenylsulfonyl, 1-naphthylsulfonyl, and 2-naphthylsulfonyl.

Unless otherwise specified, in this specification, examples of the heterocyclic moiety of “heterocycle-sulfonyl (group)” include those similar to the above-mentioned “heterocyclic group”. Specific examples of the “heterocycle-sulfonyl (group)” include, for example, a 3 to 14-membered heterocycle-sulfonyl (group) having 1 to 5 heteroatoms selected from a nitrogen atom, a sulfur atom, and an oxygen atom. Is mentioned.

In the present specification, unless otherwise specified, examples of the “alkylsulfinyl (group)” include C _1-6 alkylsulfinyl (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkylsulfinyl (group)” include methylsulfinyl and ethylsulfinyl.

In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkylsulfinyl (group)” include cyclopropylsulfinyl, cyclobutylsulfinyl, cyclopentylsulfinyl, and cyclohexylsulfinyl.

In the present specification, unless otherwise specified, examples of the “C _6-14 arylsulfinyl (group)” include phenylsulfinyl, 1-naphthylsulfinyl, and 2-naphthylsulfinyl.

Unless otherwise specified, in this specification, examples of the heterocyclic moiety of “heterocyclic-sulfinyl (group)” include those similar to the above-mentioned “heterocyclic group”. As the “heterocycle-sulfinyl (group)”, specifically, for example, a 3 to 14-membered heterocycle-sulfinyl (group) having 1 to 5 heteroatoms selected from a nitrogen atom, a sulfur atom, and an oxygen atom Is mentioned.

In the present specification, unless otherwise specified, examples of the “alkyl-carbamoyl (group)” include mono- or di-C _1-6 alkyl-carbamoyl (group).
In the present specification, unless otherwise specified, examples of the “mono- or di-C _1-6 alkyl-carbamoyl (group)” include methylcarbamoyl, dimethylcarbamoyl, ethylcarbamoyl, and propylcarbamoyl.

In the present specification, unless otherwise specified, examples of the “mono- or di-alkylamino (group)” include mono- or di-C _1-6 alkylamino (group).
In the present specification, unless otherwise specified, examples of the “mono- or di-C _1-6 alkylamino (group)” include methylamino, ethylamino, propylamino, dimethylamino, and diethylamino. .

Unless otherwise specified, in this specification, examples of the “alkyl-carbonylamino (group)” include C _1-6 alkyl-carbonylamino.
In the present specification, unless otherwise specified, examples of the “C _1-6 alkyl-carbonylamino (group)” include acetylamino, propionylamino, and pivaloylamino.

In the present specification, unless otherwise specified, as the “heterocycle (group)” of the “heterocycle-amino (group)”, for example, those similar to the “heterocycle group” described above are used. Examples of “ring-amino (group)” include 2-pyridyl-amino.

In the present specification, unless otherwise specified, as the “heterocycle-carbonyl” of the “heterocycle-carbonylamino (group)”, for example, those similar to the above-mentioned “heterocycle-carbonyl” are used. Examples of the “heterocycle-carbonylamino (group)” include pyridyl-carbonylamino.

In the present specification, unless otherwise specified, as the “heterocycle (group)” of the “heterocycle-oxycarbonylamino (group)”, for example, those similar to the above-mentioned “heterocycle group” are used, Examples of the “heterocycle-oxycarbonylamino (group)” include 2-pyridyl-oxycarbonylamino.

In the present specification, unless otherwise specified, as the “heterocycle (group)” of the “heterocycle-sulfonylamino (group)”, for example, the same “heterocycle group” as described above can be used. Examples of the “heterocycle-sulfonylamino (group)” include 2-pyridyl-sulfonylamino.

In the present specification, unless otherwise specified, examples of the “alkoxy-carbonylamino (group)” include C _1-6 alkoxy-carbonylamino (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkoxy-carbonylamino (group)” include methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino, and butoxycarbonylamino.

In the present specification, unless otherwise specified, examples of the “alkylsulfonylamino (group)” include C _1-6 alkylsulfonylamino (group).
In the present specification, unless otherwise specified, examples of the “C _1-6 alkylsulfonylamino (group)” include methylsulfonylamino and ethylsulfonylamino.

In the present specification, unless otherwise specified, examples of the “mono- or di-C _3-7 cycloalkylamino (group)” include cyclopropylamino, cyclopentylamino, and cyclohexylamino.

In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkyl-carbonylamino (group)” include cyclopropylcarbonylamino, cyclopentylcarbonylamino, and cyclohexylcarbonylamino.

In the present specification, unless otherwise specified, examples of the “C _3-7 cycloalkyloxy-carbonylamino (group)” include cyclopropoxycarbonylamino, cyclopentyloxycarbonylamino, and cyclohexyloxycarbonylamino.

Unless otherwise specified, in this specification, examples of the “C _3-7 cycloalkylsulfonylamino (group)” include cyclopropylsulfonylamino, cyclopentylsulfonylamino, and cyclohexylsulfonylamino.

In the present specification, unless otherwise specified, examples of the “mono- or di-C _6-14 arylamino (group)” include phenylamino and diphenylamino.

In the present specification, unless otherwise specified, examples of the “mono- or di-C _7-16 aralkylamino (group)” include benzylamino.

In the present specification, unless otherwise specified, examples of the “C _6-14 aryl-carbonylamino (group)” include benzoylamino and naphthoylamino.

Unless otherwise specified, in this specification, examples of the “C _6-14 arylsulfonylamino (group)” include phenylsulfonylamino, 2-naphthylsulfonylamino, and 1-naphthylsulfonylamino.

[Substituent group A]
In the present specification, the substituent group A comprises the following substituents (1) to (52).

(1) halogen atom (2) nitro group (3) cyano group (4) optionally esterified carboxy group (5) optionally substituted alkyl group (6) optionally substituted alkenyl group ( 7) An optionally substituted alkynyl group (eg, an optionally substituted C _3-7 cycloalkyl-C _2-6 alkynyl group)
(8) an optionally substituted C _3-7 cycloalkyl group (9) an _optionally substituted C _6-14 aryl group (10) an _optionally substituted C _7-16 aralkyl group (11) substituted An _optionally substituted C _6-14 aryl-C _2-6 alkenyl group (12) an optionally substituted heterocyclic group

(13) hydroxy group (14) optionally substituted alkoxy group (15) optionally substituted C _3-7 cycloalkyloxy group (16) optionally substituted C _6-14 aryloxy group ( 17) optionally substituted C _7-16 aralkyloxy group (18) optionally substituted alkyl-carbonyloxy group (19) optionally substituted alkoxy-carbonyloxy group (20) substituted Mono-alkyl-carbamoyloxy group (21) optionally substituted di-alkyl-carbamoyloxy group (22) optionally substituted C _6-14 aryl-carbonyloxy group (23) substituted which may mono - or di -C _6-14 aryl - carbamoyloxy group (24) heterocyclic ring which may be substituted - oxy (Eg, optionally substituted aromatic heterocyclic - group)
(25) an optionally substituted C _1-6 alkylsulfonyloxy group (eg, an optionally substituted halogeno C _1-6 alkylsulfonyloxy group),

(26) a sulfanyl (mercapto) group (27) an optionally substituted alkylsulfanyl group (28) an optionally substituted C _3-7 cycloalkylsulfanyl group (29) an optionally substituted C _6-14 Arylsulfanyl group (30) optionally substituted C _7-16 aralkylsulfanyl group (31) optionally substituted heterocyclic-sulfanyl group

(32) a formyl group (33) an optionally substituted alkyl-carbonyl group (34) an optionally substituted C _3-7 cycloalkyl-carbonyl group (35) an optionally substituted C _6-14 aryl A carbonyl group (36) an optionally substituted C _7-16 aralkyl-carbonyl group (37) an _optionally substituted heterocycle-carbonyl group

(38) an optionally substituted alkylsulfonyl group (39) an optionally substituted C _3-7 cycloalkylsulfonyl group (40) an optionally substituted C _6-14 arylsulfonyl group (41) Optionally substituted heterocyclic-sulfonyl group (42) optionally substituted alkylsulfinyl group (43) optionally substituted C _3-7 cycloalkylsulfinyl group (44) optionally substituted C _{6- 14} arylsulfinyl group (45) optionally substituted heterocyclic-sulfinyl group (46) sulfo group

(47) sulfamoyl group (48) sulfinamoyl group (49) sulfamoamoyl group (50) thiocarbamoyl group (51) optionally substituted carbamoyl group [eg, optionally substituted alkyl-carbamoyl etc.]

(52) an optionally substituted amino group [eg,
amino,
An optionally substituted mono- or di-alkylamino group,
An optionally substituted mono- or di-C _3-7 cycloalkylamino group,
An optionally substituted mono- or di-C _6-14 arylamino group,
An optionally substituted mono- or di-C _7-16 aralkylamino group,
Optionally substituted heterocycle-amino group,
An optionally substituted C _6-14 aryl-carbonylamino group,
Formylamino group,
Optionally substituted alkyl - carbonyl amino group (e.g., mono - (C _1-6 alkyl - carbonyl) - amino group),
An optionally substituted C _3-7 cycloalkyl-carbonylamino group,
Optionally substituted heterocycle-carbonylamino group,
An optionally substituted alkoxy-carbonylamino group,
Optionally substituted C _3-7 cycloalkyloxy-carbonylamino group,
Optionally substituted heterocycle-oxycarbonylamino group,
An optionally substituted carbamoylamino group,
An optionally substituted alkylsulfonylamino group,
An optionally substituted C _3-7 cycloalkylsulfonylamino group,
Optionally substituted heterocycle-sulfonylamino group,
C _6-14 arylsulfonylamino group which may be substituted]

In the substituent group A,
“Optionally substituted alkoxy-carbonyl group”,
"Optionally substituted alkyl group",
“Optionally substituted alkenyl group”,
“Optionally substituted alkynyl group”,
“Optionally substituted alkoxy group”,
“Optionally substituted alkyl-carbonyloxy group”,
“Optionally substituted alkoxy-carbonyloxy group”,
“Optionally substituted mono-alkyl-carbamoyloxy group”,
“Optionally substituted di-alkyl-carbamoyloxy group”,
"Optionally substituted alkylsulfanyl group",
“Optionally substituted alkyl-carbonyl group”,
"Optionally substituted alkylsulfonyl group",
"Optionally substituted alkylsulfinyl group",
“Optionally substituted alkyl-carbamoyl group”,
“Optionally substituted mono- or di-alkylamino group”,
“Optionally substituted alkyl-carbonylamino group”,
“Optionally substituted mono- (C _1-6 alkyl-carbonyl) -amino group”,
Examples of each substituent of “optionally substituted alkoxy-carbonylamino group” and “optionally substituted alkylsulfonylamino group” include substituents selected from the following substituent group B: It is done. The number of the substituents is 1 to the maximum number that can be substituted, more preferably 1 to 3, and even more preferably 1.

In the substituent group A,
“Optionally substituted C _6-14 aryloxy-carbonyl group”,
“Optionally substituted C _7-16 aralkyloxy-carbonyl group”,
“Optionally substituted C _3-7 cycloalkyl-C _2-6 alkynyl group”,
“C _3-7 cycloalkyl group which may be substituted”,
“Optionally substituted C _6-14 aryl group”,
“Optionally substituted C _7-16 aralkyl group”,
“Optionally substituted C _6-14 aryl-C _2-6 alkenyl group”,
"Optionally substituted heterocyclic group",
“Optionally substituted C _3-7 cycloalkyloxy group”,
“Optionally substituted C _6-14 aryloxy group”,
“Optionally substituted C _7-16 aralkyloxy group”,
“Optionally substituted C _6-14 aryl-carbonyloxy group”,
“Optionally substituted mono- or di-C _6-14 aryl-carbamoyloxy group”,
“Optionally substituted heterocycle-oxy group”,
“Optionally substituted aromatic heterocycle-oxy group”,
“Optionally substituted C _3-7 cycloalkylsulfanyl group”,
“Optionally substituted C _6-14 arylsulfanyl group”,
“Optionally substituted C _7-16 aralkylsulfanyl group”,
“Optionally substituted heterocycle-sulfanyl group”,
“Optionally substituted C _3-7 cycloalkyl-carbonyl group”,
“Optionally substituted C _6-14 aryl-carbonyl group”,
“Optionally substituted C _7-16 aralkyl-carbonyl group”,
“Optionally substituted heterocycle-carbonyl group”,
“Optionally substituted C _3-7 cycloalkylsulfonyl group”,
“Optionally substituted C _6-14 arylsulfonyl group”,
"Optionally substituted heterocycle-sulfonyl group",
"C _3-7 cycloalkylsulfinyl group which may be substituted",
“Optionally substituted C _6-14 arylsulfinyl group”,
“Optionally substituted heterocycle-sulfinyl group”,
“Optionally substituted carbamoyl group”,
"Optionally substituted amino group",
“Optionally substituted mono- or di-C _3-8 cycloalkylamino group”,
“Optionally substituted mono- or di-C _6-14 arylamino group”,
“Optionally substituted mono- or di-C _7-16 aralkylamino group”,
“Optionally substituted heterocycle-amino group”,
“Optionally substituted C _6-14 aryl-carbonylamino group”,
“Optionally substituted C _3-8 cycloalkyl-carbonylamino group”,
“Optionally substituted heterocycle-carbonylamino group”,
“Optionally substituted C _3-8 cycloalkoxy-carbonylamino group”,
“Optionally substituted heterocycle-oxycarbonylamino group”,
“Optionally substituted carbamoylamino group”,
"Optionally substituted alkylsulfonylamino group",
“Optionally substituted C _3-8 cycloalkylsulfonylamino group”,
Examples of each substituent of “ _optionally substituted heterocycle-sulfonylamino group” and “optionally substituted C _6-14 arylsulfonylamino group” include, for example, the following substituent group B, And substituents selected from the following substituent group B ′. The number of the substituents is 1 to the maximum number that can be substituted, more preferably 1 to 3, and even more preferably 1.

[Substituent group B]
In this specification, the substituent group B is composed of the following substituents (a) to (bb).

(A) halogen atom (b) hydroxy group (c) nitro group (d) cyano group

(E) an optionally substituted C _6-14 aryl group [eg, halogen atom, hydroxy, cyano, amino, optionally halogenated C _1-6 alkyl, mono-, or di-C _1-6 Alkylamino, mono-, or di-C _6-14 arylamino, mono-, or di-C _7-16 aralkylamino, C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl- Carbonyl, C _3-7 cycloalkyl-carbonyl, C _6-14 aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyloxy - _{carbonyl, C 1-6} _{alkylsulfanyl, C 1-6} _{alkylsulfinyl, C 1-6} alkyl sulfonyl , Carbamoyl, thiocarbamoyl, mono - or di _{-C 1-6} alkyl - carbamoyl, and mono- - or di _{-C 6-14} aryl - one or more substituents selected from the group consisting of a carbamoyl (e.g., 1 ~ C _6-14 aryl group _optionally substituted with 5 substituents]

(F) an optionally substituted C _6-14 aryloxy group [eg, halogen atom, hydroxy, cyano, amino, optionally halogenated C _1-6 alkyl, mono-, or di-C _{1- 6} alkylamino, mono-, or di-C _6-14 arylamino, mono-, or di-C _7-16 aralkylamino, C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl -Carbonyl, C _3-7 cycloalkyl-carbonyl, C _6-14 aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyl oxy - _{carbonyl, C 1-6} _{alkylsulfanyl, C 1-6} _{alkylsulfinyl, C 1-6} Arukirusu Honiru, carbamoyl, thiocarbamoyl, mono - or di _{-C 1-6} alkyl - carbamoyl, and mono- - or di _{-C 6-14} aryl - one or more substituents selected from the group consisting of a carbamoyl (e.g., 1 C _6-14 aryloxy group _optionally substituted with 5 to 5 substituents]

(G) an optionally substituted C _7-16 aralkyloxy group [eg, halogen atom, hydroxy, cyano, amino, optionally halogenated C _1-6 alkyl, mono-, or di-C _{1- 6} alkylamino, mono-, or di-C _6-14 arylamino, mono-, or di-C _7-16 aralkylamino, C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl -Carbonyl, C _3-7 cycloalkyl-carbonyl, C _6-14 aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyl oxy - _{carbonyl, C 1-6} _{alkylsulfanyl, C 1-6} _{alkylsulfinyl, C 1-6} alkyl Ruhoniru, carbamoyl, thiocarbamoyl, mono - or di _{-C 1-6} alkyl - carbamoyl, and mono- - or di _{-C 6-14} aryl - one or more substituents selected from the group consisting of a carbamoyl (e.g., 1 C _7-16 aralkyloxy group _optionally substituted with 5 to 5 substituents]

(H) an optionally substituted mono- or di-5 to 10-membered heterocyclic group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom [for example, a halogen atom, Hydroxy, cyano, amino, optionally halogenated C _1-6 alkyl, mono-, or di-C _1-6 alkylamino, mono-, or di-C _6-14 arylamino, mono-, or di -C _7-16 aralkylamino, C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl-carbonyl, C _3-7 cycloalkyl-carbonyl, C _6-14 aryl-carbonyl, C _{7 -16} aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyloxy-carbonyl _{Le, C 1-6} _{alkylsulfanyl, C 1-6} _{alkylsulfinyl, C 1-6} alkylsulfonyl, carbamoyl, thiocarbamoyl, mono- - or di _{-C 1-6} alkyl, - carbamoyl, and mono- - or di -C, _1-14 selected from a nitrogen atom, a sulfur atom, and an oxygen atom, which may be substituted with one or more (for example, 1-5) substituents selected from the group consisting of _6-14 aryl-carbamoyl and the like Mono- or di-5- to 10-membered heterocyclic groups having 4 heteroatoms (eg furyl, pyridyl, thienyl, pyrrolidino, 1-piperidinyl, 4-piperidyl, piperazinyl, 1-morpholinyl, 4-thiomorpholinyl, azepane) -1-yl, azocan-1-yl, azonan-1-yl, 3,4-dihydroisoquinolin-2-y )]

(I) an optionally substituted amino group [eg, optionally substituted C _1-6 alkyl, C _2-6 alkenyl, C _6-14 aryl, C _7-16 aralkyl, heterocyclic group, and Heterocycle-amino group optionally substituted with one or two substituents selected from the group consisting of alkyl (the “optionally substituted C _1-6 alkyl, C _2-6 alkenyl, C Examples of the substituent of “ _6-14 aryl, C _7-16 aralkyl, heterocyclic group, and heterocyclic-alkyl” include, for example, a halogen atom, hydroxy, cyano, amino, optionally halogenated C _1-6 alkyl (wherein the alkyl, and not the alkenyl substituent), a mono - or di _{-C 1-6} alkylamino, mono - or di _{-C 6-14} arylamino, Roh -, or di _{-C 7-16} _{aralkylamino, C 3-7} _{cycloalkyl, C 1-6} alkoxy, _{formyl, C 1-6} alkyl - _{carbonyl, C 3-7} cycloalkyl - _{carbonyl, C 6-14} aryl -Carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _3-7 cycloalkyloxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyloxy-carbonyl, C _{1- 6} alkylsulfanyl, C _3-7 cycloalkylsulfanyl, C _1-6 alkylsulfinyl, C _3-7 cycloalkylsulfinyl, C _1-6 alkylsulfonyl, C _3-7 cycloalkylsulfonyl, carbamoyl, thiocarbamoyl, mono-, Or di-C _1-6 alkyl-carbamoy And di-C _6-14 aryl-carbamoyl, etc. The number of the substituents is 1 or more (for example, 1 to 5), wherein “heterocyclic group”, and "Heterocycle-" of "heterocycle-alkyl" includes the same as the above-mentioned "heterocycle group")]

(J) C _3-7 cycloalkyl

(K) an optionally substituted C _1-6 alkoxy group [eg, halogen atom, hydroxy, amino, mono-, or di-C _1-6 alkylamino, mono-, or di-C _6-14 arylamino C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl-carbonyl, C _3-7 cycloalkyl-carbonyl, C _6-14 aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy - _{carbonyl, C 6-14} aryloxy - _{carbonyl, C 7-16} aralkyloxy - _{carbonyl, C 1-6} _{alkylsulfanyl, C 1-6} _{alkylsulfinyl, C 1-6} alkylsulfonyl, carbamoyl, thiocarbamoyl Mono- or di-C _1-6 alkyl-carbamoyl, and mono- Or a C _1-6 alkoxy group which may be substituted with one or more (for example, 1 to 5) substituents selected from the group consisting of di-C _6-14 aryl-carbamoyl, trimethylsilyl (TMS) and the like ]

(L) formyl group _{(m) C 1-6} alkyl - carbonyl group (e.g., acetyl, etc.)
(N) C _3-7 cycloalkyl-carbonyl group (o) C _6-14 aryl-carbonyl group (p) C _7-16 aralkyl-carbonyl group (q) C _1-6 alkoxy-carbonyl group (r) C _{6 -14} aryloxy-carbonyl group (s) C _7-16 aralkyloxy-carbonyl group

(T) C _1-6 alkylsulfanyl group (u) C _1-6 alkylsulfinyl group (v) C _1-6 alkylsulfonyl group

(W) carbamoyl group (x) thiocarbamoyl group (y) mono-C _1-6 alkyl-carbamoyl group (eg, methylcarbamoyl, ethylcarbamoyl, etc.)
(Z) Di-C _1-6 alkyl-carbamoyl group (eg, dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.)
(Aa) Mono- or di-C _6-14 aryl-carbamoyl group (eg, phenylcarbamoyl, 1-naphthylcarbamoyl, 2-naphthylcarbamoyl, etc.)
(Bb) a mono- or di-5 to 7-membered heterocyclic-carbamoyl group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom (eg, 2-pyridylcarbamoyl, 3-pyridyl) Carbamoyl, 4-pyridylcarbamoyl, 2-thienylcarbamoyl, 3-thienylcarbamoyl, etc.)

[Substituent group B ′]
In the present specification, the substituent group B ′ comprises the following substituents (a) to (c).

(A) an optionally substituted C _1-6 alkyl group [eg, halogen atom, hydroxy, cyano, amino, mono-, or di-C _1-6 alkylamino, mono-, or di-C _6-14 Arylamino, mono- or di-C _7-16 aralkylamino, C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl-carbonyl, C _3-7 cycloalkyl-carbonyl, C _{6 -14} aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyloxy-carbonyl, C _1-6 alkylsulfanyl, C _{1- 6} alkylsulfinyl, C _1-6 alkylsulfonyl, carbamoyl, thiocarbamoyl, mono-, and Is substituted with one or more (eg, 1 to 5) substituents selected from the group consisting of di-C _1-6 alkyl-carbamoyl, mono-, or di-C _6-14 aryl-carbamoyl and the like An _optionally substituted C _1-6 alkyl group]

(B) an optionally substituted C _2-6 alkenyl group [eg, halogen atom, hydroxy, cyano, amino, mono-, or di-C _1-6 alkylamino, mono-, or di-C _6-14 Arylamino, mono- or di-C _7-16 aralkylamino, C _3-7 cycloalkyl, C _1-6 alkoxy, formyl, C _1-6 alkyl-carbonyl, C _3-7 cycloalkyl-carbonyl, C _{6 -14} aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyloxy-carbonyl, C _1-6 alkylsulfanyl, C _{1- 6} alkylsulfinyl, C _1-6 alkylsulfonyl, carbamoyl, thiocarbamoyl, mono-, or Or substituted with one or more (for example, 1 to 5) substituents selected from the group consisting of di-C _1-6 alkyl-carbamoyl and mono- or di-C _6-14 aryl-carbamoyl An _optionally substituted C _2-6 alkenyl group]

Hereinafter, symbols in the formula (I ₀ ) will be described.

R ^a represents a C _1-6 alkyl group which may be substituted with a halogen atom. The number of the halogen atoms is preferably 0 (that is, unsubstituted) or 1 to 3.
R ^a is preferably, for example, a methyl group substituted with a halogen atom (the number of the halogen atoms is preferably 1 to 3), particularly preferably, for example, trifluoromethyl.

X ₀ represents —CH ₂ —, —O—, or —NR ^b —.
R ^b is a hydrogen atom, a C _1-6 alkyl group, or a C _1-6 alkyl-carbonyl group _optionally substituted with a halogen atom (the number of the halogen atoms is preferably 1 to 3). Or a C _1-6 alkoxy-carbonyl group.
R ^b is preferably, for example, a C _1-6 alkyl group.

X ₀ is more preferably, for example, —CH ₂ — or —O—.

Y ₀ represents —CR ^c R ^d — or —NH—.
R ^c and R ^d are the same or different and each represents a hydrogen atom or a C _1-6 alkyl group.

Y ₀ is preferably, for example, —CH ₂ — or —NH—.

Ring D _{0 represents a} heterocyclic ring which may be further substituted and contains one hetero atom selected from an oxygen atom and a nitrogen atom as a ring constituent atom.

The heterocycle is a 5- to 6-membered ring, and preferably a 6-membered ring, for example. That is, m is 0 or 1, and is preferably 1, for example.

The “heterocycle containing one heteroatom selected from an oxygen atom and a nitrogen atom as a ring constituent atom” is preferably, for example,

It is.
A further substituent (that is, R ^a , R ^{c) of the} “heterocycle containing one heteroatom selected from an oxygen atom and a nitrogen atom as an optionally substituted ring atom” represented by the ring D ₀ And substituents other than R ^d ) include, for example, substituents selected from the substituent group A.
The substituent is preferably, for example, a C _1-6 alkyl group, and more preferably, for example, a methyl group.
The number of the substituents is 0 (that is, unsubstituted), or 1 to the maximum number that can be substituted, and is preferably 0, 1, or 2, for example.

Partial structure of formula (I ₀ )

The portion represented by is preferably, for example,

(In the formula, R ^X represents a hydrogen atom, a hydroxy group, or an oxo group, X ₀ and Y ₀ have the same meaning as described above, and the ring D ₁ is selected from an oxygen atom and a nitrogen atom as ring-constituting atoms. A heterocyclic ring containing one hetero atom.
It is a part (moiety) represented by.

L ₀ represents a bond, —CH (R ^e ) —W ^a —, or —W ^b —. The partial structural formula: —CH (R ^e ) —W ^a — is described in the direction from the pyrazole ring to the A ₀ ring in the formula (I ₀ ).
R ^e represents a hydrogen atom or a C _1-6 alkyl group.
R ^e is preferably, for example, a hydrogen atom or methyl.
R ^e is more preferably a hydrogen atom, for example.
W ^a is
1) Joining hands,
2) -CONH-,
3) -CONHCH _2- ,
4) -NHCONHCH _2- ,
5) -NHCONH-,
6) -NHCO-,
7) -CH ₂ NHCO-,
8) -CH = CH-,
9) -C≡C-,
10) C _2-6 alkylene,
11) Phenylene,
12) Thiophenediyl,
13) 1,3,4-thiadiazolediyl,
14) 1,2,4-oxadiazoldiyl, or
15) 1,3,4-oxadiazolediyl.

The “phenylene” in the above 11) is preferably, for example,

,and

Is mentioned.
Preferably, the “thiophenediyl” in the above 12) is, for example,

Is mentioned.
As the “1,3,4-thiadiazolediyl” in the above 13), preferably, for example,

Is mentioned.
As the “1,2,4-oxadiazolediyl” in the above 14), for example,

,and

Is mentioned.
As the “1,3,4-oxadiazolediyl” in the above 15), for example,

Is mentioned.
The partial structural formulas of these divalent groups are described in the direction from the pyrazole ring to the A ₀ ring in the formula (I ₀ ).

W ^a is preferably, for example,
1) Joining hands,
2) -CONH-,
3) -NHCONH-,
4) -NHCO-,
5) -CH ₂ NHCO-,
6) -CH = CH-,
7) -C≡C-,
8) C _2-6 alkylene,
9) 1,3,4-thiadiazolediyl,
10) 1,2,4-oxadiazoldiyl, or
11) 1,3,4-oxadiazolediyl.
W ^a is more preferably, for example,
1) -CONH-,
2) 1,3,4-thiadiazolediyl,
3) 1,2,4-oxadiazoldiyl, or
4) 1,3,4-oxadiazolediyl.

W ^b is
1) piperidine diyl,
2) pyrrolidine diyl, or
3) Indicates azetidinediyl.
As the “piperidinediyl” in the above 1), for example,

Is mentioned.
As the “pyrrolidinediyl” in the above 2), for example,

Is mentioned.
As the “azetidine diyl” in the above 3), for example,

W ^b is preferably, for example, azetidine diyl, and more preferably, for example,

It is.

Each A ₀ ring may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring,
13) Thienopyrimidone ring,
14) pyrazolopyrimidine ring, or
15) Indicates an imidazopyrimidine ring.

Specific examples of the skeleton portion excluding the substituent in the A ₀ ring include the following.

The A ₀ ring is more preferably, for example, each may have a substituent.
1) tetrahydrobenzothiophene ring,
2) benzene ring,
3) imidazopyridine ring,
4) Triazolopyridine ring,
5) pyrazolopyrimidine ring, or
6) Imidazopyrimidine ring.

Examples of the substituent in the A ₀ ring include a substituent selected from the substituent group A.

As a preferred substituent in the A ₀ ring, for example,
(i) a halogen atom,
(ii) a cyano group,
(iii) a hydroxy group,
(iv) a nitro group,
(v) formyl group,
(vi) an amino group,
(vii) mono- or di-C _1-6 alkylamino group (eg methylamino, ethylamino, propylamino, dimethylamino, diethylamino, dipropylamino),
(viii) a C _1-6 alkyl-carbonylamino group (eg acetylamino, ethylcarbonylamino),
(ix) a C _1-6 alkoxy-carbonylamino group (eg, methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino),
,
(x) (a) a halogen atom, and (b) a C _3-8 cycloalkyl group optionally substituted with one or more (preferably 1 to 2) substituents selected from a hydroxy group (eg, Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl),
(xi) C _3-8 cycloalkenyl group (eg, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl),
(xii) (a) a halogen atom,
(b) C _1-6 alkyl (eg methyl),
substituted with one or more (preferably 1 to 3) substituents selected from (c) C _3-6 cycloalkyl (eg cyclopropyl), and (d) C _1-6 alkoxy (eg methoxy) An _{optionally substituted} C _6-14 aryl group (eg phenyl, 1-naphthyl, 2-naphthyl),
(xiii) a C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, optionally substituted with one or more (preferably 1 to 3) halogen atoms; tert-butoxy),
(xiv) a C _3-6 cycloalkyl-oxy group (eg, cyclopropoxy) optionally substituted with one or more (preferably 1 to 2) halogen atoms,
(xv) C _7-16 aralkyloxy group (eg, benzyloxy),
(xvi) (a) a C _1-6 alkoxy group (eg, methoxy),
(b) a C _1-6 alkyl group (eg, methyl),
(c) C _3-6 cycloalkyl (eg, cyclopropyl), and (d) C _6- which may be substituted with one or more (preferably 1 to 3) substituents selected from halogen atoms. ₁₄ aryloxy groups (eg phenoxy),
(xvii) carboxyl group,
(xviii) C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, tert-butoxycarbonyl),
(xix) C _7-16 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl),
(xx) C _6-14 aryloxy-carbonyl group (eg, phenoxycarbonyl),
(xxi) a C _1-6 alkyl-carbonyl group (eg, acetyl, ethylcarbonyl, propylcarbonyl, isopropylcarbonyl, 2,2-dimethylpropylcarbonyl),
(xxii) a C _3-8 cycloalkyl-carbonyl group (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl),
(xxiii) a C _7-16 aralkyl-carbonyl group (eg, benzylcarbonyl),
(xxiv) C _6-14 aryl-carbonyl group (eg benzoyl)
(xxv) carbamoyl group,
(xxvi) a thiocarbamoyl group,
(xxvii) mono- or di-C _1-6 alkyl-carbamoyl groups (eg, methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl, isopropylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, dipropylcarbamoyl),
(xxviii) mono- or di-C _7-16 aralkyl-carbamoyl group (eg, benzylcarbamoyl, dibenzylcarbamoyl),
(xxix) thiol group,
(xxx) C _1-6 alkylthio group (eg, methylthio, ethylthio, propylthio),
(xxxi) C _7-16 aralkylthio group (eg, benzylthio),
(xxxii) a C _3-6 cycloalkyl-thio group (eg, cyclopropylthio),
(xxxiii) C _1-6 alkylsulfinyl group (eg, methylsulfinyl, ethylsulfinyl, propylsulfinyl, butylsulfinyl),
(xxxiv) a C _3-8 cycloalkylsulfinyl group (eg, cyclopropylsulfinyl, cyclobutylsulfinyl, cyclopentylsulfinyl),
(xxxv) C _6-10 arylsulfinyl group (eg, phenylsulfinyl, naphthylsulfinyl),
(xxxvi) C _1-6 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl),
(xxxvii) a C _3-8 cycloalkylsulfonyl group (eg, cyclopropylsulfonyl, cyclobutylsulfonyl, cyclopentylsulfonyl),
(xxxviii) C _6-14 arylsulfonyl group (eg, phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl),
(xxxix) C _7-16 aralkylsulfonyl group (eg, benzylsulfonyl),
(xl) a 5- to 8-membered non-aromatic heterocyclic group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (eg, pyrrolidinyl, tetrahydrofuryl, tetrahydrothienyl, Piperidyl, tetrahydropyranyl, morpholinyl, thiomorpholinyl, piperazinyl) [the non-aromatic heterocyclic group includes (a) a halogen atom, (b) a C _1-6 alkyl group (eg, methyl), (c) C _1-6 alkoxy A group (eg methoxy) or (d) optionally substituted by one or more (preferably 1 to 3) substituents selected from C _3-6 cycloalkyl (eg cyclopropyl)],
(xli) 5- to 8-membered aromatic heterocyclic group having 1 to 4 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom (eg, furyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl) , Thiazolyl, isothiazolyl, imidazolyl, pyrazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, furazanyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl 1,3,4-thiadiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl), the aromatic heterocyclic group is (a) halogen atoms, _{(b) C 1-6} alkyl group (e.g. methyl), _{(c) C 1-6} alkoxy group (e.g. methoxy), or _{(d) C 3-6} cycloalkyl It may be substituted with one or more (preferably 1 to 3) substituents selected from alkyl (eg, cyclopropyl) and may be condensed with a benzene ring (eg, benzothienyl). ,
(xlii) a 5- to 8-membered non-aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (eg, pyrrolidinylcarbonyl, tetrahydro Furylcarbonyl, tetrahydrothienylcarbonyl, piperidylcarbonyl, tetrahydropyranylcarbonyl, morpholinylcarbonyl, thiomorpholinylcarbonyl, piperazinylcarbonyl),
(xliii) a 5- to 8-membered aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from a nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms (eg, furylcarbonyl, thienylcarbonyl, pyrrole) Rucarbonyl, oxazolylcarbonyl, isoxazolylcarbonyl, thiazolylcarbonyl, isothiazolylcarbonyl, imidazolylcarbonyl, pyrazolylcarbonyl, 1,2,3-oxadiazolylcarbonyl, 1,2,4-oxadiazolyl Carbonyl, 1,3,4-oxadiazolylcarbonyl, furazanylcarbonyl, 1,2,3-thiadiazolylcarbonyl, 1,2,4-thiadiazolylcarbonyl, 1,3,4-thiadiazolylcarbonyl 1,2,3-triazolylcarbonyl, 1,2,4-triazolylcarbonyl, tetrazolylcarbonyl Pyridylcarbonyl, pyridazinyl carbonyl, pyrimidinyl carbonyl, pyrazinylcarbonyl, triazinyl carbonyl),
(xliv) ureido group,
(xlv) mono- or di-C _1-6 alkyl-ureido groups (eg methylureido, ethylureido, propylureido, N, N′-dimethylureido, N, N′-diethylureido),
(xlvi) C _6-14 aryl-ureido group (eg, phenylureido, 1-naphthylureido, 2-naphthylureido),
(xlvii) C _1-4 alkylenedioxy group (eg, methylenedioxy, ethylenedioxy, propylenedioxy)
(xlviii) an aminosulfonyl group,
(xlix) mono-N—C _1-6 alkylaminosulfonyl group (eg, methylaminosulfonyl, ethylaminosulfonyl),
(l) di-N, N—C _1-6 alkylaminosulfonyl group (eg, dimethylaminosulfonyl, diethylaminosulfonyl),
(li) mono-N—C _3-6 cycloalkylaminosulfonyl group (eg, mono-N-cyclopropylaminosulfonyl group),
(lii) a bridged C _7-10 cycloalkyl group (eg bicyclo [3.1.1] heptyl, adamantyl) optionally substituted with a C _1-6 alkyl group (eg methyl), and
(liii) a C _6-14 arylthio group (eg, phenylthio),
(liv) a C _1-6 alkyl group (eg, methyl) optionally substituted with one or more (preferably 1 to 3) substituents selected from (a) a halogen atom and (b) a hydroxy group , Ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, neopentyl, hexyl),
(lv) a C _2-6 alkenyl group (eg, vinyl, 1-propenyl, allyl, isopropenyl, butenyl, isobutenyl) optionally substituted with one or more (preferably 1 to 3) halogen atoms,
(lvi) a C _2-6 alkynyl group (eg, ethynyl, propargyl, butynyl, 1-hexynyl) optionally substituted with one or more (preferably 1 to 3) halogen atoms,
(lvii) a C _7-16 aralkyl group (eg, benzyl, 2-phenylethyl, 1-phenylethyl, 3-phenylpropyl, 4-phenylbutyl),
(lviii) a 5- to 8-membered aromatic heterocyclic-oxy group containing 1 to 4 heteroatoms selected from a nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms (eg, furyloxy, thienyloxy, pyrrolyloxy) , Oxazolyloxy, isoxazolyloxy, thiazolyloxy, isothiazolyloxy, imidazolyloxy, pyrazolyloxy, 1,2,3-oxadiazolyloxy, 1,2,4-oxadiazolyloxy, 1,3, 4-oxadiazolyloxy, furazanyloxy, 1,2,3-thiadiazolyloxy, 1,2,4-thiadiazolyloxy, 1,3,4-thiadiazolyloxy, 1,2,3-triazoly Ruoxy, 1,2,4-triazolyloxy, tetrazolyloxy, pyridyloxy, pyridazinyloxy, pyrimidinyloxy, pyrazinyloxy, tri Jiniruokishi), and
(lix) oxo group may be mentioned.

As a more preferred substituent in the A ₀ ring, for example,
(i) a halogen atom (preferably a fluorine atom, a chlorine atom, a bromine atom),
(ii) (a) a halogen atom, and (b) 1 or more selected from hydroxy group (preferably, 1-3) of which may be substituted with a substituent C _3-8 cycloalkyl group (e.g. : Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl),
(iii) (a) a halogen atom,
(b) C _1-6 alkyl (eg methyl),
substituted with one or more (preferably 1 to 2) substituents selected from (c) C _3-6 cycloalkyl (eg cyclopropyl) and (d) C _1-6 alkoxy (eg methoxy) An _{optionally substituted} C _6-14 aryl group (preferably phenyl),
(iv) a C _1-6 alkoxy group (preferably methoxy) optionally substituted by one or more (preferably 1 to 3) halogen atoms,
(v) a carboxyl group,
(vi) a C _1-6 alkoxy-carbonyl group (preferably methoxycarbonyl),
(vii) a carbamoyl group,
(viii) a mono- or di-C _1-6 alkyl-carbamoyl group (preferably methylcarbamoyl, isopropylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl),
(ix) a 5- to 8-membered aromatic heterocyclic group (preferably thiazolyl) having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom;
(x) a 5- to 8-membered non-aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (preferably pyrrolidinylcarbonyl) ,
(xi) mono-N-C _3-8 cycloalkylaminosulfonyl group (preferably mono-N-cyclopropylaminosulfonyl group),
(xii) (a) a halogen atom (preferably a fluorine atom), and (b) one or more (preferably 1 to 3) substituents selected from a hydroxy group may be substituted with C _{1- 6} alkyl groups (preferably methyl, isopropyl), and
(xiii) an oxo group.

As a more preferred substituent in the A ₀ ring, for example,
(a) a halogen atom,
(b) a C _1-6 alkyl group optionally substituted with a halogen atom or a hydroxy group,
(c) a C _1-6 alkoxy group,
(d) a C _1-6 alkoxy-carbonyl group,
(e) a pyrrolidinyl-carbonyl group, and
(f) a carbamoyl group and the like.

Particularly preferred substituents in the A ₀ ring include, for example,
(a) a halogen atom,
(b) a C _1-6 alkyl group which may be substituted with a halogen atom,
(c) a C _1-6 alkoxy group, and
(d) Carbamoyl group and the like can be mentioned.

In the A ₀ ring, one or more (preferably 1 to 3) of such substituents may be present at substitutable positions.

The A ₀ ring is preferably, for example,
(a) a halogen atom,
(b) a C _1-6 alkyl group optionally substituted with a halogen atom or a hydroxy group,
(c) a C _1-6 alkoxy group,
(d) a C _1-6 alkoxy-carbonyl group,
(e) a pyrrolidinyl-carbonyl group, and
(f) each substituted with 1 to 3 substituents selected from carbamoyl groups,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring,
13) Thienopyrimidone ring
14) pyrazolopyrimidine ring, or
15) Imidazopyrimidine ring.

A ₀ ring is more preferably, for example,
A ₀ ring is
(a) a halogen atom,
(b) a C _1-6 alkyl group which may be substituted with a halogen atom,
(c) a C _1-6 alkoxy group, and
(d) substituted with 1 to 3 substituents selected from carbamoyl groups,
1) tetrahydrobenzothiophene ring,
2) benzene ring,
3) imidazopyridine ring,
4) Triazolopyridine ring,
5) pyrazolopyrimidine ring, or
6) Imidazopyrimidine ring.
The compound (I ₀ ) is preferably, for example,
R ^a is a methyl group substituted with a halogen atom;
R ^b is a C _1-6 alkyl group,
W ^a is
1) Joining hands,
2) -CONH-,
3) -NHCONH-,
4) -NHCO-,
5) -CH ₂ NHCO-,
6) -CH = CH-,
7) -C≡C-,
8) C _2-6 alkylene,
9) 1,3,4-thiadiazolediyl,
10) 1,2,4-oxadiazoldiyl, or
11) 1,3,4-oxadiazolediyl,
W ^b is azetidine diyl,
A ₀ ring is
(a) a halogen atom,
(b) a C _1-6 alkyl group optionally substituted with a halogen atom or a hydroxy group,
(c) a C _1-6 alkoxy group,
(d) a C _1-6 alkoxy-carbonyl group,
(e) a pyrrolidinyl-carbonyl group, and
(f) each substituted with 1 to 3 substituents selected from carbamoyl groups,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) benzene ring,
5) imidazopyridine ring,
6) Triazolopyridine ring,
7) pyrazolopyrimidine ring, or
8) an imidazopyrimidine ring,
Partial structure of formula (I ₀ )

But

(In the formula, R ^X represents a hydrogen atom, a hydroxy group, or an oxo group, X ₀ and Y ₀ are as defined above, and ring D ₁ is selected from an oxygen atom and a nitrogen atom as a ring constituent atom. A heterocycle containing one heteroatom).
It is a compound which is group represented by these.

As compound (I ₀ ), preferably also, for example,
R ^a is a methyl group substituted with a halogen atom;
X ₀ is —CH ₂ — or —O—;
Y ₀ is —CH ₂ — or —NH—,
R ^e is a hydrogen atom,
W ^a is
1) -CONH-,
2) 1,3,4-thiadiazolyl,
3) 1,2,4-oxadiazolyl, or
4) 1,3,4-oxadiazolyl,
W ^b is azetidine diyl,
A ₀ ring is
(a) a halogen atom,
(b) a C _1-6 alkyl group which may be substituted with a halogen atom,
(c) a C _1-6 alkoxy group, and
(d) substituted with 1 to 3 substituents selected from carbamoyl groups,
1) tetrahydrobenzothiophene ring,
2) benzene ring,
3) imidazopyridine ring,
4) Triazolopyridine ring,
5) pyrazolopyrimidine ring, or
6) an imidazopyrimidine ring,
m is a compound which is 1.

As the compound (I ₀ ), the following compounds are particularly preferable.
Example 29 2-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6, 7-tetrahydro-1-benzothiophene-3-carboxamide or a salt thereof.
Example 44 N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl ) -5,6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide, or a salt thereof.
Example 79 1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazole-5- Yl} methyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
Example 96 1- {1- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl}- 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
Example 101 3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadi (Azol-5-yl} methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridine, or a salt thereof.
Example 78 1-({3- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -1,2,4 -Oxadiazol-5-yl} methyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.

The symbols in formula (I) will be described below.

R ¹ represents a methyl group which may be substituted with a halogen atom. The number of the halogen atoms is preferably 0 (that is, unsubstituted) or 1 to 3.
R ¹ is preferably, for example, trifluoromethyl.

X represents —O— or —NR ² —.
R ² is a hydrogen _{atom, C 1-6} alkyl group (preferably, methyl), or one or more (preferably 1 to 3) halogen atoms (preferably fluorine) may be substituted by _{C 1 A -6} alkyl-carbonyl group (preferably acetyl, trifluoroacetyl);
X is preferably, for example, -O-.

L represents a bond, —CONH—, or —CONHCH ₂ —. As will be apparent to those skilled in the art, when L is a bond, the A ring is linked to the nitrogen atom shown in Formula (I) via methylene.
L is preferably, for example, -CONH-.

Each ring A may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring, or
13) Indicates a thienopyrimidone ring.
The A ring is preferably, for example, an imidazopyridine ring, a triazolopyridine ring, a tetrahydrobenzothiophene ring, or a benzene ring.

Specific examples of the skeleton portion excluding the substituent in the A ring include the following.

Examples of the substituent in the A ring include the same groups as those exemplified as the “preferable substituent in the A ₀ ring”.

As the substituent in the A ring, among them, for example, the same groups as the substituents exemplified as “a more preferable substituent in the A ₀ ring” are preferable.

The A ring may have one or more (preferably 1 to 3) such substituents at substitutable positions.

Compound (I) is preferably, for example,
R ¹ is trifluoromethyl;
X is —O— or —NR ² —;
R ² is a hydrogen _{atom, C 1-6} alkyl group (preferably, methyl), or one or more (preferably 1 to 3) halogen atoms (preferably fluorine) may be substituted by _{C 1 A -6} alkyl-carbonyl group (preferably acetyl, trifluoroacetyl);
L is a bond, —CONH—, or —CONHCH ₂ —;
Each A ring is
(i) a halogen atom (preferably a fluorine atom, a chlorine atom, a bromine atom),
(ii) a C _3-8 cycloalkyl group (preferably cyclopropyl, cyclobutyl),
(iii) a C _6-14 aryl group (preferably phenyl) _optionally substituted with one or more (preferably 1 to 3) halogen atoms,
(iv) a C _1-6 alkoxy group (preferably methoxy) optionally substituted by one or more (preferably 1 to 3) halogen atoms,
(v) a carboxyl group,
(vi) a C _1-6 alkoxy-carbonyl group (preferably methoxycarbonyl),
(vii) a carbamoyl group,
(viii) a mono- or di-C _1-6 alkyl-carbamoyl group (preferably methylcarbamoyl, isopropylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl),
(ix) a 5- to 8-membered aromatic heterocyclic group (preferably thiazolyl) having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom;
(x) a 5- to 8-membered non-aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (preferably pyrrolidinylcarbonyl) ,
(xi) mono-N-C _3-8 cycloalkylaminosulfonyl group (preferably mono-N-cyclopropylaminosulfonyl group),
(xii) (a) a halogen atom (preferably a fluorine atom), and (b) one or more (preferably 1 to 3) substituents selected from a hydroxy group may be substituted with C _{1- 6} alkyl groups (preferably methyl, isopropyl), and
(xiii) each may have one or more (preferably 1 to 3) substituents selected from oxo groups;
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring, or
13) A compound that is a thienopyrimidone ring.

When compound (I ₀ ) and compound (I) are salts, examples of such salts include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, bases And salts with acidic or acidic amino acids.
Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; aluminum salt; ammonium salt and the like.
Preferable examples of the salt with an organic base include salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N, N-dibenzylethylenediamine and the like.
Preferable examples of the salt with inorganic acid include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
Preferable examples of the salt with organic acid include formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p- Examples thereof include salts with toluenesulfonic acid and the like.
Preferable examples of the salt with basic amino acid include salts with arginine, lysine, ornithine and the like.
Preferable examples of the salt with acidic amino acid include salts with aspartic acid, glutamic acid and the like.

[Production method]
The production methods of compound (I ₀ ) and compound (I) are described below.
Compound (I ₀ ) and compound (I) can be produced, for example, by the following method or a method analogous thereto.
The compound in the reaction formula may form a salt. Examples of such salts include compounds (I ₀ ) and the same salts as those in compound (I).

Process A
Compound (I) is Compound (Ia):

In the formula (wherein n represents an integer of 0 or 1 and other symbols are as defined above), the compound (I) is, for example,
Compound (II):

(Wherein each symbol is as defined above) and compound (III):

(Each symbol in the formula is as defined above) can be reacted. As this reaction, for example,
A-1) A method of condensing compound (II) and compound (III) with a generally known dehydration condensing agent;
A-2) A method of reacting compound (III) after activating the carboxyl group of compound (II) by a generally known activation method;
Etc.

Step A-1
Compound (Ia) can be produced by condensing compound (II) and compound (III) with a generally known dehydration condensation agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (III) is preferably used in an amount of usually about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (II). About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Step A-2
Compound (Ia) can also be produced by reacting compound (III) after activating the carboxyl group of compound (II) by a generally known activation method.
As a method for activating the carboxyl group of compound (II), a general method is adopted, for example, mixed acid anhydride using chloroformate, pivaloyl chloride, 2,4,6-trichlorobenzoyl chloride and the like. A method of forming an acid halide using thionyl chloride, oxalyl chloride or the like; a method of forming an active ester with 1-hydroxybenzotriazole, pentafluorophenol or the like using a dehydrating condensing agent.
A typical example is a method of acid halide, and as acid halide,
Compound (IIa):

(Wherein Xa represents a halogen atom, and other symbols are as defined above)
For example, it can be produced by treating compound (II) with a halogenating agent such as thionyl chloride or oxalyl chloride. In this case, for example, N, N-dimethylformamide may be added as an additive.
This reaction is preferably performed in a known solvent, for example, halogenated hydrocarbons such as dichloromethane; ethers such as tetrahydrofuran and diethyl ether; or aromatic hydrocarbons such as toluene or without solvent. .
This reaction is preferably carried out by adding oxalyl chloride to compound (II) in the presence of N, N-dimethylformamide in tetrahydrofuran.
In this reaction, the halogenating agent is usually used in an amount of about 1 to about 100 equivalents, preferably 1 to 5 equivalents, relative to 1 mol of the starting compound (Compound II). The reaction temperature is usually −78 ° C. to 100 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
The reaction of compound (IIa) with compound (III) is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone; halogenation such as dichloromethane Hydrocarbons; Esters such as ethyl acetate; Hydrocarbons such as cyclohexane and n-hexane; Aromatic hydrocarbons such as toluene; Ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane It is carried out in a solvent. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction preferably uses about 0.5 to about 10 moles, preferably about 1 to about 5 moles of compound (III) per mole of compound (IIa), and the base is about 0.1 To about 100 equivalents, preferably from about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process B
Compound (Ia) is
Compound (VI):

(Wherein R ³ represents an optionally substituted C _1-6 alkyl group (for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, etc.), and other symbols. Are as defined above) and compound (III):

(In the formula, each symbol is as defined above).
This reaction is carried out, for example, by a method in which compound (VI) and compound (III) coexist and are heated.
This reaction may be carried out in the presence of a base such as sodium hydride, sodium methoxide, alkyllithium, Grignard reagent; and a metal reagent such as trimethylaluminum as necessary.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, about 1 to about 5 mol of compound (III) is usually used per 1 mol of the raw material compound (compound (IV)), and the reaction temperature is usually 0 ° C. to 200 ° C., preferably 40 ° C. to It is carried out at a reaction temperature of 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process C
Compound (Ia) is
Compound (IV):

(Wherein each symbol is as defined above) and compound (V):

(Wherein, Xb represents a leaving group, and other symbols are as defined above).
Examples of the “leaving group” represented by Xb include halogen atoms; sulfonyloxy groups such as p-toluenesulfonyloxy group, methanesulfonyloxy group, trifluoromethanesulfonyloxy group, etc., preferably chlorine, bromine And halogen atoms such as iodine.
The reaction between compound (IV) and compound (V) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (IV) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (V).
In this reaction, about 1 to about 5 mol of compound (V) is usually used per 1 mol of the starting compound (compound (IV)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (II)>
Process D
Compound (II) used for the production of compound (Ia) is, for example,
Compound (VI):

(Wherein each symbol has the same meaning as described above) can be produced by a method D-1) or D-2) of hydrolysis.

Process D-1
This reaction generally employs a method in which an ester is hydrolyzed under basic conditions, and is performed, for example, by treating with an alkali such as lithium hydroxide, sodium hydroxide, and potassium hydroxide. Preferably, the compound (VI) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof, an aqueous sodium hydroxide solution, an aqueous lithium hydroxide solution, or the like. It is carried out by treating with an alkaline aqueous solution.
In this reaction, about 1 to about 10 equivalent of an aqueous alkali solution is usually used per 1 mol of the raw material compound (compound (VI)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process D-2
Compound (II) can also be produced by a method in which an ester of compound (VI) is hydrolyzed under acidic conditions. For example, it is carried out by treatment with an acid such as hydrochloric acid, sulfuric acid, and nitric acid. Preferably, the compound (VI) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof and treated with an aqueous acid solution such as hydrochloric acid and sulfuric acid. Is done.
In this reaction, about 1 to about 10 equivalents of an aqueous acid solution is usually used per 1 mol of the starting compound (compound (VI)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (VI)>
Process E
Compound (VI) used for the production of compound (II) is, for example,
Compound (IV):

(In the formula, each symbol is as defined above) and compound (VII):

(Each symbol in the formula is as defined above) can be reacted.

The reaction between compound (IV) and compound (VII) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (IV) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (VII).
In this reaction, about 1 to about 5 mol of compound (VII) is usually used with respect to 1 mol of raw material compound (compound (IV)), and the amount of base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process F

Compound (VI) is
Compound (VIII):

(Wherein each symbol is as defined above) can also be produced by intramolecular cyclization reaction. As this reaction, for example,
F-1) A method using a dehydration condensing agent generally known for compound (VIII);
F-2) A method of subjecting compound (VIII) to dehydration condensation under acidic conditions;
Etc.

Process F-1
The intramolecular cyclization reaction of compound (VIII) is performed by using, for example, phosphines and azocarboxylic acid esters.
Examples of phosphines used in this reaction include triphenylphosphine and tributylphosphine.
Examples of the azocarboxylic acid esters used in this reaction include diethyl azodicarboxylate, diisopropyl azodicarboxylate, 1, 1 ′-(azodicarbonyl) dipiperidine (ADDP), and the like.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; halogenated carbonization such as chloroform and dichloromethane. Hydrogen; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Ketones such as acetone and 2-butanone; Sulfoxides such as dimethyl sulfoxide And the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably performed by dissolving compound (VIII) and a phosphine such as triphenylphosphine in a solvent such as tetrahydrofuran and using an azocarboxylic acid ester such as diethyl azodicarboxylate.
In this reaction, phosphines are usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, and azocarboxylic acid esters are usually used with respect to 1 mol of the starting compound (compound (VIII)). , About 1 to about 10 moles, preferably about 1 to about 5 moles. The reaction temperature is usually -78 ° C to 100 ° C, preferably -78 ° C to 30 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Step F-2
The intramolecular cyclization reaction of compound (VIII) may be performed, for example, under acidic conditions.
Examples of the acid used in this reaction include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron fluoride acid.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone Ketones such as sulfoxides such as dimethyl sulfoxide; acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid and the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out in the presence of sulfuric acid or the like, if necessary, by dissolving compound (VIII) in a solvent such as methanol.
This reaction is preferably carried out using usually about 0.1 to about 10 moles, preferably about 0.1 to about 5 moles of acid per mole of starting compound (compound (VIII)). An acid may be used as a solvent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 25 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process G
Compound (IV) used for the production of compound (VI) is, for example,
Compound (IX):

(Wherein each symbol is as defined above) can also be produced by intramolecular cyclization reaction. As this reaction, for example,
G-1) A method using a dehydration condensing agent generally known for compound (IX);
G-2) A method of subjecting compound (IX) to dehydration condensation under acidic conditions;
Etc.

Process G-1
The intramolecular cyclization reaction of compound (IX) is performed by using, for example, phosphines and azocarboxylic acid esters.
Examples of phosphines used in this reaction include triphenylphosphine and tributylphosphine.
Examples of the azocarboxylic acid esters used in this reaction include diethyl azodicarboxylate, diisopropyl azodicarboxylate, 1, 1 ′-(azodicarbonyl) dipiperidine (ADDP), and the like.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; halogenated carbonization such as chloroform and dichloromethane. Hydrogen; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Ketones such as acetone and 2-butanone; Sulfoxides such as dimethyl sulfoxide And the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (IX) and a phosphine such as triphenylphosphine in a solvent such as tetrahydrofuran and using an azocarboxylic acid ester such as diethyl azodicarboxylate.
In this reaction, phosphines are usually used in an amount of about 1 to about 10 moles, preferably about 1 to about 5 moles per mole of the raw material compound (compound (IX)), and azocarboxylic acid esters are usually used. , About 1 to about 10 moles, preferably about 1 to about 5 moles. The reaction temperature is usually -78 ° C to 100 ° C, preferably -78 ° C to 30 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process G-2
The intramolecular cyclization reaction of compound (IX) may be performed, for example, under acidic conditions.
Examples of the acid used in this reaction include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron fluoride acid.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone Ketones such as sulfoxides such as dimethyl sulfoxide; acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid and the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out in the presence of sulfuric acid or the like, if necessary, by dissolving compound (IX) in a solvent such as methanol.
This reaction is preferably carried out using usually about 0.1 to about 10 moles, preferably about 0.1 to about 5 moles of acid per mole of starting compound (compound (IX)). An acid may be used as a solvent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 25 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (IX)>
Process H
Compound (IX) used for the production of compound (IV) is, for example,
Compound (Xa) or Compound (Xb):

(Each symbol in the formula is as defined above) and hydrazine can be reacted. The reaction of compound (Xa) or compound (Xb) with hydrazine is carried out, for example, using a catalyst or a dehydrating condensing agent as necessary.
Examples of the catalyst used as necessary in this reaction include acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boronic acid; acetic acid chloride, propionic acid chloride, benzoic acid chloride. And acid halides such as sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine and other bases, tetrabutylammonium bromide, sodium acetate and the like. Examples of the dehydrating condensing agent include Burgess reagent, N, N′-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N′-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluoro Phosphate (HATU), 2-chloro-1,3-dimethylimidazolium chloride, bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (Diphenyl phosphate azide; DPPA), condensing agents such as 4- (4,6-dimethoxy [1,3,5] triazin-2-yl) -4-methylmorpholinium chloride (DMTMM); Can be mentioned.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; Esters, such as chloroform, dichloromethane; nitriles, such as acetonitrile; amides, such as N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone; acetone, It is carried out in a solvent such as ketones such as 2-butanone; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction is preferably carried out by dissolving compound (Xa) or compound (Xb) and hydrazine monohydrate in a solvent such as methanol and, if necessary, in the presence of an acid such as p-toluenesulfonic acid.
In this reaction, hydrazine is usually used in an amount of usually about 1 to about 10 moles, preferably about 1 to about 5 moles per mole of the starting compound (compound (Xa) or compound (Xb)), and the catalyst is usually used. About 0.01 to about 1 mole, preferably about 0.01 to about 0.1 mole. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process I
Compound (VIII) used for the production of compound (VI) is, for example,
Compound (Xa) or Compound (Xb):

(In the formula, each symbol is as defined above) and compound (XI):

(Each symbol in the formula is as defined above) can be reacted.
The reaction of compound (Xa) or compound (Xb) with compound (XI) is carried out, for example, using a catalyst or a dehydrating condensing agent as necessary.
Examples of the catalyst or dehydrating condensing agent used in this reaction as necessary include acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boronic acid; acetic acid chloride and propionic acid chloride. Acid halides such as benzoyl chloride; bases such as sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine, tetrabutylammonium bromide, sodium acetate, Burgess reagent, N, N '-Dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N'-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (dimethylamino) Suphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3- Dimethylimidazolium chloride, bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy Condensing agents such as [1,3,5] triazin-2-yl) -4-methylmorpholinium chloride (DMTMM); Lawson's reagent and the like.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; Esters, such as chloroform, dichloromethane; nitriles, such as acetonitrile; amides, such as N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone; acetone, It is carried out in a solvent such as ketones such as 2-butanone; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction is preferably carried out by dissolving compound (Xa) or compound (Xb) and compound (XI) in a solvent such as methanol and, if necessary, in the presence of an acid such as p-toluenesulfonic acid.
In this reaction, compound (XI) is usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of starting compound (compound (Xa) or compound (Xb)), The catalyst is usually used in an amount of about 0.01 to about 1 mole, preferably about 0.01 to about 0.1 mole. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process J
Compound (I) is Compound (Ib):

In the case where each symbol in the formula is as defined above, the compound (I) is, for example,
Compound (XII):

(Wherein each symbol has the same meaning as described above) can be produced by intramolecular cyclization reaction. As this reaction, for example,
J-1) A method using a dehydration condensing agent generally known for compound (XII);
J-2) A method of subjecting compound (XII) to dehydration condensation under acidic conditions;
Etc.

Process J-1
The intramolecular cyclization reaction of compound (XII) is performed by using, for example, phosphines and azocarboxylic acid esters.
Examples of phosphines used in this reaction include triphenylphosphine and tributylphosphine.
Examples of the azocarboxylic acid esters used in this reaction include diethyl azodicarboxylate, diisopropyl azodicarboxylate, 1, 1 ′-(azodicarbonyl) dipiperidine (ADDP), and the like.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; halogenated carbonization such as chloroform and dichloromethane. Hydrogen; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Ketones such as acetone and 2-butanone; Sulfoxides such as dimethyl sulfoxide And the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (XII) and a phosphine such as triphenylphosphine in a solvent such as tetrahydrofuran and using an azocarboxylic acid ester such as diethyl azodicarboxylate.
In this reaction, phosphines are usually used in an amount of about 1 to about 10 moles, preferably about 1 to about 5 moles per mole of the raw material compound (compound (XII)), and azocarboxylic acid esters are usually used. , About 1 to about 10 moles, preferably about 1 to about 5 moles. The reaction temperature is usually -78 ° C to 100 ° C, preferably -78 ° C to 30 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process J-2
The intramolecular cyclization reaction of compound (XII) may be performed, for example, under acidic conditions.
Examples of the acid used in this reaction include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron fluoride acid.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone Ketones such as sulfoxides such as dimethyl sulfoxide; acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid and the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (XII) in a solvent such as methanol and, if necessary, in the presence of sulfuric acid or the like.
This reaction is preferably carried out using usually about 0.1 to about 10 moles, preferably about 0.1 to about 5 moles of acid per mole of starting compound (compound (XII)). An acid may be used as a solvent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 25 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (XII)>
Process K
(XII) used for the production of compound (Ib) is, for example,
Compound (Xa) or Compound (Xb):

(Each symbol in the formula is as defined above) and Compound (XIII):

(Each symbol in the formula is as defined above) can be reacted.
The reaction of compound (Xa) or compound (Xb) with compound (XIII) is carried out, for example, using a catalyst or a dehydrating condensing agent as necessary.
Examples of the catalyst or dehydrating condensing agent used in this reaction as necessary include acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boronic acid; acetic acid chloride and propionic acid chloride. Acid halides such as benzoyl chloride; bases such as sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine, tetrabutylammonium bromide, sodium acetate, Burgess reagent, N, N '-Dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N'-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (dimethylamino) Suphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3- Dimethylimidazolium chloride, bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy Condensing agents such as [1,3,5] triazin-2-yl) -4-methylmorpholinium chloride (DMTMM); Lawson's reagent and the like.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; Esters, such as chloroform, dichloromethane; nitriles, such as acetonitrile; amides, such as N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone; acetone, It is carried out in a solvent such as ketones such as 2-butanone; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction is preferably carried out by dissolving compound (Xa) or compound (Xb) and compound (XIII) in a solvent such as methanol, and if necessary, in the presence of an acid such as p-toluenesulfonic acid.
In this reaction, compound (XIII) is usually used in an amount of usually about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of starting compound (compound (Xa) or compound (Xb)). The catalyst is usually used in an amount of about 0.01 to about 1 mole, preferably about 0.01 to about 0.1 mole. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process L
Compound (I) is Compound (Ic):

In the formula (wherein R ⁴ and R ⁵ each represents an optionally substituted C _1-6 alkyl group, and other symbols are as defined above), the compound (I) is, for example,
Compound (II):

(Each symbol in the formula is as defined above) and Compound (XIV):

(Each symbol in the formula is as defined above) can be reacted. As this reaction, for example,
L-1) A method of condensing compound (II) and compound (XIV) with a generally known dehydration condensing agent;
L-2) A method of reacting compound (XIV) after activating the carboxyl group of compound (II) by a generally known activation method;
Etc.

Process L-1
Compound (Ic) can be produced by condensing compound (II) and compound (XIV) with a generally known dehydration condensing agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Butomotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (XIV) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (II). About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process L-2
It can also be produced by reacting compound (XIV) after activating the carboxyl group of compound (II) by a generally known activation method.
As a method for activating the carboxyl group of compound (II), a general method is adopted, for example, mixed acid anhydride using chloroformate, pivaloyl chloride, 2,4,6-trichlorobenzoyl chloride and the like. A method of forming an acid halide using thionyl chloride, oxalyl chloride or the like; a method of forming an active ester with 1-hydroxybenzotriazole, pentafluorophenol or the like using a dehydrating condensing agent.
A typical example is a method of acid halide, and as acid halide,
Compound (IIa):

(Each symbol in the formula is as defined above)
For example, the compound (IIa) can be produced by treating with a halogenating agent such as thionyl chloride or oxalyl chloride. In this case, for example, N, N-dimethylformamide may be added as an additive.
This reaction is preferably performed in a known solvent, for example, halogenated hydrocarbons such as dichloromethane; ethers such as tetrahydrofuran and diethyl ether; or aromatic hydrocarbons such as toluene or without solvent. .
This reaction is preferably carried out by adding oxalyl chloride to compound (II) in the presence of N, N-dimethylformamide in tetrahydrofuran.
In this reaction, the halogenating agent is usually used in an amount of about 1 to about 100 equivalents, preferably 1 to 5 equivalents, relative to 1 mol of the starting compound (Compound II). The reaction temperature is usually −78 ° C. to 100 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
The reaction between compound (IIa) and compound (XIV) is preferably a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone; halogenation such as dichloromethane Hydrocarbons; Esters such as ethyl acetate; Hydrocarbons such as cyclohexane and n-hexane; Aromatic hydrocarbons such as toluene; Ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane It is carried out in a solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (XIV) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (IIa), and the base is about 0.1 To about 100 equivalents, preferably from about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process M
Compound (I) is Compound (Id):

In the formula (wherein R ⁶ represents a C _1-6 alkyl group which may be substituted with a halogen atom, and other symbols are as defined above), the compound (I) is, for example,
Compound (XV):

(In the formula, each symbol is as defined above) and compound (XVI):

The reaction between compound (XV) and compound (XVI) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), diisopropyl In the presence of a base such as ethylamine, potassium carbonate, and cesium carbonate, aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide It is carried out in a solvent.
This reaction is preferably carried out by dissolving compound (XV) in a solvent such as N, N-dimethylformamide, adding potassium carbonate and then adding compound (XVI).
In this reaction, the compound (XVI) is usually used in an amount of about 1 to about 5 moles per mole of the raw material compound (compound (XV)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process N
Compound (Id) is
Compound (XV):

(Each symbol in the formula is as defined above) and Compound (XVII):

(In the formula, R ⁷ represents a C _1-5 alkyl group which may be substituted with a halogen atom) and then a reduction reaction is performed.
The reaction between compound (XV) and compound (XVII) is, for example, halogenated hydrocarbons such as dichloromethane and 1,2-dichloroethane; ethers such as 1,4-dioxane and tetrahydrofuran; or organic acids such as acetic acid. In the solvent.
This reaction is preferably carried out by reacting compound (XV) and compound (XVII) with a solvent such as 1,2-dichloroethane, and then sodium borohydride, zinc borohydride, sodium triacetoxyborohydride, sodium cyanoborohydride. A reducing agent such as palladium; reduction by a hydrogenation reaction using a catalyst such as palladium carbon.
This reaction may be performed in the presence of an organic acid such as acetic acid, if necessary.
A typical example is a method using a reducing agent. In this reaction, the compound (XVII) is usually used in an amount of about 1 to about 5 mol per 1 mol of the starting compound (compound (XV)). The amount is performed using about 1 to about 100 equivalents, preferably about 1 to 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XV)>
Process O
Compound (XV) used for the production of compound (Id) is, for example,
Compound (XVIIIa) or Compound (XVIIIb):

(Each symbol in the formula is as defined above) and Compound (XIII):

(Each symbol in the formula is as defined above) can be reacted.
The reaction of compound (XVIIIa) or compound (XVIIIb) with compound (XIII) is carried out, for example, using a catalyst or a dehydrating condensing agent as necessary.
Examples of the catalyst or dehydrating condensing agent used in this reaction as necessary include acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boronic acid; acetic acid chloride and propionic acid chloride. Acid halides such as benzoyl chloride; bases such as sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine, tetrabutylammonium bromide, sodium acetate, Burgess reagent, N, N '-Dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N'-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (dimethylamino) Suphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3- Dimethylimidazolium chloride, bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy Condensing agents such as [1,3,5] triazin-2-yl) -4-methylmorpholinium chloride (DMTMM); Lawson's reagent and the like.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; Esters, such as chloroform, dichloromethane; nitriles, such as acetonitrile; amides, such as N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone; acetone, It is carried out in a solvent such as ketones such as 2-butanone; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction is preferably performed by dissolving compound (XVIIIa) or compound (XVIIIb) and compound (XIII) in a solvent such as methanol, and if necessary, in the presence of an acid such as p-toluenesulfonic acid.
In this reaction, compound (XIII) is preferably used in an amount of usually about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of starting compound (compound (XVIIIa) or compound (XVIIIb)) The catalyst is usually used in an amount of about 0.01 to about 1 mole, preferably about 0.01 to about 0.1 mole. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (XVIIIa) or Compound (XVIIIb)>
Process P
Compound (XVIIIa) or Compound (XVIIIb) used for the production of compound (XV) is, for example,
Compound (XIXa) or Compound (XIXb):

(Wherein PG ₁ represents an amino-protecting group such as tert-butoxycarbonyl, p-methoxybenzylamine, etc., and other symbols are as defined above), and is produced by deprotecting the protecting group Can do. This reaction can be performed according to a known method, for example, the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980).

<Production of Compound (XIXa) or Compound (XIXb)>
Process Q
Compound (XIXa) or compound (XIXb) used for the production of compound (XVIIIa) or compound (XVIIIb) is, for example,
Compound (XX):

(Wherein each symbol is as defined above) and compound (XXI):

(Each symbol in the formula is as defined above) can be reacted.
The reaction of compound (XX) with compound (XXI) is preferably carried out in the presence of a base such as lithium diisopropylamide, sodium bis (trimethylsilyl) amide, lithium bis (trimethylsilyl) amide, sodium hydride and sodium methoxide. It is carried out in a solvent such as a solvent, for example, ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; alcohols such as methanol and ethanol.
This reaction is preferably performed by dissolving compound (XX) in a solvent such as terahydrofuran, reacting lithium diisopropylamide, and then adding compound (XXI).
In this reaction, about 1 to about 5 mol of compound (XXI) is usually used with respect to 1 mol of raw material compound (compound (XX)), and the amount of base is about 0.1 to about 50 equivalents, preferably 1 ~ 2 equivalents. The reaction temperature is usually −78 ° C. to 100 ° C., preferably −78 ° C. to 20 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process R
Compound (I) is Compound (Ie):

In the case where each symbol in the formula is as defined above, the compound (I) is, for example,
Compound (XXII):

(Wherein each symbol is as defined above) and compound (III):

(Each symbol in the formula is as defined above) can be reacted. As this reaction, for example,
R-1) A method of condensing compound (XXII) and compound (III) with a generally known dehydration condensing agent;
R-2) A method of reacting compound (III) after activating the carboxyl group of compound (XXII) by a generally known activation method;
Etc.

Process R-1
Compound (Ie) can be produced by condensing compound (XXII) and compound (III) with a generally known dehydration condensation agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Butomotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (III) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (XXII), and the amount of dehydrating condensing agent is About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process R-2
It can also be produced by reacting compound (III) after activating the carboxyl group of compound (XXII) by a generally known activation method.
As a method for activating the carboxyl group of compound (XXII), a general method is adopted. For example, mixed acid anhydrides using chloroformate, pivaloyl chloride, 2,4,6-trichlorobenzoyl chloride, etc. A method of forming an acid halide using thionyl chloride, oxalyl chloride or the like; a method of forming an active ester with 1-hydroxybenzotriazole, pentafluorophenol or the like using a dehydrating condensing agent.
A typical example is a method of acid halide, and as acid halide,
Compound (XXIIa):

(In the formula, each symbol has the same meaning as described above). For example, the compound (XXII) can be produced by treating with a halogenating agent such as thionyl chloride or oxalyl chloride. In this case, for example, N, N-dimethylformamide may be added as an additive.
This reaction is preferably performed in a known solvent, for example, halogenated hydrocarbons such as dichloromethane; ethers such as tetrahydrofuran and diethyl ether; or aromatic hydrocarbons such as toluene or without solvent. .
This reaction is preferably carried out by adding oxalyl chloride to compound (XXII) in the presence of N, N-dimethylformamide in tetrahydrofuran.
In this reaction, the halogenating agent is generally used in an amount of about 1 to about 100 equivalents, preferably 1 to 5 equivalents, relative to 1 mol of the raw material compound (Compound XXII). The reaction temperature is usually −78 ° C. to 100 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
The reaction of compound (XXIIa) with compound (III) is preferably a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone; halogenation such as dichloromethane Hydrocarbons; Esters such as ethyl acetate; Hydrocarbons such as cyclohexane and n-hexane; Aromatic hydrocarbons such as toluene; Ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane It is carried out in a solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (III) is preferably used in an amount of usually about 0.5 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of compound (XXIIa), and the base is about 0.1 To about 100 equivalents, preferably from about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process S
Compound (Ie) is
Compound (XXIII):

(Wherein each symbol is as defined above) and compound (III):

(In the formula, each symbol is as defined above).
This reaction is performed, for example, by a method in which compound (XXIII) and compound (III) coexist and are heated.
This reaction may be carried out in the presence of a base such as sodium hydride, sodium methoxide, alkyllithium, Grignard reagent; and a metal reagent such as trimethylaluminum as necessary.
In this reaction, compound (III) is usually used in an amount of about 1 to about 5 mol per mol of the raw material compound (compound (XXIII)), and the reaction temperature is usually 0 ° C. to 200 ° C., preferably 40 ° C. to It is carried out at a reaction temperature of 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process T
Compound (Ie) is
Compound (XXIV):

(Wherein each symbol is as defined above) and compound (V):

(In the formula, each symbol is as defined above).
The reaction of compound (XXIV) with compound (V) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (XXIV) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (V).
In this reaction, about 1 to about 5 mol of compound (V) is usually used with respect to 1 mol of the starting compound (compound (XXIV)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXII)>
Process U
Compound (XXII) used for the production of compound (Ie) is, for example,
Compound (XXIII):

(Wherein each symbol is as defined above) can be produced by a method U-1) or U-2) of hydrolysis.

Process U-1
This reaction generally employs a method in which an ester is hydrolyzed under basic conditions, and is performed, for example, by treating with an alkali such as lithium hydroxide, sodium hydroxide, and potassium hydroxide. Preferably, the compound (XXIII) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof. It is performed by treating with an alkaline aqueous solution.
In this reaction, about 1 to about 10 equivalent of an aqueous alkali solution is usually used per 1 mol of the raw material compound (Compound (XXIII)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process U-2
Compound (XXII) can also be produced by a method of hydrolyzing an ester of compound (XXIII) under acidic conditions. For example, it is carried out by treatment with an acid such as hydrochloric acid, sulfuric acid, and nitric acid. Preferably, compound (XXIII) is dissolved in alcohols such as methanol and ethanol; or water-soluble solvents such as tetrahydrofuran and dioxane; or a mixed solvent thereof, and treated with an aqueous acid solution such as hydrochloric acid and sulfuric acid. Is done.
In this reaction, about 1 to about 10 equivalent of an aqueous acid solution is usually used for 1 mol of the starting compound (compound (XXIII)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXIII)>
Process V
Compound (XXIII) used for the production of compound (XXII) and compound (Ie) is, for example,
Compound (XXIV):

(In the formula, each symbol is as defined above) and compound (VII):

(Each symbol in the formula is as defined above) can be reacted.

The reaction between compound (XXIV) and compound (VII) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (XXIV) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (VII).
In this reaction, compound (VII) is usually used in an amount of about 1 to about 5 mol per mol of the raw material compound (compound (XXIV)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process W
Compound (XXIV) used for the production of compound (XXIII) and compound (Ie) is, for example,
Compound (XXV):

(Wherein PG ₂ represents a protecting group for an amino group such as tert-butoxycarbonyl, p-methoxybenzyl, etc., and other symbols are as defined above). it can. This reaction can be performed according to a known method, for example, the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980).

Process X
Compound (XXV) used for the production of compound (XXIV) is, for example,
Compound (XXVI):

(In the formula, each symbol is as defined above) and compound (XVI):

(Each symbol in the formula is as defined above) can be reacted.
The reaction between compound (XXVI) and compound (XVI) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), diisopropyl In the presence of a base such as ethylamine, potassium carbonate, and cesium carbonate, aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide It is carried out in a solvent.
This reaction is preferably carried out by dissolving compound (XXVI) in a solvent such as N, N-dimethylformamide, adding potassium carbonate and then adding compound (XVI).
In this reaction, about 1 to about 5 mol of compound (XVI) is usually used per 1 mol of the starting compound (compound (XXVI)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process Y
In addition, compound (XXV) is
Compound (XXVI):

(Each symbol in the formula is as defined above) and Compound (XVII):

(The symbols in the formula have the same meanings as described above), followed by a reduction reaction.
Reaction of compound (XXVI) with compound (XVII) is, for example, halogenated hydrocarbons such as dichloromethane and 1,2-dichloroethane; ethers such as 1,4-dioxane and tetrahydrofuran; or organic acids such as acetic acid. In the solvent.
This reaction is preferably carried out by reacting compound (XXVI) and compound (XVII) with a solvent such as 1,2-dichloroethane, and then sodium borohydride, zinc borohydride, sodium triacetoxyborohydride, sodium cyanoborohydride. A reducing agent such as palladium; carried out by reduction by a hydrogenation reaction using a catalyst such as palladium carbon.
This reaction may be performed in the presence of an organic acid such as acetic acid, if necessary.
A typical example is a method using a reducing agent. In this reaction, the compound (XVII) is usually used in an amount of about 1 to about 5 moles per 1 mole of the starting compound (compound (XXVI)). The amount is performed using about 1 to about 100 equivalents, preferably about 1 to 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process Z
Compound (XXVI) used for the production of compound (XXV) is, for example,
Compound (XVIIIa) or Compound (XVIIIb):

(Wherein each symbol is as defined above) and compound (XXVII):

(Each symbol in the formula is as defined above) can be reacted.
The reaction of compound (XVIIIa) or compound (XVIIIb) with compound (XXVII) is carried out, for example, using a dehydration condensing agent or an activator as necessary.
Examples of the dehydrating condensing agent or activating agent used in this reaction include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boronic acid; acetic acid chloride, propion Acid halides such as acid chloride and benzoic acid chloride; sodium methoxide, potassium tert-butoxide, bases such as sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine, tetrabutylammonium bromide, sodium acetate, Burgess reagent, N , N′-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N′-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (dimethylamido) ) Phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3- Dimethylimidazolium chloride, bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy Condensing agents such as [1,3,5] triazin-2-yl) -4-methylmorpholinium chloride (DMTMM); Lawson's reagent and the like.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; Esters, such as chloroform, dichloromethane; nitriles, such as acetonitrile; amides, such as N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone; acetone, It is carried out in a solvent such as ketones such as 2-butanone; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction is preferably performed by dissolving compound (XVIIIa) or compound (XVIIIb) and compound compound (XXVII) in a solvent such as methanol, and if necessary, in the presence of an acid such as p-toluenesulfonic acid.
In this reaction, compound (XXVII) is usually used in an amount of usually about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of starting compound (compound (XVIIIa) or compound (XVIIIb)), The catalyst is usually used in an amount of about 0.01 to about 1 mole, preferably about 0.01 to about 0.1 mole. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Process AA
Compound (I) is Compound (If):

In the case where each symbol in the formula is as defined above, the compound (I) is, for example,
Compound (XXVIII):
(Wherein each symbol is as defined above) and compound (III):

(Each symbol in the formula is as defined above) can be reacted. Examples of this reaction include a method of condensing compound (XXVIII) and compound (III) with a generally known dehydration condensing agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction preferably uses about 0.5 to about 10 moles, preferably about 1 to about 5 moles of compound (III) relative to 1 mole of compound (XXVIII), and the amount of dehydrating condensing agent is About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AB
Compound (If) is
Compound (XXIX):

(Wherein each symbol is as defined above) and compound (III):

(In the formula, each symbol is as defined above).
This reaction is performed, for example, by a method in which compound (XXIX) and compound (III) coexist and are heated.
This reaction may be carried out in the presence of a base such as sodium hydride, sodium methoxide, alkyllithium, Grignard reagent; and a metal reagent such as trimethylaluminum as necessary.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (III) is usually used in an amount of about 1 to about 5 mol per mol of the raw material compound (compound (XXIX)), and the reaction temperature is usually 0 ° C. to 200 ° C., preferably 40 ° C. to It is carried out at a reaction temperature of 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AC
Compound (If) is
Compound (XXX):

(Wherein each symbol is as defined above) and compound (V):

(In the formula, each symbol is as defined above).
The reaction of compound (XXX) with compound (V) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (XXX) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (V).
In this reaction, compound (V) is usually used in an amount of about 1 to about 5 mol per mol of the raw material compound (compound (XXX)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXVIII)>
Process AD
Compound (XXVIII) used for the production of compound (If) is, for example,
Compound (XXIX):

(Wherein the symbols in the formula are as defined above) can be produced by the hydrolysis method AD-1) or AD-2).

Process AD-1
This reaction generally employs a method in which an ester is hydrolyzed under basic conditions, and is performed, for example, by treating with an alkali such as lithium hydroxide, sodium hydroxide, and potassium hydroxide. Preferably, the compound (XXIX) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof, an aqueous sodium hydroxide solution, an aqueous lithium hydroxide solution, or the like. It is carried out by treating with an alkaline aqueous solution.
In this reaction, about 1 to about 10 equivalent of an alkaline aqueous solution is usually used for 1 mol of the starting compound (compound (XXIX)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AD-2
Compound (XXVIII) can also be produced by a method in which an ester of compound (XXIX) is hydrolyzed under acidic conditions. For example, it is carried out by treatment with an acid such as hydrochloric acid, sulfuric acid, and nitric acid. Preferably, compound (XXIX) is dissolved in methanol and alcohols such as ethanol; or water-soluble solvents such as tetrahydrofuran and dioxane; or a mixed solvent thereof, and treated with an aqueous acid solution such as hydrochloric acid and sulfuric acid. Is done.
In this reaction, about 1 to about 10 equivalent of an aqueous acid solution is usually used per 1 mol of the starting compound (compound (XXIX)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXIX)>
Process AE
Compound (XXIX) used for the production of compound (XXVIII) and compound (If) is, for example,
Compound (XXX):

(In the formula, each symbol is as defined above) and compound (VII):

(Each symbol in the formula is as defined above) can be reacted.

The reaction between compound (XXX) and compound (VII) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (XXX) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (VII).
In this reaction, about 1 to about 5 mol of compound (VII) is usually used with respect to 1 mol of the starting compound (compound (XXX)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXX)>
Process AF
Compound (XXX) and Compound (XXX) used for the production of Compound (If) are, for example,
Compound (XXVI):

It can be produced by deprotecting the protecting group (wherein each symbol is as defined above). This reaction can be performed according to a known method, for example, the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980).

Process AG
Compound (I) is Compound (Ig):

In the formula (wherein R ⁸ represents a C _1-6 alkyl group, and other symbols are as defined above), the compound (I) is, for example,
Compound (If):

(Wherein each symbol is as defined above) and compound (XXXI):

(Each symbol in the formula is as defined above) can be reacted.
The reaction between compound (If) and compound (XXXI) is preferably aromatic hydrocarbons such as toluene in the presence of a base such as triethylamine, pyridine, diisopropylethylamine; ethers such as 1,4-dioxane and tetrahydrofuran Or in a solvent such as amides such as N, N-dimethylformamide.
This reaction is preferably carried out by dissolving compound (If) in a solvent such as tetrahydrofuran, adding triethylamine, and then adding compound (XXXI).
In this reaction, about 1 to about 5 mol of compound (XXXI) is usually used with respect to 1 mol of raw material compound (compound (If)), and the amount of base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AH
Also compounds:

(Each symbol in the formula is as defined above) is, for example,
Compound (If):

(Wherein each symbol is as defined above) and compound (XXXII):

(Wherein each symbol is as defined above) can be produced by a method of condensing with a generally known dehydration condensing agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (XXXII) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (If), and the amount of dehydration condensing agent is About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AI
Compound (Ig) is
Compound (XXXIII):

(Wherein each symbol is as defined above) and compound (III):

(Each symbol in the formula is as defined above) can be reacted. As this reaction, for example,
AI-1) A method of condensing compound (XXXIII) and compound (III) with a generally known dehydration condensing agent;
AI-2) A method of reacting compound (III) after activating the carboxyl group of compound (XXXIII) by a generally known activation method;
Etc.

Step AI-1
Compound (Ig) can be produced by condensing compound (XXXIII) and compound (III) with a generally known dehydration condensing agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Butomotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (III) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (XXXIII). About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Step AI-2
It can also be produced by reacting compound (III) after activating the carboxyl group of compound (XXXIII) by a generally known activation method.
As a method for activating the carboxyl group of compound (XXXIII), a general method is adopted. For example, mixed acid anhydrides using chloroformate, pivaloyl chloride, 2,4,6-trichlorobenzoyl chloride and the like are used. A method of forming an acid halide using thionyl chloride, oxalyl chloride or the like; a method of forming an active ester with 1-hydroxybenzotriazole, pentafluorophenol or the like using a dehydrating condensing agent.
A typical example is a method of acid halide, and as acid halide,
Compound (XXXIIIa):

(Wherein each symbol has the same meaning as described above), and for example, it can be produced by treating compound (XXXIII) with a halogenating agent such as thionyl chloride or oxalyl chloride. In this case, for example, N, N-dimethylformamide may be added as an additive.
This reaction is preferably performed in a known solvent, for example, halogenated hydrocarbons such as dichloromethane; ethers such as tetrahydrofuran and diethyl ether; or aromatic hydrocarbons such as toluene or without solvent. .
This reaction is preferably carried out by adding oxalyl chloride to compound (XXXIII) in the presence of N, N-dimethylformamide in tetrahydrofuran.
In this reaction, the halogenating agent is usually used in an amount of about 1 to about 100 equivalents, preferably 1 to 5 equivalents, relative to 1 mol of the raw material compound (Compound XXXIII). The reaction temperature is usually −78 ° C. to 100 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
The reaction of compound (XXXIIIa) with compound (III) is preferably a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone; halogenation such as dichloromethane Hydrocarbons; Esters such as ethyl acetate; Hydrocarbons such as cyclohexane and n-hexane; Aromatic hydrocarbons such as toluene; Ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane It is carried out in a solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (III) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, and base is about 0.1 to 1 mol of compound (XXXIIIa). To about 100 equivalents, preferably from about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AJ
Compound (Ig) is
Compound (XXXIV):

(Wherein each symbol is as defined above) and compound (III):

(In the formula, each symbol is as defined above).
This reaction is performed, for example, by a method in which compound (XXXIV) and compound (III) coexist and are heated.
This reaction may be carried out in the presence of a base such as sodium hydride, sodium methoxide, alkyllithium, Grignard reagent; and a metal reagent such as trimethylaluminum as necessary.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, about 1 to about 5 mol of compound (III) is usually used per 1 mol of the starting compound (compound (XXXIV)), and the reaction temperature is usually 0 ° C. to 200 ° C., preferably 40 ° C. to It is carried out at a reaction temperature of 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXXIII)>
Process AK
Compound (XXXIII) used for the production of compound (Ig) is, for example,
Compound (XXXIV):

(Wherein each symbol has the same meaning as described above) can be produced by a method AK-1) or AK-2) of hydrolysis.

Process AK-1
This reaction generally employs a method in which an ester is hydrolyzed under basic conditions, and is performed, for example, by treating with an alkali such as lithium hydroxide, sodium hydroxide, and potassium hydroxide. Preferably, the compound (XXXIV) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof, an aqueous sodium hydroxide solution, an aqueous lithium hydroxide solution, or the like. It is carried out by treating with an alkaline aqueous solution.
In this reaction, about 1 to about 10 equivalent of an aqueous alkali solution is usually used per 1 mol of the raw material compound (Compound (XXXIV)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AK-2
Compound (XXXIII) can also be produced by a method of hydrolyzing an ester of compound (XXXIV) under acidic conditions. For example, it is carried out by treatment with an acid such as hydrochloric acid, sulfuric acid, and nitric acid. Preferably, Compound (XXXIV) is dissolved in methanol and alcohols such as ethanol; or water-soluble solvents such as tetrahydrofuran and dioxane; or a mixed solvent thereof, and treated with an aqueous acid solution such as hydrochloric acid and sulfuric acid. Is done.
In this reaction, about 1 to about 10 equivalents of an aqueous acid solution is usually used per 1 mol of the starting compound (compound (XXXIV)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (XXXIV)>
Process AL
Compound (XXXIV) used for the production of compound (XXXIII) and compound (Ig) is, for example,
Compound (XXIX):

(Wherein each symbol is as defined above) and compound (XXXI):

(Each symbol in the formula is as defined above) can be reacted.
The reaction between compound (XXIX) and compound (XXXI) is preferably an aromatic hydrocarbon such as toluene in the presence of a base such as triethylamine, pyridine or diisopropylethylamine; an ether such as 1,4-dioxane and tetrahydrofuran Or in a solvent such as amides such as N, N-dimethylformamide.
This reaction is preferably performed by dissolving compound (XXIX) in a solvent such as tetrahydrofuran, adding triethylamine, and then adding compound (XXXI).
In this reaction, compound (XXXI) is usually used in an amount of about 1 to about 5 mol per mol of the starting compound (compound (XXIX)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process AM
Compound (XXXIV) is, for example,
Compound (XXIX):

(Wherein each symbol is as defined above) and compound (XXXII):

(Wherein each symbol is as defined above) can be produced by a method of condensing with a generally known dehydration condensing agent.
Examples of the dehydrating condensing agent used in this reaction include N, N-dicyclohexylamide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, carbonyldiimidazole, 1H-benzoic acid. Triazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) ), Bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethyl phosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl azide (diphenyl phosphate azide; DPPA), 4- (4,6-dimethoxy [1, , 5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, with a base such as 1-hydroxybenzotriazole (HOBt), N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, 4- (N, N-dimethylamino) pyridine and the like. You may carry out in presence.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; alcohols such as methanol and ethanol; water, etc. In the solvent. These solvents may be mixed in an appropriate ratio or may not be used.
In this reaction, compound (XXXII) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (XXIX). About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, the base is used with about 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Furthermore, the production method of the compound (I ₀ ) of the present invention will be described below.
The compound (I ₀ ) of the present invention can be obtained, for example, by the method shown by the following reaction formula or a method analogous thereto. Each symbol of the compound in the reaction formula has the same meaning as described above. The compound in the formula includes a case where a salt is formed. Examples of such a salt include the same salts as the salt of compound (I ₀ ). Further, the compound obtained in each step can be used in the next reaction as a reaction solution or as a crude product, but can be isolated from the reaction mixture according to a conventional method. , Extraction, concentration, neutralization, filtration, distillation, recrystallization, distillation, chromatography, and other separation means. Or when the compound in a formula is marketed, a commercial item can also be used as it is.

A schematic diagram of the reaction formula is shown below.

Compound (2) can be produced by reacting Compound (1) and Compound (XXIa) in Step 1 by the same method as in Step Q.

Compound (3) can be produced by reacting Compound (2) and hydrazine in Step 2 by the same method as in Step Z.

Compound (4) can be produced by reacting Compound (2) and hydrazine in Step 3 in the same manner as in Step H.

Compound (3) can be produced in Step 4 by subjecting Compound (4) to an intramolecular cyclization reaction in the same manner as in Step G.

Compound (5) is obtained by reacting compound (3) with compound (VIIa) (in the formula, Yx represents a functional group such as a cyano group or an ester group) in Step 5 by the same method as in Step E. Can be manufactured.

Compound (7) can be produced by reacting Compound (6) with Compound (XIa) in Step 6 in the same manner as in Step I.

Compound (8) can be produced in Step 7 by acylating from compound (7) using compound (XXXV) in the presence of a suitable base according to a known method or the like. The amount of compound (XXXV) to be used is about 1 mol to 5 mol, preferably about 1 mol to 2.0 mol, per 1 mol of compound (7). The amount of the base used is about 1 mol to 10 mol, preferably about 1 mol to 3.0 mol, per 1 mol of the compound (7). Suitable bases include, for example, tertiary organic bases such as triethylamine, ethyldiisopropylamine, pyridine, sodium hydride, potassium carbonate, potassium tert-butoxide, potassium hydride, calcium hydride, sodium amide, sodium ethoxide, sodium Using methoxide, magnesium ethoxide and the like, an appropriate solvent such as an aprotic solvent (for example, a polar compound (for example, DMF, DMSO, HMPA), a nitrile compound (for example, acetonitrile, propionitrile), an ether compound ( THF, dioxane, diethyl ether, dibutyl ether, dimethoxyethane), ketone compounds (acetone, methyl ethyl ketone, methyl isobutyl ketone), aromatic hydrocarbons (eg, benzene, toluene, xylene, etc.) , Halogenated aromatic hydrocarbons (eg monochlorobenzene, dichlorobenzene, etc.), aliphatic hydrocarbons (hexane, heptane, octane), mixed solvents thereof, etc. The reaction temperature is usually about The temperature is -78 to about 100 ° C., preferably about 0 to about 100 ° C. A temperature higher or lower can be selected as necessary.The reaction time is usually about 30 minutes to about 48 hours, preferably About 1 to 24 hours, a time longer or shorter can be selected as required.

Compound (5) can be produced in Step 8 by subjecting Compound (8) to an intramolecular cyclization reaction in the same manner as in Step G-2.

In step 9, compound (I ₀ ) is obtained from compound (3) according to known methods and the like using compound (XXXVI) (where Xx represents a hydroxyl group or a hydrogen atom). It can be produced by alkylation by a method or the like, or a coupling reaction.

The alkylation reaction by the Mitsunobu method is performed by using, for example, phosphines and azocarboxylic acid esters. Examples of phosphines used in this reaction include triphenylphosphine and tributylphosphine. Examples of the azocarboxylic acid esters used in this reaction include diethyl azodicarboxylate, diisopropyl azodicarboxylate, 1, 1 ′-(azodicarbonyl) dipiperidine (ADDP), and the like.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; halogenated carbonization such as chloroform and dichloromethane. Hydrogen; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Ketones such as acetone and 2-butanone; Sulfoxides such as dimethyl sulfoxide And the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (3), compound (XXXVI) and phosphines such as triphenylphosphine in a solvent such as tetrahydrofuran and using azocarboxylic acid esters such as diethyl azodicarboxylate.
In this reaction, phosphines are usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, and azocarboxylic acid esters are usually used in an amount of about 1 to about 1 mol per 1 mol of compound (3). It is carried out using about 10 moles, preferably about 1 to about 5 moles. The reaction temperature is usually -78 ° C to 100 ° C, preferably -78 ° C to 30 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

The coupling reaction is performed using, for example, a base, a palladium reagent, or a copper reagent. A phosphine ligand may be used as necessary.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salt; alkali metal phosphate such as tripotassium phosphate; alkali metal hydride such as sodium hydride and potassium hydride; sodium amide; alkali metal alkoxide such as sodium methoxide and sodium ethoxide; trimethylamine, triethylamine, N- Amines such as ethyl N-isopropylpropan-2-amine and diisopropylamine; cyclic amines such as pyridine, 4-dimethylaminopyridine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), etc. Can be mentioned.
Examples of the palladium reagent include tetrakis (triphenylphosphine) palladium (0), bis (triphenylphosphine) palladium (II) dichloride, tris (dibenzylideneacetone) dipalladium (0), trans-dichlorobis (tri- o-Tolylphosphine) palladium (II), palladium (II) trifluoroacetate, palladium (II) acetate and the like.
Examples of the copper catalyst include copper iodide, copper bromide, copper chloride, copper acetate and the like.
Examples of the phosphine ligand include triphenylphosphine, 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl, 2- (di-tert-butylphosphino) biphenyl, and 2- (dicyclohexylphosphino). Biphenyl, 2- (dicyclohexylphosphino) -2 ′, 6′-dimethoxy-1,1′-biphenyl, 2- (dicyclohexylphosphino) -2 ′,-4 ′, 6′-triisopropyl-1,1 ′ -Biphenyl, 2- (dicyclohexylphosphino) -2 '-(N, N-dimethylamino) biphenyl, 1,1'-bis (diphenylphosphino) ferrocene, tri-tert-butylphosphine, tricyclohexylphosphine, (9 , 9-dimethyl-9H-xanthene-4,5-diyl) bis (diphenylphosphine).
In this reaction, for example, cyclohexyl-1,2-diamine, N, N′-dimethylcyclohexyl-1,2-diamine, or picolinic acid may be used as necessary.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane, 1,2-dimethoxyethane and tetrahydrofuran; and aromatics such as benzene, toluene and xylene. Aromatic hydrocarbons; Esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone Amides such as; ketones such as acetone and 2-butanone; and sulfoxides such as dimethyl sulfoxide. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction may be performed under an atmosphere of nitrogen, argon, or the like as necessary.
In this reaction, (XXXVI) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to the compound (3) mol, and the amount of the base is about 0.1 To about 100 equivalents, preferably about 1 to about 5 equivalents, palladium or copper reagent is about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents, and the phosphine ligand is about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents, and cyclohexyl-1,2-diamines are about 0.01 to about 2 equivalents, preferably about 0.01 to about 1 equivalent is used. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 50 ° C. to 150 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

In step 10, compound (9) is compound (XXXVII) (wherein Xxa represents a hydroxyl group or a leaving group, and Yz represents boric acid, or from compound (3) according to a known method, etc. Represents a boric acid ester, etc. Examples of the “leaving group” include a halogen atom, a sulfonyloxy group such as a p-toluenesulfonyloxy group, a methanesulfonyloxy group, a trifluoromethanesulfonyloxy group, etc. Xxa is preferred. Can be produced by alkylation under basic conditions using a halogen atom such as chlorine, bromine or iodine.
In alkylation under basic conditions, the amount of compound (XXXVII) to be used is about 1 mol to 5 mol, preferably about 1 mol to 2.0 mol, per 1 mol of compound (3). The amount of the base used is about 1 mol to 10 mol, preferably about 1 mol to 3.0 mol, per 1 mol of the compound (3). Suitable bases include, for example, tertiary organic bases such as triethylamine, ethyldiisopropylamine, pyridine, sodium hydride, potassium carbonate, potassium tert-butoxide, potassium hydride, calcium hydride, sodium amide, sodium ethoxide, sodium Using a methoxide or the like, an appropriate solvent such as an aprotic solvent (for example, a polar compound (for example, DMF, DMSO, HMPA), a nitrile compound (for example, acetonitrile, propionitrile), an ether compound (THF, dioxane, Diethyl ether, dibutyl ether, dimethoxyethane), ketone compounds (acetone, methyl ethyl ketone, methyl isobutyl ketone), aromatic hydrocarbons (eg benzene, toluene, xylene, etc.), halogenated aromatic carbonization The reaction can be carried out in an organic solvent (eg monochlorobenzene, dichlorobenzene, etc.), aliphatic hydrocarbon (hexane, heptane, octane), a mixed solvent thereof, etc. The reaction temperature is usually about −78 to about 150 ° C. The temperature is preferably about 0 to about 100 ° C. If necessary, a temperature higher or lower can be selected, and the reaction time is usually about 30 minutes to about 48 hours, preferably about 1 hour to 24 hours. More or less time can be selected as needed.

Compound (I ₀ ) can be produced in Step 11 from compound (9) by a coupling reaction using compound (XXXVIII) according to a known method or the like.
The coupling reaction is performed using, for example, a base, a palladium reagent, or a copper reagent. A phosphine ligand may be used as necessary.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salt; alkali metal phosphate such as tripotassium phosphate; alkali metal hydride such as sodium hydride and potassium hydride; sodium amide; alkali metal alkoxide such as sodium methoxide and sodium ethoxide; trimethylamine, triethylamine, N- Amines such as ethyl N-isopropylpropan-2-amine and diisopropylamine; cyclic amines such as pyridine, 4-dimethylaminopyridine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), etc. Can be mentioned.
Examples of the palladium reagent include tetrakis (triphenylphosphine) palladium (0), bis (triphenylphosphine) palladium (II) dichloride, tris (dibenzylideneacetone) dipalladium (0), trans-dichlorobis (tri- o-Tolylphosphine) palladium (II), palladium (II) trifluoroacetate, palladium (II) acetate and the like.
Examples of the copper catalyst include copper iodide, copper bromide, copper chloride, copper acetate and the like.
Examples of the phosphine ligand include triphenylphosphine, 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl, 2- (di-tert-butylphosphino) biphenyl, and 2- (dicyclohexylphosphino). Biphenyl, 2- (dicyclohexylphosphino) -2 ′, 6′-dimethoxy-1,1′-biphenyl, 2- (dicyclohexylphosphino) -2 ′,-4 ′, 6′-triisopropyl-1,1 ′ -Biphenyl, 2- (dicyclohexylphosphino) -2 '-(N, N-dimethylamino) biphenyl, 1,1'-bis (diphenylphosphino) ferrocene, tri-tert-butylphosphine, tricyclohexylphosphine, (9 , 9-dimethyl-9H-xanthene-4,5-diyl) bis (diphenylphosphine).
In this reaction, for example, cyclohexyl-1,2-diamine, N, N′-dimethylcyclohexyl-1,2-diamine, or picolinic acid may be used as necessary.
This reaction is carried out using a known solvent such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane, 1,2-dimethoxyethane and tetrahydrofuran; and aromatics such as benzene, toluene and xylene. Aromatic hydrocarbons; Esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl-2-pyrrolidinone Amides such as; ketones such as acetone and 2-butanone; and sulfoxides such as dimethyl sulfoxide. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction may be performed under an atmosphere of nitrogen, argon, or the like as necessary.
In this reaction, (XXXVIII) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of compound (9), and the amount of base is about 0.00. 1 to about 100 equivalents, preferably about 1 to about 5 equivalents, palladium reagent or copper reagent is about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents, and the phosphine ligand is About 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents, and cyclohexyl-1,2-diamines are about 0.01 to about 2 equivalents, preferably about 0.01 to about About 1 equivalent is used. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 50 ° C. to 150 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Compound (I ₀₁ ) can be produced from step (12) by reductive alkylation together with an aldehyde using compound (XXXIX) from compound (3) according to a known method and the like. As the aldehyde, paraformaldehyde or the like is used. The amount of the aldehyde to be used is about 0.5 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of compound (3). If desired, an acid catalyst may be added together with the aldehyde. As the acid catalyst, a protonic acid (for example, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, etc.) and a Lewis acid (for example, aluminum chloride) can be used.
This reaction is advantageously carried out without solvent or using a solvent inert to the reaction. Such a solvent is not particularly limited as long as the reaction proceeds. For example, alcohols such as water, methanol, ethanol, and propanol, hydrocarbons such as cyclohexane, hexane, benzene, toluene, xylene, and mesitylene, formic acid, Organic acids such as acetic acid, ethers such as tetrahydrofuran, dioxane, 1,2-dimethoxyethane, diethyl ether and diisopropyl ether, anilines such as N, N-dimethylaniline and N, N-diethylaniline, dichloromethane, chloroform, four Halogenated hydrocarbons such as carbon chloride and 1,2-dichloroethane or mixed solvents thereof are used.
The reaction temperature is usually about 0 to about 150 ° C., preferably about 60 to about 120 ° C. More or less temperatures can be selected as required. The reaction time is usually about 10 minutes to about 24 hours, preferably about 30 minutes to 12 hours. More or less time can be selected as needed.

Compound (I ₀₁ ) can be produced in Step 13 by reacting Compound (5) and Compound (XXXX) (wherein Xya represents an amino group or the like) in the same manner as in Step B. .

Compound (10) (wherein Yy represents a carboxy group, a hydroxyamidine, an aminomethyl group, etc.) is hydrolyzed, reduced or hydroxyamined from compound (5) in step 14 according to a known method or the like. It can be produced by an addition reaction or the like.
The hydrolysis reaction generally employs a method of hydrolysis under basic conditions or acidic conditions, and the basic conditions include, for example, treatment with an alkali such as lithium hydroxide, sodium hydroxide, and potassium hydroxide. Is done. Preferably, the compound (5) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof, an aqueous sodium hydroxide solution, an aqueous lithium hydroxide solution, or the like. It is performed by treating with an alkaline aqueous solution.
In this reaction, about 1 to about 10 equivalent of an aqueous alkaline solution is usually used per 1 mol of compound (5). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
As acidic conditions, for example, it is carried out by treatment with an acid such as hydrochloric acid, sulfuric acid, and nitric acid. Preferably, the compound (5) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof, and treated with an aqueous acid solution such as hydrochloric acid, sulfuric acid or nitric acid. Is done.
In this reaction, about 1 to about 10 equivalent of an aqueous acid solution is usually used per 1 mol of compound (5). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
In the reduction reaction, metal hydrides such as sodium borohydride, lithium aluminum hydride and diisopropylaluminum hydride, and boranes such as borane tetrahydrofuran complex are used as a reducing agent. The amount of the reducing agent to be used is about 0.5 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of the compound. If desired, an acid catalyst may be added together with the reducing agent. As the acid catalyst, a protonic acid (for example, acetic acid, trifluoroacetic acid and the like), a Lewis acid (for example, aluminum chloride and the like) and the like can be used.
This reaction is advantageously carried out without solvent or using a solvent inert to the reaction. Such a solvent is not particularly limited as long as the reaction proceeds. For example, alcohols such as water, methanol, ethanol, and propanol, hydrocarbons such as cyclohexane, hexane, benzene, toluene, xylene, and mesitylene, formic acid, Organic acids such as acetic acid, ethers such as tetrahydrofuran, dioxane, 1,2-dimethoxyethane, diethyl ether and diisopropyl ether, anilines such as N, N-dimethylaniline and N, N-diethylaniline, dichloromethane, chloroform, four Halogenated hydrocarbons such as carbon chloride and 1,2-dichloroethane or mixed solvents thereof are used.
The reaction temperature is usually about 0 to about 120 ° C., preferably about 25 to about 60 ° C. More or less temperatures can be selected as required. The reaction time is usually about 10 minutes to about 24 hours, preferably about 30 minutes to 12 hours. More or less time can be selected as needed.
Hydroxyamine addition reaction is carried out by using known solvents such as water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane, 1,2-dimethoxyethane and tetrahydrofuran; benzene, toluene and xylene. Aromatic hydrocarbons such as ethyl acetate; halogenated hydrocarbons such as chloroform and dichloromethane; nitriles such as acetonitrile; N, N-dimethylformamide, N, N-dimethylacetamide, 1-methyl- It is carried out in a solvent such as amides such as 2-pyrrolidinone; ketones such as acetone and 2-butanone; sulfoxides such as dimethyl sulfoxide. These solvents may be mixed in an appropriate ratio or may not be used.
The reaction may be performed in the presence of a suitable base or acid according to a known method. The amount of hydroxylamine to be used is about 1 mol to 5 mol, preferably about 1 mol to 2.0 mol, per 1 mol of compound (5). The amount of the base used is about 1 mol to 10 mol, preferably about 1 mol to 3.0 mol, per 1 mol of the compound (5) used. Suitable bases include, for example, tertiary organic bases such as triethylamine, ethyldiisopropylamine, pyridine, sodium hydride, potassium carbonate, sodium carbonate, potassium tert-butoxide, potassium hydride, calcium hydride, sodium amide, sodium ethoxy. , Sodium methoxide, magnesium ethoxide and the like can be used. As the acid catalyst, a protonic acid (for example, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, etc.) and a Lewis acid (for example, aluminum chloride) can be used.
The reaction temperature is generally about −78 to about 100 ° C., preferably about 0 to about 100 ° C. More or less temperatures can be selected as required. The reaction time is usually about 30 minutes to about 48 hours, preferably about 1 hour to 24 hours. More or less time can be selected as needed.

Compound (I ₀₁ ) is compounded in Step 15, compound (10) with compound (XXXXI) (wherein Xyb represents an amino group, a carboxy group, a hydroxyamidine group, etc.) Diacyl obtained by condensing an acid as an acid chloride with an amine, converting it to an isocyanate by a rearrangement reaction of a carboxylic acid, condensing it with an amine, condensing the carboxylic acid with hydrazine, and then condensing with another carboxylic acid Oxadiazole cyclization by intramolecular dehydration condensation of acylhydroxyamidine obtained by condensation of hydrazine or carboxylic acid with hydroxyamidine, thiadiazole cyclization reaction by intramolecular dehydration condensation of diacylhydrazine with niline pentasulfide, etc. It can be manufactured by performing.
Amidation via acid chloride and production of diacylhydrazine and acylhydroxyamidine are carried out in the same manner as in Step A.
Examples of the rearrangement reaction from carboxylic acid to isocyanate include Curtius rearrangement, Schmitt rearrangement, Rossen rearrangement, Hoffman rearrangement and the like, and Curtius rearrangement is preferable.
Although various conditions can be applied to the rearrangement reaction, diphenylphosphoryl azide (DPPA) is preferable when performing the Curtius rearrangement. The carboxylic acid represented by the compound (5) is converted to an acyl azide by reacting with DPPA in the presence of a solvent, and this acyl azide is easily rearranged into an isocyanate by heating in the solvent. The amount of DPPA used is calculated to be 1 mol or more with respect to the carboxylic acid, but preferably 1 to 3 mol.
Any reaction solvent can be used as long as it is an inert solvent, but aromatic hydrocarbon solvents such as benzene, toluene and xylene can be preferably used.
The reaction temperature is, for example, −10 to 150 ° C., preferably 60 to 110 ° C. A base may be used as necessary.
Examples of the base used in the reaction include triethylamine, diisopropylethylamine, 4-methylmorpholine, 4-ethylmorpholine, pyridine, 1-methylimidazole, 1,2-dimethylimidazole, 1,5-diazabicyclo [4.3. 0] -5-nonene, organic bases such as 1,5-diazabicyclo [5.4.0] -5-undecene, lithium methoxide, lithium ethoxide, sodium methoxide, sodium ethoxide, sodium tert-butoxide , Alkali metal alkoxides such as potassium methoxide, potassium ethoxide, potassium tert-butoxide, and the like.
The reaction temperature usually ranges from −70 ° C. to the boiling point of the solvent used, and preferably from −10 ° C. to the boiling point of the solvent used.
The intramolecular dehydration condensation reaction is preferably carried out using a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; ethyl acetate Esters such as cyclohexane, hydrocarbons such as n-hexane, aromatic hydrocarbons such as toluene and xylene, aromatic heterocycles such as pyridine, tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc. Ethers such as methanol and ethanol; nitriles such as acetonitrile; organic acids such as acetic acid; inorganic acid aqueous solutions such as hydrochloric acid; or solvents such as water.
This reaction may be carried out, if necessary, for example, acid halides such as acetic acid chloride, propionic acid chloride, benzoic acid chloride; acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid; sodium methoxide, potassium tert- Bases such as butoxide, sodium hydride, potassium carbonate, and cesium carbonate; tetrabutylammonium bromide; sodium acetate; or Burgess reagent; or N, N′-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl ) Carbodiimide (WSC) or its hydrochloride, N, N′-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate, and O- (7-azabenzotriazole- -Yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3-dimethylimidazolium chloride and bromotripyrrolidinophosphonium hexafluorophosphate You may carry out in presence.
Alternatively, the reaction may be performed under Mitsunobu reaction conditions using azocarboxylic acid esters such as diethyl azodicarboxylate and diisopropyl azodicarboxylate, and phosphines such as triphenylphosphine.
This reaction is usually performed at a reaction temperature of 0 ° C to 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
The thiadiazole cyclization reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; ethyl acetate and the like Esters; hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene and xylene; aromatic heterocycles such as pyridine; tetrahydrofuran, diethyl ether, dioxane, 1,2-dimethoxyethane, etc. Ethers; alcohols such as methanol and ethanol; nitriles such as acetonitrile; organic acids such as acetic acid; inorganic acid aqueous solutions such as hydrochloric acid; or solvents such as water.
Preferably, this reaction is carried out by dissolving diacylhydrazine in a solvent such as THF / toluene and irradiating with heating and stirring or microwaves.
This reaction is usually performed at a reaction temperature of 0 ° C to 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

In any case, if desired, the functional group in the molecule can be converted to the target functional group by combining known chemical reactions. Examples of the chemical reaction include an oxidation reaction, a reduction reaction, an alkylation reaction, a hydrolysis reaction, an amination reaction, an amidation reaction, an esterification reaction, an aryl coupling reaction, and a deprotection reaction.
In each of the above reactions, when the raw material compound has an amino group, a carboxyl group, a hydroxy group, or a carbonyl group as a substituent, a protective group generally used in peptide chemistry or the like is introduced into these groups. In addition, the target compound can be obtained by removing the protecting group as necessary after the reaction.
Examples of the amino-protecting group include, for example, formyl, C _1-6 alkylcarbonyl (eg, acetyl, ethylcarbonyl, etc.), phenylcarbonyl, C _1-6 alkoxy-carbonyl (which may each have a substituent) For example, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), phenyloxycarbonyl, C _7-10 aralkyl-carbonyl (eg, benzylcarbonyl, etc.), trityl, phthaloyl, N, N-dimethylaminomethylene, etc. . Substituents for the “amino-protecting group” include halogen atoms (eg, fluorine, chlorine, bromine, iodine), C _1-6 alkyl-carbonyl (eg, methylcarbonyl, ethylcarbonyl, butylcarbonyl, etc.), and The number of substituents including a nitro group is 1 to several (eg, 3).
Examples of the protecting group for the carboxyl group include a C _1-6 alkyl group, a C _7-11 aralkyl group (eg, benzyl), a phenyl group, a trityl group, a substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl), and C _2-6 alkenyl groups (eg, 1-allyl). These groups may be substituted with 1 to 3 halogen atoms, C _1-6 alkoxy groups, nitro groups and the like.
Examples of the protecting group for the hydroxy group include a C _1-6 alkyl group, a phenyl group, a trityl group, a C _7-10 aralkyl group (eg, benzyl), a formyl group, a C _1-6 alkyl-carbonyl group, a benzoyl group, C _7-10 aralkyl-carbonyl group (eg, benzylcarbonyl), 2-tetrahydropyranyl group, 2-tetrahydrofuranyl group, substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert -Butyldiethylsilyl), C _2-6 alkenyl groups (eg, 1-allyl) and the like. These groups may be substituted with 1 to 3 halogen atoms, a C _1-6 alkyl group, a C _1-6 alkoxy group, a nitro group and the like.
Examples of the protecting group for the carbonyl group include cyclic acetals (eg, 1,3-dioxane), acyclic acetals (eg, di-C _1-6 alkylacetal) and the like.
The method for removing the protecting group described above can be carried out according to a known method such as the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980). For example, a method using acid, base, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate, trialkylsilyl halide (eg, trimethylsilyl iodide, trimethylsilyl bromide), A reduction method or the like is used.

In any case, a known deprotection reaction, acylation reaction, alkylation reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbon chain extension reaction, or substituent exchange reaction may be carried out singly or in combination, as desired. By combining the above, compound (I) or (I ₀ ) can be synthesized.
When compound (I) or (I ₀ ) has an isomer such as an optical isomer, a stereoisomer, a positional isomer, a rotational isomer, etc., either one of the isomers or a mixture thereof is compound (I) or Included in (I ₀ ). For example, Compound (I) or if (I ₀₎ to optical isomers are present, using a method analogous to known or, by optical resolution, the compound is an optically active substance (I) or (I ₀₎ It can also be. Examples of the optical resolution method include methods known per se, such as a fractional recrystallization method, a chiral column method, a diastereomer method, and the like. The “fractional recrystallization method” includes racemates and optically active compounds [eg, (+)-mandelic acid, (−)-mandelic acid, (+)-tartaric acid, (−)-tartaric acid, (+)-1 -Phenethylamine, (-)-1-phenethylamine, cinchonine, (-)-cinchonidine, brucine, etc.) to form a salt, which is separated by fractional recrystallization, etc., and optionally subjected to a neutralization step, free The method of obtaining the optical isomer of this is mentioned. Examples of the “chiral column method” include a method in which a racemate or a salt thereof is applied to an optical isomer separation column (chiral column). For example, in the case of liquid chromatography, a racemate is added to a chiral column such as ENANTIO-OVM (manufactured by Tosoh Corporation) or CHIRAL series (manufactured by Daicel Corporation), and water, buffer solution (eg, phosphate buffer solution), organic solvent (eg, hexane) , Ethanol, methanol, isopropanol, acetonitrile, trifluoroacetic acid, diethylamine, triethylamine, etc.) or a mixed solvent thereof to separate optical isomers. For example, in the case of gas chromatography, a separation method using a chiral column such as CP-Chirasil-DeX CB (manufactured by GL Sciences) can be mentioned. In the “diastereomer method”, a racemic mixture and an optically active reagent are reacted to obtain a mixture of diastereomers, and then one diastereomer is obtained by a usual separation means (eg, fractional recrystallization, chromatography method, etc.). After obtaining the polymer, it is subjected to a chemical reaction (eg, acid hydrolysis reaction, basic hydrolysis reaction, hydrogenolysis reaction, etc.) to cleave the optically active reagent site to obtain the desired optical isomer. Can be mentioned. Examples of the “optically active reagent” include optically active organic acids such as MTPA [α-methoxy-α- (trifluoromethyl) phenylacetic acid] and (−)-menthoxyacetic acid; (1R-endo) -2 And optically active alkoxymethyl halides such as-(chloromethoxy) -1,3,3-trimethylbicyclo [2.2.1] heptane.

Compound (I) or (I ₀ ) may be in the form of a crystal, and is included in compound (I) or (I ₀ ), respectively, whether the crystal form is single or a crystal form mixture. Crystals can be produced by crystallization by applying a crystallization method known per se.
Compound (I) or (I ₀ ) may be a pharmaceutically acceptable cocrystal or cocrystal salt. Here, co-crystals or co-crystal salts are two or more unique at room temperature, each having different physical properties (eg structure, melting point, heat of fusion, hygroscopicity, solubility and stability). Means a crystalline substance composed of a solid. The cocrystal or cocrystal salt can be produced according to a cocrystallization method known per se.
Compound (I) or (I ₀ ) may be a solvate (eg, a hydrate) or a non-solvate (eg, an anhydride), and both are compound (I) Or (I ₀ ).
A compound labeled or substituted with an isotope (eg, ² H, ³ H, ¹¹ C, ¹⁴ C, ¹⁸ F, ³⁵ S, ¹²⁵ I, etc.) is also encompassed in compound (I) or (I ₀ ).
The prodrug of compound (I) or (I _0), the compound by reaction with an enzyme, gastric acid, etc. under the physiological condition in the living body (I) or a compound which is converted into (I _0), i.e. enzymatic oxidation, reduction, hydrolysis and the like compound (I) or (I ₀₎ changed to compound, and a compound that converts to compound hydrolysis and the like (I) or (I ₀₎ by gastric acid and the like. As a prodrug of compound (I) or (I ₀ ), a compound in which amino of compound (I) or (I ₀ ) is acylated, alkylated or phosphorylated (eg, compound (I) or (I ₀ )) Amino is eicosanoylated, alanylated, pentylaminocarbonylated, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylated, tetrahydrofuranylated, pyrrolidylmethylated, pivaloyloxy Methylated or tert-butylated compounds, etc.); compounds wherein the hydroxy group of compound (I) or (I ₀ ) is acylated, alkylated, phosphorylated or borated (eg, compound (I) or (I ₀ ) hydroxy is acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, fumarylated, alanylated Or a compound in which the carboxy group of compound (I) or (I ₀ ) is esterified or amidated (eg, carboxy of compound (I) or (I ₀ ) is an ethyl ester) , Phenyl esterification, carboxymethyl esterification, dimethylaminomethyl esterification, pivaloyloxymethyl esterification, ethoxycarbonyloxyethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3- Dioxolen-4-yl) methyl esterified, cyclohexyloxycarbonylethyl esterified or methylamidated compounds, and the like. These compounds can be produced from compound (I) or (I ₀ ) by a method known per se.
In addition, the prodrug of compound (I) or (I ₀ ) is compound (I) under physiological conditions as described in Hirokawa Shoten 1990, “Development of Drugs”, Volume 7, Molecular Design, pages 163 to 198. Alternatively, it may be changed to (I ₀ ).
Compounds (I) and (I ₀ ), and their prodrugs (hereinafter sometimes simply referred to as the compounds of the present invention) exhibit excellent AMPA receptor function-enhancing action, and thus are based on these actions. It is also useful as a safe medicine.
The compound of the present invention having an excellent AMPA receptor function-enhancing action is effective against mammals (eg, mouse, rat, hamster, rabbit, cat, dog, cow, sheep, monkey, human, etc.)
(1) Psychiatric disorders [eg, depression, major depression, bipolar depression, mood disorders, affective disorders (such as seasonal affective disorders), recurrent depression, postpartum depression, stress disorder, depressive symptoms, Gonorrhea, anxiety, generalized anxiety disorder, anxiety syndrome, panic disorder, phobia, social phobia, social anxiety disorder, obsessive compulsive disorder, post-traumatic stress syndrome, post-traumatic stress disorder, taurette syndrome, autism , Adaptation disorder, bipolar disorder, neurosis, schizophrenia (schizophrenia), neurosis, chronic fatigue syndrome, anxiety, obsessive-compulsive disorder, panic disorder, epilepsy, anxiety, uncomfortable mental state, emotional abnormalities , Emotional temperament, nervousness, fainting, sputum, decreased libido, attention deficit hyperactivity disorder (ADHD), psychotic major depression, refractory major depression, treatment-resistant depression],
(2) Neurodegenerative diseases [eg, Alzheimer's disease, Alzheimer type senile dementia, Parkinson's disease, Huntington's chorea, multiple cerebral infarction dementia, frontotemporal dementia, Parkinson's type frontotemporal dementia, progressive nucleus Upper palsy, Pick syndrome, Niemann-Pick syndrome, cerebral cortex basal degeneration, Down syndrome, vascular dementia, Parkinson's disease after encephalitis, Lewy body dementia, HIV dementia, amyotrophic spinal cord sclerosis (ALS), motor neurogenic disease (MND), Creutzfeldt-Jakob disease or prion disease, cerebral palsy, progressive supranuclear palsy, multiple sclerosis],
(3) Cognitive / memory impairment associated with aging [eg, age-related memory impairment, senile dementia]
(4) Sleep disorders [eg, intrinsic sleep disorders (eg, psychophysiological insomnia, etc.), extrinsic sleep disorders, circadian rhythm disorders (eg, time zone change syndrome (time difference blur), shift work sleep disorders) , Irregular sleep-wake patterns, sleep phase regression syndrome, sleep phase advance syndrome, non-24-hour sleep awakening, etc., parasomnia, internal medicine or psychiatric disorders (eg, chronic obstructive pulmonary disease, Alzheimer's disease, Parkinson's disease) , Cerebrovascular dementia, schizophrenia, depression, anxiety), sleep disorders associated with stress insomnia, insomnia, insomnia, sleep apnea syndrome]
(5) Respiratory depression caused by anesthetics, traumatic diseases, or neurodegenerative diseases,
(6) Traumatic brain injury, anorexia nervosa, eating disorders, anorexia nervosa, bulimia, other eating disorders, alcoholism, alcohol abuse, alcoholic amnesia, alcohol paranoia, alcohol preference Sex, alcohol withdrawal, alcoholic psychosis, alcoholism, alcoholic manic, alcoholic manic, alcohol-dependent mental disorder, alcohol psychosis, drug preference, drug phobia, drug craving, drug withdrawal, migraine, stress headache, tension Headache, diabetic neuropathy, obesity, diabetes, muscle spasms, Meniere's disease, autonomic dysfunction, alopecia, glaucoma, hypertension, heart disease, tachycardia, congestive heart failure, hyperventilation, bronchial asthma, apnea, sudden infants Death syndrome, inflammatory disease, allergic disease, impotence, menopause, infertility, cancer, immunodeficiency syndrome due to HIV infection, Immunodeficiency syndrome due to loess, encephalomyelitis, acromegaly, incontinence, metabolic syndrome, osteoporosis, peptic ulcer, irritable bowel syndrome, inflammatory bowel disease, ulcerative colitis, Crohn's disease, stress gastrointestinal It is useful as a prophylactic / therapeutic agent for diseases such as disorders, neurogenic vomiting, peptic ulcer, diarrhea, constipation, postoperative ileus, and stress gastrointestinal disorders.
The compound of the present invention is particularly useful as a prophylactic / therapeutic agent for diseases such as depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).

Since the compound of the present invention has an excellent AMPA receptor function enhancing action, an excellent therapeutic effect on the above diseases can be expected.

The compounds of the present invention have excellent pharmacokinetics (eg, blood drug half-life) and low toxicity (eg, acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, drug interaction, carcinogenicity, etc.) From the point of view, mammals (eg, humans, monkeys, cows, horses, pigs, mice, Rats, hamsters, rabbits, cats, dogs, sheep, goats, etc.) and can be safely administered orally or parenterally. “Parenteral” includes intravenous, intramuscular, subcutaneous, intraorgan, intranasal, intradermal, instillation, intracerebral, rectal, intravaginal, intraperitoneal, and direct lesion administration. Including.
The medicament containing the compound of the present invention can be prepared by singly using the compound of the present invention alone or pharmaceutically with the compound of the present invention according to a method known per se (eg, a method described in the Japanese Pharmacopoeia) as a method for producing a pharmaceutical preparation. It can be used as a pharmaceutical composition mixed with an acceptable carrier. Examples of the medicament containing the compound of the present invention include tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (soft capsules, microcapsules). Capsules), lozenges, syrups, solutions, emulsions, suspensions, controlled release formulations (eg, immediate release formulations, sustained release formulations, sustained release microcapsules), aerosols, films ( E.g., orally disintegrating film, buccal mucosa adhesive film), injection (eg, subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), instillation, transdermal preparation, ointment, Lotions, patches, suppositories (eg, rectal suppositories, vaginal suppositories), pellets, nasal agents, pulmonary agents (inhalants), eye drops, etc., orally or parenterally (eg, intravenously) , Intramuscular, subcutaneous, intraorgan, intranasal, intradermal, eye drop, Among them, it can be safely administered rectally, intravaginally, intraperitoneally, lesion, etc.).
Examples of the excipient include lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like.
Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like.
Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose, and the like.
Examples of the disintegrant include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, carboxymethyl starch sodium, L-hydroxypropyl cellulose, and the like.
Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like.
Examples of the solubilizer include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like.
Examples of the suspending agent include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate; for example, polyvinyl alcohol, polyvinylpyrrolidone And hydrophilic polymers such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and the like.

Examples of the isotonic agent include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like.
Examples of the buffer include buffer solutions of phosphate, acetate, carbonate, citrate and the like.
Examples of soothing agents include benzyl alcohol.
Examples of preservatives include p-hydroxybenzoates, chlorobutanol, benzyl alcohol, phenylethyl alcohol, dehydroacetic acid, sorbic acid, and the like.
Examples of the antioxidant include sulfite, ascorbic acid, α-tocopherol and the like.

The dose of the compound of the present invention varies depending on the administration route, symptoms and the like. For example, when administered orally to a schizophrenic patient (adult, body weight 40 to 80 kg, eg 60 kg), for example, 0.001 to 1000 mg per day. / Kg body weight, preferably 0.01 to 100 mg / kg body weight per day, more preferably 0.1 to 10 mg / kg body weight per day. This amount can be administered in 1 to 3 divided doses per day.

As the above-mentioned “pharmaceutically acceptable carrier”, various organic or inorganic carriers conventionally used as pharmaceutical materials can be used. For example, in solid preparations, excipients, lubricants, binders and disintegrants are used, and in liquid preparations, solvents, solubilizers, suspending agents, isotonic agents, buffering agents, and the like Soothing agents and the like are used. If necessary, preparation additives such as preservatives, antioxidants, colorants, sweeteners and the like can also be used.

The pharmaceutical composition varies depending on the dosage form, administration method, carrier, etc., but the compound of the present invention is usually 0.01 to 100% (w / w), preferably 0.1 to 95% (w / W), it can be produced according to a conventional method.

The compound of the present invention may be used in combination with other active ingredients (hereinafter abbreviated as concomitant drugs).

Examples of the concomitant drug include the following.
Benzodiazepines (chlordiazepoxide, diazepam, potassium chlorazebuate, lorazepam, clonazepam, alprazolam, etc.), L-type calcium channel inhibitors (pregabalin, etc.), tricyclic or tetracyclic antidepressants (imipramine hydrochloride, amitriptyline hydrochloride, desipramine hydrochloride, Clomipramine hydrochloride, etc.), selective serotonin reuptake inhibitors (fluvoxamine maleate, floxetine hydrochloride, citalopram hydrochloride, sertraline hydrochloride, paroxetine hydrochloride, escitalopram oxalate, etc.), serotonin-noradrenaline reuptake inhibitors (venlafaxine hydrochloride, hydrochloric acid) Duroxetine, desvenlafaxine hydrochloride, etc.), noradrenaline reuptake inhibitors (eg, reboxetine mesylate), mirtazapine, trazodone hydrochloride, nefazodone hydrochloride Bupropion hydrochloride, setiptiline maleate, _{5-HT 1A} agonists, (buspirone hydrochloride, tandospirone citrate, such as hydrochloric acid Osemozotan), 5-HT ₃ antagonist (Cyamemazine, etc.), cardiac selective and no β inhibitors (propranolol hydrochloride, Oxyprenolol hydrochloride, etc.), histamine H ₁ antagonists (hydroxyzine hydrochloride, etc.), schizophrenia drugs (chlorpromazine, haloperidol, sulprid, clozapine, trifluoperazine hydrochloride, fluphenazine hydrochloride, olanzapine, quetiapine fumarate, risperidone , Aripiprazole, etc.), CRF antagonists, other anxiolytic drugs (meprobamate, etc.), tachykinin antagonists (MK-869, saledurant etc.), drugs acting on metabotropic glutamate receptors, CCK antagonists, β3 adrenergic antagonists ( hydrochloric acid Mibegron, etc.), GAT-1 inhibitors (tiagabine hydrochloride, etc.), N-type calcium channel inhibitors, type 2 carbonic anhydrase inhibitors, NMDA glycine site agonists, NMDA antagonists (memantine, etc.), peripheral benzodiazepine receptors Body agonist, vasopressin antagonist, vasopressin V1b antagonist, vasopressin V1a antagonist, phosphodiesterase inhibitor, opioid antagonist, opioid agonist, uridine, nicotinic acid receptor agonist, thyroid hormone (T3, T4), TSH, TRH, MAO inhibitor (phenelzine sulfate, tranylcypromine sulfate, moclobemide, etc.), 5-HT _2A antagonist, 5-HT _2A inverse agonist, COMT inhibitor (entacapone, etc.), bipolar disorder treatment (lithium carbonate, Sodium valproate, lamotrigine, riluzole, Erbamate, etc.), cannabinoid CB1 antagonists (eg, rimonabant), FAAH inhibitors, sodium channel inhibitors, anti-ADHD drugs (eg, methylphenidate hydrochloride, methamphetamine hydrochloride), alcoholics, autism, chronic fatigue Syndrome treatment, spasm treatment, fibromyalgia treatment, headache treatment, insomnia treatment (etizolam, zopiclone, triazolam, zolpidem, ramelteon, indiplon, etc.), smoking cessation treatment, myasthenia gravis treatment Medicine, cerebral infarction medicine, gonorrhea medicine, hypersomnia medicine, pain medicine, mood dysfunction medicine, autonomic dysfunction medicine, male and female sexual dysfunction medicine, migraine medicine, disease Gambling treatment, restless leg syndrome treatment, substance dependence treatment, alcohol-related treatment, irritable bowel syndrome treatment, Alzheimer Disease treatment drugs (Donepezil, Galantamine, Memantine, etc.), Parkinson's disease treatment drugs, ALS treatment drugs (Riluzole, etc., neurotrophic factors, etc.), Dyslipidemia treatment drugs such as cholesterol lowering drugs (statin series (pravastatin sodium, atorvastatin) , Simvastatin, rosuvastatin, etc.), fibrates (clofibrate, etc.), squalene synthesis inhibitors), abnormal behavior treatments or dementia wandering agents (sedatives, anxiolytics, etc.), apoptosis inhibitors, antiobesity agents , Antidiabetic, antihypertensive, hypotensive, rheumatic (DMARD), anticancer, parathyroid (PTH), calcium receptor antagonist, sex hormone or its derivatives (progesterone, estradiol, estradiol benzoate) Etc.), neuronal differentiation promoting drugs, Trans-regeneration promoting drugs, non-steroidal anti-inflammatory drugs (meloxicam, tenoxicam, indomethacin, ibuprofen, celecoxib, rofecoxib, aspirin, indomethacin, etc.), steroids (dexamethasone, cortisone acetate, etc.), anti-cytokine drugs (TNF inhibitor, MAP kinase inhibitor) Drugs), antibody drugs, nucleic acids or nucleic acid derivatives, aptamer drugs and the like.

By combining the compound of the present invention and a concomitant drug,
(1) The dose can be reduced compared to when the compound of the present invention or the concomitant drug is administered alone.
(2) The drug used in combination with the compound of the present invention can be selected according to the patient's symptoms (mild, severe, etc.),
(3) By selecting a concomitant drug having a different mechanism of action from the compound of the present invention, the treatment period can be set longer.
(4) By selecting a concomitant drug having a different mechanism of action from the compound of the present invention, the therapeutic effect can be sustained.
(5) By using the compound of the present invention in combination with a concomitant drug, excellent effects such as a synergistic effect can be obtained.

Hereinafter, the combined use of the compound of the present invention and the concomitant drug is referred to as “the combination drug of the present invention”.
When using the concomitant drug of the present invention, the timing of administration of the compound of the present invention and the concomitant drug is not limited, and the compound of the present invention or the pharmaceutical composition thereof and the concomitant drug or the pharmaceutical composition thereof are administered to the subject of administration. They may be administered at the same time or may be administered with a time difference. The dose of the concomitant drug may be determined according to the dose used clinically, and can be appropriately selected depending on the administration subject, administration route, disease, combination and the like.
The administration form of the concomitant drug of the present invention is not particularly limited as long as the compound of the present invention and the concomitant drug are combined at the time of administration. Examples of such administration forms include (1) administration of a single preparation obtained by simultaneously formulating the compound of the present invention and a concomitant drug, and (2) separate preparation of the compound of the present invention and the concomitant drug. Simultaneous administration of the two preparations obtained by the same administration by the same administration route, (3) with a time difference in the same administration route of the two preparations obtained by separately formulating the compound of the present invention and the concomitant drug. (4) Simultaneous administration of two preparations obtained by separately formulating the compound of the present invention and a concomitant drug by different administration routes, (5) Formulating the compound of the present invention and the concomitant drug separately Administration of the two types of preparations obtained by combining the two preparations at different time intervals (for example, the compound of the present invention; administration in the order of the concomitant drugs, or administration in the reverse order) and the like.

The medicament containing the compound of the present invention is a pharmacologically acceptable compound of the present compound alone or with the compound of the present invention according to a method known per se as a method for producing a pharmaceutical preparation (eg, a method described in the Japanese Pharmacopoeia). It can be used as a pharmaceutical composition mixed with a carrier. Examples of the medicament containing the compound of the present invention include tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (soft capsules, microcapsules). Capsules), lozenges, syrups, solutions, emulsions, suspensions, controlled release formulations (eg, immediate release formulations, sustained release formulations, sustained release microcapsules), aerosols, films ( E.g., orally disintegrating film, buccal mucosa adhesive film), injection (eg, subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), instillation, transdermal preparation, ointment, Lotions, patches, suppositories (eg, rectal suppositories, vaginal suppositories), pellets, nasal agents, pulmonary agents (inhalants), eye drops, etc., orally or parenterally (eg, intravenously) , Intramuscular, subcutaneous, intraorgan, intranasal, intradermal, eye drop, Pharmacologically acceptable carriers that can be used safely in the manufacture of the combination of the present invention can be safely administered to the inside, rectum, vagina, intraperitoneal cavity, lesion, etc. And various organic or inorganic carrier materials. For example, in solid preparations, excipients, lubricants, binders and disintegrants can be used. In liquid preparations, solvents, solubilizers, suspending agents, tonicity agents, buffers, soothing agents, and the like can be used. If necessary, additives such as conventional preservatives, antioxidants, colorants, sweeteners, adsorbents, wetting agents and the like can be used in appropriate amounts.
Examples of the excipient include lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like.
Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like.
Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose, and the like.
Examples of the disintegrant include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, carboxymethyl starch sodium, L-hydroxypropyl cellulose, and the like.
Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like.
Examples of the solubilizer include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like.
Examples of the suspending agent include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate; for example, polyvinyl alcohol, polyvinylpyrrolidone And hydrophilic polymers such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and the like.

The compounding ratio of the compound of the present invention and the concomitant drug in the concomitant drug of the present invention can be appropriately selected depending on the administration subject, administration route, disease and the like.
For example, the content of the compound of the present invention in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, based on the whole preparation. More preferably, it is about 0.5 to 20% by weight.
The content of the concomitant drug in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, more preferably about the whole preparation. About 0.5 to 20% by weight.
The content of additives such as carriers in the combination agent of the present invention varies depending on the form of the preparation, but is usually about 1 to 99.99% by weight, preferably about 10 to 90% by weight, based on the whole preparation. .
The same content may be used when the compound of the present invention and the concomitant drug are formulated separately.

Hereinafter, the present invention will be described more specifically with reference to Reference Examples, Examples, Formulation Examples and Experimental Examples, but the present invention is not limited thereto.
In the following Reference Examples and Examples, “room temperature” usually indicates about 10 ° C. to about 35 ° C. “%” Indicates weight percent unless otherwise specified. Other abbreviations used in the text have the following meanings. s is a singlet, d is a doublet, t is a triplet, q is a quartet, spt is a septet, m is a multiplet, and br is a broad, “brs” is a broad singlet, and “J” is a coupling constant.

The meanings of the abbreviations in Examples and Reference Examples are as follows.
LC-MS: Liquid chromatography-mass spectrometry spectrum ESI: Electrospray ionization method TLC: Thin layer chromatography M: Molar concentration N: Standard
mp: melting point BINAP: 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl BSA: bovine serum albumin DCM: dichloromethane DIAD: diisopropyl azodicarboxylate DIEA: N, N-diisopropylethylamine DMA: N, N -Dimethylacetamide DMF: N, N-dimethylformamide DMSO: dimethyl sulfoxide EDCI: 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide EDTA: ethylenediaminetetraacetic acid HATU: O- (7-azabenzotriazol-1-yl ) -1,1,3,3-tetramethyluronium hexafluorophosphate HOBt: 1-hydroxybenzotriazole LDA: lithium diisopropylamide NBS: N-bromosuccinimide PE: petroleum ether THF Tetrahydrofuran Further, nuclear magnetic resonance spectrum (1H-NMR) analysis in the following Reference Examples and Examples was carried out under the following conditions.
Measuring instruments: Burker AVANCE III plus 400 MHz, Bruker AVANCE 300, Varian VNMRS-400
Internal standard: trimethylsilane MS values in the following examples were measured under the following conditions.
Measuring instrument: Waters LC-MS system HPLC part: Agilent HP1100
MS Department: Waters company micromassZQ
Ionization method: ESI
Or
HPLC part: Agilent 1200
MS Department: Agilent 6300
Ionization method: ESI
Or
Measuring equipment: FINNIGAN Thermo LCQ Advantage MAX, Agilent LC 1200 series
Ionization method: ESI
Further, purification by preparative HPLC in the following examples was carried out under the following conditions.
Equipment: Waters Purification System Column: YMC CombiPrep ODS-A, 5 μm, 50 × 20 mm
Solvent: Solution A; 0.1% trifluoroacetic acid-containing water, Solution B; 0.1% trifluoroacetic acid-containing acetonitrile gradient cycle: 0.00 minutes (A solution / B solution = 90/10), 4.20 minutes (A liquid / B liquid = 0/100), 6.30 minutes (A liquid / B liquid = 0/100), 6.30 minutes (A liquid / B liquid = 90/10), 7.50 minutes (A Liquid / B liquid = 90/10)
Flow rate: 25 mL / min, detection method: UV 220 nm
Or
Equipment: Gilson purification system Column: Welchrom XB-C18, 5 μm, 150 × 20 mm
Solvent: A liquid; 0.1% trifluoroacetic acid-containing acetonitrile, B liquid; 0.1% trifluoroacetic acid-containing water 0.00 min (A liquid / B liquid = 10/90), 5.00 min (A liquid / B liquid = 10/90), 20.00 minutes (A liquid / B liquid = 70/30), 25.00 minutes (A liquid / B liquid = 70/30), 30.00 minutes (A liquid / B Liquid = 10/90); or 0.00 minutes (liquid A / liquid B = 10/90), 5.00 minutes (liquid A / liquid B = 10/90), 20.00 minutes (liquid A / liquid B) = 80/20), 25.00 minutes (A solution / B solution = 80/20), 30.00 minutes (A solution / B solution = 10/90); etc. Flow rate: 25 mL / min, detection method: UV 220 nm

Reference example 1
(3Z) -3- (2,2,2-trifluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one n-butyllithium (1.6 M hexane solution, 250 ml, 400 mmol) was added under a nitrogen atmosphere. To a solution of diisopropylamine (40.48 g, 400 mmol) in tetrahydrofuran (THF) (600 ml) was added dropwise at −78 ° C. over 25 minutes, and the mixture was stirred at 0 ° C. for 25 minutes. The resulting THF solution of lithium diisopropylamide (LDA) was added dropwise to a solution of tetrahydro-2H-pyran-2-one (33.37 g, 333 mmol) in THF (450 ml) at −78 ° C. over 1.5 hours. Fluoroacetic acid 2,2,2-trifluoroethyl ester was added dropwise at −78 ° C. over 20 minutes, and the mixture was further stirred for 30 minutes. The reaction mixture was poured into a mixture of 6N hydrochloric acid (100 mL) and ice (600 mL), and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (66:34)] to give the title compound (43.06 g) as orange crystals (yield 66%).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.93-2.01 (2H, m), 2.64-2.69 (2H, m), 4.40-4.43 (2H, m) , 13.94 (1H, brs).

Reference example 2
tert-Butyl 2- [4- (methoxycarbonyl) benzyl] hydrazinecarboxylate To a solution of 4-bromomethylbenzoic acid (15.0 g, 70 mmol) in methanol (168 mL) was added 4.2 mL of concentrated sulfuric acid and the mixture was stirred for 5 hours. did. The reaction mixture was extracted with 200 mL of diethyl ether and then washed with 200 mL of water and 100 mL of saturated aqueous sodium hydrogen carbonate solution. The extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain methyl 4- (bromomethyl) benzoate (13.0 g, yield 82%). Diisopropylethylamine (65 mL) was added to a mixture of the resulting methyl 4- (bromomethyl) benzoate (13.0 g, 57 mmol), tert-butyl carbamate (8.3 g, 63 mmol) and N, N-dimethylformamide (DMF) (65 mL). DIEA) (14.0 mL, 86 mmol) was added. The mixture was heated at 90 ° C. for 1.5 hours, extracted with 200 mL of diethyl ether, washed with 200 mL of water, and dried over anhydrous sodium sulfate. Concentration under reduced pressure gave the title compound (10.0 g) as a yellow solid (yield 63%). The obtained title compound was used in the next step without purification.

Reference example 3
To a solution of methyl 4- (hydrazinomethyl) benzoate tert-butyl 2- [4- (methoxycarbonyl) benzyl] hydrazinecarboxylate (10.0 g, 36 mmol) in ethyl acetate (500 mL) is added a saturated methanolic hydrochloric acid (300 mL) solution. In addition, the mixture was stirred under a nitrogen atmosphere for 4 hours and concentrated under reduced pressure. The residue is washed with 10 mL of diethyl ether to give the hydrochloride salt of the title compound, which is added to 100 mL of ethyl acetate and 2 mL of water, the mixture is cooled to 0 ° C., and saturated aqueous sodium carbonate (10 mL) is added to 40-60 It was dripped at ° C. The organic layer was then dried over anhydrous sodium sulfate and concentrated under reduced pressure to give the title compound (1.4 g) as a yellow solid (yield 22%).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ ppm 3.82 (s, 3H), 4.12 (s, 2H), 6.87 (brs, 3H), 7.48-7.54 (m , 2H), 7.90-7.96 (m, 2H).

Reference example 4
Methyl 4-{[5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] methyl} benzoate (3Z) -3- (2,2,2 -Trifluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one (1.4 g, 7.2 mmol), methyl 4- (hydrazinomethyl) benzoate (1.3 g, 7.2 mmol) and p- A solution of toluenesulfonic acid (0.13 g, 0.7 mmol) in benzene (50 mL) was refluxed for 4 hours and concentrated under reduced pressure to give the title compound (1.3 g) as a yellow solid (yield 50%).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.78 (t, J = 6.0 Hz, 2H), 2.65 (t, J = 6.4 Hz, 2H), 3.67-3.71 ( m, 2H), 3.91 (s, 3H), 5.23 (s, 2H), 7.25-7.27 (m, 2H), 7.96-7.98 (m, 2H). * Two “OH group” peaks were not observed.

Reference Example 5
tert-Butyl 2- [3- (methoxycarbonyl) benzyl] hydrazinecarboxylate methyl 3- (bromomethyl) benzoate (5.0 g, 22 mmol), tert-butyl carbazate (3.2 g, 24 mmol) in DMF (25 mL) To the stirring solution was added DIEA (5.8 mL, 33 mmol). The mixture was heated at 90 ° C. for 1.5 hours, extracted with 200 mL of diethyl ether, washed with 200 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (4.9 g) as yellow Obtained as a solid (80% yield). The obtained title compound was used in the next step without purification.

Reference Example 6
To a solution of methyl 3- (hydrazinomethyl) benzoate tert-butyl 2- [3- (methoxycarbonyl) benzyl] hydrazinecarboxylate (4.9 g, 17.5 mmol) in ethyl acetate (500 mL), saturated methanolic hydrochloric acid (200 mL) The solution was added and the mixture was stirred at room temperature for 4 hours under a nitrogen atmosphere and concentrated under reduced pressure. The residue was washed with diethyl ether to give the hydrochloride salt of the title compound, to which 100 mL ethyl acetate and 2 mL water were added. The mixture was cooled to 0 ° C., and saturated aqueous sodium carbonate (10 mL) was added dropwise at 40-60 ° C. The organic layer was then dried over anhydrous sodium sulfate and concentrated under reduced pressure to give the title compound (1.9 g) as a yellow solid (yield 60%).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ ppm 3.86 (s, 3H), 4.16 (s, 2H), 5.96 (brs, 3H), 7.41-7.45 (m , 2H), 7.84-8.01 (m, 2H).

Reference Example 7
Methyl 3-{[5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] methyl} benzoate (3Z) -3- (2,2,2 -Trifluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one (2.5 g, 12.9 mmol), methyl 3- (hydrazinomethyl) benzoate (2.3 g, 12.9 mmol), p- A solution of toluenesulfonic acid monohydrate (0.25 g, 1.3 mmol) in benzene (90 mL) was refluxed for 4 hours and concentrated under reduced pressure to give the title compound (765 mg) as a yellow solid (yield 16%).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.93-2.00 (m, 2H), 2.62-2.69 (m, 2H), 3.90 (s, 3H), 4.39 -4.44 (m, 2H), 4.59 (s, 2H), 7.33-7.51 (m, 2H), 7.72-8.06 (m, 2H), 13.95 (brs) , 2H).

Reference Example 8
4- (3-Hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol under nitrogen atmosphere, (3Z) -3- (2,2,2-trifluoro-1-hydroxyethylidene) tetrahydro -H-pyran-2-one (43.06 g, 220 mmol), p-toluenesulfonic acid monohydrate (2.09 g, 11 mmol) and toluene (400 ml) in a mixture of hydrazine monohydrate (14.29 g, 286 mmol), and the mixture was stirred at 80 ° C. for 4 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The aqueous layer was extracted with an ethyl acetate / THF mixed solvent (3/1), and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was recrystallized from THF-ethyl acetate-hexane to give the title compound (24.02 g) as pink crystals (yield 52%).
¹ H NMR (300 MHz, DMSO-d ₆ ) δ ppm 1.46-1.69 (2H, m), 2.36 (2H, t, J = 7.8 Hz), 3.38 (2H, t, J = 6.6 Hz), 12.66 (1H, d, J = 0.8 Hz). * Two “OH group” peaks were not observed.

Reference Example 9
3- (Trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazole-5 To a mixture of all (24.02 g, 114 mmol), triphenylphosphine (44.97 g, 171 mmol), ammonium chloride (12.2 g, 228 mmol) and THF (750 ml) diethyl azodicarboxylate (DEAD) (2.2 M toluene) (Solution, 78 ml, 171 mmol) was added dropwise over 40 minutes, followed by stirring at room temperature for 4 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The aqueous layer was extracted with an ethyl acetate / THF mixed solvent (3/1), and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was saturated with hot ethyl acetate, and white needle crystals formed upon standing at room temperature were filtered off. The residue obtained by concentrating the filtrate was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (84: 16-67: 33)] to give the title compound (20.03 g) as yellow crystals. (Yield 91%).
MS Found: 193 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.95-2.04 (2H, m), 2.66 (2H, t, J = 6.4 Hz), 4.20-4.36 (2H, m), 9.67 (1H, brs).

Reference Example 10
[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethyl acetate 3- (trifluoromethyl) -1,4,5,6-tetrahydropyra Potassium tert-butoxide (5.80 g, 52 mmol) was added to a mixture of bis [2,3-c] pyrazole (4.97 g, 26 mmol) and THF (90 ml) at 0 ° C., and the mixture was stirred for 5 minutes. Ethyl bromoacetate (8.63 g, 52 mmol) was added at 0 ° C., followed by stirring at room temperature for 20 hours. 1N Hydrochloric acid (50 ml) was added to the reaction mixture at 0 ° C., and the mixture was extracted with ethyl acetate at room temperature. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (95: 5-90: 10-80: 20)] to give the title compound (4.29 g) as a pale yellow oil. Obtained (yield 60%).
MS Found: 279 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.28 (3H, t, J = 7.2 Hz), 1.96-2.04 (2H, m), 2.65 (2H, t, J = 6.3 Hz), 4.23 (2H, q, J = 7.2 Hz), 4.29-4.32 (2H, m), 4.73 (2H, s).

Reference Example 11
[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid [3- (trifluoromethyl) -5,6-dihydropyrano [2,3- c] Pyrazol-1 (4H) -yl] ethyl acetate (4.29 g, 15 mmol), THF (15 ml), methanol (15 ml), water (28 ml) in a mixture of lithium hydroxide monohydrate (1.94 g, 46 mmol) was added, followed by stirring at room temperature for 4 hours. The aqueous layer was washed with ethyl acetate and acidified with 1N hydrochloric acid (100 ml). This was extracted with ethyl acetate, and the organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was recrystallized from ethyl acetate-hexane to give the title compound (3.02 g) as colorless crystals (yield 78%).
MS Found: 250 (M)
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.87-2.15 (2H, m), 2.65 (2H, t, J = 6.2 Hz), 4.21-4.47 (2H, m), 4.79 (2H, s). * A peak of “COOH group” was not observed.

Reference Example 12
[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride [3- (trifluoromethyl) -5,6-dihydropyrano [2,3 Oxalyl chloride (102 μl, 1.16 mmol) was added dropwise at room temperature to a solution of —c] pyrazol-1 (4H) -yl] acetic acid (250 mg, 0.999 mmol) and DMF (1 drop) in dichloromethane (8.0 mL). The resulting reaction mixture was stirred for 2 hours and then concentrated under reduced pressure to obtain an acid chloride form (270 mg), which was used in the next reaction without purification.

Reference Example 13
3- (Trifluoroacetyl) piperidin-2-one 5.00 g (25 mmol) tert-butyl 2-oxopiperidine-1-carboxylate was dissolved in 50 mL dimethoxyethane and the resulting solution was cooled to -78 ° C. After that, 30 mL (30 mmol) of hexamethyldisilazane lithium (LiHMDS, 1M, THF solution) was added dropwise, stirred for about 1 hour, and then 3.9 mL (33 mmol) of ethyl trifluoroacetate was added dropwise. After stirring for 1 hour, the dry ice-acetone bath was removed, and the mixture was further stirred for about 2 hours. The mixture was poured into an aqueous ammonium chloride solution, extracted with ethyl acetate, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: petroleum ether / dichloromethane (1: 1)] to obtain 3.26 g (yield 44%) of the product as a white solid. The product was dissolved in ethyl acetate (50 mL) and 4N hydrogen chloride ethyl acetate solution (20 mL) was added. The reaction mixture was stirred at room temperature for 5 hours and concentrated under reduced pressure. The residue was poured into aqueous sodium hydrogen carbonate / ammonia solution (3: 1, 40 mL) and extracted with ethyl acetate (50 mL × 3). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was suspended in ether and filtered. The resulting solid was washed with ether and dried to give 1.85 g of the title compound as a colorless gel (yield 86%).

Reference Example 14
7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine 1- (4-methoxybenzyl) -7-methyl-3- (tri Fluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (300 mg, 0.92 mmol) in trifluoroacetic acid (10 mL) and chloroform (10 mL) Stir overnight. The mixture was adjusted to pH 7 with saturated aqueous sodium hydrogen carbonate solution. The mixture was extracted with 20 mL of dichloromethane, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (150 mg) as a white solid (yield 79%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.95-2.01 (m, 2H), 2.60-2.63 (m, 2H), 2.87 (s, 3H), 3.04 -3.07 (m, 2H). * A peak of “OH group” was not observed.

Reference Example 15
Ethyl [7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetate 7-methyl-3- (trifluoro Methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (410 mg, 2.0 mmol) and potassium tert-butoxide (448 mg, 4.0 mmol) at 0 ° C. in THF (20 mL ) To the solution was added ethyl 2-bromoacetate (0.46 mL, 4.0 mmol). The mixture was stirred at room temperature overnight. The mixture was washed with 20 mL 1N hydrochloric acid. The aqueous layer was extracted with 100 mL ethyl acetate. The organic layer was washed with 50 mL of saturated aqueous sodium bicarbonate solution and 50 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (5: 1)] to give the title compound (400 mg) as a white solid (yield 70%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.30 (t, J = 6.8 Hz, 3H), 1.88-1.91 (m, 2H), 2.59 (t, J = 6. 4 Hz, 2H), 2.72 (s, 3H), 3.05-3.08 (m, 2H), 4.20 (q, J = 6.8 Hz, 2H), 4.82 (s, 2H) .

Reference Example 16
[7-Methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] ethyl acetate [7-methyl-3- (tri Fluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetate (400 mg, 1.37 mmol) and lithium hydroxide monohydrate (173 mg, 4 0.1 mmol) in THF (10 mL) / methanol (10 mL) / water (3 mL) was stirred at room temperature for 2 hours. The solvent was concentrated under reduced pressure, and the residue was washed with 100 mL of ethyl acetate. The aqueous layer was neutralized with 30 mL of 1N hydrochloric acid and extracted twice with 30 mL of ethyl acetate. The extract was washed with 30 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (320 mg) as a white solid (yield 89%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.78-1.81 (m, 2H), 2.58-2.61 (m, 2H), 2.75 (s, 3H), 3.06 -3.09 (m, 2H), 4.87 (s, 2H). * A peak of “COOH group” was not observed.

Reference Example 17
7- (Trifluoroacetyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine 1- (4-methoxybenzyl) -7- (tri Fluoroacetyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (300 mg, 0.73 mmol) in trifluoroacetic acid (10 mL) / chloroform ( The solution was stirred at 55 ° C. for 2 hours. The mixture was adjusted to pH 7 with saturated aqueous sodium hydrogen carbonate solution. The mixture was extracted with 20 mL of dichloromethane, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (155 mg) as a yellow solid (yield 73%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.10-2.17 (m, 2H), 2.76 (t, J = 6.4 Hz, 2H), 3.98-4.01 (m, 2H), 11.73 (br, 1H).

Reference Example 18
3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine 7- (trifluoroacetyl) -3- (trifluoromethyl) -4,5,6 , 7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (429 mg, 1.49 mmol) and lithium hydroxide monohydrate (188 mg, 4.48 mmol) in THF (5 mL) / methanol (5 mL) / water The (2.5 mL) solution was stirred for 2 hours at room temperature. The solvent was concentrated under reduced pressure and the residue was washed with 50 mL of ethyl acetate. The aqueous layer was neutralized with 20 mL of 1N hydrochloric acid and extracted twice with 20 mL of ethyl acetate. The extract was washed with 20 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the title compound (315 mg, containing impurities) as a yellow solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.88-1.92 (m, 2H), 2.64 (t, J = 6.0 Hz, 2H), 3.26-3.29 (m, 2H). * Two “NH group” peaks were not observed.

Reference Example 19
Ethyl [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetate 3- (trifluoromethyl) -4,5,6 , 7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (285 mg, 1.49 mmol) and potassium tert-butoxide (200 mg, 1.79 mmol) in THF (15 mL) while stirring at 0 ° C. -Ethyl bromoacetate (0.18 mL, 1.64 mmol) was added. The mixture was stirred at room temperature overnight. The mixture was washed with 30 mL of 1N hydrochloric acid. The aqueous layer was extracted twice with 200 mL of ethyl acetate. The organic layer was washed with 60 mL of saturated aqueous sodium bicarbonate solution and 60 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to obtain the title compound (86 mg) as a white solid (yield 21%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.30 (t, J = 7.2 Hz, 3H), 1.80-1.85 (m, 2H), 2.63 (t, J = 6. 0 Hz, 2H), 3.24-3.28 (m, 2H), 3.70 (brs, 1H), 4.24 (q, J = 7.2 Hz, 2H), 4.75 (s, 2H) .

Reference Example 20
Ethyl [7-acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetate ethyl [3- (trifluoromethyl ) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetate (86 mg, 0.31 mmol) in 0 ° C. DMF (7 mL) with sodium hydride ( 60% in mineral oil, 19 mg, 0.47 mmol). After 5 minutes, acetic anhydride (0.044 mL, 0.47 mmol) was added. The reaction mixture was warmed to room temperature and stirred overnight. The mixture was extracted with 30 mL diethyl ether, washed twice with 30 mL water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the crude title compound that was used in the next step without purification. .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.26 (t, J = 7.6 Hz, 3H), 1.97-2.03 (m, 2H), 2.25 (s, 3H), 2 .75 (t, J = 6.4 Hz, 2H), 3.67-3.71 (m, 2H), 4.20 (q, J = 7.6 Hz, 2H), 5.03 (s, 2H) .

Reference Example 21
[7-Acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] ethyl synthesized in Reference Example 20 [7- Acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetate and lithium hydroxide monohydrate (51 mg, 1. 2 mmol) in THF (2 mL) / methanol (2 mL) / water (1 mL) was stirred at room temperature for 2 hours. The solvent was concentrated under reduced pressure and the residue was washed with 20 mL of ethyl acetate. The aqueous layer was neutralized with 20 mL of 1N hydrochloric acid and extracted twice with 20 mL of ethyl acetate. The extract was washed with 20 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (72 mg) as a yellow solid (2 step yield 80%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.96-2.01 (m, 2H), 2.74 (s, 3H), 2.88-2.91 (m, 2H), 3.68 -3.72 (m, 2H), 4.99 (s, 2H).

Reference Example 22
To a solution of 2-bromo-N- (5-chloro-2-methoxyphenyl) acetamidobromoacetic acid (2.58 mL, 36 mmol) in dichloromethane (150 mL) was added oxalyl chloride (4.7 mL, 54 mmol) and DMF (1 drop) to 0. The mixture was added at 0 ° C. and stirred for 1 hour in a nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in dichloromethane (72 mL). The reaction solution was added to a mixture of 5-chloro-2-methoxyphenylamine (5.1 g, 32.4 mmol) and triethylamine (6 mL, 0.68 mmol) and stirred at room temperature for 4 hours. 200 mL of dichloromethane was added to the mixture and washed with 50 mL of saturated aqueous sodium hydrogen carbonate solution. The organic layer was washed with 200 mL of water, 100 mL of 1N hydrochloric acid, 100 mL of saturated aqueous sodium hydrogen carbonate solution and 100 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to give the title compound (4.5 g) as a white solid (yield 50%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 3.91 (s, 3H), 4.02 (s, 2H), 6.82 (dd, J = 8.4, 2.4 Hz, 1H), 7 .04-7.08 (m, 1H), 8.38-8.41 (m, 1H), 8.77 (brs, 1H).

Reference Example 23
N- (5-Chloro-2-methoxyphenyl) -2- [7- (trifluoroacetyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-2H-pyrazolo [3,4 b] pyridin-2-yl] acetamide and N- (5-chloro-2-methoxyphenyl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3 4-b] pyridin-1-yl] acetamide 7- (trifluoroacetyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (155 mg , 0.54 mmol), 2-bromo-N- (5-chloro-2-methoxyphenyl) acetamide (180 mg, 0.65 mmol) and potassium tert-butoxide (90 mg The THF (4 mL) solution of 0.81 mmol) was stirred 2 hours at 0 ° C.. The mixture was washed with 10 mL of 1N hydrochloric acid. The aqueous layer was extracted twice with 50 mL of ethyl acetate. The organic layer was washed with 30 mL saturated aqueous sodium hydrogen carbonate solution and 30 mL water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to give N- (5-chloro-2-methoxyphenyl) -2- [7- (trifluoroacetyl)- 3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetamide and N- (5-chloro-2-methoxyphenyl) -2 A mixture (130 mg) of-[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-2-yl] acetamide was obtained as a white solid.

Reference Example 24
To a solution of 3-bromopentane-2,4-dioneacetylacetone (5.00 mL, 48.9 mmol) in carbon tetrachloride (49 mL) was added N-bromosuccinimide (NBS) (9.15 g, 51.4 mmol) and ammonium acetate (377 mg). 4.89 mmol) was added. The reaction mixture was stirred at 80 ° C. for 1.5 hours and cooled to room temperature. The mixture was washed with saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by distillation under reduced pressure (2 torr, 35 ° C.) to give the title compound (6.50 g) as a colorless oil (yield 36%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.34 (6H, s), 4.73 (1H, s).

Reference Example 25
2-Bromopentan-3-one 3-pentanone (5.00 g, 58.1 mmol), NBS (11.3 g, 63.9 mmol) and carbon tetrachloride (58 mL) in a mixture described in the literature (J. Org. Chem. 1997, 62, 8952-8954) sodium hydrogen sulfate-silica gel (5.81 g, 27.4 mmol) was added at room temperature. The reaction mixture was stirred at 80 ° C. for 1.5 hours, cooled to room temperature and filtered. The filtrate was concentrated under reduced pressure, hexane was added to the residue, the precipitated white solid was removed by filtration, and the filtrate was concentrated under reduced pressure to give the title compound (6.97 g) as a brown oil (yield 72%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.11 (3H, t, J = 7.2 Hz), 1.74 (3H, d, J = 6.8 Hz), 2.53-2.64 ( 1H, m), 2.81-2.91 (1H, m), 4.41 (1H, q, J = 6.8 Hz).

Reference Example 26
8-Bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (2.50 g, 10.4 mmol), chloroacetaldehyde (45% aqueous solution) A mixture of 1.99 g, 11.4 mmol) and ethanol (19.0 mL) was refluxed for 24 hours, cooled to room temperature, and concentrated under reduced pressure. The residue was diluted with water (80 mL), washed with saturated aqueous sodium bicarbonate and extracted with dichloromethane (3 × 80 mL). The organic layers were combined, washed with saturated brine (80 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1-1: 2)] to give the title compound (2.33 g) as a yellow solid (yield 85%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 7.61 (1H, s), 7.79 (1H, d, J = 1.2 Hz), 7.82 (1H, d, J = 1.2 Hz) 8.52 (1H, d, J = 1.6 Hz).

Reference Example 27
N- (diphenylmethylidene) -6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine (2 .20 g, 8.30 mmol), benzophenone imine (2.08 mL, 12.4 mmol), tris (dibenzylideneacetone) dipalladium (0) (380 mg, 0.415 mmol), 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl (BINAP) (775 mg, 1.24 mmol), sodium tert-butoxide (1.03 g, 10.7 mmol) and toluene (41.5 mL) were heated at 85 ° C. for 6 hours, Cooled to. The mixture was diluted with dichloromethane, filtered through celite, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1-1: 1)] to give the title compound (2.61 g) as a yellow oil (yield 86%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 6.35 (1H, d, J = 1.6 Hz), 7.18-7.23 (5H, m), 7.42 (2H, t, J = 7.2 Hz), 7.51 (1H, t, J = 7.2 Hz), 7.61 (1H, d, J = 1.2 Hz), 7.67 (1H, d, J = 1.6 Hz), 7.86 (2H, d, J = 1.6 Hz), 8.13 (1H, t, J = 1.6 Hz).

Reference Example 28
6- (Trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (2 Sodium acetate (1.40 g, 17.1 mmol) and hydroxylamine hydrochloride (894 mg, 12.8 mmol) were added at room temperature to a solution of .61 g, 7.14 mmol) in methanol (71.4 mL). The reaction mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1-1: 5)] to give the title compound (812 mg) as a yellow solid (yield 56%).
¹ H NMR (CDCl ₃ , 400 MHz): δ ppm 4.74 (2H, s), 6.41 (1H, d, J = 0.9 Hz), 7.60 (2H, s), 7.97 (1H , T, J = 0.9 Hz).

Reference Example 29
8-Bromo-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (3.00 g, 12.4 mmol), 2- A mixture of bromopropanal (3.41 g, 24.9 mmol), disodium hydrogen phosphate (2.65 g, 18.6 mmol) and n-butanol (25 mL) was stirred at 120 ° C. for 3 days and cooled to room temperature. . The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, washed with saturated brine (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (2.24 g) as a yellow solid (yield 64%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.52 (3H, s), 7.56 (2H, s), 5.20 (1H, s).

Reference Example 30
N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-3-methyl-6- (trifluoromethyl) imidazo [1 , 2-a] pyridine (2.20 g, 7.88 mmol), benzophenone imine (1.98 mL, 11.8 mmol), tris (dibenzylideneacetone) dipalladium (0) (361 mg, 0.394 mmol), BINAP (736 mg) , 1.18 mmol), sodium tert-butoxide (985 mg, 10.2 mmol) and toluene (42.0 mL) were heated at 85 ° C. for 6 hours and cooled to room temperature. The mixture was diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-2: 1)] to give the title compound (2.40 g) as a yellow oil. Obtained (yield 81%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.45 (3H, s), 6.33 (1H, s), 7.19 (5H, s), 7.37-7.47 (4H, m ), 7.82-7.84 (3H, m).

Reference Example 31
3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) imidazo [1,2-a ] Sodium acetate (1.25 g, 15.2 mmol) and hydroxylamine hydrochloride (794 mg, 11.4 mmol) were added to a solution of pyridine-8-amine (2.40 g, 6.35 mmol) in methanol (64.0 mL) at room temperature. It was. The mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (1.06 g) as a yellow solid (yield 78%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.46 (3H, s), 4.72 (2H, brs), 6.39 (1H, d, J = 1.2 Hz), 7.34 (1H , S), 7.68 (1H, s).

Reference Example 32
8-Bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (3.00 g, 12.4 mmol), bromoacetone A mixture of (1.14 mL, 13.6 mmol), disodium hydrogen phosphate (2.65 g, 18.6 mmol) and n-butanol (25 mL) was stirred at 120 ° C. for 3 days and cooled to room temperature. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, washed with saturated brine (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (1.92 g) as a yellow solid (yield 55%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.52 (3H, d, J = 0.8 Hz), 7.52-7.57 (2H, m), 8.40 (1H, d, J = 1.2 Hz).

Reference Example 33
N- (diphenylmethylidene) -2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-2-methyl-6- (trifluoromethyl) imidazo [1 , 2-a] pyridine (1.80 g, 6.45 mmol), benzophenone imine (1.62 mL, 9.68 mmol), tris (dibenzylideneacetone) dipalladium (0) (295 mg, 323 mmol), BINAP (602 mg, 0 .968 mmol), sodium tert-butoxide (806 mg, 8.39 mmol) and toluene (33 mL) were heated at 85 ° C. for 6 h and cooled to room temperature. The mixture was diluted with dichloromethane, filtered through celite, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1-1: 1)] to give the title compound (1.40 g) as a yellow oil (yield 57%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.46 (3H, d, J = 0.8 Hz), 6.20 (1H, d, J = 1.6 Hz), 7.18-7.24 ( 5H, m), 7.34-7.42 (4H, m), 7.84 (1H, s), 7.86 (1H, s), 8.01-8.03 (1H, m).

Reference Example 34
2-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -2-methyl-6- (trifluoromethyl) imidazo [1,2-a ] Sodium acetate (1.25 g, 15.2 mmol) and hydroxylamine hydrochloride (794 mg, 11.4 mmol) were added to a solution of pyridine-8-amine (1.40 g, 3.69 mmol) in methanol (40.0 mL) at room temperature. It was. The mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (689 mg) as a yellow solid (yield 87%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.45 (3H, s), 4.66 (2H, brs), 6.38 (1H, d, J = 1.2 Hz), 7.33 (1H , D, J = 0.8 Hz), 7.87 (1H, d, J = 1.4 Hz).

Reference Example 35
1- [8-Bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-3-yl] ethanone 2-amino-3-bromo-5-trifluoromethylpyridine (2. 00 g, 8.30 mmol), 3-bromopentane-2,4-dione (2.97 g, 16.6 mmol), disodium hydrogen phosphate (1.76 g, 12.4 mmol) and n-butanol (20 mL) Was stirred at 120 ° C. for 3 days and cooled to room temperature. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, washed with saturated brine (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (339 mg) as a brown solid (yield 12%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.68 (3H, s), 2.88 (3H, s), 7.86 (1H, d, J = 1.6 Hz), 10.13 (1H , S).

Reference Example 36
1- [8-Bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-3-yl] ethanol in a mixture of THF (3.00 mL) and methanol (6.00 mL) Of 1- [8-bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-3-yl] ethanone (610 mg, 1.90 mmol) to sodium borohydride (94.0 mg) 2.47 mmol) was added at room temperature. The reaction mixture was stirred for 1 hour at room temperature and quenched with water. After concentration under reduced pressure, the residue was diluted with water (15 mL) and extracted with dichloromethane (3 × 15 mL). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure to give the title compound (650 mg, quantitative), which was used in the next reaction without purification.
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.64 (3H, d, J = 6.8 Hz), 2.31 (3H, s), 5.35 (1H, q, J = 6.8 Hz) 7.51 (1H, d, J = 1.2 Hz), 8.88 (1H, s). * OH peak was not observed.

Reference Example 37
8-Bromo-3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 1- [8-bromo-2-methyl-6- (trifluoromethyl) imidazo [1, To a solution of 2-a] pyridin-3-yl] ethanol (550 mg, 1.70 mmol) in trifluoroacetic acid (2.62 mL, 34.0 mmol) was added triethylsilane (1.69 mL, 10.2 mmol) at 0 ° C. . The reaction mixture was stirred for 1 hour at room temperature and then heated to 80 ° C. for 16 hours under an argon atmosphere. After concentration under reduced pressure, the residue was dissolved in ethyl acetate (50 mL) and neutralized with a saturated aqueous solution. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (7: 1-4: 1)] to give the title compound (472 mg) as a white solid (yield 90%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.26 (3H, t, J = 7.6 Hz), 2.50 (3H, s), 2.92 (2H, q, J = 7.6 Hz) 7.53 (1H, d, J = 1.2 Hz), 8.18 (1H, t, J = 1.2 Hz).

Reference Example 38
N- (diphenylmethylidene) -3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-3-ethyl-2-methyl-6- (Trifluoromethyl) imidazo [1,2-a] pyridine (550 mg, 1.79 mmol), benzophenone imine (451 μl, 2.69 mmol), tris (dibenzylideneacetone) dipalladium (0) (42.0 mg, 0. 179 mmol), BINAP (167 mg, 0.269 mmol), sodium tert-butoxide (224 mg, 2.32 mmol) and toluene (9 mL) were heated at 85 ° C. for 6 hours and cooled to room temperature. The mixture was diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (700 mg) as a yellow oil. (Yield 96%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.23 (3H, t, J = 7.6 Hz), 2.45 (3H, s), 2.88 (2H, q, J = 7.6 Hz) 6.16 (1H, d, J = 1.6 Hz), 7.18-7.25 (4H, m), 7.36-7.52 (5H, m), 7.82-7.85 ( 2H, m).

Reference Example 39
3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -3-ethyl-2-methyl-6- (trifluoromethyl ) A solution of imidazo [1,2-a] pyridin-8-amine (700 mg, 1.71 mmol) in methanol (17.0 mL) with sodium acetate (338 mg, 4.12 mmol) and hydroxylamine hydrochloride (215 mg, 3.09 mmol) Was added at room temperature. The reaction mixture was stirred for 6 hours at room temperature and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (25 mL) and dichloromethane (25 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1-1: 5)] to give the title compound (319 mg) as a yellow solid (yield 76%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.23 (3H, t, J = 7.6 Hz), 2.45 (3H, s), 2.88 (2H, q, J = 7.6 Hz) 4.62 (2H, brs), 6.38 (1H, d, J = 1.6 Hz), 7.68 (1H, d, J = 1.2 Hz).

Reference Example 40
8-bromo-2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (500 mg, 2.07 mmol), A mixture of 2-bromopentan-3-one (856 mg, 5.19 mmol), titanium tetrachloride (171 μL, 1.55 mmol), and triethylamine (173 μl, 1.24 mmol) and chloroform (2.0 mL) was stirred while stirring. Microwave irradiation at 25 ° C. for 25 minutes. The reaction mixture was diluted with dichloromethane (15 mL) and 10% aqueous potassium carbonate (15 mL). The aqueous layer was extracted with dichloromethane (2 × 15 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-5: 1)] to give the title compound (505 mg) as a yellow solid (yield 79%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.30 (3H, t, J = 7.6 Hz), 2.45 (3H, s), 2.82 (2H, q, J = 7.6 Hz) 7.51 (1H, d, J = 1.6 Hz), 8.12 (1H, t, J = 1.2 Hz).

Reference Example 41
N- (diphenylmethylidene) -2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-2-ethyl-3-methyl-6- (Trifluoromethyl) imidazo [1,2-a] pyridine (560 mg, 1.82 mmol), benzophenone imine (459 μl, 2.74 mmol), tris (dibenzylideneacetone) dipalladium (0) (42.7 mg, 0.82 mmol). 182 mmol), BINAP (341 mg, 0.547 mmol), sodium tert-butoxide (228 mg, 2.37 mmol) and toluene (9 mL) were heated at 85 ° C. for 6 hours and cooled to room temperature. The mixture was diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (4: 1-2: 1)] to give the title compound (708 mg) as a yellow oil. (Yield 95%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.26 (3H, t, J = 7.6 Hz), 2.40 (3H, s), 2.79 (2H, q, J = 7.6 Hz) 6.27 (1H, d, J = 1.6 Hz), 7.17-7.24 (4H, m), 7.38-7.52 (5H, m), 7.78-7.85 ( 2H, m).

Reference Example 42
2-Ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -2-ethyl-3-methyl-6- (trifluoromethyl ) A solution of imidazo [1,2-a] pyridin-8-amine (708 mg, 1.73 mmol) in methanol (30 mL) was added sodium acetate (342 mg, 4.15 mmol) and hydroxylamine hydrochloride (217 mg, 3.13 mmol) at room temperature. Added in. The mixture was stirred for 6 hours at room temperature and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (25 mL) and dichloromethane (25 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1-1: 5)] to give the title compound (339 mg) as a yellow solid (yield 68%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.30 (3H, t, J = 7.6 Hz), 2.41 (3H, s), 2.77 (2H, q, J = 7.6 Hz) 4.63 (2H, brs), 6.39 (1H, d, J = 1.6 Hz), 7.64 (1H, t, J = 1.2 Hz).

Reference Example 43
8-bromo-2,3-dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (3.00 g, 12.4 mmol), A mixture of 3-bromobutan-2-one (2.76 g, 18.2 mmol), disodium hydrogen phosphate (3.53 g, 23.9 mmol) and n-butanol (33.0 mL) was stirred at 120 ° C. for 3 days. And cooled to room temperature. The reaction mixture was diluted with water (75 mL) and extracted with ethyl acetate (3 × 75 mL). The organic layers were combined, washed with saturated brine (75 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-2: 1)] to give the title compound (3.40 g) as a yellow solid (yield 69%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.46 (3H, s), 2.50 (3H, s), 7.54 (1H, s), 8.14 (1H, s).

Reference Example 44
N- (diphenylmethylidene) -2,3-dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-2,3-dimethyl-6- (trifluoromethyl) ) Imidazo [1,2-a] pyridine (1.42 g, 4.85 mmol), benzophenone imine (1.22 mL, 7.27 mmol), tris (dibenzylideneacetone) dipalladium (0) (222 mg, 0.242 mmol) , BINAP (453 mg, 0.727 mmol), sodium tert-butoxide (605 mg, 6.30 mmol) and toluene (25.0 mL) were heated at 85 ° C. for 6 hours and cooled to room temperature. The mixture was diluted with dichloromethane, filtered through celite, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (1.34 g) as a yellow oil (yield 70%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.40 (3H, s), 2.43 (3H, s), 6.18 (1H, d, J = 1.2 Hz), 7.18-7 .25 (5H, m), 7.36-7.42 (2H, m), 7.46-7.52 (1H, m), 7.76-7.85 (3H, m).

Reference Example 45
2,3-Dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -2,3-dimethyl-6- (trifluoromethyl) imidazo [1 , 2-a] Pyridin-8-amine (1.32 g, 3.36 mmol) in methanol (34.0 mL) was added sodium acetate (661 mg, 8.05 mmol) and hydroxylamine hydrochloride (420 mg, 6.04 mmol) at room temperature. Added in. The reaction mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 4)] to give the title compound (397 mg) as a yellow solid (yield 51%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.40 (3H, s), 2.42 (3H, s), 4.61 (2H, s), 6.40 (1H, d, J = 1) .6 Hz), 7.63 (1H, t, J = 1.6 Hz).

Reference Example 46
2-Hydrazino-5- (trifluoromethyl) pyridine 2-chloro-5- (trifluoromethyl) pyridine (20.0 g, 110 mmol) in ethanol (370 mL) in hydrazine monohydrate (10.8 mL, 220 mmol) Was added at room temperature. The resulting reaction mixture was refluxed for 6 hours and then concentrated under reduced pressure to give the title compound (18.5 g, 95%) as a yellow oil, which was used in the next step without purification.
¹ H NMR (400 MHz, DMSO-d ₆ ): δ ppm 5.63 (2H, brs), 6.82 (1H, d, J = 8.8 Hz), 7.70 (1H, dd, J = 8. 8, 1.6 Hz), 8.27 (1H, s), 8.28 (1H, brs).

Reference Example 47
3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 2-hydrazino-5- (trifluoromethyl) pyridine (18.5 g, 104 mmol) and acetic acid (500 mL ) Was refluxed for 24 hours and then concentrated under reduced pressure. The residue was partitioned between ethyl acetate (100 mL) and water (100 mL). The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution (100 mL) and saturated brine (100 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: ethyl acetate only] to give the title compound (16.0 g)
Was obtained as a yellow solid (76% yield).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.83 (3H, s), 7.37 (1H, dd, J = 10.0, 1.6 Hz), 7.86 (1H, d, J = 9.6 Hz), 8.25 (1H, d, J = 1.2 Hz).

Reference Example 48
8-Bromo-3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 3-methyl-6- (trifluoromethyl) [1,2,4] triazolo To a solution of [4,3-a] pyridine (16.0 g, 80.0 mmol) in acetonitrile (260 mL) was added NBS (17.0 g, 95 mmol) at room temperature. The reaction mixture was refluxed for 6 hours, cooled to room temperature, and then quenched with water (100 mL). The mixture was extracted with ethyl acetate (150 mL), washed with water (3 × 150 mL), dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1)] to give the title compound (8.00 g) as a yellow solid (yield 36%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.84 (3H, s), 7.63 (1H, d, J = 1.2 Hz), 8.27 (1H, t, J = 1.2 Hz) .

Reference Example 49
N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine 8-bromo-3-methyl-6- ( Trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine (1.50 g, 5.36 mmol), benzophenone imine (1.35 mL, 8.03 mmol), tris (dibenzylideneacetone) dipalladium A mixture of (0) (1.47 g, 1.61 mmol), BINAP (2.00 g, 3.21 mmol) sodium tert-butoxide (0.720 g, 7.50 mmol) and toluene (26.8 mL) at 85 ° C. Heated for 3 hours. The reaction mixture was cooled to room temperature, diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1)] to give the title compound (430 mg) as a yellow solid (yield 21%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.76 (3H, s), 6.37 (1H, d, J = 1.6 Hz), 7.24-7.27 (5H, m), 7 .39-7.46 (2H, m), 7.50-7.54 (1H, m), 7.83 (1H, t, J = 1.2 Hz), 7.82-7.89 (2H, m).

Reference Example 50
3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) To a solution of [1,2,4] triazolo [4,3-a] pyridin-8-amine (430 mg, 1.13 mmol) in methanol (10 mL), sodium acetate (223 mg, 2.71 mmol) and hydroxylamine hydrochloride (141 mg, 2.04 mmol) was added at room temperature. The reaction mixture was stirred at room temperature for 5 hours and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: ethyl acetate only] to give the title compound (100 mg) as a white solid (yield 41%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.77 (3H, s), 5.17 (2H, brs), 6.38 (1H, d, J = 1.2 Hz), 7.66 (1H , T, J = 1.2 Hz).

Reference Example 51
5-Bromo-3-nitropyridin-2-amine 5-bromopyridin-2-amine (10 g, 57.8 mmol) was added to concentrated sulfuric acid (60 mL) at −6 ° C., and nitric acid (3 mL) was added at the same temperature. Slowly dropped. The reaction solution was stirred at 0 ° C. for 90 minutes and then warmed to room temperature over 2 hours. The reaction solution was poured into ice water (300 mL) and adjusted to pH 8 using 50% aqueous sodium hydroxide solution. The precipitated crystals were collected by filtration and washed with water and diethyl ether to give the title compound (10.1 g) (yield 81%).
¹ H NMR (400 MHz, CD ₃ OD): δ ppm 7.20 (d, J = 1.6 Hz, 1H), 7.32 (d, J = 2.0 Hz, 1H). (* "NH group" peak not observed )

Reference Example 52
5-Bromopyridine-2,3-diamine
Tin (II) chloride (52 g, 233 mmol) was added to a mixture of 5-bromo-3-nitropyridin-2-amine (10.1 g, 46.5 mmol) and ethanol (150 mL), and the mixture was stirred for 2 hours while heating under reflux. . The reaction mixture was concentrated under reduced pressure, water (200 mL) was added to the residue, and the mixture was extracted with ethyl acetate (200 mL). The organic layer was washed with 10% aqueous sodium hydroxide solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / diethyl ether (10: 1)] to give the title compound (8.6 g) as a yellow solid (yield 99%).
¹ H NMR (400 MHz, DMSO-d ₆ ): δ ppm 5.00 (s, 2H), 5.60 (s, 2H), 6.81 (d, J = 2.0 Hz, 1H), 7.28 (d, J = 2.4 Hz, 1H).

Reference Example 53
6-Bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-amine
5-bromopyridine-2,3-diamine (1.0 g, 5.3 mmol), 3-bromobutan-2-one (2.41 g, 15.9 mmol), 2,6-lutidine (1.7 g, 15.9 mmol) ) And acetonitrile (55 mL) were stirred for 36 hours under heating to reflux (adding one equivalent of 3-bromobutan-2-one and 2,6-lutidine every 12 hours). After cooling to room temperature, the crystals were collected by filtration to give the title compound (1.13 g) as a brown solid (yield 90%).
^{1 H NMR (400 MHz, DMSO} -d 6): δ ppm 2.44 (s, 3H), 2.46 (s, 3H), 6.41 (br s, 2H), 7.03 (s, 1H), 8.22 (d, J = 1.6 Hz, 1H).

Reference Example 54
Di-tert-butyl (6-bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) imidodicarbonate
6-bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-amine (2 g, 8.33 mmol), dicarbonate-di-tert-butyl (5.44 g, 25 mmol), 4-dimethylamino A mixture of pyridine (4.1 g, 33 mmol) and chloroform (80 mL) was stirred overnight with heating under reflux. The reaction mixture was washed with 1N hydrochloric acid (100 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by basic silica gel column chromatography [developing solvent: chloroform] to give the title compound (3.1 g) as a white solid (yield 86%).
¹ H NMR (400 MHz, CDCl ₃ ): δ 1.47 (s, 18H), 2.41 (s, 3H), 2.42 (s, 3H), 7.10 (d, J = 1.2 Hz, 1H), 7.90 (d, J = 1.2 Hz, 1H).

Reference Example 55
6-Cyclopropyl-2,3-dimethylimidazo [1,2-a] pyridin-8-aminedi-tert-butyl (6-bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-yl ) Imidodicarbonate (400 mg, 0.91 mmol), cyclopropylboronic acid (936 mg, 10.9 mmol), 1,1′-bis (diphenylphosphino) ferrocene] dichloropalladium (120 mg, 0.27 mmol), potassium carbonate (1.5 g, 10.9 mmol), 1,2-dimethoxyethane (16 mL) and water (4 mL) were stirred overnight under a nitrogen atmosphere at reflux (cyclopropylboronic acid (0. 4 equivalents), 1,1′-bis (diphenylphosphino) ferrocene] dichloropalladium (0.1 equivalent), potassium carbonate (0.4 equivalent) was added). The reaction solution was extracted with chloroform (100 mL), and the organic layer was washed twice with water (100 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. A hydrochloric acid / methanol solution (100 mL) was added to the obtained residue, and the mixture was stirred at room temperature for 3 hours. The mixture was concentrated under reduced pressure, 10% aqueous sodium carbonate solution was added to the residue, and the mixture was extracted with chloroform (20 mLX2). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by basic silica gel column chromatography [developing solvent: chloroform / petroleum ether (1: 4)] to obtain the title compound (66 mg) as a white solid (yield 67%).
¹ H NMR (400 MHz, CDCl ₃ ): δ 0.65-0.70 (m, 2H), 0.90-0.95 (m, 2H), 1.85-1.89 (m, 1H), 2.36 (s, 3H), 2.41 (s, 3H), 4.37 (s, 2H), 6.09 (s, 1H), 7.15 (s, 1H).

Example 1
Methyl 4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoate

Methyl 4-{[5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] methyl} benzoate (compound of Reference Example 4) (1.3 g, 3.6 mmol) and triphenylphosphine (1.9 g, 7.2 mmol) in THF (36 mL) were added diisopropyl azodicarboxylate (DIAD) (1.4 mL, 7.2 mmol) and the mixture was added at 0 ° C. for 1 hour. Stir for hours and concentrate under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / diethyl ether (7: 3)] to give the title compound (500 mg) as a white solid (yield 41%).
MS Found: 341 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.94-2.01 (m, 2H), 2.64 (t, J = 4.2 Hz, 2H), 3.90 (s, 3H), 4 .27-4.30 (m, 2H), 5.20 (s, 2H), 7.26-7.29 (m, 2H), 8.00 (dt, J = 6.6, 1.5 Hz, 2H).

Example 2
4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid

Methyl 4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoate (480 mg, 1.41 mmol) and lithium hydroxide mono Hydrate (178 mg, 4.23 mmol) in THF (2.8 mL) / methanol (2.8 mL) / water (1.4 mL) was stirred at room temperature for 1.5 hours. The solvent was concentrated under reduced pressure and the residue was washed with 50 mL of ethyl acetate. The aqueous layer was neutralized with 20 mL of 1N hydrochloric acid and extracted twice with 10 mL of ethyl acetate. The extract was washed with 40 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (400 mg) as a white solid (yield 87%).
MS Found: 327 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.96-2.00 (m, 2H), 2.65 (t, J = 6.0 Hz, 2H), 4.27-4.31 (m, 2H), 5.22 (s, 2H), 7.30 (d, J = 8.7 Hz, 2H), 8.06 (dd, J = 6.6, 1.5 Hz, 2H). * A peak of “COOH group” was not observed.

Example 3
N, N-dimethyl-4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide
4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (100 mg, 0.31 mmol) in dichloromethane (3.2 mL) ) Solution with diisopropylethylamine (DIEA) (0.34 mL, 1.86 mmol), dimethylamine hydrochloride (78 mg, 0.94 mmol), 1-hydroxybenzotriazole (HOBt, 127 mg, 0.94 mmol) and 1- (3- Dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDCI, 191 mg, 0.94 mmol) was added at 0 ° C., and the mixture was stirred overnight at room temperature under a nitrogen atmosphere. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 20 mL of water, 10 mL of 1N hydrochloric acid, 10 mL of saturated aqueous sodium hydrogen carbonate solution and 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative thin phase chromatography (TLC) (petroleum ether / ethyl acetate = 2: 1) to give the title compound (70 mg) as a yellow solid (yield 64%).
^{MS Found: 354 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.93-2.01 (m, 2H), 2.64 (t, J = 6.0 Hz, 2H), 2.95 (brs, 3H), 3 .10 (brs, 3H), 4.27-4.30 (m, 2H), 5.16 (s, 2H), 7.23-7.26 (m, 2H), 7.37 (dt, J = 8.4, 1.8 Hz, 2H).

Example 4
N, N-diethyl-4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (100 mg, 0.31 mmol) in dichloromethane (3.2 mL) ) DIEA (0.34 mL, 1.86 mmol), diethylamine (0.1 mL, 0.94 mmol), HOBt (127 mg, 0.94 mmol) and EDCI (191 mg, 0.94 mmol) were added to the solution at 0 ° C. and nitrogen atmosphere The mixture was stirred overnight at room temperature. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 20 mL of water, 10 mL of 1N hydrochloric acid, 10 mL of saturated aqueous sodium hydrogen carbonate solution and 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (90 mg) as a yellow gel (yield 76%).
^{MS Found: 382 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.09-1.28 (m, 6H), 1.96-1.99 (m, 2H), 2.64 (t, J = 6.0 Hz, 2H), 3.17-3.28 (m, 2H), 3.42-3.58 (m, 2H), 4.28 (t, J = 5.4 Hz, 2H), 5.16 (s, 2H), 7.24 (dd, J = 6.3, 1.8 Hz, 2H), 7.32 (dd, J = 6.3, 1.8 Hz, 2H).

Example 5
N- (1-methylethyl) -4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (100 mg, 0.31 mmol) in dichloromethane (3.2 mL) ) To the solution was added DIEA (0.34 mL, 1.86 mmol), isopropylamine (0.1 mL, 0.94 mmol), HOBt (127 mg, 0.94 mmol) and EDCI (191 mg, 0.94 mmol) at 0 ° C. The mixture was stirred overnight at room temperature under a nitrogen atmosphere. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 20 mL of water, 10 mL of 1N hydrochloric acid, 10 mL of saturated aqueous sodium hydrogen carbonate solution and 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (90 mg) as a white solid (yield 79%).
^{MS Found: 368 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.24 (d, J = 6.3 Hz, 6H), 1.95-1.98 (m, 2H), 2.63 (t, J = 6. 3 Hz, 2H), 4.25-4.29 (m, 3H), 5.17 (s, 2H), 5.88 (d, J = 4.8 Hz, 1H), 7.27 (dd, J = 6.3, 1.8 Hz, 2H), 7.69 (dd, J = 6.3, 1.8 Hz, 2H).

Example 6
1- [4- (Pyrrolidin-1-ylcarbonyl) benzyl] -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

4-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (100 mg, 0.31 mmol) in dichloromethane (3.2 mL) ) DIEA (0.34 mL, 1.86 mmol), pyrrolidine (0.1 mL, 0.94 mmol), HOBt (127 mg, 0.94 mmol) and EDCI (191 mg, 0.94 mmol) were added to the solution at 0 ° C. and nitrogen atmosphere The mixture was stirred overnight at room temperature. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 20 mL of water, 10 mL of 1N hydrochloric acid, 10 mL of saturated aqueous sodium hydrogen carbonate solution and 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (25 mg) as a yellow solid (yield 21%).
^{MS Found: 380 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.83 to 2.02 (m, 6H), 2.61-2.66 (m, 2H), 3.40 (t, J = 6.6 Hz, 2H), 3.61-3.65 (m, 2H), 4.26-4.30 (m, 2H), 5.15 (s, 2H), 7.24 (dd, J = 6.3) 2.1 Hz, 2H), 7.47 (dd, J = 6.3, 2.1 Hz, 2H).

Example 7
Methyl 3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoate

Methyl 3-{[5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] methyl} benzoate (compound of Reference Example 7) (350 mg, 0. To a solution of 98 mmol) and triphenylphosphine (514 mg, 1.96 mmol) in THF (36 mL) was added DIAD (0.38 mL, 1.96 mmol). The mixture was stirred at 0 ° C. for 1 hour and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / diethyl ether (7: 3)] to give the title compound (239 mg) as a white solid (yield 72%).
MS Found: 341 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.94-2.01 (m, 2H), 2.62-2.66 (m, 2H), 3.92 (s, 3H), 4.28 -4.31 (m, 2H), 5.18 (s, 2H), 7.38-7.43 (m, 2H), 7.95-7.98 (m, 2H).

Example 8
3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid

Methyl 3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoate (267 mg, 0.78 mmol), and lithium hydroxide A solution of monohydrate (98 mg, 2.36 mmol) in THF (2.0 mL) / methanol (2.0 mL) / water (1.0 mL) was stirred at room temperature for 1.5 hours. The solvent was concentrated under reduced pressure and the residue was washed with 30 mL of ethyl acetate. The aqueous layer was neutralized with 10 mL of 1N hydrochloric acid and extracted twice with 20 mL of ethyl acetate. The extract was washed with 20 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (256 mg) as a white solid (quantitative).
MS Found: 325 (M ⁺ -H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.95-2.03 (m, 2H), 2.65 (t, J = 6.3 Hz, 2H), 4.31 (t, J = 5. 1 Hz, 2H), 5.22 (s, 2H), 7.44-7.49 (m, 2H), 8.02-8.05 (m, 2H). * A peak of “COOH group” was not observed.

Example 9
N, N-dimethyl-3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (150 mg, 0.46 mmol) in dichloromethane (5 mL) DIEA (0.50 mL, 2.76 mmol), dimethylamine hydrochloride (117 mg, 1.38 mmol), HOBt (127 mg, 1.38 mmol) and EDCI (287 mg, 1.38 mmol) were added at 0 ° C. under a nitrogen atmosphere. Stir overnight at room temperature. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 15 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 30 mL water, 15 mL 1N hydrochloric acid, 15 mL saturated aqueous sodium hydrogen carbonate solution and 15 mL saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (160 mg) as a brown gel (quantitative).
^{MS Found: 354 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.86-1.93 (m, 2H), 2.56 (t, J = 6.3 Hz, 2H), 2.87 (s, 3H), 3 .03 (s, 3H), 4.21 (t, J = 5.1 Hz, 2H), 5.08 (s, 2H), 7.19-7.32 (m, 4H).

Example 10
N, N-diethyl-3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (100 mg, 0.31 mmol) in dichloromethane (3.2 mL) ) DIEA (0.34 mL, 1.86 mmol), diethylamine (0.1 mL, 0.94 mmol), HOBt (127 mg, 0.94 mmol) and EDCI (191 mg, 0.94 mmol) were added to the solution at 0 ° C. and nitrogen atmosphere The mixture was stirred overnight at room temperature. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 20 mL of water, 10 mL of 1N hydrochloric acid, 10 mL of saturated aqueous sodium hydrogen carbonate solution and 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (72 mg) as a yellow gel (yield 61%).
^{MS Found: 382 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.05-1.26 (m, 6H), 1.92-1.96 (m, 2H), 2.59-2.61 (m, 2H) 3.19 (brs, 2H), 3.51 (brs, 2H), 4.24-4.27 (m, 2H), 5.13 (s, 2H), 7.19-7.34 (m , 4H).

Example 11
N- (1-methylethyl) -3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (100 mg, 0.31 mmol) in dichloromethane (3.2 mL) ) To the solution was added DIEA (0.34 mL, 1.86 mmol), isopropylamine (0.1 mL, 0.94 mmol), HOBt (127 mg, 0.94 mmol) and EDCI (191 mg, 0.94 mmol) at 0 ° C. The mixture was stirred overnight at room temperature under a nitrogen atmosphere. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 20 mL of water, 10 mL of 1N hydrochloric acid, 10 mL of saturated aqueous sodium hydrogen carbonate solution and 10 mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (77 mg) as a white solid (68% yield).
^{MS Found: 368 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.25 (d, J = 6.0 Hz, 6H), 1.91-2.00 (m, 2H), 2.61 (t, J = 6. 3Hz, 2H), 4.21-4.29 (m, 3H), 5.13 (s, 2H), 6.10 (br, 1H), 7.33-7.38 (m, 2H), 7 .63-7.66 (m, 2H).

Example 12
1- [3- (Pyrrolidin-1-ylcarbonyl) benzyl] -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (200 mg, 0.61 mmol) in dichloromethane (6 mL) DIEA (0.66 mL, 3.68 mmol), pyrrolidine (0.2 mL, 1.83 mmol), HOBt (254 mg, 1.83 mmol) and EDCI (382 mg, 1.83 mmol) were added at 0 ° C. under a nitrogen atmosphere. Stir at room temperature overnight. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 20 mL of saturated aqueous sodium hydrogen carbonate solution. The aqueous layer was washed with 40 mL water, 20 mL 1N hydrochloric acid, 20 mL saturated aqueous sodium hydrogen carbonate solution and 20 mL saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (210 mg) as a yellow gel (yield 91%).
^{MS Found: 380 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.84-1.99 (m, 6H), 2.60-2.64 (m, 2H), 3.36-3.41 (m, 2H) 3.60-3.64 (m, 2H), 4.26-4.30 (m, 2H), 5.16 (s, 2H), 7.28-7.46 (m, 4H).

Example 13
3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (130 mg, 0.40 mmol) in dichloromethane (2 mL) Was added with oxalyl chloride (0.052 mL, 0.60 mmol) and DMF (1 drop) at room temperature and stirred for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in 2 mL of THF. The above acid chloride solution was added to aqueous ammonia (28%, 0.2 mL) at room temperature, and the mixture was stirred at room temperature for 5 hours. The mixture was washed with 10 mL of 1N hydrochloric acid. The aqueous layer was extracted with 20 mL ethyl acetate. The organic layer was washed with 20 mL of saturated aqueous sodium hydrogen carbonate solution and 20 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 1: 1) to give the title compound (105 mg) as a white solid (yield 81%).
MS Found: 326 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.95-1.99 (m, 2H), 2.63 (t, J = 6.0 Hz, 2H), 4.28-4.31 (m, 2H), 5.17 (s, 2H), 5.00-5.50 (brs, 1H), 6.00-6.30 (1H, brs), 7.40-7.42 (m, 2H) , 7.72-7.73 (m, 2H).

Example 14
N-methyl-3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide

3-{[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzoic acid (130 mg, 0.40 mmol) in dichloromethane (2 mL) Oxalyl chloride (0.052 mL, 0.60 mmol) and DMF (1 drop) were added at room temperature and stirred for 1 hour. The reaction mixture was concentrated under reduced pressure and the residue was added to 2 mL of THF. To the methylamine solution (40%, 0.2 mL in H ₂ O) was added the above acid chloride solution at room temperature and the mixture was stirred at room temperature for 5 hours. The mixture was washed with 10 mL of 1N hydrochloric acid. The aqueous layer was extracted twice with 20 mL of ethyl acetate. The organic layer was washed with 20 mL of saturated aqueous sodium hydrogen carbonate solution and 20 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 1: 1) to give the title compound (80 mg) as a white solid (yield 59%).
^{MS Found: 340 (M + +} H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.95-2.00 (m, 2H), 2.62 (t, J = 6.0 Hz, 2H), 3.00 (d, J = 4. 8 Hz, 3H), 4.27-4.30 (m, 2H), 5.16 (s, 2H), 6.30 (brs, 1H), 7.37-7.39 (m, 2H), 7 .66-7.68 (m, 2H).

Example 15
5,6-Dimethyl-2-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} thieno [2,3-d] pyrimidine -4 (3H)-ON

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (80 mg, 0.32 mmol) in dichloromethane (2 mL) Oxalyl chloride (0.055 mL, 0.64 mmol) and DMF (1 drop) were added to the solution at room temperature and stirred for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in 1 mL of N, N-dimethylacetamide (DMA). The prepared acid chloride in DMA was added to a solution of 2-amino-4,5-dimethylthiophene-3-carboxamide (63 mg, 0.32 mmol) in DMA (2 mL) at 0 ° C., and the mixture was stirred at room temperature overnight. . Water was added to the mixture and stirred at room temperature for 3 hours. The resulting solid was collected by filtration and washed with water to give the title compound (82 mg) as a brown solid (yield 67%).
MS Found: 383 (M ⁺ -H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.03 to 2.09 (m, 2H), 2.18 (s, 3H), 2.29 (s, 3H), 2.71 (t, J = 6.0 Hz, 2H), 4.42 (t, J = 4.8 Hz, 2H), 4.89 (s, 2H), 5.37 (brs, 1H).

Example 16
Methyl 4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzoate

3- (trifluoroacetyl) piperidin-2-one (565 mg, 2.9 mmol) (compound of reference example 13), methyl 4- (hydrazinomethyl) benzoate (compound of reference example 3) (522 mg, 2.9 mmol) ), Toluene (50 mL) and p-toluenesulfonic acid monohydrate (23 mg, 0.05 mmol) were refluxed for 4 hours and then concentrated under reduced pressure. THF (30 mL) and Lawesson's reagent (1.2 g, 2.9 mmol) were added to the residue, and the mixture was stirred at room temperature for 15 minutes, and then the mixture was stirred overnight with heating under reflux. The solution was cooled to room temperature, silica gel (10 g) was added, the mixture was concentrated, and washed with a short silica gel column (acetic acid / ethyl acetate / petroleum ether = 2: 18: 80). The solution was concentrated, and the product was purified by silica gel flash column chromatography [developing solvent: ethyl acetate / petroleum ether (10:90) -acetic acid / ethyl acetate / petroleum ether (2:13:85) to purify the title compound ( 570 mg) was obtained as an orange solid (58% yield).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.72-1.81 (m, 2H), 2.62 (t, J = 6.0 Hz, 2H), 3.16-3.21 (m, 2H), 3.91 (s, 3H), 5.21 (s, 2H), 6.09 (s, 1H), 7.20 (d, J = 8.4 Hz, 2H), 8.01 (d, J = 8.4 Hz, 2H).

Example 17
4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzoic acid

Methyl 4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzoate (570 mg, 1.7 mmol) Lithium hydroxide monohydrate (430 mg, 10.2 mmol) was added to a THF (8 mL) / methanol (8 mL) / water (8 mL) solution and stirred at room temperature for 3 hours, and then 2N hydrochloric acid (10 mL) was added to the solution. And extracted three times with ethyl acetate (20 mL). The organic layer was washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give the title compound (405 mg) as an orange solid (yield 73%).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ ppm 1.73-1.75 (m, 2H), 2.48-2.53 (m, 2H), 3.13-3.17 (m, 2H), 5.21 (s, 2H), 6.09 (s, 1H), 7.25 (d, J = 8.4 Hz, 2H) 7.91 (d, J = 8.4 Hz, 2H). (* "COOH group" peak was not observed.)

Example 18
N, N-diethyl-4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzamide

4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzoic acid (compound of Example 17) ( 300 mg, 0.92 mmol) in dichloromethane (9 mL) was cooled to 0 ° C., then diisopropylethylamine (0.96 mL, 5.6 mmol), diethylamine (0.30 mL, 2.8 mmol), HOBt (378 mg, 2.8 mmol) , EDCI (540 mg, 2.8 mmol) was added. After stirring at room temperature for 24 hours, the mixture was washed with a saturated aqueous sodium hydrogen carbonate solution (10 mL). The aqueous layer was extracted twice with ethyl acetate (20 mL). The organic layer was washed with water (10 mL), 1N hydrochloric acid (10 mL), water (10 mL), saturated aqueous sodium hydrogen carbonate solution (5 mL), then saturated brine (10 mL), and dried over anhydrous sodium sulfate. The residue was purified by chromatography [developing solvent: dichloromethane / methanol (100: 0-98: 3)] to give the title compound (278 mg) as orange crystals (yield 80%).
MS Found: 381 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.06-1.15 (m, 3H), 1.16-1.30 (m, 3H), 1.75-1.80 (m, 2H) , 2.61 (t, J = 6.2 Hz, 2H), 3.14-3.19 (m, 4H), 3.20-3.26 (m, 1H), 3.50-3.55 ( m, 2H), 5.17, (s, 2H), 7.16 (d, J = 8.1 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H).

Example 19
7-Methyl-1- [4- (pyrrolidin-1-ylcarbonyl) benzyl] -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine

4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzoic acid (compound of Example 17) ( After cooling a solution of 100 mg, 0.30 mmol) in dichloromethane (3 mL) to 0 ° C., diisopropylethylamine (0.32 mL, 1.8 mmol), pyrrolidine (0.077 mL, 0.92 mmol), HOBt (124 mg, 2.8 mmol) , And EDCI (177 mg, 2.8 mmol) were added. After stirring at room temperature for 24 hours, the mixture was washed with a saturated aqueous sodium hydrogen carbonate solution (10 mL). The aqueous layer was extracted twice with ethyl acetate (20 mL). The organic layer was washed with water (10 mL), 1N hydrochloric acid (10 mL), water (10 mL), saturated aqueous sodium hydrogen carbonate solution (5 mL), then saturated brine (10 mL), and dried over anhydrous sodium sulfate. Concentration under reduced pressure gave 1- [4- (pyrrolidin-1-ylcarbonyl) benzyl] -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4 as the crude product. -B] Pyridine (75 mg) was obtained as an orange oil (yield 66%).
The resulting 1- [4- (pyrrolidin-1-ylcarbonyl) benzyl] -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (70 mg , 0.19 mmol) in DMF (1.2 mL) was cooled to 0 ° C. and then sodium hydride (11 mg, 0.28 mmol, 60% in mineral oil) was added. After 5 minutes, iodomethane DMF solution (0.5 mL, 0.22 mmol, 0.43 M) was added. The reaction mixture was allowed to warm to room temperature and stirred overnight. Water was added to the reaction solution, followed by extraction with ethyl acetate (20 mL), and the organic layer was dried over anhydrous sodium sulfate. The residue was purified by preparative TLC (dichloromethane / methanol = 98.5: 1.5) to give the title compound (25 mg) as a yellow oil (yield 34%).
MS Found: 393 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.75-1.96 (m, 6H), 2.57 (s, 3H), 2.59 (t, J = 6.3 Hz, 2H), 3 .02-3.06 (m, 2H), 3.39 (t, J = 6.6 Hz, 2H), 3.63 (t, J = 6.9 Hz, 2H), 5.29 (s, 2H) 7.15 (m, 2H), 7.47 (m, 2H).

Example 20
N, N-diethyl-4-{[7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} Benzamide

N, N-diethyl-4-{[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] methyl} benzamide (140 mg, To a solution of 0.36 mmol) in 0 ° C. DMF (1.4 mL) was added sodium hydride (22 mg, 0.54 mmol, 60% in mineral oil). After 5 minutes, iodomethane DMF solution (1 mL, 0.43 mmol, 0.43 M) was added. The reaction mixture was allowed to warm to room temperature and stirred overnight. Water was added to the reaction solution, followed by extraction with ethyl acetate (20 mL), and the organic layer was dried over anhydrous sodium sulfate. The residue was purified by silica gel chromatography [developing solvent: dichloromethane / methanol (100: 0-98: 1)] to give the title compound (128 mg) as a brown oil (yield 89 %).
MS Found: 395 (M ⁺ + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.04-1.15 (m, 3H), 1.15-1.25 (m, 3H), 1.73-1.77 (m, 2H) , 2.56 (s, 3H), 2.59 (t, J = 6.3 Hz, 2H), 3.00-3.03 (m, 2H), 3.19-3.22 (m, 2H) 3.44-3.55 (m, 2H), 5.27 (s, 2H), 7.12 (d, J = 8.1 Hz, 2H), 7.30 (d, J = 8.1 Hz, 2H).

Example 21
1- (4-Methoxybenzyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine

3- (trifluoroacetyl) piperidin-2-one (Compound of Reference Example 13) (8.0 g, 40 mmol) and (4-methoxybenzyl) hydrazine (6.2 g, 40 mmol) in toluene (100 mL) / ethyl acetate The solution (10 mL) was refluxed for 4 hours and then concentrated under reduced pressure. After the residue was dissolved in 500 mL of THF, Lawesson reagent (19.4 g, 48 mmol) was added, and the mixture was stirred at 55 ° C. overnight and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to obtain the title compound (7.0 g) as a yellow solid (yield 56%).
^{MS Found: 312 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.75-1.79 (m, 2H), 2.60 (t, J = 6.0 Hz, 2H), 3.14 (brs, 1H), 3 .16 (t, J = 4.8 Hz, 2H), 3.79 (s, 3H), 5.10 (s, 2H), 6.87 (dd, J = 6.8, 2.0 Hz, 2H) , 7.13 (dd, J = 6.8, 2.0 Hz, 2H).

Example 22
1- (4-Methoxybenzyl) -7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine

1- (4-methoxybenzyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (311 mg, 1.0 mmol) at 0 ° C. DMF To the (20 mL) solution, sodium hydride (60%, in mineral oil, 60 mg, 1.5 mmol) was added and after 5 minutes iodomethane (0.075 mL, 1.2 mmol) was added. The reaction mixture was warmed to room temperature and stirred overnight. The mixture was extracted with 50 mL of diethyl ether, washed twice with 50 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to give the title compound (269 mg) as a white solid (yield 83%).
MS Found: 326 (M ⁺ + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.74-1.77 (m, 2H), 2.59 (t, J = 6.0 Hz, 2H), 2.61 (s, 3H), 3 .02-3.05 (m, 2H), 3.78 (s, 3H), 5.20 (s, 2H), 6.84 (dd, J = 6.8, 2.0 Hz, 2H), 7 .11 (dd, J = 6.8, 2.0 Hz, 2H).

Example 23
7-acetyl-1- (4-methoxybenzyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine

1- (4-methoxybenzyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (311 mg, 1.0 mmol) at 0 ° C. DMF To (20 mL) was added sodium hydride (60%, in mineral oil, 60 mg, 1.5 mmol). After 5 minutes, acetic anhydride (0.15 mL, 1.5 mmol) was added. The reaction mixture was warmed to room temperature and stirred overnight. The mixture was extracted with 50 mL of diethyl ether, washed twice with 50 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to obtain the title compound (300 mg) as a yellow solid (yield 85%).
^{MS Found: 354 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.89-1.95 (m, 2H), 2.12 (s, 3H), 2.71 (t, J = 6.0 Hz, 2H), 3 .43 (br, 2H), 3.78 (s, 3H), 5.34 (s, 2H), 6.78-6.82 (m, 2H), 7.00 (d, J = 8.4 Hz) , 2H).

Example 24
1- (4-Methoxybenzyl) -7- (trifluoroacetyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine

1- (4-Methoxybenzyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (compound of Example 21) (311 mg, 1. Triethylamine (0.83 mL, 6.0 mmol) was added to a solution of 0 mmol) in dichloromethane (5 mL) at 0 ° C. After 5 minutes, trifluoroacetic anhydride (0.42 mL, 3.0 mmol) was added. The reaction mixture was warmed to room temperature and stirred for 2 hours. The mixture was poured into 50 mL of water, extracted with 50 mL of dichloromethane, washed with 50 mL of 1N hydrochloric acid and 50 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (5: 1)] to give the title compound (300 mg) as a yellow solid (yield 73%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.97-2.03 (m, 2H), 2.75 (t, J = 6.4 Hz, 2H), 3.50-3.54 (m, 2H), 3.76 (s, 3H), 5.33 (s, 2H), 6.78-6.82 (m, 2H), 6.94-6.96 (m, 2H).

Example 25
N- (5-Chloro-2-methoxyphenyl) -2- [7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine 1-yl] acetamide

[7-Methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetic acid (compound of Reference Example 16) (320 mg, To a solution of 1.22 mmol) in dichloromethane (5 mL) were added oxalyl chloride (0.16 mL, 1.83 mmol) and DMF (1 drop) at 0 ° C., and the mixture was stirred under a nitrogen atmosphere for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in 2 mL of 1,2-dichloroethane. A mixture of 5-chloro-2-methoxyphenylamine (192 mg, 1.22 mmol), 4-dimethylaminopyridine (DMAP) (15 mg, 0.122 mmol) and pyridine (0.2 mL, 2.44 mmol) was added to the reaction solution. The mixture was further stirred at room temperature for 4 hours. 50 mL of dichloromethane was added to the mixture, and the mixture was washed with 30 mL of saturated aqueous sodium hydrogen carbonate solution. The organic layer was washed with 20 mL water, 10 mL 1N hydrochloric acid, 10 mL saturated aqueous sodium hydrogen carbonate solution and 20 mL saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (200 mg) as a white solid (yield 41%).
MS Found: 403 (M ⁺ + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.78-1.80 (m, 2H), 2.60-2.63 (m, 2H), 2.77 (s, 3H), 3.07 -3.10 (m, 2H), 3.81 (s, 3H), 4.82 (s, 2H), 6.75 (d, J = 8.8 Hz, 1H), 7.00 (dd, J = 8.8, 2.4 Hz, 1H), 8.41 (d, J = 2.4 Hz, 1H), 8.97 (brs, 1H).

Example 26
2- [7-acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] -N- (5-chloro-2 -Methoxyphenyl) acetamide

[7-Acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] acetic acid (72 mg, 0.25 mmol) in dichloromethane ( 2 mL) were added oxalyl chloride (0.033 mL, 0.37 mmol) and DMF (1 drop) at 0 ° C., and the mixture was stirred under a nitrogen atmosphere for 1 hour. The reaction mixture was concentrated under reduced pressure and the residue was dissolved in 2 mL of 1,2-dichloroethane. The reaction solution was added to a mixture of 5-chloro-2-methoxyphenylamine (39 mg, 0.25 mmol), DMAP (3 mg, 0.025 mmol) and pyridine (0.03 mL, 0.50 mmol) and stirred at room temperature for 4 hours. did. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The organic layer was washed with 10 mL water, 10 mL 1N hydrochloric acid, 10 mL saturated aqueous sodium bicarbonate solution and 10 mL saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (19 mg) as a white solid (yield 18%).
MS Found: 431 (M ⁺ + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.96-2.02 (m, 2H), 2.28 (s, 3H), 2.77 (t, J = 6.8 Hz, 2H), 3 .70-3.75 (m, 2H), 3.79 (s, 3H), 4.82 (s, 2H), 6.73 (d, J = 8.8 Hz, 1H), 6.98 (dd , J = 8.8, 2.4 Hz, 1H), 8.47 (d, J = 2.4 Hz, 1H), 8.80 (brs, 1H).

Example 27
N- (5-Chloro-2-methoxyphenyl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] Acetamide

N- (5-Chloro-2-methoxyphenyl) -2- [7- (trifluoroacetyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-2H-pyrazolo [3,4 b] pyridin-2-yl] acetamide and N- (5-chloro-2-methoxyphenyl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3 4-b] pyridin-1-yl] acetamide mixture (Reference Example 23) (130 mg) in a solution of THF (2 mL), methanol (2 mL) and water (1 mL) was added lithium hydroxide monohydrate (45 mg, 1 mL). 0.08 mmol) was added and stirred at room temperature for 2 hours. The solvent was concentrated under reduced pressure and the residue was washed with 20 mL of ethyl acetate. The aqueous layer was neutralized with 10 mL of 1N hydrochloric acid and extracted twice with 10 mL of ethyl acetate. The extract was washed with 10 mL of saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by preparative TLC (petroleum ether / ethyl acetate = 2: 1) to give the title compound (40 mg ) As a white solid (2 step yield 19%).
MS Found: 389 (M ⁺ + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.84-1.87 (m, 2H), 2.64 (t, J = 6.0 Hz, 2H), 3.29-3.32 (m, 2H), 3.82 (s, 3H), 4.72 (s, 2H), 6.75 (d, J = 8.8 Hz, 1H), 7.00 (dd, J = 8.8, 2. 4 Hz, 1 H), 8.35 (d, J = 2.4 Hz, 1 H), 8.74 (brs, 1 H). * A peak of “NH group” was not observed.

Example 28
7-methyl-1-[(2-methyl-1,3-benzothiazol-5-yl) methyl] -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3 4-b] pyridine

7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridine (Compound of Reference Example 14) (102 mg, 0.50 mmol) at 0 ° C. To a DMF (2 mL) solution of sodium hydride (60%, 30 mg, 0.75 mmol in mineral oil) was added. After 5 minutes, 5- (bromomethyl) -2-methyl 1,3-benzothiazole (145 mg, 0.60 mmol) was added. The reaction mixture was allowed to warm to room temperature and stirred overnight. The mixture was poured into 20 mL of water, extracted with 20 mL of diethyl ether, washed twice with 20 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: petroleum ether / ethyl acetate (4: 1)] to obtain the title compound (23 mg) as a yellow solid (yield 12%).
^{MS Found: 367 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.74-1.80 (m, 2H), 2.59-2.63 (m, 5H), 2.82 (s, 3H), 3.03 −3.06 (m, 2H), 5.40 (s, 2H), 7.21 (dd, J = 8.4, 1.6 Hz, 1H), 7.66 (s, 1H), 7.77 (D, J = 8.4 Hz, 1H).

Example 29
2-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6,7-tetrahydro-1 -Benzothiophene-3-carboxamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (80 mg, 0.32 mmol) in dichloromethane (2 mL) Oxalyl chloride (0.055 mL, 0.64 mmol) and DMF (1 drop) were added to the solution at 0 ° C. under a nitrogen atmosphere and stirred for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in DMA (1 mL). The acid chloride solution was added to DMA (2 mL) of 2-amino-4,5,6,7-tetrahydro-1-benzothiophene-3-carboxamide (63 mg, 0.32 mmol) at 0 ° C. and the mixture was allowed to cool to room temperature. Stir overnight. Water was added to the mixture and stirred at room temperature for 3 hours. The resulting solid was collected by filtration and washed with water to give the title compound (54 mg) as a brown solid (yield 39%).
MS Found: 429 (M ⁺ + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.84-1.87 (m, 4H), 2.04 (t, J = 4.8 Hz, 2H), 2.70-2.72 (m, 6H), 4.37 (t, J = 4.8 Hz, 2H), 4.91 (s, 2H), 5.75 (s, 2H), 12.22 (brs, 1H).

Example 30
4,5-dimethyl-2-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) thiophene-3-carboxamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.40 mmol) in dichloromethane (3. 2 mL) solution into DIEA (0.44 mL, 2.40 mmol), 2-amino-4,5-dimethylthiophene-3-carboxamide (204 mg, 1.20 mmol), HOBt (162 mg, 1.20 mmol) and EDCI (230 mg, 1.20 mmol) was added at 0 ° C. and stirred overnight at room temperature under a nitrogen atmosphere. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 10 mL of saturated aqueous sodium hydrogen carbonate solution. The organic layer was washed with 20 mL water, 10 mL 1N hydrochloric acid, 10 mL saturated aqueous sodium bicarbonate solution and 10 mL saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 1: 1) to give the title compound (90 mg) as a white solid (yield 56%).
MS Found: 403 (M ⁺ + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.03 to 2.06 (m, 2H), 2.31 (s, 6H), 2.71 (t, J = 6.4 Hz, 2H), 4 .37 (t, J = 5.6 Hz, 2H), 4.90 (s, 2H), 5.75 (brs, 2H), 12.07 (brs, 1H).

Example 31
N- (5-Chloro-2-methoxyphenyl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (80 mg, 0.32 mmol) in dichloromethane (2 mL) Oxalyl chloride (0.055 mL, 0.64 mmol) and DMF (1 drop) were added dropwise at 0 ° C. under a nitrogen atmosphere. After stirring for 1 hour, the reaction mixture was concentrated under reduced pressure, and the residue was dissolved in 2 mL of 1,2-dichloroethane. The acid chloride solution was added to a solution of 5-chloro-2-methoxyaniline (50 mg, 0.32 mmol), DMAP (3.9 mg, 0.032 mmol) and pyridine (0.05 mL, 0.64 mmol) at 80 ° C. For 1.5 hours. 20 mL of dichloromethane was added to the mixture, and the mixture was washed with 20 mL of saturated aqueous sodium hydrogen carbonate solution. The organic layer was washed with 20 mL water, 10 mL 1N hydrochloric acid, 10 mL saturated aqueous sodium bicarbonate solution and 10 mL saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC (petroleum ether / ethyl acetate = 1: 1) to give the title compound (70 mg) as a white solid (yield 56%).
^{MS Found: 390 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.01-2.07 (m, 2H), 2.70 (t, J = 6.4 Hz, 2H), 3.84 (s, 3H), 4 .38 (t, J = 4.8 Hz, 2H), 4.80 (s, 2H), 6.78 (d, J = 8.8 Hz, 1H), 7.03 (dd, J = 8.8, 2.4 Hz, 1H), 8.45 (d, J = 2.4 Hz, 1H), 8.99 (brs, 1H).

Example 32
N- (3-Chloro-4-fluorobenzyl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.40 mmol) and DMF (5 mL) To this mixture was added EDCI (115 mg, 0.60 mmol), HOBt monohydrate (81 mg, 0.60 mmol), and 1- (3-chloro-4-fluorophenyl) methanamine (96 mg, 0.60 mmol) at room temperature. And stirred for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: hexane-ethyl acetate (60: 40-20: 80)] and recrystallized from ethyl acetate-hexane to give the title compound (53.6 mg). Was obtained as colorless crystals (yield 34%).
MS Found: 392 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.95-2.06 (2H, m), 2.65 (2H, t, J = 6.3 Hz), 4.30-4.37 (2H, m), 4.41 (2H, d, J = 6.1 Hz), 4.69 (2H, s), 6.56 (1H, brs), 7.06-7.13 (2H, m), 7 .22-7.31 (1H, m).

Example 33
N-{[3- (1-Methylethyl) isoxazol-5-yl] methyl} -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazole-1 (4H ) -Il] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (300 mg, 1.2 mmol), THF (6 ml) Then, oxalyl chloride (304 mg, 2.4 mmol) was added to a mixture of DMF (6 drops) at 0 ° C. and stirred for 20 minutes, and then stirred at room temperature for 40 minutes. The reaction mixture was concentrated under reduced pressure, and DMA (6 mL) was added. This was added to a mixture of 1- [3- (1-methylethyl) isoxazol-5-yl] methanamine hydrochloride (233 mg, 1.3 mmol), triethylamine (146 mg, 1.4 mmol) and DMA (6 mL) at 0 ° C. The mixture was stirred for 10 minutes and then stirred at room temperature for 6 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (75: 25-40: 60)] and recrystallized from ethyl acetate-hexane to give the title compound (290.8 mg) as a colorless product. Obtained as crystals (yield 65%).
MS Found: 373 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.26 (6H, d, J = 6.8 Hz), 1.79-2.27 (2H, m), 2.66 (2H, t, J = 6.3 Hz), 3.02 (1 H, m) 4.24-4.43 (2 H, m) 4.53 (2 H, d, J = 5.7 Hz) 4.68 (2 H, s) 6.03 (1H, s) 6.68 (1H, brs).

Example 34
N-[(1-Methyl-1H-benzotriazol-5-yl) methyl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazole-1 (4H)- Yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.40 mmol) and DMF (5 mL) EDCI (115 mg, 0.60 mmol), HOBt monohydrate (81 mg, 0.60 mmol), and 1- (1-methyl-1H-benzotriazol-5-yl) methanamine (71 mg, 0.60 mmol) Was added at room temperature and stirred for 2.5 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was recrystallized from ethyl acetate-hexane to give the title compound (31.9 mg) as colorless crystals (yield 20%).
MS Found: 395 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.94-2.06 (2H, m), 2.64 (2H, t, J = 6.4 Hz), 4.29 (3H, s), 4 .32-4.40 (2H, m), 4.63 (2H, d, J = 6.0 Hz), 4.72 (2H, s), 6.62 (1H, brs), 7.39-7 .51 (2H, m), 7.85 (1H, s).

Example 35
N- (5-Chloro-2,4-dimethoxyphenyl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (200 mg, 0.8 mmol), THF (4 mL) Then, oxalyl chloride (203 mg, 1.6 mmol) was added to a mixture of DMF (4 drops) at 0 ° C. and stirred for 20 minutes, and then stirred at room temperature for 40 minutes. The reaction mixture was concentrated under reduced pressure, and DMA (4 mL) was added. This was added to a mixture of 5-chloro-2,4-dimethoxyaniline (165 mg, 0.9 mmol) and DMA (4 mL) at 0 ° C., stirred for 10 minutes, and then stirred at room temperature for 4 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (70: 30-20: 80)] and recrystallized from ethyl acetate-hexane to give the title compound (175.0 mg) as a colorless product. Obtained as crystals (52% yield).
MS Found: 420 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.94-2.14 (2H, m), 2.67 (2H, t, J = 6.3 Hz), 3.84 (3H, s), 3 .87 (3H, s), 4.27-4.41 (2H, m), 4.75 (2H, s), 6.48 (1H, s), 8.42 (1H, s), 8. 78 (1H, brs).

Example 36
N- [5- (Cyclopropylsulfamoyl) -2-methoxyphenyl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl Acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.40 mmol) and DMF (5 mL) EDCI (115 mg, 0.60 mmol), HOBt monohydrate (81 mg, 0.60 mmol), and 3-amino-N-cyclopropyl-4-methoxybenzenesulfonamide (107 mg, 0.60 mmol) at room temperature. And then stirred for 48 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was recrystallized from ethyl acetate-hexane to give the title compound (75.6 mg) as colorless crystals (yield 40%).
MS Found: 475 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 0.54-0.70 (4H, m), 1.96-2.11 (2H, m), 2.18-2.35 (1H, m) 2.68 (2H, t, J = 6.3 Hz), 3.92 (3H, s), 4.30-4.42 (2H, m), 4.79 (3H, brs), 6.93. (1H, d, J = 8.7 Hz), 7.63 (1H, dd, J = 8.7, 2.3 Hz), 8.88 (1H, d, J = 2.3 Hz), 9.14 ( 1H, s).

Example 37
2-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -5,6-dihydro-4H-cyclopenta [b ] Thiophene-3-carboxamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.4 mmol), THF (2 mL) And oxalyl chloride (102 mg, 0.8 mmol) was added to a mixture of DMF (2 drops) at 0 ° C. and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure, and DMA (2 mL) was added. This was added to a mixture of 2-amino-5,6-dihydro-4H-cyclopenta [b] thiophene-3-carboxamide (80 mg, 0.4 mmol) and DMA (2 mL) at 0 ° C., stirred for 10 minutes, and then at room temperature. Stir for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: hexane-ethyl acetate (75: 25-40: 60)] and recrystallized from ethyl acetate-hexane to give the title compound (80.1 mg). Was obtained as colorless crystals (yield 48%).
MS Found: 415 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.94-2.11 (2H, m), 2.39-2.57 (2H, m), 2.68 (2H, t, J = 6. 3 Hz), 2.88 (4H, t, J = 7.2 Hz), 4.27-4.44 (2H, m), 4.88 (2H, s), 5.59 (2H, brs), 12 .04 (1H, brs).

Example 38
2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1,2-a ] Pyridin-8-yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride (compound of Reference Example 12) (268 mg, 0.999 mmol) in dichloromethane (8 .00 mL) solution in triethylamine (0.232 mL, 1.66 mmol) followed by 6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 28) (168 mg, 0.833 mmol) ) Was added dropwise at 0 ° C. The reaction mixture was stirred at room temperature for 5 hours and concentrated under reduced pressure. The residue was neutralized with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate (50 mL). The organic layer was washed with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (77.0 mg) as a yellow solid (yield 21%).
MS Found: 434.2 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.03 (2H, m), 2.69 (2H, m), 4.37 (2H, m), 4.90 (2H, s), 7. 62 (1H, d, J = 1.2 Hz), 7.65 (1H, d, J = 1.2 Hz), 8.24 (1H, d, J = 1.6 Hz), 8.28 (1H, d , J = 1.2 Hz), 9.38 (1H, brs).

Example 39
N- [3-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3- c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride (compound of Reference Example 12) (268 mg, 0.999 mmol) in dichloromethane (8 .00 mL) solution in triethylamine (0.232 mL, 1.66 mmol) followed by 3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 31) (179 mg 0.833 mmol) was added dropwise at 0 ° C. The reaction mixture was stirred at room temperature for 5 hours and concentrated under reduced pressure. The residue was neutralized with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate (50 mL). The organic layer was washed with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (144 mg) as a yellow solid (yield 38%).
MS Found: 448.3 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.03 (2H, m), 2.50 (3H, d, J = 0.8 Hz), 2.68 (2H, m), 4.36 (2H M), 4.90 (2H, s), 7.38 (1H, d, J = 0.8 Hz), 7.98 (1H, d, J = 1.2 Hz), 8.27 (1H, d) , J = 1.6 Hz), 8.32 (1H, brs).

Example 40
N- [2-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3- c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride (compound of Reference Example 12) (268 mg, 0.999 mmol) in dichloromethane (8 .00 mL) solution in triethylamine (0.232 mL, 1.66 mmol), followed by 2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 34) (179 mg 0.833 mmol) was added dropwise at 0 ° C. The reaction mixture was stirred at room temperature for 5 hours and concentrated under reduced pressure. The residue was neutralized with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate (50 mL). The organic layer was washed with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (141 mg) as a yellow solid (yield 37%).
MS Found: 448.2 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.03 (2H, m), 2.43 (3H, s), 2.69 (2H, m), 4.36 (2H, m), 4. 89 (2H, s), 7.38 (1 H, d, J = 0.8 Hz), 8.13 (1 H, s), 8.22 (1 H, d, J = 1.2 Hz), 8.47 ( 1H, brs).

Example 41
N- [2,3-Dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2, 3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (200 mg, 0.80 mmol), 2,3- Dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 45) (180 mg, 0.8 mmol), triethylamine (0.33 ml, 2.4 mmol) and DMF ( 4 ml) was added bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop) (560 mg, 1.2 mmol) at 0 ° C. and then stirred at room temperature for 15 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (85: 15-50: 50)] and then recrystallized from ethyl acetate-hexane to give the title compound (160 mg) as colorless crystals. (Yield 43%).
MS Found: 462 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.97-2.08 (2H, m), 2.40 (3H, s), 2.42 (3H, s), 2.69 (2H, t , J = 6.2 Hz), 4.32-4.41 (2H, m), 4.89 (2H, s), 7.89 (1H, s), 8.21 (1H, d, J = 1) .5 Hz), 9.39 (1H, brs).

Example 42
N- [3-Ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [ 2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride (compound of Reference Example 12) (268 mg, 0.999 mmol) in dichloromethane (8 .00 mL) solution in triethylamine (0.232 mL, 1.66 mmol), then 3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (from Reference Example 39). Compound) (150 mg, 0.617 mmol) was added dropwise at 0 ° C. The reaction mixture was stirred at room temperature for 5 hours and concentrated under reduced pressure. The residue was neutralized with saturated aqueous sodium hydrogen carbonate solution, and ethyl acetate (50 mL) was extracted. The organic layer was washed with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (160 mg) as a yellow solid (yield 54%).
MS Found: 476.3 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.22 (3H, t, J = 7.2 Hz), 2.02 (2H, m), 2.40 (3H, s), 2.68 (2H M), 2.88 (2H, q, J = 7.2 Hz), 4.36 (2H, m), 4.88 (2H, s), 7.93 (1H, s), 8.19 ( 1H, d, J = 1.2 Hz), 9.41 (1H, brs).

Example 43
N- [2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [ 2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride (compound of Reference Example 12) (268 mg, 0.999 mmol) in dichloromethane (8 .00 mL) solution in triethylamine (0.232 mL, 1.66 mmol), followed by 2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (from Reference Example 42). Compound) (203 mg, 0.833 mmol) was added dropwise at 0 ° C. The reaction mixture was stirred at room temperature for 4 hours and concentrated under reduced pressure. The residue was neutralized with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate (50 mL). The organic layer was washed with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (160 mg) as a yellow solid (yield 40%).
MS Found: 476.3 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.29 (3H, t, J = 7.6 Hz), 2.02 (2H, m), 2.42 (3H, s), 2.67-2 .76 (4H, m), 4.36 (2H, m), 4.90 (2H, s), 7.90 (1H, s), 8.23 (1H, d, J = 1.6 Hz), 9.33 (1H, brs).

Example 44
N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6 -Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl chloride (compound of Reference Example 12) (271 mg, 1.01 mmol) in dichloromethane (5 .00 mL) solution in triethylamine (0.374 mL, 2.69 mmol), then 3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine (reference The compound of Example 50) (150 mg, 0.694 mmol) was added dropwise at 0 ° C. The reaction mixture was stirred at room temperature for 5 hours and concentrated under reduced pressure. The residue was neutralized with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate (50 mL). The organic layer was washed with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1)] to give the title compound (40.0 mg) as a yellow solid (yield 14%).
MS Found: 449.2 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.02-2.07 (2H, m), 2.69 (2H, t, J = 6.0 Hz), 2.80 (3H, s), 4 .40 (2H, t, J = 5.2 Hz), 4.96 (2H, s), 7.96 (1H, t, J = 1.2 Hz), 8.34 (1H, d, J = 1. 2 Hz), 9.49 (1H, brs).

Example 45
N- (6-Bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] Pyrazol-1 (4H) -yl] acetamide

6-Bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-amine (compound of Reference Example 53) (1.50 g, 6.25 mmol), [3- (trifluoromethyl) -5, 6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (1.56 g, 6.25 mmol), boric acid (1.16 g, 18.75 mmol) in chlorobenzene The (300 mL) solution was refluxed for 24 hours, water was removed using calcium hydride in a dean stark apparatus, cooled and concentrated under reduced pressure. The residue was purified by basic column chromatography [developing solvent: 100% chloroform] to give the title compound (2.5 g) as a brown solid (yield 83%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.01-2.08 (m, 2H), 2.38 (s, 3H), 2.39 (s, 3H), 2.71 (t, J = 6.4 Hz, 2H), 4.37-4.40 (m, 2H), 4.91 (s, 2H), 7.70 (d, J = 1.6 Hz, 1H), 8.20 (d , J = 1.6 Hz, 1H), 9.40 (brs, 1H).

Example 46
N- (2,3-Dimethyl-6-phenylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] Pyrazol-1 (4H) -yl] acetamide

N- (6-Bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] Pyrazol-1 (4H) -yl] acetamide (Compound of Example 45) (268 mg, 0.57 mmol), phenylboronic acid (139 mg, 1.14 mmol), 1,1′-bis (diphenylphosphino) ferrocene] dichloro Palladium (51 mg, 0.11 mmol), potassium carbonate (236 mg, 1.71 mmol) in dimethoxyethane (24 m) / water (6 mL) was stirred overnight under a nitrogen atmosphere. The mixture was extracted with 50 mL of chloroform, washed twice with 50 mL of water, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by basic column chromatography [developing solvent: chloroform] to give the title compound (250 mg) as a white solid (yield 93%).
^{MS Found: 470 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.00-2.08 (m, 2H), 2.44 (s, 3H), 2.45 (s, 3H), 2.68-2.73 (M, 2H), 4.39 (t, J = 5.2 Hz, 2H), 4.98 (s, 2H), 7.37-7.40 (m, 1H), 7.46 (t, J = 7.6 Hz, 2H), 7.61 (d, J = 7.2 Hz, 2H), 7.74 (s, 1H), 8.40 (s, 1H), 9.35 (brs, 1H).

Example 47
N- (2-pyridylmethyl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.40 mmol) and DMF (5 mL) was added triethylamine (121 mg, 1.20 mmol), 2-picolylamine (59 mg, 0.40 mmol), and PyBrop (280 mg, 0.60 mmol) at 0 ° C. and stirred for 5 minutes. Thereafter, the mixture was stirred at room temperature for 20 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (40: 60-10: 90)] and recrystallized from ethyl acetate-hexane to give the title compound (72.3 mg). Obtained as colorless crystals (53% yield).
MS Found: 341 (M ⁺ + H).
1H NMR (300 MHz, CDCl ₃ ): δ ppm 1.91-2.08 (2H, m), 2.66 (2H, t, J = 6.3 Hz), 4.26-4.40 (2H M), 4.56 (2H, d, J = 4.5 Hz), 4.72 (2H, s), 7.12-7.26 (2H, m), 7.44 (1H, brs) 7.64 (1H, td, J = 7.8, 1.9 Hz), 8.42-8.58 (1H, m).

Example 48
2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- (2,3,6-trimethylimidazo [1,2-a ] Pyridin-8-yl) acetamide

N- (6-Bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] Pyrazol-1 (4H) -yl] acetamide (Compound of Example 45) (800 mg, 1.69 mmol), dimethylzinc (17 mL, 17 mmol), tetrakistriphenylphosphine palladium (192 mg, 0.08 mmol), copper iodide ( A mixture of I) (16 mg, 0.08 mmol) and 1,2-dimethoxyethane (32 mL) was stirred at 60 ° C. overnight under a nitrogen atmosphere. Insoluble material was removed by filtration through Celite, and the filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to give the title compound (125 mg) as a white solid (17% yield).
^{MS Found: 408 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.01-2.07 (m, 2H), 2.33 (s, 3H), 2.36 (s, 3H), 2.38 (s, 3H), 2.68-2.71 (m, 2H), 4.36-4.38 (m, 2H), 4.92 (s, 2H), 7.35 (s, 1H), 7.94 (S, 1H). (* "NH group" peak was not observed.)

Example 49
N- (6-Cyclopropyl-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c ] Pyrazol-1 (4H) -yl] acetamide N- (6-cyclopropyl-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl)- 5,6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (90 mg, 0.36 mmol), 6-cyclopropyl A solution of -2,3-dimethylimidazo [1,2-a] pyridin-8-amine (the compound of Reference Example 55) (66 mg, 0.33 mmol) and boric acid (51 mg, 0.82 mmol) in chlorobenzene (50 mL) After refluxing for 24 hours, water was removed using calcium hydride in a dean stark apparatus, followed by cooling and concentration under reduced pressure. The residue was purified by basic column chromatography [developing solvent: 100% chloroform] to give the title compound (144 mg) as a brown solid (yield 98%).
^{MS Found: 434 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 0.70-0.74 (m, 2H), 0.92-0.96 (m, 2H), 1.88-1.94 (m, 1H ), 2.02-2.08 (m, 2H), 2.38 (s, 3H), 2.41 (s, 3H), 2.70 (t, J = 6.0 Hz, 2H), 4. 37-4.39 (m, 2H), 4.92 (s, 2H), 7.38 (d, J = 1.2 Hz, 1H), 8.40 (d, J = 1.2 Hz, 1H). (* "NH group" peak was not observed.)

Example 50
N- [2,3-Dimethyl-6- (1,3-thiazol-2-yl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5, 6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

N- (6-Bromo-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] Pyrazol-1 (4H) -yl] acetamide (Compound of Example 45) (400 mg, 0.85 mmol), 2- (tributylstannanyl) -1,3-thiazole (700 mg, 1.87 mmol), tetrakistriphenylphosphine A mixture of palladium (196 mg, 0.17 mmol), copper (I) iodide (32 mg, 0.17 mmol) and DMF (16 mL) was stirred at 130 ° C. for 30 minutes under microwave irradiation. The reaction mixture was extracted with chloroform (100 mL), and the organic layer was washed twice with water (100 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by preparative TLC to give the title compound (55 mg) as a yellow solid (yield 15%).
^{MS Found: 477 (M + +} H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.05-2.07 (m, 2H), 2.43 (s, 3H), 2.48 (s, 3H), 2.72 (t, J = 6.4 Hz, 2H), 4.38-4.41 (m, 2H), 4.96 (s, 2H), 7.39 (d, J = 3.2 Hz, 1H), 7.87 ( d, J = 3.2 Hz, 1H), 8.42 (d, J = 1.2 Hz, 1H), 8.56 (d, J = 1.2 Hz, 1H). (* "NH group" peak was not observed.)

Example 51
N- (1H-Indol-3-ylmethyl) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (143 mg, 0.57 mmol) and DMF (9 ml) To this mixture was added triethylamine (174 mg, 1.72 mmol), 1- (1H-indol-3-yl) methanamine (84 mg, 0.57 mmol), and PyBrop (401 mg, 0.86 mmol) at 0 ° C., then at room temperature. For 6 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (80: 20-40: 60)], and recrystallized from ethyl acetate-hexane to give the title compound (171.7 mg) as a colorless product. Obtained as crystals (yield 79%).
MS Found: 378 (M).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.83-1.95 (2H, m), 2.56 (2H, t, J = 6.3 Hz), 4.17-4.26 (2H, m), 4.60-4.69 (4H, m), 6.33 (1H, brs), 7.07-7.16 (2H, m), 7.17-7.25 (1H, m) , 7.32-7.41 (1H, m), 7.50-7.59 (1H, m), 8.05 (1H, brs).

Example 52
1-methyl-4-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -1H-pyrazole-5-carboxamide

[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (compound of Reference Example 11) (100 mg, 0.40 mmol), THF (2 mL) And oxalyl chloride (102 mg, 0.80 mmol) was added to a mixture of DMF (2 drops) at 0 ° C. and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure, and DMA (2 mL) was added. This was added to a mixture of 4-amino-1-methyl-1H-pyrazole-5-carboxamide (62 mg, 0.44 mmol) and DMA (2 mL) at 0 ° C., stirred for 10 minutes, and then stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (70: 30-10: 90-0: 100)] and recrystallized from ethyl acetate-hexane to give the title compound (55. 1 mg) was obtained as colorless crystals (yield 37%).
MS Found: 373 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.94-2.13 (2H, m), 2.68 (2H, t, J = 6.4 Hz), 4.09 (3H, s), 4 .31-4.42 (2H, m), 4.79 (2H, s), 5.89 (2H, brs), 7.91 (1H, s), 8.67 (1H, brs).

Example 53
N- [3- (methylsulfonyl) phenyl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide Same as Example 32 To give the title compound.
MS (ESI +): [M + H] ⁺ 404.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.97-2.10 (2H, m), 2.69 (2H, t, J = 6.2 Hz), 3.06 (3H, s), 4.32-4.45 (2H, m), 4.79 ( 2H, s), 7.46-7.59 (1H, m), 7.66-7.81 (2H, m), 8.09 (1H, t, J = 1.9 Hz), 8.68 (1H, brs).
mp: 187-189 ° C

Example 54
N- [2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6 -Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

A) 2-Methyl-8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridine 2-chloro-3-nitro-5- (trifluoromethyl) pyridine ( Hydrazine monohydrate was added to a solution of 868 mg) in ethanol (17 mL) under ice cooling. The reaction mixture was stirred for 5 minutes under ice-cooling, and the solvent was evaporated under reduced pressure. Trimethyl orthoacetate (16 mL) was added at room temperature. The reaction mixture was stirred at 80 ° C. overnight, and saturated aqueous sodium hydrogen carbonate solution was added. The reaction mixture was extracted with ethyl acetate, the extract was dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (141 mg) as a yellow solid.
MS (ESI +): [M + H] ⁺ 247.1.

B) 2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine 10% palladium-carbon (50% wet, 120 mg) and 2-methyl A mixture of -8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridine (130 mg) in THF (50 mL) was stirred under a hydrogen atmosphere for 14 hours. The reaction mixture was filtered and the filtrate was concentrated to give the title compound (115 mg) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 2.60 (3H, s), 4.72 (2H, brs), 6.67 (1H, s), 8.27 (1H, s).

C) N- [2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5 , 6-Dihydropyrano [2,3-c] pyrazol-1 (4H) yl] acetamide [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) yl] acetic acid (Compound of Reference Example 11) (126 mg), dehydrated THF (3 mL), and dehydrated DMF (3 drops) were added with oxalyl chloride (129 mg) under ice cooling. The reaction mixture was stirred for 20 minutes under ice-cooling and then stirred for 40 minutes at room temperature. The solvent and excess oxalyl chloride were distilled off under reduced pressure, and dehydrated THF (3 mL) was added. This was dissolved in 2-methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine (110 mg), triethylamine (62 mg) and dehydrated THF (3 mL). ) Was added to the mixture under ice cooling. The reaction mixture was stirred at room temperature for 4 hours, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) .The resulting solid was crystallized from an ethyl acetate-hexane mixed solvent to give the title compound (34 mg) as a white solid. It was.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.94-2.14 (2H, m), 2.59 (3H, s), 2.70 (2H, t, J = 6.2 Hz), 4.32-4.41 (2H, m), 4.88 ( 2H, s), 8.54 (2H, brs), 9.55 (1H, brs).
MS (ESI +): [M + H] ⁺ 449.3.
mp: 210-211 ℃

Example 55
3- (Trifluoromethyl) -1- {3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] benzyl} -1,4,5,6-tetrahydropyrano [ 2,3-c] pyrazole

A) {3- [6- (Trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] phenyl} methanol 8-Bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine (Compound of Reference Example 26) (532 mg), [3- (hydroxymethyl) phenyl] boronic acid (319 mg) and 1,2-dimethoxyethane (5 mL) were mixed with sodium carbonate (1060 mg), water (5 mL) and tetrakis (triphenylphosphine) palladium (0) (145 mg) were added. The reaction mixture was stirred at 100 ° C. for 150 minutes under a nitrogen atmosphere, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (400 mg) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 4.80 (2H, d, J = 4.9 Hz), 7.43-7.55 (3H, m), 7.76-7.79 (2H, m), 7.90-7.92 (1H, m), 8.00 (1H, s), 8.51-8.52 (1H, m). * The peak of “OH group” was not observed.

B) 3- (Trifluoromethyl) -1- {3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] benzyl} -1,4,5,6-tetrahydropyra [2,3-c] pyrazole 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (compound of Reference Example 9) (116 mg), {3 In a mixture of-[6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] phenyl} methanol (176 mg), tributylphosphine (122 mg) and toluene (4 mL), '-(Azodicarbonyl) dipiperidine (229 mg) was added at -78 ° C. The reaction mixture was stirred at −78 ° C. for 10 minutes under a nitrogen atmosphere, and then stirred at room temperature for 4 hours. Ethyl acetate was added to the reaction mixture, and the insoluble material was filtered off using celite. The filtrate was concentrated under reduced pressure, and the residue was purified by basic silica gel column chromatography (ethyl acetate / hexane) to give the title compound (20 mg) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.91-2.04 (2H, m), 2.63 (2H, t, J = 6.0 Hz), 4.26-4.34 (2H, m), 5.25 (2H, s), 7.33 ( 1H, d, J = 8.3 Hz), 7.39 (1H, d, J = 1.9 Hz), 7.48 (1H, t, J = 7.6 Hz), 7.76 (1H, d, J = 1.5 Hz), 7.78 (1H, d, J = 1.1 Hz), 7.84-7.88 (1H, m), 7.95-8.00 (1H, m), 8.48-8.53 (1H, m).
MS (ESI +): [M + H] ⁺ 467.3.
mp: 125-126 ℃

Example 56
3- (Trifluoromethyl) -1- {4- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] benzyl} -1,4,5,6-tetrahydropyrano [ 2,3-c] pyrazole The title compound was obtained in the same manner as in Example 55.
MS (ESI +): [M + H] ⁺ 467.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.89-2.06 (2H, m), 2.64 (2H, t, J = 6.2 Hz), 4.25-4.38 (2H, m), 5.21 (2H, s), 7.36- 7.47 (3H, m), 7.77 (2H, dd, J = 10.2, 1.1 Hz), 7.92-7.99 (2H, m), 8.42-8.55 (1H, m).
mp: 135-137 ℃

Example 57
2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) [1,2,4] Triazolo [1,5-a] pyridin-8-yl] acetamide

A) Mixture of 2-chloro-3-nitro-5- (trifluoromethyl) pyridine 3-nitro-5- (trifluoromethyl) pyridin-2-ol (50.0 g, 240 mmol) and phosphoryl chloride (224 mL) Was heated at 110 ° C. overnight. The reaction mixture was cooled to room temperature, diluted with water (300 mL), neutralized with saturated aqueous sodium hydrogen carbonate solution (300 mL), and extracted three times with ethyl acetate (200 mL). The combined organic layers were dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1)] to give the title compound (52.8 g) as a yellow oil.
MS (ESI +): [M + H] ⁺ 208.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 8.47 (1H, d, J = 1.6 Hz), 8.89 (1H, dd, J = 2.4, 0.8 Hz).

B) 2-Hydrazino-3-nitro-5- (trifluoromethyl) pyridine 2-chloro-3-nitro-5- (trifluoromethyl) pyridine (20.0 g, 88.0 mmol) in ethanol (100 mL) in hydrazine Monohydrate (9.13 mL, 88.0 mmol) was added at room temperature. The reaction mixture was stirred for 0.5 hours at room temperature and then concentrated under reduced pressure. The resulting residue was diluted with water (100 mL) and extracted three times with ethyl acetate (100 mL). The combined organic layers were dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give the title compound (19.0 g) as a dark brown oil, which was used in the next step without purification.
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 4.43 (2H, s), 8.67 (2H, d, J = 10.4 Hz), 9.28 (1H, s).

C) 8-Nitro-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridine 2-hydrazino-3-nitro-5- (trifluoromethyl) pyridine (30.0 mg, 0.135 mmol) and formic acid (3 mL) were heated at 85 ° C. for 16 h. The reaction mixture was cooled to room temperature, diluted with water (10 mL), and extracted three times with ethyl acetate (10 mL). The combined organic layers were dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1)] to give the title compound (20 mg) as a yellow oil.
¹ H NMR (400 MHz, CDCl ₃ ) δ 8.72 (1H, s), 8.73 (1H, d, J = 1.6 Hz), 9.29 (1H, dd, J = 1.6, 1.2 Hz).

D) 6- (Trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine 8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [1 , 5-a] pyridine (15.0 mg, 0.065 mmol) and ethanol (2 mL) were added with 10% palladium carbon (13.7 mg) at room temperature, and the mixture was stirred under a hydrogen stream for 3 hours. The reaction mixture was filtered through celite and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1)] to give the title compound (11.4 mg) as white crystals.
MS (ESI +): [M + H] ⁺ 203.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 5.10 (2H, s), 6.73 (1H, d, J = 1.2 Hz), 8.32 (1H, s), 8.38 (1 H, s).

E) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) [1,2, 4] Triazolo [1,5-a] pyridin-8-yl] acetamide The title compound was obtained in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 435.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.96-2.11 (2H, m), 2.70 (2H, t, J = 6.2 Hz), 4.32-4.44 (2H, m), 4.91 (2H, s), 8.36 ( 1H, s), 8.64 (1H, s), 8.67 (1H, s), 9.48 (1H, s).

Example 58
2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) [1,2,4] Triazolo [4,3-a] pyridin-8-yl] acetamide

A) 8-Nitro-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 2-hydrazino-3-nitro-5- (trifluoromethyl) pyridine (10.0 g, 45.0 mmol) and triethyl orthoformate (50 mL) were heated at 85 ° C. for 16 h. The precipitated solid was collected by filtration, washed 3 times with ether (100 mL), and dried at 25 ° C. to give the title compound (6.77 g) as a yellow solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 8.46 (1H, d, J = 1.6 Hz), 9.17 (1H, d, J = 1.2 Hz), 9.33 (1H, s).

B) 6- (Trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine 8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [4 , 3-a] pyridine (6.50 g, 28.0 mmol) in water (100 mL) and acetic acid (20 mL) was added to iron powder (15.6 g, 28.0 mmol) at room temperature. The mixture was heated at 50 ° C. for 2 hours and then cooled to room temperature. The reaction mixture was filtered through Celite, and the filtrate was diluted with water (100 mL) and ethyl acetate (200 mL), and then the mixture was stirred at room temperature for 30 minutes. The aqueous layer was separated and extracted three times with ethyl acetate (10 mL). The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1)] to give the title compound (1.50 g) as a brown solid.
MS (ESI +): [M + H] ⁺ 203.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 5.25 (2H, s), 6.41 (1H, s), 7.96 (1H, s), 8.86 (1H, s).

C) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) [1,2, 4] Triazolo [4,3-a] pyridin-8-yl] acetamide The title compound was obtained in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 435.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.96-2.13 (2H, m), 2.70 (2H, t, J = 6.2 Hz), 4.32-4.48 (2H, m), 4.96 (2H, s), 8.21- 8.30 (1H, m), 8.39 (1H, d, J = 1.5 Hz), 8.90 (1H, s), 9.54 (1H, s).

Example 59
N- [3-Methoxy-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6 -Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

A) 8-Nitro-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-3 (2H) -one
A mixture of 2-hydrazino-3-nitro-5- (trifluoromethyl) pyridine hydrochloride (8.00 g), 1,1'-carbonyldiimidazole (10.0 g) and THF (200 mL) was stirred at 85 ° C for 16 hours. did. The precipitate was collected by filtration and washed with hexane to give the title compound (5.10 g) as a brown solid.
MS (ESI +): [M + H] ⁺ 249.0.

B) 3-Methoxy-8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 8-nitro-6- (trifluoromethyl) [1,2,4 ] Iodomethane (0.756 mL) was added to a DMF (2.0 mL) solution of triazolo [4,3-a] pyridin-3 (2H) -one (40.0 mg) and potassium carbonate (44.6 mg) at room temperature, and then the reaction mixture Was stirred at 50 ° C. for 16 hours. The reaction mixture was returned to room temperature, water was added, and the mixture was extracted 3 times with ethyl acetate, and the combined extracts were dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (8.10 mg) as a white solid.
¹ H NMR (CDCl ₃ , Varian 400 MHz) δ 4.23 (3H, t, J = 1.4 Hz), 8.65 (1H, d, J = 1.6 Hz), 9.03 (1H, dd, J = 1.6 Hz, 0.8 Hz) .

C) 3-Methoxy-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine
Ethanol of 3-methoxy-8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine (43.0 mg) and Pd / C (5 wt%, 34.9 mg) (5.0 mL) The suspension was stirred at room temperature for 2 hours under a hydrogen stream. The reaction mixture was filtered through celite, and the filtrate was concentrated. The obtained residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (35.0 mg) as a white solid.
MS (ESI +): [M + H] ⁺ 233.2.
¹ H NMR (CDCl ₃ , Varian 400 MHz) δ 4.11 (3H, s), 7.60 (2H, s), 6.70 (1H, s), 8.18 (1H, s).

D) N- [3-methoxy-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5 , 6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide The title compound was obtained in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 465.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ1.98-2.09 (2H, m), 2.69 (2H, t, J = 6.0 Hz), 4.13 (3H, s), 4.34-4.42 (2H, m), 4.88 (2H, s), 8.44-8.49 (1H, m), 8.63 (1H, d, J = 1.5 Hz), 9.34 (1H, s).

Example 60
3- (trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] thiophen-2-yl} methyl) -1,4,5 , 6-Tetrahydropyrano [2,3-c] pyrazole

A) {5- [6- (Trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] thiophen-2-yl} methanol (5-formylthiophen-2-yl) boronic acid (300 mg) To a suspension of 2-propanol (3.0 mL) was added sodium tetrahydroborate (90.9 mg) at 0 ° C., and the mixture was stirred at the same temperature for 1 hour. After evaporating the solvent under reduced pressure, the residue was dissolved in DME (5.0 mL), tetrakis (triphenylphosphine) palladium (0) (111 mg) and 2N aqueous sodium carbonate solution were added, and the mixture was stirred at 100 ° C. for 21.5 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (204.5 mg).
MS (ESI +): [M + H] ⁺ 299.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.92 (1H, t, J = 6.0 Hz), 4.90 (2H, d, J = 6.0 Hz), 7.11 (1H, d, J = 3.8 Hz), 7.57 (1H , d, J = 1.5 Hz), 7.74 (1H, d, J = 1.5 Hz), 7.83 (1H, d, J = 1.5 Hz), 8.03 (1H, d, J = 3.8 Hz), 8.44 (1H, quin , J = 1.3 Hz).

B) 3- (Trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] thiophen-2-yl} methyl) -1,4 , 5,6-Tetrahydropyrano [2,3-c] pyrazole {5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] thiophen-2-yl} methanol (119 mg) in THF (4.0 mL) in 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (76.7 mg), triphenylphosphine (136 mg) and DIAD (102 μL) was added at 0 ° C. The reaction solution was stirred at 0 ° C. for 1 hour, then warmed to room temperature and further stirred for 13 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) and preparative HPLC. The obtained solid was recrystallized from ethyl acetate / hexane to give the title compound (23.1 mg).
MS (ESI +): [M + H] ⁺ 473.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.92-2.05 (2H, m), 2.63 (2H, t, J = 6.4 Hz), 4.28-4.38 (2H, m), 5.34 (2H, s), 7.12 ( 1H, d, J = 3.8 Hz), 7.49-7.55 (1H, m), 7.73 (1H, d, J = 1.1 Hz), 7.81 (1H, d, J = 1.1 Hz), 8.02 (1H, d, J = 3.8 Hz), 8.41-8.46 (1H, m).

Example 61
N- [6- (1-hydroxy-1-methylethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3 -c] pyrazol-1 (4H) -yl] acetamide

A) Methyl 6-amino-5-bromopyridine-3-carboxylate NBS (49.1 g) was gradually added to a solution of methyl 6-aminopyridine-3-carboxylate (35.0 g) in anhydrous THF (767 mL) at 0 ° C. After the addition, the reaction mixture was stirred at room temperature for 17 hours. Water (2 L) was added, and the precipitated crystals were collected by filtration, washed with water (700 mL), and dried under reduced pressure to give the title compound (27.2 g) as a white solid.
¹ H-NMR (CDCl ₃ , 400 MHz): δ 3.89 (3H, s), 5.35 (2H, brs), 8.26 (1H, d, J = 2.0 Hz), 8.66 (1H, d, J = 2.0 Hz) .

B) Methyl 8-bromoimidazo [1,2-a] pyridine-6-carboxylate
A mixture of methyl 6-amino-5-bromopyridine-3-carboxylate (27.2 g), 2-chloroacetaldehyde (45% aqueous solution, 1.24.6 g) and ethanol (392 mL) was heated and stirred at 85 ° C. for 24 hours. . After cooling to room temperature, saturated aqueous sodium hydrogen carbonate solution (400 mL) was added, and the mixture was extracted twice with dichloromethane. The combined extract was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (14.7 g) as a yellow solid.
¹ H-NMR (CDCl ₃ , 400 MHz): 3.97 (3H, s), 7.76 (1H, s), 7.78 (1H, s), 8.02 (1H, s), 8.91 (1H, s).

C) Methyl 8-aminoimidazo [1,2-a] pyridine-6-carboxylate
8-bromoimidazo [1,2-a] pyridine-6-carboxylate methyl (14.7 g), tris (dibenzylideneacetone) dipalladium (0) (2.64 g), benzophenone imine (11.6 mL), cesium carbonate (28.2) g), 2′-bis (diphenylphosphino) -1,1′-binaphthyl (BINAP) (5.38 g), and toluene (192 mL) were stirred at 95 ° C. for 6 days under a stream of argon. The reaction mixture was cooled to room temperature, filtered through celite, washed with dichloromethane, and the filtrate was concentrated under reduced pressure. 6N Hydrochloric acid (150 mL) was added to the obtained residue, the mixture was stirred for 30 min, saturated aqueous sodium hydrogen carbonate solution (200 mL) was added, and the mixture was extracted twice with dichloromethane. The combined extract was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (7.20 g) as a yellow solid.
¹ H NMR (CDCl ₃ , 400 MHz): δ 3.92 (3H, s), 4.60 (2H, brs), 6.86 (1H, d, J = 1.2 Hz), 7.59 (2H, s), 8.40 (1H, d , J = 1.2 Hz).

D) methyl 2- (8-aminoimidazo [1,2-a] pyridin-6-yl) propan-2-ol 8-aminoimidazo [1,2-a] pyridine-6-carboxylate (2.00 g), Methyllithium (1.6 M ether solution, 39.2 mL) was added dropwise to a mixture of HMPA (3.64 mL) and anhydrous THF (35 mL) at -78 ° C, then at -78 ° C for 30 minutes, at room temperature for 2 days. Stir. A saturated aqueous ammonium chloride solution was added to the reaction mixture, a saturated aqueous sodium bicarbonate solution was further added, and the mixture was extracted 4 times with dichloromethane. The combined extracts were dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (390 mg) as a brown solid.
MS (ESI +): [M + H] ⁺ 192.1.
¹ H-NMR (CDCl ₃ , 400 MHz): δ 1.59 (6H, s), 4.47 (2H, brs), 6.40 (1H, d, J = 1.6 Hz), 7.49-7.50 (2H, m), 7.77 ( 1H, d, J = 1.6 Hz). * The peak of “OH group” was not observed.

E) N- [6- (1-hydroxy-1-methylethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2 , 3-c] pyrazol-1 (4H) -yl] acetamide The title compound was obtained in the same manner as in Step C of Example 54.
MS (ESI +): [M + H] ⁺ 424.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.60 (6H, s), 1.97-2.04 (2H, m), 2.67 (2H, t, J = 6.2 Hz), 4.30-4.40 (2H, m), 4.91 ( 2H, s), 7.48 (1H, s), 7.53 (1H, s), 8.11 (1H, s), 8.14 (1H, d, J = 1.5 Hz), 9.48 (1H, brs), * “OH group” No peak was observed.

Example 62
8-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) imidazo [1,2-a] pyridine-6- Carboxamide

A) 8-Aminoimidazo [1,2-a] pyridine-6-carboxylic acid Methyl 8-aminoimidazo [1,2-a] pyridine-6-carboxylate (3.20 g), 2N aqueous sodium hydroxide solution (16.7 mL) ), And methanol (30 mL) was stirred at room temperature for 17 hours. A 10% aqueous citric acid solution was added, and the precipitate was collected by filtration and washed with water (50 mL) to give the title compound (2.70 g) as a white solid.
¹ H-NMR (CDCl ₃ , 400 MHz): 5.81 (2H, brs), 6.67 (1H, d, J = 1.2 Hz), 7.50 (1H, d, J = 1.2 Hz), 7.96 (1H, d, J = 1.2 Hz), 8.51 (1H, d, J = 1.2 Hz), 12.85 (1H, brs).

B) 8-Aminoimidazo [1,2-a] pyridine-6-carboxamide 8-Aminoimidazo [1,2-a] pyridine-6-carboxylic acid (2.70 g), ammonium chloride (2.45 g), HOBt (2.80 A mixture of g), EDCI (3.51 g), DIEA (7.99 mL), and THF (50.8 mL) was stirred at room temperature for 17 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (ethyl acetate / methanol) to give the title compound (2.00 g) as a white solid.
MS (ESI +): [M + H] ⁺ 177.1.
¹ H NMR (DMSO-d ₆ , 400 MHz): δ 5.72 (2H, brs), 6.63 (1H, d, J = 1.6 Hz), 7.27 (1H, brs), 7.48 (1H, s), 7.83 (1H , brs), 7.87 (1H, s), 8.36 (1H, d, J = 1.6 Hz).

C) 8-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) imidazo [1,2-a] pyridine- 6-Carboxamide

The title compound was obtained in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 409.3.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.88-1.99 (2H, m), 2.58 (2H, t, J = 5.9 Hz), 4.28-4.38 (2H, m), 5.12 (2H, s), 7.43 (1H, brs), 7.67 (1H, s), 8.00 (1H, brs), 8.08 (1H, d, J = 1.5 Hz), 8.33 (1H, d, J = 1.5 Hz), 8.87 (1H, d , J = 1.5 Hz), 10.61 (1H, s).

Example 63
N- [6- (1-hydroxy-1-methylethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5, 6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

A) Methyl 6-chloro-5-nitropyridine-3-carboxylate DMF (2.52 mL) was added to a mixture of methyl 6-hydroxy-5-nitropyridine-3-carboxylate (60.0 g) and thionyl chloride (119 mL). After dropwise addition at 0 ° C., the mixture was stirred at 80 ° C. for 17 hours. The reaction mixture was cooled to room temperature and concentrated under reduced pressure. The resulting residue was dissolved in dichloromethane (700 mL), methanol (350 mL) was added dropwise at 0 ° C., and the mixture was allowed to return to room temperature. Water (600 mL) was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The combined extracts were dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (48.0 g) as a brown solid.
¹ H NMR (CDCl ₃ , 400 MHz) δ 4.03 (3H, s), 8.77 (1H, d, J = 2.0 Hz), 9.18 (1H, d, J = 2.0 Hz).

B) Methyl 6-hydrazino-5-nitropyridine-3-carboxylate 6-chloro-5-nitropyridine-3-carboxylate (48.0 g) in THF (169 mL) and 1,4-dioxane (369 mL) A solution of hydrazine monohydrate (126 mL) in THF (200 mL) was added to the mixed solution at 0 ° C., and the mixture was stirred at 0 ° C. for 30 min. Ice water (500 mL) was added to the reaction mixture, and the precipitate was collected by filtration, washed with water (300 mL), and dried under reduced pressure to give the title compound (28.7 g) as a white solid.
¹ H NMR (CDCl ₃ , 400 MHz) δ 3.95 (3H, s), 4.47 (2H, d, J = 4.4 Hz), 9.01 (1H, d, J = 2.0 Hz), 9.05 (1H, d, J = 2.0 Hz), 9.33 (1H, brs).

C) Methyl 8-nitro [1,2,4] triazolo [1,5-a] pyridine-6-carboxylate methyl 6-hydrazino-5-nitropyridine-3-carboxylate (20.0 g) and formic acid (94 mL ) Was stirred at 85 ° C. for 17 hours. The reaction mixture was cooled to room temperature, saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted twice with dichloromethane. The combined extracts were dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (18.2 g) as a white solid.
¹ H NMR (DMSO-d ₆ , 400 MHz) δ 3.98 (3H, s), 8.85 (1H, d, J = 1.2 Hz), 8.95 (1H, s), 9.97 (1H, d, J = 1.6 Hz) .

D) Methyl 8-amino [1,2,4] triazolo [1,5-a] pyridine-6-carboxylate 8-nitro [1,2,4] triazolo [1,5-a] pyridine-6-carvone Iron powder (45.8 g) was added to a mixed solution of methyl acid (18.2 g) in water (341 mL) and acetic acid (68.3 mL) at room temperature, and the mixture was stirred at 50 ° C. for 1 hr. The reaction mixture was cooled to room temperature, insoluble material was removed by Celite filtration, saturated aqueous sodium hydrogen carbonate solution (300 mL) was added, and the mixture was extracted twice with ethyl acetate. The combined extracts were dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (13.5 g) as a white solid.
¹ H NMR (CDCl ₃ , 400 MHz): δ 3.96 (3H, s), 4.69 (2H, brs), 7.18 (1H, s), 8.32 (1H, s), 8.76 (1H, s).

E) 2- (8-Amino [1,2,4] triazolo [1,5-a] pyridin-6-yl) propan-2-ol 8-amino [1,2,4] triazolo [1,5- a) Methyl lithium (1.6 M ether solution, 48.8 mL) was added to a mixture of methyl pyridine-6-carboxylate ((2.50 g), hexamethylphosphate triamide (HMPA) (4.53 mL), and anhydrous THF (43 mL). After dropwise addition at −78 ° C., the mixture was stirred at −78 ° C. for 30 minutes and at room temperature for 5 days. The combined extracts were dried over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / methanol) to give the title compound (100 mg) Was obtained as a yellow solid.
MS (ESI +): [M + H] ⁺ 193.1.
¹ H NMR (DMSO-d ₆ , 400 MHz): δ 1.45 (6H, s), 5.20 (1H, s), 5.86 (2H, brs), 6.72 (1H, d, J = 1.6 Hz), 8.04 (1H , d, J = 1.6 Hz), 8.27 (1H, s).

F) N- [6- (1-hydroxy-1-methylethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl)- 5,6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide

The title compound was obtained in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 425.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.64 (6H, s), 1.92 (1H, s), 1.97-2.10 (2H, m), 2.69 (2H, t, J = 6.2 Hz), 4.34-4.43 ( 2H, m), 4.90 (2H, s), 8.24 (1H, s), 8.48 (1H, d, J = 1.5 Hz), 8.53 (1H, d, J = 1.5 Hz), 9.10 (1H, s).

Example 64
8-({[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) [1,2,4] triazolo [1,5 -a] pyridine-6-carboxamide

A) 8-Amino [1,2,4] triazolo [1,5-a] pyridine-6-carboxylic acid 8-Amino [1,2,4] triazolo [1,5-a] pyridine-6-carboxylic acid A mixture of methyl (5.00 g), 2N aqueous sodium hydroxide solution (26.0 mL), and methanol (43 mL) was stirred at room temperature for 17 hours. A 10% aqueous citric acid solution was added, and the precipitate was collected by filtration and washed with water (50 mL) to give the title compound (3.77 g) as a white solid.
¹ H NMR (DMSO-d ₆ , 400 MHz) δ 6.23 (2H, brs), 7.04 (1H, s), 8.48 (1H, s), 8.59 (1H, s), 13.29 (1H, brs).

B) 8-amino [1,2,4] triazolo [1,5-a] pyridine-6-carboxamide 8-amino [1,2,4] triazolo [1,5-a] pyridine-6-carboxylic acid ( A mixture of 3.77 g), ammonium chloride (3.40 g), HOBt (3.89 g), EDCI (4.87 g), DIEA (11.1 mL), and THF (70.5 mL) was stirred at room temperature for 17 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (ethyl acetate / methanol) to give the title compound (2.20 g) as a white solid.
MS (ESI +): [M + H] ⁺ 178.1.
¹ H NMR (DMSO-d ₆ , 400 MHz) δ 6.14 (2H, brs), 7.02 (1H, d, J = 1.2 Hz), 7.47 (1H, brs), 8.01 (1H, brs), 8.43 (1H, s), 8.72 (1H, d, J = 1.2 Hz).

C) 8-({[3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) [1,2,4] triazolo [1 , 5-a] pyridine-6-carboxamide The title compound was obtained in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 410.3.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.87-2.01 (2H, m), 2.58 (2H, t, J = 6.0 Hz), 4.28-4.39 (2H, m), 5.13 (2H, s), 7.64 (1H, brs), 8.15 (1H, brs), 8.67 (1H, s), 8.73 (1H, d, J = 1.5 Hz), 9.25 (1H, d, J = 1.5 Hz), 10.95 (1H, s ).

Example 65
2-({[6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -5,6-dihydro -4H-cyclopenta [b] thiophene-3-carboxamide

A) 6,6-Dimethyltetrahydro-2H-pyran-2-one Under a nitrogen atmosphere, a mixture of ethyl 4-acetylbutyrate (27.3 g) and diethyl ether (280 mL) was added to a diethyl ether solution (1.7 mg of methyl magnesium iodide). M, 100 mL) was added at 0 ° C. The reaction mixture was stirred at room temperature for 20 hours under nitrogen atmosphere, and 1N hydrochloric acid (200 mL) was added at 0 ° C. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (11.98 g) as a colorless liquid.
MS (ESI +): [M + H] ⁺ 129.9.

B) (3Z) -6,6-Dimethyl-3- (2,2,2-trifluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one Diisopropylamine (11.3 g) and dehydration under nitrogen atmosphere To a mixture of THF (175 mL) was added butyllithium in hexane (1.6 M, 70 mL) at -78 ° C. The reaction mixture was stirred at 0 ° C. for 40 minutes under a nitrogen atmosphere. This was added to a mixture of 6,6-dimethyltetrahydro-2H-pyran-2-one (11.92 g) and dehydrated THF (130 mL) at −78 ° C., stirred for 35 minutes, and then 2,2,2-trifluoroacetic acid. Trifluoroethyl (21.90 g) was added and stirred for 1 hour. The reaction mixture was added to a mixture of 6N hydrochloric acid (66 mL) and ice (400 mL), extracted with ethyl acetate, and the extract was washed with water and saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (20.65 g) as an orange liquid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.44 (6H, s), 1.84 (2H, t, J = 6.9 Hz), 2.64-2.69 (2H, m), 14.30 (1H, brs).

C) 4- (3-Hydroxy-3-methylbutyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol (3Z) -6,6-dimethyl-3- (2,2,2-trifluoro -1-Hydroxyethylidene) tetrahydro-2H-pyran-2-one (18.44 g), p-toluenesulfonic acid monohydrate (0.78 g) and toluene (150 mL) in a mixture of hydrazine monohydrate (5.36 g ) Was added. The reaction mixture was stirred at 80 ° C. for 4 hours under a nitrogen atmosphere, and water was added. The reaction mixture was extracted with ethyl acetate, the aqueous phase was extracted with an ethyl acetate / THF mixture, and the combined organic phases were dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (14.03 g) as a white solid.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.10 (6H, s), 1.45-1.50 (2H, m), 2.34-2.40 (2H, m), 12.66 (1H, brs). The “group” peak was not observed.

D) 6,6-Dimethyl-3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 4- (3-hydroxy-3-methylbutyl) -3- ( To a mixture of (trifluoromethyl) -1H-pyrazol-5-ol (14.03 g) and toluene (180 mL) was added 15% sulfuric acid (86 mL). The reaction mixture was stirred at 105 ° C. for 150 minutes, and saturated aqueous sodium hydrogen carbonate solution was added. The reaction mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (13.45 g) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.38 (6H, s), 1.79 (2H, t, J = 6.0 Hz), 2.63 (2 H, t,) J = 6.0 Hz), 9.54 (1H, brs) .

E) [6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethyl acetate 6,6-dimethyl-3- (tri To a mixture of (fluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (7.58 g) and THF (120 mL) was added potassium tert-butoxide (7.61 g) under ice-cooling. . The reaction mixture was stirred for 10 minutes under ice cooling, and ethyl bromoacetate (7.72 g) was slowly added dropwise under ice cooling. The reaction mixture was stirred at room temperature for 20 hours, 1N hydrochloric acid (60 mL) was added under ice-cooling, and the mixture was extracted with ethyl acetate. The extract was washed with saturated aqueous sodium hydrogen carbonate solution, water and saturated aqueous sodium chloride solution, and anhydrous sodium sulfate. And dried. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (5.50 g) as a pale yellow liquid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.26 (3H, t, J = 7.2Hz), 1.37 (6H, s), 1.79 (2H, t, J = 6.3 Hz), 2.62 (2 H, t, J = 6.3 Hz), 4.21 (2H, q, J = 7.2 Hz), 4.73 (2H, s).

F) [6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid [6,6-dimethyl-3- (tri Of fluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethyl acetate (5.50 g), THF (18 ml), methanol (18 mL) and water (36 mL) To the mixture was added lithium hydroxide monohydrate (2.27 g). The reaction mixture was stirred at room temperature for 90 minutes. The aqueous layer was washed with diethyl ether, and 1N hydrochloric acid was added until acidic. The mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was crystallized from an ethyl acetate-hexane mixed solvent to obtain the title compound (2.92 g) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.37 (6H, s), 1.80 (2H, t, J = 6.3 Hz), 2.62 (2 H, t, J = 6.3 Hz), 4.76 (2H, s). * The peak of “COOH group” was not observed.

G) 2-({[6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -5,6 -Dihydro-4H-cyclopenta [b] thiophene-3-carboxamide The title compound was obtained in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 443.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.36 (6H, s), 1.81 (2H, t, J = 6.4 Hz), 2.38-2.58 (2H, m), 2.66 (2H, t, J = 6.4 Hz) , 2.87 (4H, t, J = 7.2 Hz), 4.87 (2H, s), 5.71 (2H, brs), 11.97 (1H, brs).
mp: 208-210 ℃

Example 66
N- (5-Chloro-2,4-dimethoxyphenyl) -2- [6,6-dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazole-1 (4H) -Iyl] acetamide The title compound was obtained in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 448.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.38 (6H, s), 1.80 (2H, t, J = 6.3 Hz), 2.65 (2H, t, J = 6.2 Hz), 3.83 (3H, s), 3.87 (3H, s), 4.75 (2H, s), 6.48 (1H, s), 8.42 (1H, s), 8.76 (1H, brs).
mp: 160-162 ℃

Example 67
2- [6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] acetamide 6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 28) (0.71 g) in toluene (30 mL ) Triethylaluminum (15% toluene solution, 2.0 mL) was added to the solution, and the reaction mixture was stirred at room temperature for 30 minutes, and then [6,6-dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2 , 3-c] pyrazol-1 (4H) -yl] ethyl acetate (0.36 g) in toluene (10 mL) was added. The reaction mixture was stirred for 24 hours, water was added, the reaction mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.25 g) as a white solid.
MS (ESI +): [M + H] ⁺ 462.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ1.39 (6 H, s) 1.82 (2 H, t, J = 6.4 Hz) 2.67 (2 H, t, J = 6.4 Hz) 4.89 (2 H, s) 7.61 (1 H, d, J = 1.1 Hz) 7.64 (1 H, d, J = 1.1 Hz) 8.20-8.32 (2 H, m) 9.38 (1 H, brs).
mp: 129-130 ° C.
Anal. Calcd for C ₁₉ H ₁₇ F ₆ N ₅ O ₂ : C, 49.46; H, 3.71; N, 15.18. Found: C, 49.65; H, 3.76; N, 14.98.

Example 68
2- [4-Oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1 , 2-a] Pyridin-8-yl] acetamide

A) [5-Hydroxy-3- (trifluoromethyl) -1H-pyrazol-1-yl] ethyl acetate 4,4,4-trifluoroacetoacetate ethyl (14.7 g), hydrazinoacetic acid ethyl hydrochloride (12.4 g) , A mixture of triethylamine (8.10 g, 80 mmol) and ethanol (200 mL) was stirred with heating under reflux for 72 hours, and then the solvent was evaporated under reduced pressure. Water was added to the residue, extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was crystallized from a mixed solvent of ethyl acetate-hexane to give the title compound (16.5 g) as a white solid.
MS (ESI +): [M + H] ⁺ 239.1.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.20 (3 H, t, J = 7.0 Hz) 4.15 (2 H, q, J = 7.2 Hz) 4.85 (2 H, s) 5.75 (1 H, s ) 11.97 (1 H, brs).

B) 4-Acryloyl-5-hydroxy-3- (trifluoromethyl) -1H-pyrazol-1-yl] ethyl acetate [5-hydroxy-3- (trifluoromethyl) -1H-pyrazol-1-yl] acetic acid A mixture of ethyl (1.19 g), magnesium ethoxide (0.57 g), and THF (50 mL) was stirred with heating under reflux for 4 hours, and then cooled to 0 ° C. After adding a solution of acrylolyl chloride (0.45 g,) in THF (3 mL), the reaction mixture was stirred at room temperature for 18 hours. Water was added and the mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.20 g) as a pink solid.
MS (ESI +): [M + H] ⁺ 293.1.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.19 (3 H, d, J = 7.2 Hz) 4.20 (2 H, q, J = 7.2 Hz) 4.31-4.99 (2 H, m) 5.42 (1 H, brs), 5.73-6.62 (2 H, m) 7.87 (1 H, brs).

C) [4-Oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethyl acetate 4-acryloyl-5-hydroxy-3- (tri A mixture of (fluoromethyl) -1H-pyrazol-1-yl] ethyl acetate (2.52 g) and concentrated sulfuric acid (30 mL) was stirred at 0 ° C. for 90 minutes and then added to ice water. Water was added, and the mixture was extracted with ethyl acetate. The extract was washed with a saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (2.5 g) as a white solid.
MS (ESI +): [M + H] ⁺ 293.1.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.30 (3 H, t, J = 7.2 Hz) 2.74 (2 H, t, J = 6.4 Hz) 4.27 (2 H, q, J = 7.2 Hz) 4.75 (2 (H, t, J = 6.4 Hz) 4.80 (2 H, s).

2- [4-Oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1 , 2-a] pyridin-8-yl] acetamide 6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 28) (2.05 g) in toluene (50 mL) Triethylaluminum (15% toluene solution, 5.7 mL) was added to the reaction mixture, and the reaction mixture was stirred at room temperature for 1 hour, and then [4-oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c ] Pyrazol-1 (4H) -yl] ethyl acetate (0.86 g) was added. The reaction mixture was stirred for 36 hours, water was added, the reaction mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.36 g) as a white solid.
MS (ESI +): [M + H] ⁺ 448.0.
¹ H NMR (300 MHz, CDCl ₃ ) δ 2.78 (2 H, t, J = 6.44 Hz) 4.81 (2 H, t, J = 6.44 Hz) 5.00 (2 H, s) 7.67 (2 H, dd, J = 15.15, 1.14 Hz) 8.18-8.39 (2 H, m) 9.19 (1 H, brs).
mp: 196-197 ° C.

Example 69
2- [4-Hydroxy-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1 , 2-a] Pyridin-8-yl] acetamide
A) Ethyl [4-hydroxy-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetate [4-oxo-3- (trifluoromethyl) -5,6-Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] hydrogenated at 0 ° C in a mixed solution of ethyl acetate (0.68 g) in THF (10 mL) and ethanol (10 mL) After adding sodium boron (0.10 g), the mixture was stirred at 0 ° C. for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound (0.61 g) as a light brown amorphous.
MS (ESI +): [M + H] ⁺ 295.1.
¹ H NMR (300 MHz, CDCl ₃ ) δ1.28 (t, J = 7.2 Hz, 3H), 1.89-2.17 (2 H, m), 3.94-4.12 (1 H, m), 4.23 (q, J = 7.2 Hz, 2H), 4.35-4.58 (2 H, m), 4.75 (2 H, s), 4.88-5.03 (1 H, m).

B) 2- [4-Hydroxy-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1,2-a] Pyridin-8-yl] acetamide 6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (compound of Reference Example 28) (1.21 g) in toluene (50 mL ) Triethylaluminum (15% toluene solution, 3.3 mL) was added to the solution, and the reaction mixture was stirred at room temperature for 1 hour, and then [4-hydroxy-3- (trifluoromethyl) -5,6-dihydropyrano [2,3 -c] Pyrazol-1 (4H) -yl] ethyl acetate (0.33 g) in toluene (5 mL) was added. The reaction mixture was stirred for 72 hours, water was added, the reaction mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.28 g) as a light brown solid.
MS (ESI +): [M + H] ⁺ 450.0.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.80-1.90 (1 H, m), 1.90-2.04 (1 H, m), 4.28-4.39 (1 H, m), 4.43-4.53 (1 H, m), 4.67-4.73 (1 H, m), 5.18 (2 H, s), 5.23 (1 H, d, J = 5.7 Hz), 7.76 (1 H, d, J = 1.1 Hz), 8.13 (1 H, d, J = 1.5 Hz), 8.15 (1 H, d, J = 1.5 Hz), 8.97-9.01 (1 H, m), 10.94 (1 H, s).
mp: 212-213 ° C.
Anal. Calcd for C ₁₇ H ₁₃ F ₆ N ₅ O ₃ : C, 45.44; H, 2.92; N, 15.59. Found: C, 45.54; H, 3.06; N, 15.25.

Example 70
2- [6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N-{[3- (1-methylethyl ) Isoxazol-5-yl] methyl} acetamide The title compound was prepared in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 401.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.25 (6H, d, J = 6.8 Hz), 1.37 (6H, s), 1.80 (2H, t, J = 6.4 Hz), 2.63 (2H, t, J = 6.4 Hz), 3.02 (1H, spt, J = 6.8 Hz), 4.53 (2H, d, J = 6.1 Hz), 4.67 (2H, s), 6.02 (1H, s), 6.68 (1H, brs).
mp: 98-99 ℃

Example 71
2-({[6-Methyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -5,6-dihydro-4H -Cyclopenta [b] thiophene-3-carboxamide The title compound was produced in the same manner as in Example 65.
MS (ESI +): [M + H] ⁺ 429.4.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.42 (3H, d, J = 6.4 Hz), 1.66-1.87 (1H, m), 1.91-2.12 (1H, m), 2.36-2.57 (2H, m), 2.57-2.80 (2H, m), 2.80-3.04 (4H, m), 4.28-4.60 (1H, m), 4.88 (2H, s), 5.55 (2H, brs), 12.02 (1H, s).
mp: 228-229 ° C

Example 72
N-{[3- (1-methylethyl) isoxazol-5-yl] methyl} -2- [6-methyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazole -1 (4H) -yl] acetamide The title compound was produced in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 387.4.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.26 (6H, d, J = 7.2 Hz), 1.44 (3H, d, J = 6.1 Hz), 1.61-1.82 (1H, m), 1.85-2.12 (1H, m), 2.50-2.78 (2H, m), 2.92-3.17 (1H, m), 4.23-4.45 (1H, m), 4.53 (2H, d, J = 5.7 Hz), 4.68 (2H, s), 6.03 (1H, s), 6.74 (1H, brs).
mp: 153-154 ℃

Example 73
N- (5-Chloro-2,4-dimethoxyphenyl) -2- [6-methyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl Acetamide The title compound was produced in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 434.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.45 (3H, d, J = 6.4 Hz), 1.64-1.83 (1H, m), 1.93-2.11 (1H, m), 2.54-2.79 (2H, m), 3.83 (3H, s), 3.87 (3H, s), 4.29-4.44 (1H, m), 4.76 (2H, s), 6.48 (1H, s), 8.43 (1H, s), 8.83 (1H, s) .
mp: 190-191 ℃

Example 74
2-({[6,6-Dimethyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6 , 7-Tetrahydro-1-benzothiophene-3-carboxamide]
The title compound was produced in the same manner as in Step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 457.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.36 (6H, s) 1.77-1.87 (6H, m), 2.62-2.72 (6H, m), 4.86 (2H, s), 5.64 (2H, brs), 12.11 (1H, s).

Example 75
2-({[6-Methyl-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6,7 -Tetrahydro-1-benzothiophene-3-carboxamide The title compound was prepared in a similar manner to step 54 of Example 54.
MS (ESI +): [M + H] ⁺ 443.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.42 (3H, d, J = 6.4 Hz), 1.66-1.89 (5H, m), 1.93-2.07 (1H, m), 2.57-2.77 (6H, m), 4.30-4.52 (1H, m), 4.88 (2H, s), 5.73 (2H, brs), 12.17 (1H, s).

Example 76
2-({[4-oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6,7 -Tetrahydro-1-benzothiophene-3-carboxamide

A) [4-oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid [4-oxo-3- (trifluoromethyl)- A mixture of ethyl 5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetate (0.19 g) and 6N hydrochloric acid (3 mL) was heated and stirred at 60 ° C. for 5 hours, and then concentrated under reduced pressure. The title compound (0.17 g) was obtained as a white solid.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 2.70 (2 H, t), 4.80 (2 H, t, J = 6.4 Hz), 4.96 (2 H, s), 13.58 (1 H, brs).

B) 2-({[4-oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6 , 7-Tetrahydro-1-benzothiophene-3-carboxamide [4-oxo-3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (0.17 To a solution of g) in THF (3 mL) was added oxalyl chloride (0.16 g) and DMF (1 drop) at 0 ° C., and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in THF (2 mL). 2-Amino-4,5,6,7-tetrahydro-1-benzothiophene-3-carboxamide (0.20 g) and triethylamine (0.30 g) in THF (5 mL) were added at 0 ° C. with the acid chloride solution. The mixture was stirred at 0 ° C. for 1 hour. Water was added, the reaction mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) .The resulting solid was crystallized from a mixed solvent of ethyl acetate-hexane to give the title compound (0.14 g) as light brown crystals. Obtained.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.85 (4 H, d), 2.63-2.81 (6 H, m), 4.79 (2 H, t, J = 6.4 Hz), 4.95 (2 H, s), 5.78 (2 H, br.s.), 12.51 (1 H, s).
mp: 216-217 ° C.
Anal. Calcd for C ₁₈ H ₁₇ F ₃ N ₄ O ₄ S: C, 48.87; H, 3.87; N, 12.66. Found: C, 49.18; H, 3.87; N, 12.40.

Example 77
3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazol-5-yl } Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) 6- (Trifluoromethyl) imidazo [1,2-a] pyridine-8-carbonitrile 8-Bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine (1.0 g), cyanide A mixture of zinc (0.33 g), tris (dibenzylideneacetic acid) dipalladium (0) (0.173 g), 1,1'-bis (diphenylphosphine) ferrocene (0.21 g), and DMF (2 mL) under nitrogen flow The mixture was heated and stirred at 120 ° C. for 2.5 hours. The reaction mixture was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.54 g) as a yellow brown solid.
MS (ESI +): [M + H] ⁺ 212.1.
¹ H NMR (300 MHz, CDCl ₃ ) δ 7.79 (1 H, d), 7.85 (1 H, d, J = 1.1 Hz), 7.92 (1 H, d, J = 1.5 Hz), 8.72-8.75 (1 H, m).
IR (KBr) 3136, 2240, 1634, 1520, 1385, 1333, 1314, 1256, 1221, 1179, 1140, 1082, 1097 cm ^-1 .

B) N-hydroxy-6- (trifluoromethyl) imidazo [1,2-a] pyridine-8-carboximidamide 6- (trifluoromethyl) imidazo [1,2-a] pyridine-8-carbonitrile ( A mixture of 0.43 g), hydroxylammonium chloride (0.21 g) and sodium carbonate (0.32 g) in ethanol (15 mL) and water (1.5 mL) was stirred at room temperature for 36 hours. The reaction mixture was concentrated under reduced pressure, water was added to the residue, the mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was crystallized from diisopropyl ether to give the title compound (0.37 g) as a white solid.
MS (ESI +): [M + H] ⁺ 245.1.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 6.82 (2 H, br. S.), 7.81 (1 H, s), 7.82 (1 H, s), 8.18 (1 H, d, J = 1.5 Hz), 9.32 (1 H, s), 10.01 (1 H, s).

C) 3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazole-5 -Il} methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole N-hydroxy-6- (trifluoromethyl) imidazo [1,2-a] pyridine-8-carboximide Amide (0.24 g), [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (0.25 g) and HOBt monohydrate (0.23 g EDCI (0.29 g) and triethylamine (0.15 g) were added to a DMF (5 mL) solution, and the mixture was stirred at room temperature for 3 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure. The residue was dissolved in pyridine (10 mL), heated and stirred at 115 ° C. for 18 hours, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane), and the obtained solid was crystallized from a mixed solvent of ethyl acetate-hexane to give the title compound (0.19 g) as pale-brown crystals.
MS (ESI +): [M + H] ⁺ 459.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.98-2.08 (2 H, m), 2.68 (2 H, t, J = 6.2 Hz), 4.32-4.39 (2 H, m), 5.54 (2 H, s ), 7.81 (1 H, d, J = 1.5 Hz), 7.93 (1 H, d, J = 1.5 Hz), 8.21 (1 H, d, J = 1.5 Hz), 8.66-8.69 (1 H, m) .
mp: 108-109 ° C.
Anal. Calcd for C ₁₈ H ₁₂ F ₆ N ₆ O ₂ : C, 47.17; H, 2.64; N, 18.34. Found: C, 46.86; H, 2.60; N, 18.21.
IR (KBr) 3098, 1601, 1541, 1505, 1421, 1364, 1312, 1294, 1264, 1100, 999 cm ^-1 .

Example 78
1-({3- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -1,2,4-oxadiazole- 5-yl} methyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) 3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine-8-carbonitrile 8-bromo-3-methyl-6- (trifluoromethyl) [ 1,2,4] triazolo [4,3-a] pyridine (0.53 g), zinc cyanide (0.18 g), tris (dibenzylideneacetic acid) dipalladium (0) (0.092 g), 1,1'-bis A mixture of (diphenylphosphine) ferrocene (0.11 g) and DMF (2 mL) was heated and stirred at 120 ° C. for 3 hours under a nitrogen stream. The reaction mixture was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.36 g) as a yellow-brown solid.
MS (ESI +): [M + H] ⁺ 226.9.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 2.79 (3 H, s), 8.57 (1 H, d, J = 1.5 Hz), 9.31 (1 H, t, J = 1.5 Hz).

B) 1-({3- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -1,2,4-oxadi Azol-5-yl} methyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 3-methyl-6- (trifluoromethyl) [1, 2,4] Triazolo [4,3-a] pyridine-8-carbonitrile (0.17 g), hydroxylammonium chloride (0.046 g) and sodium carbonate (0.076 g) in ethanol (5 mL) and water (0.5 mL) The mixture was stirred at room temperature for 60 hours, concentrated under reduced pressure, and then dissolved in pyridine (3 mL). [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (0.18 g) in THF (3 mL) in oxalyl chloride (0.18 g) And DMF (1 drop) was added at 0 ° C., stirred at room temperature for 1 hour, and concentrated under reduced pressure.The residue was dissolved in THF (1 mL) and added dropwise to the pyridine mixture at 0 ° C. at 0 ° C. It was. The reaction mixture was stirred at room temperature for 1 hour, and then the THF solvent was distilled off under reduced pressure. The pyridine mixture was heated and stirred at 115 ° C. for 6 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) and basic silica gel column chromatography (ethyl acetate / hexane) to give the title compound (0.024 g) as colorless crystals. It was.
MS (ESI +): [M + H] ⁺ 474.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.99-2.09 (2 H, m), 2.68 (2 H, t, J = 6.2 Hz), 2.89 (3 H, s), 4.34-4.40 (2 H, m ), 5.55 (2 H, s), 8.25 (1 H, d, J = 1.5 Hz), 8.35-8.38 (1 H, m).

Example 79
1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazol-5-yl} methyl)- 3- (Trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole N'-hydroxy-5-methyl-7- (trifluoromethyl) pyrazolo [1,5-a ] Pyrimidine-3-carboximidamide (0.26 g), [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (0.25 g) and HOBt To a solution of monohydrate (0.23 g) in DMF (5 mL) were added WSC (0.29 g) and triethylamine (0.15 g), and the mixture was stirred at room temperature for 3 hr. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure. The residue was dissolved in toluene (30 mL), heated and stirred at 120 ° C. for 1 hour, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane), and the obtained solid was crystallized from a mixed solvent of ethyl acetate-hexane to give the title compound (0.19 g) as pale-yellow crystals.
MS (ESI +): [M + H] ⁺ 474.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.96-2.07 (2 H, m), 2.67 (2 H, t, J = 6.2 Hz), 2.83 (3 H, s), 4.32-4.38 (2 H, m ), 5.50 (2 H, s), 7.21 (1 H, s), 8.72 (1 H, s).
mp: 201-202 ° C.
Anal. Calcd for C ₁₈ H ₁₃ F ₆ N ₇ O ₂ : C, 45.67; H, 2.77; N, 20.71.Found: C, 45.94; H, 2.86; N, 20.18.

Example 80
3- (Trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,3,4-oxadiazol-2-yl } Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) tert-butyl 2-{[3- (trifluoromethyl) -3a, 5,6,7a-tetrahydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} hydrazinecarboxylate [ To a solution of 3- (trifluoromethyl) -3a, 5,6,7a-tetrahydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (250 mg) in DMF (5.0 mL), tert -Butyl hydrazinecarboxylate (158.6 mg) and triethylamine (279 μL) were added. To the reaction solution, O- (benzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluorophosphate (HATU) (456.3 mg) was added little by little at 0 ° C, and For 10 minutes. The reaction mixture was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (320.6 mg).
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.39 (9H, s) 1.84-1.97 (2H, m) 2.55 (2H, t, J = 6.2 Hz) 4.26-4.35 (2H, m) 4.63 (2H, s) 8.89 (1H, s) 9.95 (1H, s).

B) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetohydrazide tert-butyl 2-{[3- (trifluoromethyl) -3a, 5,6,7a-Tetrahydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} hydrazinecarboxylate (319.2 mg) in ethyl acetate (4.0 mL) in 4N hydrogen chloride / Ethyl acetate (2.0 mL) solution was added. The reaction mixture was stirred at room temperature for 3 hours. Further, 4N hydrogen chloride / ethyl acetate (2.0 mL) solution was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. After concentration under reduced pressure, the resulting residue was diluted with a saturated aqueous sodium bicarbonate solution and extracted with ethyl acetate / 2-propanol. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (209.6 mg).
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.90-2.09 (2H, m) 2.65 (2H, t, J = 6.4 Hz) 3.88 (2H, br.s.) 4.25-4.41 (2H, m) 4.68 (2H , s). * 1 No proton peak was observed.

C) 6- (Trifluoromethyl) -N '-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} imidazo [1, 2-a] pyridine-8-carbohydrazide
2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetohydrazide (29.8 mg) in 6- (tri Fluoromethyl) imidazo [1,2-a] pyridine-8-carboxylic acid (26 mg) and triethylamine (31.5 μL) were added. HATU (51.6 mg) was added to the reaction solution little by little at 0 ° C., and the mixture was stirred at 0 ° C. for 30 minutes and at room temperature for 5.5 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (67.2 mg).
MS (ESI +): [M + H] ⁺ 476.8.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.93-2.11 (2H, m), 2.60-2.73 (2H, m), 4.33-4.43 (2H, m), 4.85 (2H, s), 7.74-7.88 (2H , m), 8.34 (1H, d, J = 1.9 Hz), 8.61-8.73 (1H, m), 9.20-9.38 (1H, m), 12.65-12.84 (1H, m).

D) 3- (Trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,3,4-oxadiazole-2 -Yl} methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 6- (trifluoromethyl) -N '-{[3- (trifluoromethyl) -5,6- Triphenylphosphine on polystyrene with dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} imidazo [1,2-a] pyridine-8-carbohydrazide (67.2 mg) in acetonitrile (3.0 mL) (170.4 mg) and trichloroacetonitrile (22.7 μL) were added, and the mixture was stirred at 90 ° C. for 25 hours. The reaction mixture was cooled to room temperature, and the insoluble material was filtered off using celite. The filtrate was concentrated under reduced pressure, and the obtained residue was purified by basic silica gel column chromatography (ethyl acetate / hexane) to give the title compound (15.9 mg).
MS (ESI +): [M + H] ⁺ 459.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.95-2.07 (2H, m), 2.65 (2H, t, J = 6.2 Hz), 4.31-4.41 (2H, m), 5.56 (2H, s), 7.85 ( 1H, d, J = 1.1 Hz), 7.94 (1H, d, J = 1.1 Hz), 8.12 (1H, d, J = 1.5 Hz), 8.68-8.75 (1H, m).

Example 81
3- (Trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazol-3-yl } Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetonitrile 3- (trifluoromethyl) -1,4,5,6-tetrahydro To a mixture of pyrano [2,3-c] pyrazole (the compound of Reference Example 9) (1.0 g) and THF (15 ml) was added potassium tert-butoxide (1.16 g) under ice cooling. The reaction mixture was stirred for 30 minutes under ice cooling, and then a mixture of bromoacetonitrile (0.63 g) and THF (3 ml) was slowly added dropwise under ice cooling. The reaction mixture was stirred at room temperature overnight, and potassium tert-butoxide (1.16 g) and bromoacetonitrile (0.63 g) were added under ice cooling. The reaction mixture was stirred at room temperature for 2 days, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (474 mg) as a yellow solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.93-2.08 (2H, m), 2.64 (2H, t, J = 6.1 Hz), 4.34-4.45 (2H, m), 4.88 (2H, s).

B) (1Z) -N'-hydroxy-2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethanimidoamide [3- ( (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetonitrile (0.12 g), hydroxylammonium chloride (0.051 g) and sodium carbonate (0.080 g) in ethanol (3 mL) and water (0.3 mL) were stirred at room temperature for 96 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound (0.12 g) as a white solid.
MS (ESI +): [M + H] ⁺ 265.1.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.84-1.96 (2 H, m), 2.52-2.58 (2 H, m), 4.25-4.39 (2 H, m), 4.50 (2 H, s) , 5.40 (2 H, s), 9.31 (1 H, s).

C) 6- (Trifluoromethyl) imidazo [1,2-a] pyridine-8-carboxylic acid 8-bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine (2.0 g), cyanide A mixture of zinc (0.66 g), tris (dibenzylideneacetic acid) dipalladium (0) (0.35 g), 1,1'-bis (diphenylphosphine) ferrocene (0.41 g), and DMF (3 mL) under nitrogen flow The mixture was heated and stirred at 120 ° C. for 2.5 hours. The reaction mixture was purified by silica gel column chromatography (ethyl acetate / hexane), and the mixture of 6N hydrochloric acid (5 mL) of the obtained light brown solid (0.20 g) was heated with stirring at 120 ° C. for 16 hours, and then concentrated under reduced pressure. did. The obtained residue was dissolved in water (5 mL), triethylamine (1 mL) was added, and the mixture was concentrated under reduced pressure. The obtained residue was crystallized from methanol and ether to give the title compound (0.23 g) as a pale brown solid.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 7.84 (1 H, d, J = 1.1 Hz), 7.90 (1 H, d, J = 1.9 Hz), 8.19 (1 H, d, J = 1.1 Hz ), 9.44-9.48 (1 H, m). * No peak of "COOH group" was observed.

D) (1Z) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N '-({[6- (trifluoro Methyl) imidazo [1,2-a] pyridin-8-yl] carbonyl} oxy) ethanimidoamide (1Z) -N'-hydroxy-2- [3- (trifluoromethyl) -5,6-dihydropyrano [2 , 3-c] pyrazol-1 (4H) -yl] ethaneimidoamide (0.12 g), 6- (trifluoromethyl) imidazo [1,2-a] pyridine-8-carboxylic acid (0.13 g) and HOBt EDCI (0.12 g) and triethylamine (0.066 g) were added to a DMF (3 mL) solution of hydrate (0.10 g), and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the precipitate was collected by filtration to give the title compound (0.16 g) as a brown solid.
MS (ESI +): [M + H] ⁺ 476.9.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.89-2.01 (2 H, m), 2.57 (2 H, t, J = 6.1 Hz), 4.34-4.43 (2 H, m), 4.79 (2 H , s), 7.87 (1 H, d, J = 1.5 Hz), 8.08 (1 H, d, J = 1.9 Hz), 8.24 (1 H, d, J = 1.1 Hz), 9.54-9.58 (1 H, m). * No peak of “NH ₂ group” was observed.

E) 3- (Trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazole-3 -Yl} methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (1Z) -2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3- c] pyrazol-1 (4H) -yl] -N ′-({[6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] carbonyl} oxy) ethanimidoamide (0.16 g) Was dissolved in pyridine (30 mL), heated and stirred at 120 ° C. for 16 hours, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane), and the obtained solid was crystallized from a mixed solvent of ethyl acetate-hexane to give the title compound (0.070 g) as colorless crystals.
MS (ESI +): [M + H] ⁺ 459.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.96-2.07 (2 H, m), 2.67 (2 H, t, J = 6.2 Hz), 4.31-4.37 (2 H, m), 5.47 (2 H, s ), 7.86 (1 H, d, J = 1.5 Hz), 7.98 (1 H, d, J = 1.5 Hz), 8.27 (1 H, d, J = 1.5 Hz), 8.72-8.76 (1 H, m) .

Example 82
3- (Trifluoromethyl) -1-({5- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,3,4-thiadiazol-2-yl} methyl ) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 6- (trifluoromethyl) -N '-{[3- (trifluoromethyl) -5,6-dihydropyrano [2, 3-c] pyrazol-1 (4H) -yl] acetyl} imidazo [1,2-a] pyridine-8-carbohydrazide (100 mg) (synthesized in Example 80, Step C) in THF / toluene (2.5 mL / 1.0 mL) was mixed with niline pentasulfide (140 mg). The reaction solution was irradiated with microwaves at 180 ° C. for 20 minutes. The reaction mixture was diluted with water and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane). The obtained solid was recrystallized from ethyl acetate / hexane to give the title compound (43.9 mg).
MS (ESI +): [M + H] ⁺ 475.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.93-2.07 (2H, m), 2.65 (2H, t, J = 6.2 Hz), 4.30-4.39 (2H, m), 5.70 (2H, s), 7.83 ( 1H, d, J = 1.1 Hz), 7.86 (1H, d, J = 1.1 Hz), 8.59 (1H, d, J = 1.5 Hz), 8.64-8.68 (1H, m).

Example 83
1-({3- [2-methyl-4- (trifluoromethyl) imidazo [1,5-a] pyrimidin-8-yl] -1,2,4-oxadiazol-5-yl} methyl)- 3- (Trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) 2-Methyl-4- (trifluoromethyl) imidazo [1,5-a] pyrimidine-8-carbonitrile 5-amino-1H-imidazole-4-carbonitrile (5.0 g), 1,1,1- A mixture of trifluoropentane-2,4-dione (7.3 g) and acetic acid (100 mL) was stirred with heating under reflux for 8 hours, and then concentrated under reduced pressure. The residue was dissolved in ethyl acetate, an aqueous potassium carbonate solution was added, the mixture was extracted with ethyl acetate, and the extract was dried over anhydrous magnesium sulfate. The solvent was evaporated under reduced pressure, and the resulting residue was washed with ether to give the title compound (5.6 g).
MS (ESI +): [M + H] ⁺ 227.1.
¹ H NMR (300 MHz, CDCl ₃ ) δ 2.75 (3H, s), 7.10 (1H, s), 8.13 (1H, s).

B) N'-hydroxy-2-methyl-4- (trifluoromethyl) imidazo [1,5-a] pyrimidine-8-carboximidamide 2-methyl-4- (trifluoromethyl) imidazo [1,5- a] A mixture of pyrimidine-8-carbonitrile (0.23 g), hydroxylammonium chloride (0.11 g) and sodium carbonate (0.16 g) in ethanol (10 mL) and water (1 mL) was stirred at room temperature for 2 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, the residue was crystallized from diisopropyl ether, and the filtrate was concentrated. The obtained residue was purified by silica gel column chromatography (ethyl acetate / methanol) to give the title compound (0.026 g) as a yellow-brown solid.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 2.55 (3 H, s), 5.75 (2 H, s), 7.44 (1 H, s), 8.42 (1 H, d, J = 1.9 Hz), 9.67 (1 H, s).

C) 1-({3- [2-Methyl-4- (trifluoromethyl) imidazo [1,5-a] pyrimidin-8-yl] -1,2,4-oxadiazol-5-yl} methyl ) -3- (Trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole N'-hydroxy-2-methyl-4- (trifluoromethyl) imidazo [1,5 -a] pyrimidine-8-carboximidamide (0.026 g), [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetic acid (0.025 g) WSC (0.029 g) and triethylamine (0.015 g) were added to a DMF (2 mL) solution of HOBt monohydrate (0.023 g), and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure. The residue was dissolved in toluene (10 mL), heated and stirred at 120 ° C. for 1 hour, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane), and the obtained solid was crystallized from an ethyl acetate-hexane mixed solvent to give the title compound (0.019 g) as pale-brown crystals.
MS (ESI +): [M + H] ⁺ 474.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.96-2.04 (2 H, m), 2.65 (2 H, t, J = 6.4 Hz), 2.75 (3 H, s), 4.30-4.36 (2 H, m ), 5.54 (2 H, s), 7.01 (1 H, s), 8.25 (1 H, q, J = 1.5 Hz).

Example 84
3- (trifluoromethyl) -1-{(2E) -3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] prop-2-en-1-yl}- 1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) 1-[(2E) -3- (4,4,5,5-Tetramethyl-1,3,2-dioxaborolan-2-yl) -2-propen-1-yl] -3- (trifluoro Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole ( Compound of Reference Example 9) (284 mg), potassium carbonate (410 mg) and DMF (7 mL) were mixed with 2-[(1E) -3-chloro-1-propen-1-yl] -4,4 , 5,5-Tetramethyldioxaborolane (300 mg) was added under ice cooling. The reaction mixture was stirred at room temperature for 2 days, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (94 mg) as a colorless liquid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.25 (12H, s), 1.92-2.02 (2H, m), 2.62 (2H, t, J = 6.4 Hz), 4.25-4.31 (2H, m), 4.65 ( 2H, dd, J = 4.7, 1.9 Hz), 5.33 (1H, dt, J = 18.2, 1.9 Hz), 6.61 (1H, dt, J = 18.2, 4.7 Hz).

B) 3- (Trifluoromethyl) -1-{(2E) -3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2-propen-1-yl} -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole The title compound was obtained in the same manner as in Step A of Example 55.
MS (ESI +): [M + H] ⁺ 417.2.
¹ H NMR (300 MHz, DMSO-d ₆ ) δ 1.89-2.02 (2H, m), 2.56-2.62 (2H, m), 4.29-4.41 (2H, m), 4.85 (2H, d, J = 6.1 Hz ), 6.84 (1H, d, J = 13.6 Hz), 7.49-7.67 (2H, m), 7.74 (1H, d, J = 1.1 Hz), 8.10 (1H, d, J = 1.1 Hz), 9.17 (1H , s).
mp: 108-110 ℃

Example 85
1-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} -3- [6- (trifluoromethyl) imidazo [1, 2-a] pyridin-8-yl] urea [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) yl] acetic acid (compound of Reference Example 11) (370 mg), toluene (4 mL), dehydrated THF (4 mL), and triethylamine (180 mg) were added with diphenylphosphoric acid azide (451 mg). The reaction mixture was stirred at 100 ° C. for 2 hours under a nitrogen atmosphere, and then allowed to cool to room temperature. To the reaction mixture, 6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (the compound of Reference Example 28) (300 mg) was added. The reaction mixture was stirred at 60 ° C. overnight, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) .The resulting solid was crystallized from an ethyl acetate-hexane mixed solvent to give the title compound (193 mg) as a white solid. It was.
MS (ESI +): [M + H] ⁺ 449.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.92-2.06 (2H, m), 2.62 (2H, t, J = 6.4 Hz), 4.34-4.43 (2H, m), 5.45 (2H, d, J = 6.8 Hz), 6.31 (1H, t, J = 6.8 Hz), 7.58 (1H, d, J = 1.1 Hz), 7.63 (1H, d, J = 1.1 Hz), 8.11-8.19 (2H, m), 8.55 ( 1H, s).
mp: 200-202 ° C.

Example 86
1-{[3- (1-methylethyl) isoxazol-5-yl] methyl} -3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazole-1 ( 4H) -yl] methyl} urea The title compound was obtained in the same manner as in Example 85.
MS (ESI +): [M + H] ⁺ 388.4.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.26 (6H, d, J = 6.8 Hz), 1.91-2.08 (2H, m), 2.62 (2H, t, J = 6.4 Hz), 2.94-3.10 (1H, m), 4.30-4.40 (2H, m), 4.44-4.56 (2H, m), 5.24-5.32 (2H, m), 5.34-5.45 (1H, m), 5.83 (1H, brs), 6.03 (1H, s).
mp: 155-157 ° C.

Example 87
1- (5-chloro-2,4-dimethoxyphenyl) -3-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} Urea The title compound was obtained in the same manner as in Example 85.
MS (ESI +): [M + H] ⁺ 435.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.92-2.07 (2H, m), 2.62 (2H, t, J = 6.2 Hz), 3.82 (3H, s), 3.86 (3H, s), 4.31-4.42 ( 2H, m), 5.38 (2H, d, J = 6.8 Hz), 5.71-5.83 (1H, m), 6.45 (1H, s), 6.90 (1H, brs), 8.03 (1H, s).
mp: 208-209 ℃

Example 88
3- (Trifluoromethyl) -1- {1- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] piperidin-4-yl} -1,4,5,6- Tetrahydropyrano [2,3-c] pyrazole

A) tert-Butyl 1-piperidin-4-yl 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 4-hydroxypiperidine-1-carboxylate (1.88 g), diisopropyl azodicarboxylate (2.91 g), triphenylphosphine (3.78 g) and dehydrated THF (50 mL) were added to 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [ 2,3-c] pyrazole (the compound of Reference Example 9) (1.37 g) was added under ice cooling. The reaction mixture was stirred at room temperature for 20 minutes under a nitrogen atmosphere and then stirred at 50 ° C. overnight. The solvent was removed under reduced pressure, and the residue was stirred in air at room temperature until a white precipitate formed. The reaction mixture was purified by silica gel column chromatography (ethyl acetate / hexane). The solvent was evaporated under reduced pressure, and trifluoroacetic acid (8 mL) was added to the obtained residue under ice-cooling. The reaction mixture was stirred at room temperature for 5 hours, and saturated aqueous sodium hydrogen carbonate solution was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (1.61 g) as an orange liquid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.89-2.02 (2H, m), 2.06-2.40 (4H, m), 2.58-2.73 (2H, m), 2.92-3.08 (2H, m), 3.46-3.60 (2H, m), 4.20-4.40 (3H, m). * No peak of “NH group” was observed.

B) 3- (Trifluoromethyl) -1- {1- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] piperidin-4-yl} -1,4,5, 6-Tetrahydropyrano [2,3-c] pyrazole 1-piperidin-4-yl 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (200 mg ), 8-bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine (compound of Reference Example 26) (532 mg), cesium carbonate (308 mg), rac-2,2'-bis ( Tris (dibenzylideneacetone) dipalladium (33 mg) was added to a mixture of diphenylphosphino) -1,1'-binaphthyl (68 mg) and toluene (3 mL). The reaction mixture was stirred at 90 ° C. for 3 hours under a nitrogen atmosphere, and then rac-2,2′-bis (diphenylphosphino) -1,1′-binaphthyl (68 mg) and tris (dibenzylideneacetone) dipalladium (33 mg) was added. The reaction mixture was stirred at 90 ° C. overnight under a nitrogen atmosphere, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane). The obtained solid was crystallized from ethanol and water to give the title compound (69.5 mg) as a white solid.
MS (ESI +): [M + H] ⁺ 460.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.90-2.05 (2H, m), 2.05-2.20 (2H, m), 2.43-2.59 (2H, m), 2.64 (2H, t, J = 6.2 Hz), 2.91-3.09 (2H, m), 4.22-4.42 (3H, m), 4.48-4.63 (2H, m), 6.47 (1H, s), 7.59 (1H, d, J = 1.5 Hz), 7.63 (1H, d, J = 1.5 Hz), 8.12 (1H, d, J = 1.5 Hz).
mp: 90-92 ℃

Example 89
3- (Trifluoromethyl) -1- {3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] propyl} -1,4,5,6-tetrahydropyrano [ 2,3-c] pyrazole 3- (trifluoromethyl) -1-{(2E) -3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2-propene 1-yl} -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (compound of Example 84) (35 mg) and ethanol (2 mL) in a mixture of 10% palladium-carbon (50% wet, 20 mg) was added. The reaction mixture was stirred at room temperature overnight under a hydrogen atmosphere, and the insoluble material was filtered off using celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (13.4 mg) as a colorless liquid.
MS (ESI +): [M + H] ⁺ 419.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.91-2.04 (2H, m), 2.32-2.48 (2H, m), 2.62 (2H, t, J = 6.4 Hz), 3.06 (2H, t, J = 7.5 Hz), 4.04 (2H, t, J = 6.4 Hz), 4.23-4.34 (2H, m), 7.11 (1H, s), 7.67 (1H, d, J = 1.1 Hz), 7.71 (1H, d, J = 1.1 Hz), 8.40 (1H, s).

Example 90
3- (Trifluoromethyl) -1- {1- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] pyrrolidin-3-yl} -1,4,5,6- Tetrahydropyrano [2,3-c] pyrazole The title compound was obtained in the same manner as in Example 88.
MS (ESI +): [M + H] ⁺ 446.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.92-2.05 (2H, m), 2.38-2.52 (1H, m), 2.63 (2H, t, J = 6.4 Hz), 2.67-2.80 (1H, m), 3.89-4.18 (3H, m), 4.27-4.35 (2H, m), 4.50 (1H, dd, J = 10.8, 7.4 Hz), 4.99 (1H, quin, J = 7.3 Hz), 6.02 (1H, d, J = 1.1 Hz), 7.55 (2H, s), 7.89 (1H, s).
mp: 134-136 ° C.

Example 91
6- (Trifluoromethyl) -N- {2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethyl} imidazo [1,2 -a] pyridine-8-carboxamide

A) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide [3- (Trifluoromethyl) -5,6-dihydropyrano [ 2,3-c] pyrazol-1 (4H) yl] acetic acid (compound of Reference Example 11) (500 mg) and dehydrated DMF (15 mL) in a mixture of HOBt-NH ₃ (456 mg) and EDCI (575 mg) Was added at room temperature. The reaction mixture was stirred at room temperature for 4 hours, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (379 mg) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.83-2.17 (2H, m), 2.65 (2H, t, J = 6.2 Hz), 4.20-4.29 (2H, m), 4.64 (2H, s), 5.44 ( 1H, brs), 6.21 (1H, brs).

B) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethanamine 2- [3- (trifluoromethyl) -5,6- Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide (70 mg), borane-tetrahydrofuran complex in THF (1.9 M, 0.6 mL) and dehydrated THF (1 mL) were mixed with trifluoride. Diethyl ether complex (44 mg) was added at room temperature. The reaction mixture was stirred at 70 ° C. overnight, and 1N aqueous sodium hydroxide solution was added. The reaction mixture was extracted with diethyl ether and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (69.2 mg) as a colorless liquid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.92-2.05 (2H, m), 2.64 (2H, t, J = 6.2 Hz), 3.09 (2H, t, J = 6.1 Hz), 4.00 (2H, t, J = 6.1 Hz), 4.26-4.35 (2H, m). * No peak of “NH group” was observed.

C) 6- (Trifluoromethyl) -N- {2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] ethyl} imidazo [1 , 2-a] pyridine-8-carboxamide The title compound was obtained in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 448.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.81-1.91 (2H, m), 2.60 (2H, t, J = 6.2 Hz), 3.97 (2H, q, J = 5.8 Hz), 4.11-4.17 (2H, m), 4.27 (2H, t, J = 6.0 Hz), 7.72 (1H, d, J = 1.5 Hz), 7.75 (1H, d, J = 1.1 Hz), 8.36 (1H, d, J = 1.5 Hz) , 8.57-8.69 (1H, m), 10.22-10.37 (1H, m).
mp: 143-145 ° C.

Example 92
5-chloro-2-methoxy-N-{[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] methyl} benzamide 3- (trifluoromethyl ) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (compound of Reference Example 9) (50 mg), 5-chloro-2-methoxybenzamide (48 mg), paraformaldehyde (23 mg), anhydrous magnesium sulfate (31 mg), and toluene (1 mL) were added with p-toluenesulfonic acid monohydrate (4.5 mg). The reaction mixture was refluxed for 4 hours, and the insoluble material was filtered off using celite. The filtrate was concentrated under reduced pressure, the residue was purified by silica gel column chromatography (ethyl acetate / hexane), and the obtained solid was crystallized from a mixed solvent of ethyl acetate-hexane to give the title compound (25.8 mg) as a white solid. It was.
MS (ESI +): [M + H] ⁺ 390.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.87-2.16 (2H, m), 2.62 (2H, t, J = 6.2 Hz), 3.95 (3H, s), 4.22-4.49 (2H, m), 5.60 ( 2H, d, J = 6.1 Hz), 6.91 (1H, d, J = 8.7 Hz), 7.40 (1H, dd, J = 8.7, 2.7 Hz), 8.18 (1H, d, J = 2.7 Hz), 8.69 ( (1H, t, J = 6.1 Hz).
mp: 156-158 ° C.

Example 93
2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1,2-a ] Pyridin-8-yl] propanamide

A) Ethyl 2- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] propionate 3- (trifluoromethyl) -1,4,5 To a mixture of 1,6-tetrahydropyrano [2,3-c] pyrazole (the compound of Reference Example 9) (750 mg) and THF (15 mL) was added potassium tert-butoxide (875 mg) under ice-cooling. The reaction mixture was stirred for 10 minutes under ice cooling, and ethyl 2-bromopropionate (1.42 g) was slowly added dropwise under ice cooling. The reaction mixture was stirred at room temperature for 2 days, 1N hydrochloric acid was added under ice-cooling, and the mixture was extracted with ethyl acetate. The extract was washed with saturated aqueous sodium hydrogen carbonate solution, water and saturated aqueous sodium chloride solution, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (714 mg) as a pale yellow liquid.
MS (ESI +): [M + H] ⁺ 293.0.

B) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] propionic acid 2- [3- (trifluoromethyl) -5,6 6N hydrochloric acid (10 mL) was added to ethyl -dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] propionate (714 mg). The reaction mixture was stirred at 60 ° C. overnight, and the solvent was evaporated under reduced pressure to give the title compound (645 mg) as a colorless liquid.
MS (ESI +): [M + H] ⁺ 265.1.

C) 2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) imidazo [1,2 -a] Pyridin-8-yl] propanamide The title compound was obtained in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 448.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.89 (3H, d, J = 7.2 Hz), 1.97-2.07 (2H, m), 2.68 (2H, t, J = 6.4 Hz), 4.30-4.40 (2H, m), 5.12 (1H, q, J = 7.2 Hz), 7.60-7.65 (2H, m), 8.18-8.25 (1H, m), 8.28 (1H, d, J = 1.5 Hz), 9.78 (1H, s ).
mp: 136-138 ℃

Example 94
3- (trifluoromethyl) -1- {3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] prop-2-yn-1-yl} -1,4, 5,6-Tetrahydropyrano [2,3-c] pyrazole

A) 3- [6- (Trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2-propyn-1-ol 8-bromo-6- (trifluoromethyl) imidazo [1,2 -a] pyridine (compound of Reference Example 26) (200 mg), propargyl alcohol (126 mg), bis (triphenylphosphine) palladium dichloride (52 mg), and triethylamine (4 mL) were mixed with copper iodide ( I) (7 mg) was added. The reaction mixture was stirred at 90 ° C. overnight under a nitrogen atmosphere, and water was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with a saturated aqueous sodium chloride solution and then dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (109 mg) as a yellow solid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 2.43 (1H, brs), 4.63 (2H, s), 7.49 (1H, d, J = 1.5 Hz), 7.72 (1H, d, J = 1.5 Hz), 7.79 (1H, d, J = 1.1 Hz), 8.45-8.54 (1H, m).

B) 3- (Trifluoromethyl) -1- {3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2-propyn-1-yl} -1,4 , 5,6-Tetrahydropyrano [1,2-a] pyrazole The title compound was obtained in the same manner as in Step 88 of Example 88.
MS (ESI +): [M + H] ⁺ 415.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.94-2.07 (2H, m), 2.65 (2H, t, J = 6.2 Hz), 4.28-4.43 (2H, m), 5.12 (2H, s), 7.52 ( 1H, d, J = 1.5 Hz), 7.71 (1H, d, J = 1.5 Hz), 7.78 (1H, d, J = 1.1 Hz), 8.49 (1H, s).
mp: 166-168 ° C

Example 95
2- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] -N- [6- (trifluoromethyl) [1,2,4] Triazolo [4,3-a] pyridin-8-yl] propanamide The title compound was obtained in the same manner as in Example 33.
MS (ESI +): [M + H] ⁺ 449.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.89 (3H, d, J = 7.4 Hz), 1.94-2.15 (2H, m), 2.68 (2H, t, J = 6.2 Hz), 4.41 (2H, td, J = 5.2, 0.9 Hz), 5.14 (1H, q, J = 7.4 Hz), 8.16-8.27 (1H, m), 8.37 (1H, d, J = 1.5 Hz), 8.88 (1H, s), 9.71 ( 1H, s).
mp: 221-223 ℃

Example 96
1- {1- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl} -3- (trifluoro Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole

A) tert-butyl 1-azetidin-3-yl-3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 3-hydroxyazetidine-1-carboxylate (0.83 g), diisopropyl azodicarboxylate (1.49 g), triphenylphosphine (1.93 g) and dehydrated THF (25 mL) were mixed with 3- (trifluoromethyl) -1,4,5,6-tetrahydropyra. No [2,3-c] pyrazole (the compound of Reference Example 9) (0.70 g) was added under ice cooling. The reaction mixture was stirred at room temperature for 30 minutes under a nitrogen atmosphere and then stirred at 60 ° C. overnight. The solvent was removed under reduced pressure, and the residue was stirred in air at room temperature until a white precipitate formed. The reaction mixture was purified by silica gel column chromatography (ethyl acetate / hexane). The solvent was evaporated under reduced pressure, and trifluoroacetic acid (4 ml) was added to the resulting residue under ice cooling. The reaction mixture was stirred at room temperature overnight, and saturated aqueous sodium hydrogen carbonate solution was added. The reaction mixture was extracted with ethyl acetate, and the extract was washed with saturated aqueous sodium chloride solution and dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound (0.76 g) as an orange liquid.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.91-2.04 (2H, m), 2.62 (2H, t, J = 6.1 Hz), 4.19-4.28 (2H, m), 4.28-4.35 (2H, m), 4.38-4.54 (2H, m), 4.88-5.11 (1H, m). * The peak of “NH group” was not observed.

B) 1- {1- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl} -3- ( (Trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 1-azetidin-3-yl-3- (trifluoromethyl) -1,4,5,6-tetrahydropyra [2,3-c] pyrazole (200 mg), 8-bromo-3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine (of Reference Example 48) Compound) (226 mg), cesium carbonate (342 mg), rac-2,2'-bis (diphenylphosphino) -1,1'-binaphthyl (76 mg) and toluene (3 mL) Dibenzylideneacetone) dipalladium (37 mg) was added. The reaction mixture was stirred at 100 ° C for 270 minutes under a nitrogen atmosphere, then cesium carbonate (342 mg), rac-2,2'-bis (diphenylphosphino) -1,1'-binaphthyl (76 mg) and tris (di- Benzylideneacetone) dipalladium (37 mg) was added. The reaction mixture was stirred at 100 ° C. for 14 hours under a nitrogen atmosphere, and water was added. The reaction mixture was poured into diethyl ether (60 mL), and the insoluble material was filtered off using celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / hexane) and preparative HPLC. The obtained solid was crystallized from an ethyl acetate-hexane mixed solvent to give the title compound (33.0 mg) Was obtained as a white solid.
MS (ESI +): [M + H] ⁺ 447.4.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.91-2.08 (2H, m), 2.64 (2H, t, J = 6.2 Hz), 2.73 (3H, s), 4.24-4.41 (2H, m), 4.81 ( 4H, d, J = 6.8 Hz), 5.19-5.42 (1H, m), 5.90 (1H, s), 7.61 (1H, s).
mp: 246-248 ° C.

Example 97
3- (Trifluoromethyl) -1- {1- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] azetidin-3-yl} -1,4,5,6- Tetrahydropyrano [2,3-c] pyrazole The title compound was obtained in the same manner as in Step B of Example 96.
MS (ESI +): [M + H] ⁺ 432.2.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.93-2.06 (2H, m), 2.63 (2H, t, J = 6.4 Hz), 4.28-4.35 (2H, m), 4.73 (4H, dd, J = 7.4 , 3.2 Hz), 5.28 (1H, quin, J = 7.1 Hz), 6.00 (1H, s), 7.54-7.60 (2H, m), 7.96 (1H, s).
mp: 180-182 ℃

Example 98
3- (Trifluoromethyl) -1- {1- [6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl} -1 , 4,5,6-Tetrahydropyrano [2,3-c] pyrazole

A) of 8-bromo-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 2-chloro-3-bromo-5- (trifluoromethyl) pyridine (3.23 g) Hydrazine monohydrate was added to an ethanol (50 mL) solution under ice-cooling. The reaction mixture was stirred at 80 ° C. for 3 hours, and the solvent was evaporated under reduced pressure. 300 mg of the obtained residue was added to triethyl orthoacetate (3 ml) at room temperature. The reaction mixture was stirred at 90 ° C. for 1 hr, and the solvent was evaporated under reduced pressure to give the title compound (230 mg) as a white solid.
MS (ESI +): [M + H] ⁺ 267.8.

B) 3- (Trifluoromethyl) -1- {1- [6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl} -1,4,5,6-Tetrahydropyrano [2,3-c] pyrazole The title compound was obtained in the same manner as in Step B of Example 96.
MS (ESI +): [M + H] ⁺ 433.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.88-2.09 (2H, m), 2.64 (2H, t, J = 6.2 Hz), 4.24-4.42 (2H, m), 4.83 (4H, d, J = 7.0 Hz), 5.32 (1H, quin, J = 7.0 Hz), 5.93 (1H, s), 7.91 (1H, s), 8.80 (1H, s).
mp: 229-231 ° C

Example 99
1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazol-5-yl} methyl)- 3- (Trifluoromethyl) -4,5-dihydropyrrolo [2,3-c] pyrazole-6 (1H) -carboxylate tert-butyl

A) tert-butyl 1- (2-ethoxy-2-oxoethyl) -3- (trifluoromethyl) -4,5-dihydropyrrolo [2,3-c] pyrazole-6 (1H) -carboxylate tert-butyl To a solution of 2-oxopyrrolidine-1-carboxylate (3.0 g) in THF (19 mL), a 1 mol / L lithium hexamethyldisilazide hexane solution (19.4 mL) was added dropwise at −78 ° C. over 30 minutes. After stirring at -78 ° C for 30 minutes, ethyl trifluoroacetate (3.0 g) was added to the reaction solution at -78 ° C over 15 minutes, and the mixture was stirred at the same temperature for 75 minutes. The reaction mixture was diluted with saturated aqueous ammonium chloride and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. Ethyl hydrazinoacetate (2.5 g) and p-toluenesulfonic acid monohydrate (279 mg) were added to a toluene (90 mL) solution of the obtained residue, and the mixture was stirred at 100 ° C. for 5 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (2.0 g).
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.25-1.31 (3H, m), 1.45 (9H, s), 2.73 (2H, t, J = 7.0 Hz), 3.19-3.30 (2H, m), 4.23 ( 2H, q, J = 7.2 Hz), 4.78 (2H, s).

B) [6- (tert-Butoxycarbonyl) -3- (trifluoromethyl) -5,6-dihydropyrrolo [2,3-c] pyrazol-1 (4H) -yl] acetic acid tert-butyl 1- (2 -Ethoxy-2-oxoethyl) -3- (trifluoromethyl) -4,5-dihydropyrrolo [2,3-c] pyrazole-6 (1H) -carboxylate (2.0 g) in methanol (15 mL) / THF To the mixture (15 mL) / water (8 mL) was added lithium hydroxide monohydrate (693 mg), and the mixture was stirred at room temperature for 5 hours. After distilling off the organic solvent under reduced pressure, ethyl acetate and water were added for partitioning, and the resulting aqueous layer was acidified with 0.5N hydrochloric acid and extracted with ethyl acetate. The extract was dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (1.66 g).
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.44 (9H, s), 2.70 (2H, t, J = 6.6 Hz), 3.18-3.33 (2H, m), 4.83 (2H, s). ”Was not observed.

C) 1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazol-5-yl} methyl ) -3- (Trifluoromethyl) -4,5-dihydropyrrolo [2,3-c] pyrazole-6 (1H) -carboxylate tert-butyl The title compound was prepared in a manner similar to Example 77, Step C. did.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.41 (9H, s), 2.73 (2H, t, J = 7.0 Hz), 2.82 (3H, s), 3.26 (2H, q, J = 6.8 Hz), 5.55 (2H, s), 7.20 (1H, s), 8.71 (1H, s).

Example 100
5-Methyl-7- (trifluoromethyl) -3- (5-{[3- (trifluoromethyl) -5,6-dihydropyrrolo [2,3-c] pyrazol-1 (4H) -yl] methyl } -1,2,4-oxadiazol-3-yl) pyrazolo [1,5-a] pyrimidine

1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazol-5-yl} methyl)- 3- (Trifluoromethyl) -4,5-dihydropyrrolo [2,3-c] pyrazole-6 (1H) -carboxylate tert-butyl (27.6 mg) in ethyl acetate (0.5 mL) in 4N hydrogen chloride / Ethyl acetate (1.0 mL) solution was added. The reaction mixture was stirred at room temperature for 45 minutes and then concentrated under reduced pressure. The obtained residue was diluted with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (18.2 mg).
¹ H NMR (300 MHz, CDCl ₃ ) δ 2.70-2.80 (5H, m), 3.10-3.18 (2H, m), 5.47 (2H, s), 7.20 (1H, s), 8.74 (1H, s). * The peak of “NH group” was not observed.

Example 101
3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazol-5-yl } Methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridine

A) tert-butyl 3-oxo-4- (trifluoroacetyl) piperidine-1-carboxylate To a solution of tert-butyl 3-oxopiperidinecarboxylate (20.0 g, 100.5 mmol) in dimethoxyethane (130 mL) was added -78 At 1 ° C. (dry ice bath), 1MLHMDS / THF solution (120.6 mL) was added dropwise. After 1 hour, ethyl trifluoroacetate (18.6 g, 130.6 mmol) was added dropwise to the mixture. The reaction mixture was stirred for 1 hour. The dry ice bath was removed and the mixture was further stirred for 2 hours. The mixture was poured into an aqueous ammonium chloride solution and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel chromatography (PE / dichloromethane = 1: 1) to give the title compound (13.0 g, yield 44%) as a colorless oil.
¹ H NMR (300 MHz, CDCl ₃ ) δppm 1.48 (s, 9 H), 2.57 (t, J = 5.7 Hz, 2 H), 3.56 (t, J = 5.7 Hz, 2 H), 4.22 (s, 2 H), 14.60 (s, 1 H).

B) 7a-hydroxy-3- (trifluoromethyl) -1,3a, 4,5,7,7a-hexahydro-6H-pyrazolo [3,4-c] pyridine-6-carboxylate tert-butyl 3-oxo Hydrazine hydrate (11 g, 220 mmol) was added to a solution of tert-butyl-4- (trifluoroacetyl) piperidine-1-carboxylate (13 g, 44 mmol) in ethanol (200 mL). The mixture was stirred at room temperature for 1 hour and then heated to reflux for 2 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel chromatography (PE / ethyl acetate = 5: 1) to give the title compound (6 g, yield 47%) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δppm 1.45 (s, 9H), 1.83-1.91 (m, 3H), 2.82-2.91 (m, 1H), 3.08-3.15 (m, 1H), 3.58 (d, J = 15.9 Hz, 1H), 4.28 (d, J = 15.0 Hz, 1H), 4.89 (d, J = 15.9 Hz, 1H), 5.96 (s, 1H).

C) [6- (tert-Butoxycarbonyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridin-1-yl] acetic acid 7a-hydroxy -3- (trifluoromethyl) -1,3a, 4,5,7,7a-hexahydro-6H-pyrazolo [3,4-c] pyridine-6-carboxylate tert-butyl (500 mg, 1.72 mmol), To a mixture of potassium carbonate (712 mg, 5.16 mmol) and acetone (50 mL) was added ethyl bromoacetate (344 mg, 2.06 mmol). The mixture was heated to reflux overnight. The mixture was filtered and the solvent was removed in vacuo to give crude 1- (2-ethoxy-2-oxoethyl) -3- (trifluoromethyl) -1,4,5,7-tetrahydro-6H-pyrazolo [ The tert-butyl 3,4-c] pyridine-6-carboxylate was obtained. The resulting crude 1- (2-ethoxy-2-oxoethyl) -3- (trifluoromethyl) -1,4,5,7-tetrahydro-6H-pyrazolo [3,4-c] pyridine-6- To a solution of tert-butyl carboxylate (1.72 mmol) in methanol (10 mL) was added 2N sodium hydroxide solution (10 mL) and the mixture was heated at 40-50 ° C. overnight. The reaction mixture was cooled to room temperature, methanol was evaporated under reduced pressure, water (20 mL) was added, and the mixture was extracted 3 times with ethyl acetate. The aqueous layer was adjusted to pH 4-5 with 6N hydrochloric acid and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (290 mg, yield 48%) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ) δppm 1.42 (s, 9H), 2.55-2.58 (m, 2H), 3.52-3.56 (m, 2H), 4.46 (s, 4H).

D) tert-Butyl 3- (trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadi Azol-5-yl} methyl) -1,4,5,7-tetrahydro-6H-pyrazolo [3,4-c] pyridine-6-carboxylate [6- (tert-butoxycarbonyl) -3- (trifluoro (Methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridin-1-yl] acetic acid (150 mg) in DMF (3.0 mL) solution with N'-hydroxy-6- ( (Trifluoromethyl) imidazo [1,2-a] pyridine-8-carboximidamide (110.9 mg), EDCI (98.7 mg), HOBt (69.6 mg) and triethylamine (120 μL) were added at 0 ° C and at the same temperature. After stirring for 30 minutes, the mixture was warmed to room temperature and stirred for 4.5 hours. The reaction mixture was diluted with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with water and saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was dissolved in pyridine (2.0 mL) and stirred at 100 ° C. for 14.5 hours. After cooling to room temperature, the reaction mixture was concentrated under reduced pressure, and the resulting residue was diluted with saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate / hexane) to give the title compound (58.7 mg).
MS (ESI +): [M + H] ⁺ 558.1.
¹ H NMR (300 MHz, CDCl ₃ ) δ 1.48 (9H, s), 2.67-2.77 (2H, m), 3.63-3.76 (2H, m), 4.67 (2H, s), 5.63 (2H, s), 7.83 (1H, d, J = 1.5 Hz), 7.94 (1H, d, J = 1.1 Hz), 8.21 (1H, s), 8.69 (1H, s).

E) 3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazole-5 -Yl} methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridine tert-butyl 3- (trifluoromethyl) -1-({3- [6- (trifluoro Methyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazol-5-yl} methyl) -1,4,5,7-tetrahydro-6H-pyrazolo [3, To a solution of 4-c] pyridine-6-carboxylate (58.1 mg) in ethyl acetate (0.5 mL) was added 4N hydrogen chloride / ethyl acetate (1.0 mL) solution. The reaction mixture was stirred at room temperature for 3.5 hours and then concentrated under reduced pressure. The obtained residue was diluted with a saturated aqueous sodium hydrogen carbonate solution and extracted with ethyl acetate. The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained solid was recrystallized from ethanol / hexane to give the title compound (40.8 mg).
MS (ESI +): [M + H] ⁺ 458.3.
¹ H NMR (300 MHz, CDCl ₃ ) δ 2.68 (2H, t, J = 5.3 Hz), 3.08 (2H, t, J = 5.7 Hz), 4.03 (2H, s), 5.60 (2H, s), 7.83 (1H, d, J = 1.5 Hz), 7.94 (1H, d, J = 1.5 Hz), 8.19 (1H, d, J = 1.5 Hz), 8.69 (1H, s). Not observed.

The compounds of Examples 53-101 are shown in the table below. MS in the table indicates actual measurement.

Formulation Example 1
(1) 10.0 g of the compound of Example 1
(2) Lactose 70.0g
(3) Corn starch 50.0g
(4) 7.0g soluble starch
(5) Magnesium stearate 3.0 g
The compound of Example 1 (10.0 g) and magnesium stearate (3.0 g) are granulated with 70 ml of an aqueous solution of soluble starch (7.0 g as soluble starch), dried, lactose (70.0 g) and corn starch ( (Lactose, corn starch, soluble starch and magnesium stearate are all conforming to the 14th revised Japanese Pharmacopoeia). The mixture is compressed to obtain tablets.

Test example 1
(1) Construction of expression gene Human GluR1 flip cDNA was artificially synthesized using human brain-derived cDNA (BD Bioscience) as a template. Amplified by The amplified product was digested with restriction enzymes EcoRI and NotI (Takara Shuzo) and then incorporated into the same site of pcDNA3.1 (+) (trade name) (Invitrogen) to construct pcDNA3.1 (+) / human GluR1 flip gene. Human stargazin cDNA was artificially synthesized using human hippocampal cDNA as a template, forward primer GGTCTCGAGGCCACCATGGGGCTGTTTGATCGAGGTGGTTCA (SEQ ID NO: 3) and reverse primer GTTGGATCCTTATAGGGGGGTGGTCCCGGTG The amplified product was digested with restriction enzymes XhoI and BamHI (Takara Shuzo) and then incorporated into the same site of pcDNA3.1 (-) (Invitrogen) to construct pcDNA3.1 Zeo (-) / human stargazin gene.
(2) Construction of GluR1 flip / stargazin expressing cells Subcultured in culture medium (Ham's F12 medium (Invitrogen) supplemented with 10% inactivated fetal bovine serum (Morgate) and penicillin, streptomycin (Invitrogen)) The CHO-K1 cells were detached using 0.05% trypsin diluted with D-PBS (−) and 0.53 mM EDTA (Invitrogen). The detached cells were suspended using a culture medium and collected by centrifugation at 1,000 rpm. The collected cells were resuspended with D-PBS (−) and added to a 0.4 cm electroporation cuvette (BioRad). 5 μg of pcDNA3.1 (+) / human GluR1 flip gene and 15 μg of pcDNA3.1 Zeo (−) / human stargazin gene were added to CHO-K1 cells using Gene Pulser II (BioRad) at 950 μFd and 250 mV. Introduced. The introduced cells are cultured overnight in a culture medium, and the following day, a selection medium (Zeosin (Invitrogen) is added to the culture medium to 250 μg / mL) is added to a density of 250 cells / well. Seed well plate. Clones that showed drug resistance were selected, and GluR1 flip / stargazin expression clones were selected by the assay method using calcium influx as an index as described below.
(3) AMPA receptor function-enhancing activity assay method for compounds using calcium influx as an indicator CHO-K1 / GluR1 flip / stargazin expressing cells were seeded at 2 × 10 ⁴ cells / well in a 96-well black bottom transparent plate (coaster). And cultured at 37 ° C. in a CO ₂ incubator (SANYO) for 2 days. The medium of the cell plate was removed, and assay buffer A (D-MEM (Invitrogen), 0.1% BSA (Serological Protein), 20 mM HEPES (Invitrogen))) was added to 50 μL / well. Further, a calcium indicator (Calcium 4 Assay Kit, Molecular Device) supplemented with 2.5 mM probenecid (Invitrogen) was added at 50 μL / well and left in a CO ₂ incubator at 37 ° C. for 1 hour. A cell plate is set in CellLux (PerkinElmer), and a mixture of 9 mM glutamic acid (final concentration 3 mM) and test compound diluted with assay buffer B (HBSS (Invitrogen), 0.1% BSA, 20 mM HEPES) is prepared. 50 μL (test compound concentration: 30 μM) was added, and the change in fluorescence amount for 3 minutes was measured. 100% is defined as the amount of change in fluorescence value of wells added with final concentration of 3 mM glutamic acid and 300 μM cyclothiazide (TOCRIS), and 0% is defined as the amount of change in fluorescence value of wells with final concentration of 3 mM glutamic acid alone. Calculated by the formula.
Activity (%) = (X−C) / (TC) × 100
T: Change amount of fluorescence value of well added with final concentration of 3 mM glutamic acid and 300 μM cyclothiazide C: Change amount of fluorescence value of well containing only final concentration of 3 mM glutamate X: Fluorescence value of well added with test compound Change

The results are shown in the following table.

The compound of the present invention is useful as a preventive or therapeutic agent for depression, schizophrenia, attention deficit hyperactivity disorder (ADHD) and the like.

SEQ ID NO: 1 is a forward primer for GluR1 flip cDNA.
SEQ ID NO: 2 is a reverse primer for GluR1 flip cDNA.
SEQ ID NO: 3 is a forward primer for stargazin cDNA cDNA.
SEQ ID NO: 4 is a reverse primer for stargazin cDNA cDNA.

Claims

Formula (I 0 )

[Where:
R a represents a C 1-6 alkyl group which may be substituted with a halogen atom,
X 0 represents —CH 2 —, —O—, or —NR b —,
Y 0 represents —CR c R d — or —NH—,
R b represents a hydrogen atom, a C 1-6 alkyl group, a C 1-6 alkyl-carbonyl group optionally substituted with a halogen atom, or a C 1-6 alkoxy-carbonyl group,
R c and R d are the same or different and each represents a hydrogen atom or a C 1-6 alkyl group,
L 0 represents —CH (R e ) —W a —, or —W b —
R e represents a hydrogen atom or a C 1-6 alkyl group,
W a is
1) Joining hands,
2) -CONH-,
3) -CONHCH 2- ,
4) -NHCONHCH 2- ,
5) -NHCONH-,
6) -NHCO-,
7) -CH 2 NHCO-,
8) -CH = CH-,
9) -C≡C-,
10) C 2-6 alkylene,
11) Phenylene,
12) Thiophenediyl,
13) 1,3,4-thiadiazolediyl,
14) 1,2,4-oxadiazoldiyl, or
15) represents 1,3,4-oxadiazoldiyl,
W b is
1) piperidine diyl,
2) pyrrolidine diyl, or
3) indicates azetidine diyl,
Each A 0 ring may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring,
13) Thienopyrimidone ring,
14) pyrazolopyrimidine ring, or
15) represents an imidazopyrimidine ring,
Ring D 0 represents an optionally substituted further heterocyclic ring containing one heteroatom selected from an oxygen atom and a nitrogen atom as a ring constituent atom;
m is 0 or 1. ]
Or a salt thereof.
Formula (I)

[Where:
R 1 represents a methyl group which may be substituted with a halogen atom,
X represents —O— or —NR 2 —;
R 2 represents a hydrogen atom, a C 1-6 alkyl group, or a C 1-6 alkyl-carbonyl group which may be substituted with a halogen atom,
L represents a bond, —CONH—, or —CONHCH 2 —
Each ring A may have a substituent,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) isoxazole ring,
5) pyrazole ring,
6) benzene ring,
7) pyridine ring,
8) Indole ring,
9) imidazopyridine ring,
10) Triazolopyridine ring,
11) benzotriazole ring,
12) benzothiazole ring, or
13) Indicates a thienopyrimidone ring. ]
Or a salt thereof.
The compound according to claim 2, wherein X is -O-, or a salt thereof.
The compound according to claim 2, wherein L is -CONH-, or a salt thereof.
R a represents a methyl group substituted with a halogen atom,
R b represents a C 1-6 alkyl group,
W a is
1) Joining hands,
2) -CONH-,
3) -NHCONH-,
4) -NHCO-,
5) -CH 2 NHCO-,
6) -CH = CH-,
7) -C≡C-,
8) C 2-6 alkylene,
9) 1,3,4-thiadiazolediyl,
10) 1,2,4-oxadiazoldiyl, or
11) represents 1,3,4-oxadiazoldiyl,
W b represents azetidinediyl,
A 0 ring is
(a) a halogen atom,
(b) a C 1-6 alkyl group optionally substituted with a halogen atom or a hydroxy group,
(c) a C 1-6 alkoxy group,
(d) a C 1-6 alkoxy-carbonyl group,
(e) a pyrrolidinyl-carbonyl group, and
(f) each substituted with 1 to 3 substituents selected from carbamoyl groups,
1) a thiophene ring,
2) dihydrocyclopentathiophene ring,
3) tetrahydrobenzothiophene ring,
4) benzene ring,
5) imidazopyridine ring,
6) Triazolopyridine ring,
7) pyrazolopyrimidine ring, or
8) represents an imidazopyrimidine ring,
Partial structure of formula (I 0 )

But

(In the formula, R X represents a hydrogen atom, a hydroxy group, or an oxo group, X 0 and Y 0 are as defined above, and ring D 1 is selected from an oxygen atom and a nitrogen atom as a ring constituent atom. A heterocycle containing one heteroatom).
The compound of Claim 1 which shows the part represented by this, or its salt.
R a represents a methyl group substituted with a halogen atom,
X 0 represents —CH 2 — or —O—;
Y 0 represents —CH 2 — or —NH—;
R e represents a hydrogen atom,
W a is
1) -CONH-,
2) 1,3,4-thiadiazolyl,
3) 1,2,4-oxadiazolyl, or
4) represents 1,3,4-oxadiazolyl,
W b represents azetidinediyl,
A 0 ring is
(a) a halogen atom,
(b) a C 1-6 alkyl group which may be substituted with a halogen atom,
(c) a C 1-6 alkoxy group, and
(d) substituted with 1 to 3 substituents selected from carbamoyl groups,
1) tetrahydrobenzothiophene ring,
2) benzene ring,
3) imidazopyridine ring,
4) Triazolopyridine ring,
5) pyrazolopyrimidine ring, or
6) The compound according to claim 1, which represents an imidazopyrimidine ring and m is 1, or a salt thereof.
2-({[3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetyl} amino) -4,5,6,7-tetrahydro-1 -Benzothiophene-3-carboxamide or a salt thereof.
N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -5,6 -Dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] acetamide, or a salt thereof.
1-({3- [5-Methyl-7- (trifluoromethyl) pyrazolo [1,5-a] pyrimidin-3-yl] -1,2,4-oxadiazol-5-yl} methyl)- 3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
1- {1- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] azetidin-3-yl} -3- (trifluoro Methyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
3- (Trifluoromethyl) -1-({3- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -1,2,4-oxadiazol-5-yl } Methyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-c] pyridine, or a salt thereof.
1-({3- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -1,2,4-oxadiazole- 5-yl} methyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole, or a salt thereof.
A prodrug of the compound according to claim 1 or a salt thereof.
A medicament comprising the compound according to claim 1 or a salt thereof, or a prodrug thereof.
The medicament according to claim 14, which is an AMPA receptor function enhancer.
The medicament according to claim 14, which is a prophylactic or therapeutic drug for depression, schizophrenia, or attention deficit hyperactivity disorder.
A method for enhancing AMPA receptor function, comprising administering an effective amount of the compound according to claim 1 or a salt thereof, or a prodrug thereof to a mammal.
A method for preventing or treating depression, schizophrenia, or attention deficit / hyperactivity disorder, which comprises administering an effective amount of the compound according to claim 1 or a salt thereof, or a prodrug thereof to a mammal. .
Use of the compound according to claim 1 or a salt thereof, or a prodrug thereof for producing an AMPA receptor function potentiator.
Use of the compound according to claim 1 or a salt thereof, or a prodrug thereof for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder.
The compound according to claim 1 or a salt thereof, or a prodrug thereof, for use in enhancing AMPA receptor function.
The compound according to claim 1, or a salt thereof, or a prodrug thereof for the prevention or treatment of depression, schizophrenia, or attention deficit hyperactivity disorder.