WO2010140339A1

WO2010140339A1 - Heterocyclic compound

Info

Publication number: WO2010140339A1
Application number: PCT/JP2010/003640
Authority: WO
Inventors: 望月倫代; 今枝稔博
Original assignee: 武田薬品工業株式会社
Priority date: 2009-06-01
Filing date: 2010-05-31
Publication date: 2010-12-09

Abstract

Disclosed is a novel AMPA receptor function enhancer. Specifically disclosed is a compound represented by formula (Io) [wherein one of Y and Z represents a nitrogen atom or an oxygen atom and the other represents a carbon atom; R1a, R1b, R4a and R4b are independently not present or independently represent a hydrogen atom or a substituent; R2a, R2b, R3a and R3b independently represent a hydrogen atom or a substituent; R5 represents a substituent; and Ar represents a benzene ring or a monocyclic aromatic heterocyclic ring each of which may be substituted, wherein when the benzene ring or the monocyclic aromatic heterocyclic ring is substituted by two or more substituents, two of the substituents may together form a ring which may be substituted] or a salt thereof.

Description

Heterocyclic compounds

The present invention relates to a heterocyclic compound, particularly a heterocyclic compound having an AMPA receptor function enhancing action.

Glutamate is the most abundant excitatory neurotransmitter in the mammalian central nervous system. Glutamate has an important role in the regulation of cognition, mood, and motor function, and these processes become unstable in psychiatric and neurological disorders.
The AMPA receptor is a type of receptor for the excitatory neurotransmitter glutamate, and AMPA (α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid) selectively activates the receptor. Named based on activating.
The importance of AMPA receptors in brain physiology is well known, and compounds having an AMPA receptor function enhancing action are expected to be useful as preventive or therapeutic agents for mental disorders, neurodegenerative diseases, memory disorders, sleep disorders, etc. ing.

As such compounds,
Patent Document 1 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect | action represented by these is disclosed.
Patent Document 2 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.

However, development of a heterocyclic compound having an AMPA receptor function enhancing action is still desired.

International Publication WO2007 / 107539 Pamphlet International Publication WO2008 / 003452 Pamphlet

An object of the present invention is to provide a heterocyclic compound having an AMPA receptor function enhancing action.

The present inventors have found that a compound represented by the following formula (I ₀ ) or a salt thereof (sometimes referred to herein as compound (I ₀ )) has an AMPA receptor function enhancing action. As a result of further research, the present invention has been completed.
Formula (I ₀ )

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof (hereinafter sometimes referred to as compound (I ₀ )).

That is, the present invention relates to the following compounds (compounds, salts, prodrugs) described in [1] to [9], drugs described in [10] and [11], and [12] and [13] AMPA receptor function enhancer (AMPA receptor potentiator) A pharmaceutical agent according to [14], a method according to [15] and [16], and a use according to [17] and [18].

[1]
formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent (excluding a phenyl group);
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents a substituted benzene ring or an optionally substituted monocyclic aromatic heterocyclic ring, and the benzene ring or the monocyclic aromatic heterocyclic ring is 2 When substituted with two or more substituents, two of them may be joined together to form an optionally substituted ring. ]
A compound represented by (provided that
4- {4-[(Benzyloxy) amino] -3- (difluoromethyl) -6,6-dimethyl-5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl} -2- Bromo-6-[(1-glycylpyrrolidin-3-yl) amino] benzamide,
4- {4-[(Benzyloxy) amino] -3,6,6-trimethyl-5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl} -2-[(2-hydroxy Cyclohexyl) amino] -6-methoxybenzamide and glycine 2-[(5- {4-[(benzyloxy) amino] -3- (hydroxymethyl) -5,6-dihydropyrano [2,3-c] pyrazole- Except for 1 (4H) -yl} -2-carbamoylpyridin-3-yl) amino] cyclohexyl ester. ) Or a salt thereof.
[2]
Partial structural formula of formula (I):

Is

Represents
R ^1a and R ^1b each independently represents an absence, a hydrogen atom, a C _1-10 alkyl group, or a C _1-10 alkyl-carbonyl group,
^{^R ^2a,} R 2b, R ^3a and ^{R 3b} independently represent a hydrogen atom,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom, a C _1-10 alkyl group, a C _3-10 cycloalkyl-C _1-10 alkyl group, or a C _1-10 alkyl-carbonyl group. ,
R ⁵ represents a C _1-10 alkyl group substituted with a halogen atom, and Ar is
(1) (i) di-C _1-10 alkyl-carbamoyl group, (ii) carboxy group, (iii) C _1-10 alkoxy-carbonyl group, carboxy group, and mono or di-C _1-10 alkyl-carbamoyl A C _1-10 alkyl group substituted with one or more substituents selected from the group, and (iv) an amino group substituted with a phenyl group substituted with one or more substituents selected from a halogen atom and an alkoxy group A benzene ring substituted with one or more substituents selected from a group, or (2) an amino group substituted with a phenyl group substituted with one or more substituents selected from a halogen atom and an alkoxy group. The compound of the above-mentioned [1] or a salt thereof represented by a pyridine ring.
[3]
(1) Partial structural formula of formula (I):

But,

R ^1a and R ^1b each represents a hydrogen atom, and R ^4a and R ^4b are absent,
(2) Partial structural formula of formula (I):

But,

R ^1a and R ^1b each represents a hydrogen atom, and one of R ^4a and R ^4b is a hydrogen atom, a C _1-10 alkyl group, a C _3-10 cycloalkyl-C _1-10 _Represents an alkyl group, or a C _1-10 alkyl-carbonyl group, the other is absent, and (3) a partial structural formula of formula (I):

But,

One of R ^1a and R ^1b represents a C _1-10 alkyl group or a C _1-10 alkyl-carbonyl group, the other is absent, and R ^4a and R ^4b are each a hydrogen atom Represents
The compound or a salt thereof according to the above [2].
[4]
Y represents a carbon atom, Z represents an oxygen atom,
R ^1a , R ^1b , R ^2a , R ^2b , R ^3a and R ^3b each represents a hydrogen atom,
R ^4a and ^{R 4b} are absent,
R ⁵ represents a substituted C _1-10 alkyl group,
Ar represents a substituted benzene ring,
The compound or salt thereof according to the above [1].
[5]
R ⁵ represents a C _1-10 alkyl group substituted with a halogen atom,
Ar represents a benzene ring substituted with a C _1-10 alkyl group substituted with a mono or di-C _1-10 alkyl-carbamoyl group;
The compound or a salt thereof according to the above [4].
[6]
N-methyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
[7]
N, N-dimethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
[8]
N, N-diethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
[9]
A prodrug of the compound or a salt thereof according to the above [1].
[10]
The pharmaceutical containing the compound or its salt as described in said [1], or its prodrug.
[11]
A prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), comprising the compound according to [1] or a salt thereof, or a prodrug thereof.
[12]
An AMPA receptor function enhancer comprising the compound according to [1] or a salt thereof, or a prodrug thereof.
[13]
formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof, or an AMPA receptor function enhancer comprising a prodrug thereof.
[14]
formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
A prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), comprising a compound represented by:
[15]
For mammals, the formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
A method for enhancing AMPA receptor function, which comprises administering an effective amount of a compound represented by the formula:
[16]
For mammals, the formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
A method for preventing or treating depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), which comprises administering an effective amount of the compound represented by: or a salt thereof, or a prodrug thereof.
[17]
Formula for producing an AMPA receptor function enhancer

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof, or a prodrug thereof.
[18]
Formula for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD)

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent,
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof, or a prodrug thereof.

According to the present invention, there is provided a compound having an AMPA receptor function enhancing action and useful as a preventive or therapeutic agent for depression, schizophrenia, attention deficit hyperactivity disorder (ADHD) and the like.

In the present specification, unless otherwise specified, the “aromatic ring” means a ring that is interpreted according to the Hückel rule and has 4n + 2 electrons (n is a natural number) involved in aromaticity in the ring. Examples of the “aromatic ring” include “aromatic carbocycle” and “aromatic heterocycle”.
On the other hand, “non-aromatic ring” means a ring that is not an aromatic ring. Examples of the “non-aromatic ring” include “non-aromatic carbocycle” and “non-aromatic heterocycle”.

In the present specification, examples of the “halogen atom” include a fluorine atom, a chlorine atom, a bromine atom, and an iodine atom.
In the present specification, examples of the “C _1-10 alkyl (group)” include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 1-ethylpropyl. Hexyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2-ethylbutyl, heptyl, octyl, nonyl, decyl and the like.
In the present specification, unless otherwise specified, as the “C _1-10 alkyl (group)”, for example, C _1-6 alkyl (group) is preferable.
In the present specification, examples of the “C _2-10 alkenyl (group)” include ethenyl, 1-propenyl, 2-propenyl, 2-methyl-1-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 3-methyl-2-butenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 4-methyl-3-pentenyl, 1-hexenyl, 3-hexenyl, 5-hexenyl, 1-heptenyl, 1- And octenyl.
In the present specification, unless otherwise specified, as the “C _2-10 alkenyl (group)”, for example, C _2-6 alkenyl (group) is preferable.

In the present specification, examples of the “C _2-10 alkynyl (group)” include ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, Examples include 3-pentynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl, 1-heptynyl, and 1-octynyl.
In the present specification, unless otherwise specified, as the “C _2-10 alkynyl (group)”, for example, C _2-6 alkynyl (group) is preferable.

In the present specification, examples of the “C _3-10 cycloalkyl (group)” include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, bicyclo [2.2.1] heptyl, bicyclo [2. 2.2] octyl, bicyclo [3.2.1] octyl, bicyclo [3.2.2] nonyl, bicyclo [3.3.1] nonyl, bicyclo [4.2.1] nonyl, bicyclo [4. 3.1] Decyl, adamantyl and the like.
In the present specification, unless otherwise specified, as the “C _3-10 cycloalkyl (group)”, for example, C _3-8 cycloalkyl (group) is preferable.

In the present specification, examples of the “C _3-10 cycloalkenyl (group)” include 2-cyclopenten-1-yl, 3-cyclopenten-1-yl, 2-cyclohexen-1-yl, and 3-cyclohexene- 1-yl and the like can be mentioned.
In the present specification, unless otherwise specified, as the “C _3-10 cycloalkenyl (group)”, for example, C _3-8 cycloalkenyl (group) is preferable.

In the present specification, examples of the “C _4-10 cycloalkadienyl (group)” include 2,4-cyclopentadien-1-yl, 2,4-cyclohexadien-1-yl, and 2,5- And cyclohexadien-1-yl.
In the present specification, unless otherwise specified, as the “C _4-10 cycloalkadienyl (group)”, for example, C _4-9 cycloalkadienyl (group) is preferable.

The “C _3-10 cycloalkyl (group)”, the “C _3-10 cycloalkenyl (group)” and the “C _4-10 cycloalkadienyl (group)” are each condensed with a benzene ring. Also good. Examples of such a condensed ring group include indanyl, dihydronaphthyl, tetrahydronaphthyl, and fluorenyl.

In the present specification, examples of the “C _6-14 aryl (group)” include phenyl, naphthyl, anthryl, phenanthryl, acenaphthylenyl, biphenylyl and the like.

In the present specification, examples of the “C _7-16 aralkyl (group)” include benzyl, 2-phenylethyl, 1-phenylethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenyl. Examples include ethyl, 3-phenylpropyl, 3,3-diphenylpropyl, 4-phenylbutyl, 5-phenylpentyl, 2-biphenylylmethyl, 3-biphenylylmethyl, 4-biphenylylmethyl and the like.

In the present specification, examples of the “C _8-13 aryl-alkenyl (group)” include styryl and the like.

In the present specification, examples of the “C _3-10 cycloalkyl-C _1-10 alkyl (group)” include cyclohexylmethyl and the like.
In the present specification, examples of the “C _1-6 alkoxy (group)” include methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy and the like.

In the present specification, as the “monocyclic aromatic heterocyclic group”, for example,
Frills (eg 2-furyl, 3-furyl),
Thienyl (eg, 2-thienyl, 3-thienyl),
Pyridyl (eg, 2-pyridyl, 3-pyridyl, 4-pyridyl),
Pyrimidinyl (eg, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl),
Pyridazinyl (eg, 3-pyridazinyl, 4-pyridazinyl),
Pyrazinyl (eg, 2-pyrazinyl),
Pyrrolyl (eg, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl),
Imidazolyl (eg, 1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl),
Pyrazolyl (eg, 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl),
Thiazolyl (eg, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl),
Isothiazolyl (eg, 4-isothiazolyl),
Oxazolyl (eg, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl),
Isoxazolyl, oxadiazolyl (eg, 1,2,4-oxadiazol-3-yl, 1,2,4-oxadiazol-5-yl, 1,3,4-oxadiazol-2-yl),
Thiadiazolyl (eg, 1,3,4-thiadiazol-2-yl, 1,2,4-thiadiazol-3-yl, 1,2,4-thiadiazol-5-yl),
Triazolyl (eg, 1,2,4-triazol-1-yl, 1,2,4-triazol-3-yl, 1,2,3-triazol-1-yl, 1,2,3-triazole-2- Yl, 1,2,3-triazol-4-yl),
Tetrazolyl (eg, tetrazol-1-yl, tetrazol-5-yl), and triazinyl (eg, 1,2,4-triazin-1-yl, 1,2,4-triazin-3-yl) .

In the present specification, as the “fused aromatic heterocyclic group”, for example,
Quinolyl (eg, 2-quinolyl, 3-quinolyl, 4-quinolyl, 6-quinolyl),
Isoquinolyl (eg, 3-isoquinolyl),
Quinazolyl (eg, 2-quinazolyl, 4-quinazolyl),
Quinoxalyl (eg, 2-quinoxalyl, 6-quinoxalyl),
Benzofuryl (eg, 2-benzofuryl, 3-benzofuryl),
Benzothienyl (eg, 2-benzothienyl, 3-benzothienyl),
Benzoxazolyl (eg, 2-benzoxazolyl),
Benzisoxazolyl (eg, 7-benzisoxazolyl),
Benzothiazolyl (eg, 2-benzothiazolyl),
Benzimidazolyl (eg, benzimidazol-1-yl, benzimidazol-2-yl, benzimidazol-5-yl),
Benzotriazolyl (eg, 1H-1,2,3-benzotriazol-5-yl),
Indolyl (eg, indol-1-yl, indol-2-yl, indol-3-yl, indol-5-yl),
Indazolyl (eg, 1H-indazol-3-yl),
Pyrrolopyrazinyl (eg, 1H-pyrrolo [2,3-b] pyrazin-2-yl, 1H-pyrrolo [2,3-b] pyrazin-6-yl),
Imidazopyridinyl (eg, 1H-imidazo [4,5-b] pyridin-2-yl, 1H-imidazo [4,5-c] pyridin-2-yl, 2H-imidazo [1,2-a] pyridine -3-yl),
Imidazopyrazinyl (eg, 1H-imidazo [4,5-b] pyrazin-2-yl),
Imidazothiazolyl (eg, imidazo [2,1-b] thiazol-5-yl) pyrazolopyridinyl (eg, 1H-pyrazolo [4,3-c] pyridin-3-yl),
Pyrazolothienyl (eg, 2H-pyrazolo [3,4-b] thiophen-2-yl), and pyrazolotriazinyl (eg, pyrazolo [5,1-c] [1,2,4] triazin-3-yl ) And the like.

In the present specification, as the “non-aromatic heterocyclic group”, for example,
Pyrrolidinyl (eg, 1-pyrrolidinyl),
Piperidinyl (eg, piperidino, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl),
Morpholinyl (eg, morpholino),
Thiomorpholinyl (eg, thiomorpholino),
Piperazinyl (eg, 1-piperazinyl, 2-piperazinyl, 3-piperazinyl),
Hexamethyleneiminyl (eg, hexamethyleneimine-1-yl),
Oxazolidinyl (eg, oxazolidin-2-yl),
Thiazolidinyl (eg, thiazolidin-2-yl),
Imidazolidinyl (eg, imidazolidin-2-yl, imidazolidin-3-yl),
Oxazolinyl (eg, oxazolin-2-yl),
Thiazolinyl (eg, thiazolin-2-yl),
Imidazolinyl (eg, imidazolin-2-yl, imidazolin-3-yl),
Dioxolyl (eg, 1,3-dioxol-4-yl),
Dioxolanyl (eg, 1,3-dioxolan-4-yl),
Dihydrooxadiazolyl (eg, 4,5-dihydro-1,2,4-oxadiazol-3-yl),
Thioxooxazolidinyl (eg, 2-thioxo-1,3-oxazolidine-5-yl),
Pyranyl (eg, 4-pyranyl),
Tetrahydropyranyl (eg, 4-tetrahydropyranyl),
Thiopyranyl (eg, 4-thiopyranyl),
Tetrahydrothiopyranyl (eg, 4-tetrahydrothiopyranyl),
1-oxidetetrahydrothiopyranyl (eg, 1-oxidetetrahydrothiopyran-4-yl),
1,1-dioxidetetrahydrothiopyranyl (eg, 1,1-dioxidetetrahydrothiopyran-4-yl),
Pyrazolidinyl (eg, pyrazolidin-1-yl),
Tetrahydropyrimidinyl,
Dioxanyl (eg, 1,3-dioxane-2-yl, 1,3-dioxane-4-yl, 1,3-dioxane-5-yl, 1,4-dioxane-2-yl), and dioxenyl (eg, 4H-1,3-dioxin-2-yl, 4H-1,3-dioxin-4-yl, 4H-1,3-dioxin-5-yl, 4H-1,3-dioxin-6-yl, 2, 3-dihydro-1,4-dioxin-2-yl, 2,3-dihydro-1,4-dioxin-5-yl) and the like.

In the present specification, as the “fused non-aromatic heterocyclic group”, for example,
Dihydroindolyl (eg, 2,3-dihydro-1H-isoindol-1-yl),
Dihydroisoindolyl (eg, 1,3-dihydro-2H-isoindol-2-yl),
Dihydrobenzofuranyl (eg, 2,3-dihydro-1-benzofuran-5-yl),
Dihydrobenzodioxinyl (eg, 2,3-dihydro-1,4-benzodioxinyl),
Dihydrobenzodioxepinyl (eg, 3,4-dihydro-2H-1,5-benzodioxepinyl),
Tetrahydrobenzofuranyl (eg, 4,5,6,7-tetrahydro-1-benzofuran-3-yl),
Chromenyl (eg, 4H-chromen-2-yl, 2H-chromen-3-yl),
Dihydroquinolinyl (eg, 1,2-dihydroquinolin-4-yl),
Tetrahydroquinolinyl (eg, 1,2,3,4-tetrahydroquinolin-4-yl),
Dihydroisoquinolinyl (eg, 1,2-dihydroisoquinolin-4-yl),
Tetrahydroisoquinolinyl (eg, 1,2,3,4-tetrahydroisoquinolin-4-yl),
Dihydrophthalazinyl (eg, 1,4-dihydrophthalazin-4-yl), hexahydropyrazinooxazinyl (eg, hexahydropyrazino [2,1-c] [1,4] oxazinyl), etc. Is mentioned.

Hereinafter, symbols in the formula (I ₀ ) will be described.

One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom.
In formula (I ₀ ),
The portion represented by

Etc.

R ^1a and R ^1b each independently represent an absence, a hydrogen atom, or a substituent.
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent.
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent.
R ^4a and R ^4b each independently represent an absence, a hydrogen atom, or a substituent.

As the “substituent” represented by R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b , respectively,
Halogen atom,
A cyano group,
Nitro group,
An optionally substituted hydrocarbon group,
An optionally substituted heterocyclic group,
A group represented by RO—, RCO—, or RS— (wherein R represents a hydrogen atom, an optionally substituted hydrocarbon group, or an optionally substituted heterocyclic group), and a substituent; And an amino group which may be used.

“Hydrocarbon group” of “optionally substituted hydrocarbon group” as “substituent” represented by R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b For example,
A C _1-10 alkyl group,
C _2-10 alkenyl group,
A C _2-10 alkynyl group,
A C _3-10 cycloalkyl group,
A C _3-10 cycloalkenyl group,
A C _4-10 cycloalkadienyl group,
A C _6-14 aryl group,
A C _7-16 aralkyl group,
A C _8-13 aryl-alkenyl group, a C _3-10 cycloalkyl-C _1-10 alkyl group and the like.

The C _1-10 alkyl group, C _2-10 alkenyl group and C _2-10 alkynyl group exemplified as the “hydrocarbon group” are one or more (preferably 1 to 3) at substitutable positions. It may have a substituent.

As the substituent, for example,
(1) a halogen atom,
(2) a cyano group,
(3) Nitro group,
(4) a C _3-10 cycloalkyl group which may be substituted with 1 to 3 halogen atoms and may be condensed with a benzene ring,
(5) a C _3-10 cycloalkenyl group which may be substituted with 1 to 3 halogen atoms and may be condensed with a benzene ring,
(6) a C _6-14 aryl group _optionally substituted by 1 to 3 halogen atoms,
(7) amino group,
(8) Mono- or di-C _1-10 alkylamino group (eg, methylamino, ethylamino, propylamino, dimethylamino, diethylamino, dipropylamino) optionally substituted by 1 to 3 halogen atoms ,
(9) a C _1-10 alkyl-carbonylamino group (eg, acetylamino, ethylcarbonylamino) _optionally substituted with 1 to 3 halogen atoms,
(10) a C _1-6 alkoxy-carbonylamino group (eg, methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino) optionally substituted by 1 to 3 halogen atoms,
(11) a phenyl group substituted with one or more (preferably 1 to 3) substituents selected from a halogen atom and an alkoxy group (eg, C _1-6 alkoxy group);
(12) Ureido group,
(13) a C _1-10 alkyl-ureido group (eg, methylureido, ethylureido, propylureido) optionally substituted by 1 to 3 halogen atoms,
(14) a C _6-14 aryl-ureido group _optionally substituted with 1 to 3 halogen atoms (eg, phenylureido, 1-naphthylureido, 2-naphthylureido),
(15) a hydroxy group,
(16) a C _1-6 alkoxy group optionally substituted with 1 to 3 halogen atoms (eg, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy),
(17) a C _7-16 aralkyloxy group (eg, benzyloxy) _optionally substituted by 1 to 3 halogen atoms,
(18) a C _6-14 aryloxy group (eg, phenoxy) _optionally substituted by 1 to 3 halogen atoms,
(19) formyl group,
(20) a carboxy group,
(21) a C _1-6 alkoxy-carbonyl group optionally substituted with 1 to 3 halogen atoms (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, tert-butoxycarbonyl),
(22) a C _7-16 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl) _optionally substituted with 1 to 3 halogen atoms,
(23) a C _6-14 aryloxy-carbonyl group (eg, phenoxycarbonyl) _optionally substituted by 1 to 3 halogen atoms,
(24) a C _1-10 alkyl-carbonyl group (eg, acetyl, ethylcarbonyl, propylcarbonyl, isopropylcarbonyl, 2,2-dimethylpropylcarbonyl) optionally substituted with 1 to 3 halogen atoms,
(25) a C _3-8 cycloalkyl-carbonyl group (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl) optionally substituted by 1 to 3 halogen atoms,
(26) a C _7-16 aralkyl-carbonyl group (eg, benzylcarbonyl) _optionally substituted by 1 to 3 halogen atoms,
(27) a carbamoyl group,
(28) A mono- or di-C _1-10 alkyl-carbamoyl group _optionally substituted with 1 to 3 halogen atoms (eg, methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl, isopropylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl) , Dipropylcarbamoyl),
(29) a mono- or di-C _7-16 aralkyl-carbamoyl group (eg, benzylcarbamoyl, dibenzylcarbamoyl) _optionally substituted by 1 to 3 halogen atoms,
(30) 5- to 7-membered non-aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom (eg, pyrrolidinylcarbonyl, tetrahydrofuryl) Carbonyl, tetrahydrothienylcarbonyl, piperidylcarbonyl, tetrahydropyranylcarbonyl, morpholinylcarbonyl, sulfanylmorpholinylcarbonyl, piperazinylcarbonyl),
(31) 5- to 7-membered aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom (eg, furylcarbonyl, thienylcarbonyl, pyrrolyl) Carbonyl, oxazolylcarbonyl, isoxazolylcarbonyl, thiazolylcarbonyl, isothiazolylcarbonyl, imidazolylcarbonyl, pyrazolylcarbonyl, 1,2,3-oxadiazolylcarbonyl, 1,2,4-oxadiazolylcarbonyl 1,3,4-oxadiazolylcarbonyl, furazanylcarbonyl, 1,2,3-thiadiazolylcarbonyl, 1,2,4-thiadiazolylcarbonyl, 1,3,4-thiadiazolylcarbonyl, 1,2,3-triazolylcarbonyl, 1,2,4-triazolylcarbonyl, tetrazolylcarbonyl, pi Jill carbonyl, pyridazinyl carbonyl, pyrimidinyl carbonyl, pyrazinylcarbonyl, triazinyl carbonyl),
(32) a thiocarbamoyl group,
(33) a thiol group,
(34) a C _1-10 alkylsulfanyl group (eg, methylsulfanyl, ethylsulfanyl, propylsulfanyl) optionally substituted by 1 to 3 halogen atoms,
(35) a C _7-16 aralkylsulfanyl group (eg, benzylsulfanyl) _optionally substituted by 1 to 3 halogen atoms,
(36) a C _6-14 arylsulfanyl group (eg, phenylsulfanyl) _optionally substituted by 1 to 3 halogen atoms,
(37) a C _1-10 alkylsulfinyl group (eg, methylsulfinyl, ethylsulfinyl, propylsulfinyl, butylsulfinyl) optionally substituted by 1 to 3 halogen atoms,
(38) a C _6-10 arylsulfinyl group (eg, phenylsulfinyl, naphthylsulfinyl) optionally substituted by 1 to 3 halogen atoms,
(39) a C _1-10 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl) optionally substituted with 1 to 3 halogen atoms,
(40) a C _3-8 cycloalkylsulfonyl group (eg, cyclopropylsulfonyl, cyclobutylsulfonyl, cyclopentylsulfonyl) optionally substituted with 1 to 3 halogen atoms,
(41) a C _6-14 arylsulfonyl group (eg, phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl) _optionally substituted with 1 to 3 halogen atoms,
(42) a C _7-16 aralkylsulfonyl group (eg, benzylsulfonyl) _optionally substituted with 1 to 3 halogen atoms,
(43) an aminosulfonyl group,
(44) a mono-N-C _1-10 alkylaminosulfonyl group (eg, methylaminosulfonyl, ethylaminosulfonyl) optionally substituted with 1 to 3 halogen atoms,
(45) a di-N, N-C _1-10 alkylaminosulfonyl group (eg, dimethylaminosulfonyl, diethylaminosulfonyl) optionally substituted with 1 to 3 halogen atoms,
(46) 5- to 7-membered non-aromatic heterocyclic group having 1 to 4 heteroatoms selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atom (eg, pyrrolidinyl, tetrahydrofuryl, tetrahydrothienyl, piperidinyl) , Tetrahydropyranyl, morpholinyl, thiomorpholinyl, piperazinyl) [the non-aromatic heterocyclic group may be substituted with a C _1-10 alkyl group (eg, methyl)], and
(47) A 5- or 6-membered aromatic heterocyclic group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (eg, furyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, Thiazolyl, isothiazolyl, imidazolyl, pyrazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, furazanyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl), the aromatic heterocyclic group is a halogen atom or C _{1 -10} alkyl group (e.g., methyl) may be substituted with, also, may be condensed with a benzene ring (e.g., Nzochieniru), and the like. In the present specification, a group of these substituents may be referred to as a substituent group A.

In addition, the C _3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C _4-10 cycloalkadienyl group, C _6-14 aryl group, C _7-16 aralkyl exemplified as the “hydrocarbon group” Group, C _8-13 aryl-alkenyl group and C _3-10 cycloalkyl-C _1-10 alkyl group each have one or more (preferably 1 to 3) substituents at substitutable positions. You may do it.

As the substituent, for example,
(1) a group exemplified as a substituent that the “C _1-10 alkyl group” and the like exemplified as the “hydrocarbon group” may have,
(2) 1 to 3 substitutions selected from a halogen atom, a hydroxy group, a C _1-6 alkoxy group, a C _1-10 alkoxy-carbonyl group, a carboxy group, and a mono- or di-C _1-10 alkyl-carbamoyl group A C _1-10 alkyl group _optionally substituted with a group,
(3) a C _2-10 alkenyl group optionally substituted with 1 to 3 substituents selected from a halogen atom, a hydroxy group, and a C _1-6 alkoxy group,
(4) a C _2-10 alkynyl group optionally substituted with 1 to 3 substituents selected from a halogen atom, a hydroxy group, and a C _1-6 alkoxy group, and
(5) a C _7-16 aralkyl group optionally substituted with 1 to 3 substituents selected from a halogen atom, a hydroxy group, and a C _1-6 alkoxy group (eg, benzyl, 2-phenylethyl, 1 -Phenylethyl, 3-phenylpropyl, 4-phenylbutyl) and the like. In the present specification, a group of these substituents may be referred to as a substituent group B.

“Heterocyclic group” of “optionally substituted heterocyclic group” as “substituent” represented by R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b "" Includes, for example, an aromatic heterocyclic group and a non-aromatic heterocyclic group.
Examples of the “aromatic heterocyclic group” include monocyclic aromatic heterocyclic groups and condensed aromatic heterocyclic groups.
Examples of the “non-aromatic heterocyclic group” include a monocyclic non-aromatic heterocyclic group and a condensed non-aromatic heterocyclic group.

The “monocyclic aromatic heterocyclic group” is, for example, a 5- or 6-membered member containing 1 to 4 heteroatoms selected from an oxygen atom, a sulfur atom, and a nitrogen atom in addition to a carbon atom as a ring-constituting atom. The monocyclic aromatic heterocyclic group of these is mentioned.
Examples of the “fused aromatic heterocyclic group” include the “aromatic heterocyclic group” condensed with one or two aromatic rings.
As the “aromatic ring”, for example,
(1) a benzene ring, and (2) a 5- or 6-membered monocyclic aromatic containing 1 to 3 heteroatoms selected from an oxygen atom, a sulfur atom, and a nitrogen atom in addition to a carbon atom as a ring-constituting atom Heterocycle (eg, furan, thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, imidazole, pyrazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, 1,3,4 -Oxadiazole, furazane, 1,2,3-thiadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, pyridine , Pyridazine, pyrimidine, pyrazine, triazine).
Examples of the “monocyclic non-aromatic heterocyclic group” include 5 to 7 containing 1 to 4 heteroatoms selected from an oxygen atom, a sulfur atom, and a nitrogen atom in addition to a carbon atom as a ring-constituting atom. Membered monocyclic non-aromatic heterocyclic groups.
Examples of the “fused non-aromatic heterocyclic group” include the “non-aromatic heterocyclic group” fused with one or two rings.
As the “ring”, for example,
(1) C3- _C10 carbocyclic ring [eg, benzene ring, C _3-10 cycloalkane (eg, cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclononane, cyclodecane), C _{3- 10} cycloalkene (eg, cyclopropene, cyclobutene, cyclopentene, cyclohexene, cycloheptene, cyclooctene, cyclononene, cyclodecene), C _4-10 cycloalkadiene (eg, cyclobutadiene, cyclopentadiene, cyclohexadiene, cycloheptadiene, cyclooctane) Diene, cyclononadiene, cyclodecadiene)],
(2) 5- or 6-membered monocyclic aromatic heterocycle containing 1 to 3 heteroatoms selected from oxygen, sulfur and nitrogen atoms in addition to carbon atoms as ring-constituting atoms (eg, furan, Thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, imidazole, pyrazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, 1,3,4-oxadiazole, furazane, 1,2,3-thiadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, Triazine), and (3) a heteroatom selected from an oxygen atom, a sulfur atom, and a nitrogen atom in addition to a carbon atom as a ring-constituting atom 5- to 7-membered monocyclic non-aromatic heterocycle containing 1 to 3 (eg, pyrrolidine, piperidine, piperazine, morpholine, thiomorpholine, pyrazolidine, imidazolidine, oxazolidine, thiazolidine, isoxazolidine, isothiazolidine, oxadiazo Lysine, thiadiazolidine, hexamethyleneimine)
Is mentioned.

R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , R ^4b , R ^4b , R ^4b , R ^4b , R ^4b Examples of the “optionally substituted hydrocarbon group” represented by R include, for example, R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b. Examples thereof include the same as the “optionally substituted hydrocarbon group” as the “substituent”.
Examples of the “optionally substituted heterocyclic group” represented by R are represented by R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b. Examples thereof include the same as the “optionally substituted heterocyclic group” as the “substituent”.

One or two “optionally substituted amino groups” as “substituents” represented by R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b It may be substituted with a substituent. Examples of the substituent include an optionally substituted hydrocarbon group, an optionally substituted heterocyclic group, and RCO— (wherein R represents the same meaning as described above). Groups.
Examples of the “optionally substituted hydrocarbon group” as a substituent of the “optionally substituted amino group” include, for example, R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a, and is represented by R ^4b include those similar to the "optionally substituted hydrocarbon group" as "substituents."
Examples of the “optionally substituted heterocyclic group” as a substituent of the “optionally substituted amino group” include, for example, R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b. , R ^4a , and R ^4b are the same as the “optionally substituted heterocyclic group” as the “substituent”.

In addition, although it describes only for description, when R ^<1a> , R ^<1b> , or both are absent, Y is a nitrogen atom or an oxygen atom,
Similarly, when R ^4a , R ^4b , or both are absent, Z is a nitrogen atom or an oxygen atom.

R ^1a and R ^1b are preferably each independently, for example, absent, a hydrogen atom or a substituent (excluding a phenyl group).

R ^1a and R ^1b are preferably each independently, for example, absent, a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl), RCO— (wherein R is C _1-10 A group represented by an alkyl group (eg, methyl) (that is, a C _1-10 alkyl-carbonyl group).
R ^2a and R ^2b are preferably each independently, for example, a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl), RCO— (wherein R is a C _1-10 alkyl group ( For example, a methyl atom), particularly preferably, for example, a hydrogen atom.
R ^3a and R ^3b are preferably each independently, for example, independently a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl), RCO— (wherein R is a C _1-10 alkyl group ( For example, methyl).
R ^4a and R ^4b are preferably each independently, for example, absent, a C _1-10 alkyl group _optionally substituted with a hydrogen atom or a C _3-10 cycloalkyl group (eg, cyclopropyl) ( For example, methyl, ethyl), RCO— (wherein R represents a C _1-10 alkyl group (eg, methyl)) (ie, a C _1-10 alkyl-carbonyl group).

Partial structural formula in formula (I ₀ ):

But,

Is preferably
R ^1a and R ^1b are each a hydrogen atom, and R ^4a and R ^4b are absent.
Partial structural formula in formula (I ₀ ):

But,

Is preferably
R ^1a and R ^1b are each a hydrogen atom, and one of R ^4a and R ^4b is a hydrogen atom, a C _1-10 alkyl group, a C _3-10 cycloalkyl-C _1-10 alkyl group, or _{Represents a} C _1-10 alkyl-carbonyl group, the other is absent.
Partial structural formula of formula (I):

But,

Is preferably
One of R ^1a and R ^1b is a C _1-10 alkyl group or a C _1-10 alkyl-carbonyl group, the other is absent, and R ^4a and R ^4b are each a hydrogen atom.

Examples of the “substituent” represented by R ⁵ include the “substituent” represented by R ^1a , R ^1b , R ^2a , R ^2b , R ^3a , R ^3b , R ^4a , and R ^4b . The thing similar to a thing is mentioned.
The “substituent” represented by R ⁵ is preferably a C _1-10 alkyl group which may be substituted with 1 to 3 substituents selected from a halogen atom, a hydroxy group, and a C _1-6 alkoxy group. It is.

R ⁵ is preferably a C _1-10 alkyl group which may be substituted with, for example, 1 to 3 (preferably 3) halogen atoms.

The “benzene ring” of the “optionally substituted benzene ring” represented by Ar may have one or more (preferably 1 to 3) substituents.
Examples of the substituent include a group (substituent in Substituent Group B) exemplified as a substituent that the “C _3-10 cycloalkyl group” and the like exemplified as the “hydrocarbon group” may have. Similar groups are mentioned.

As the “monocyclic aromatic heterocycle” represented by Ar, for example, it contains 1 to 3 heteroatoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in addition to a carbon atom as a ring-constituting atom. Or a 6-membered monocyclic aromatic heterocycle (eg, furan, thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, imidazole, pyrazole, 1,2,3-oxadiazole, 1,2,4- Oxadiazole, 1,3,4-oxadiazole, furazane, 1,2,3-thiadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, 1,2,3-triazole, 1, 2,4-triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, triazine).

Two of the substituents of the “optionally substituted benzene ring” represented by Ar and the “optionally substituted monocyclic aromatic heterocycle” may be formed together. As the “ring” of the “optionally substituted ring”, for example,
(1) C3- _C10 carbocyclic ring [eg, benzene ring, C _3-10 cycloalkane (eg, cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclononane, cyclodecane), C _{3- 10} cycloalkene (eg, cyclopropene, cyclobutene, cyclopentene, cyclohexene, cycloheptene, cyclooctene, cyclononene, cyclodecene), C _4-10 cycloalkadiene (eg, cyclobutadiene, cyclopentadiene, cyclohexadiene, cycloheptadiene, cyclooctane) Diene, cyclononadiene, cyclodecadiene)],
(2) 5- or 6-membered monocyclic aromatic heterocycle containing 1 to 3 heteroatoms selected from oxygen, sulfur and nitrogen atoms in addition to carbon atoms as ring-constituting atoms (eg, furan, Thiophene, pyrrole, oxazole, isoxazole, thiazole, isothiazole, imidazole, pyrazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, 1,3,4-oxadiazole, furazane, 1,2,3-thiadiazole, 1,2,4-thiadiazole, 1,3,4-thiadiazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, Triazine), and (3) a heteroatom selected from an oxygen atom, a sulfur atom, and a nitrogen atom in addition to a carbon atom as a ring-constituting atom 5- to 7-membered monocyclic non-aromatic heterocycle containing 1 to 3 (eg, pyrrolidine, piperidine, piperazine, morpholine, thiomorpholine, pyrazolidine, imidazolidine, oxazolidine, thiazolidine, isoxazolidine, isothiazolidine, oxadiazo Lysine, thiadiazolidine, hexamethyleneimine)
Is mentioned.
The “ring” may have one or more (preferably 1 to 3) substituents at substitutable positions.
Examples of the “substituent” include the groups exemplified as the substituents that the “C _3-10 cycloalkyl group” and the like exemplified as the “hydrocarbon group” may have (substituents in the substituent group B). ) And the same groups.

Ar is preferably, for example,
(1) a mono- or di-C _1-10 alkyl-carbamoyl group (eg, dimethylcarbamoyl) and a carboxy group; and (2) a mono- or di-C _1-10 alkyl-carbamoyl group (eg, methylcarbamoyl, Diethyltylcarbamoyl), C _1-10 alkoxy-carbonyl group (eg, methoxycarbonyl), and C _1-10 alkyl group (eg, optionally substituted with 1 to 3 substituents selected from carboxy group) Methyl)
A benzene ring which may be substituted with 1 to 3 substituents selected from

Ar is also preferably, for example,
(i) selected from di-C _1-10 alkyl-carbamoyl groups, (ii) carboxy groups, (iii) C _1-10 alkoxy-carbonyl groups, carboxy groups, and mono- or di-C _1-10 alkyl-carbamoyl groups 1 to 3 (preferably 3) substituents selected from a C _1-10 alkyl group substituted with one or more (preferably 1 to 3) substituents, (iv) a halogen atom and an alkoxy group And a benzene ring substituted with 1 to 3 (preferably 1) substituents selected from amino groups substituted with 1 or 2 (preferably 1) phenyl groups substituted with.

Ar is also preferably substituted with 1 or 2 (preferably 1) phenyl groups substituted with 1 to 3 (preferably 3) substituents selected from, for example, a halogen atom and an alkoxy group. A pyridine ring substituted with an amino group.

The compound (I ₀ ) is preferably, for example,
One of Y and Z is a nitrogen atom or an oxygen atom, and the other is a carbon atom;
R ^1a and R ^1b are each independently absent, a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl), RCO— (wherein R is a C _1-10 alkyl group (eg, Represents a group represented by
R ^2a and R ^2b are each independently a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl), RCO— (wherein R is a C _1-10 alkyl group (eg, methyl)) Represented), and
R ^3a and R ^3b each independently represent a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl), RCO— (wherein R represents a C _1-10 alkyl group (eg, methyl)). Represented), and
R ^4a and R ^4b are each independently absent, a hydrogen atom or a C _1-10 alkyl group (eg, methyl, ethyl) optionally substituted with a C _3-10 cycloalkyl group (eg, cyclopropyl). ), RCO— (wherein R represents a C _1-10 alkyl group (eg, methyl)),
R ⁵ is a C _1-10 alkyl group which may be substituted with 1 to 3 halogen atoms, and Ar is
(1) a mono- or di-C _1-10 alkyl-carbamoyl group (eg, dimethylcarbamoyl) and a carboxy group; and (2) a mono- or di-C _1-10 alkyl-carbamoyl group (eg, methylcarbamoyl, diethyl Ji _{carbamoyl), C 1-10} alkoxy - carbonyl group (e.g., methoxycarbonyl), and ~ 1 may be substituted with 1 to 3 substituents selected from a carboxy group of three _{C 1-10} Alkyl groups (eg, methyl)
Or a salt thereof, which is a benzene ring optionally substituted by

More preferably as the compound (I ₀ ), for example,
Partial structural formula in formula (I ₀ ):

Is

Represents
R ^1a and R ^1b each independently represents an absence, a hydrogen atom, a C _1-10 alkyl group, or a C _1-10 alkyl-carbonyl group,
^{^R ^2a,} R 2b, R ^3a and ^{R 3b} independently represent a hydrogen atom,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom, a C _1-10 alkyl group, a C _3-10 cycloalkyl-C _1-10 alkyl group, or a C _1-10 alkyl-carbonyl group. ,
R ⁵ represents a C _1-10 alkyl group substituted with a halogen atom, and Ar is
(1) (i) di-C _1-10 alkyl-carbamoyl group, (ii) carboxy group, (iii) C _1-10 alkoxy-carbonyl group, carboxy group, and mono or di-C _1-10 alkyl-carbamoyl Substituted with a substituent selected from a C _1-10 alkyl group substituted with a substituent selected from the group, and (iv) an amino group substituted with a phenyl group substituted with a substituent selected from a halogen atom and an alkoxy group Or (2) a compound representing a pyridine ring substituted with an amino group substituted with a phenyl group substituted with a substituent selected from a halogen atom and an alkoxy group, or a salt thereof.

Among the preferable compounds or salts thereof, for example, the following compounds (1) to (3) or salts thereof are more preferable.
(1) Partial structural formula of formula (I ₀ ):

But,

And
R ^1a and R ^1b each represent a hydrogen atom, and
R ^4a and R ^4b are an absent compound or a salt thereof.
(2) Partial structural formula of formula (I ₀ ):

But,

And
R ^1a and R ^1b each represent a hydrogen atom, and
One of R ^4a and R ^4b represents a hydrogen atom, a C _1-10 alkyl group, a C _3-10 cycloalkyl-C _1-10 alkyl group, or a C _1-10 alkyl-carbonyl group, and the other is absent A compound or a salt thereof.
(3) Partial structural formula of formula (I ₀ ):

But,

One of R ^1a and R ^1b represents a C _1-10 alkyl group or a C _1-10 alkyl-carbonyl group, the other is absent, and
R ^4a and R ^4b are each a compound representing a hydrogen atom or a salt thereof.

In the preferred compound or a salt thereof, more preferably, for example,
R ⁵ represents a C _1-10 alkyl group substituted with 1 to 3 (preferably 3) halogen atoms,
Ar is
(1)
(i) a di-C _1-10 alkyl-carbamoyl group,
(ii) a carboxy group,
(iii) a C _1-10 alkyl group substituted with a substituent selected from a C _1-10 alkoxy-carbonyl group, a carboxy group, and a mono- or di-C _1-10 alkyl-carbamoyl group,
(Iv) selected from amino groups substituted with 1 or 2 (preferably 1) phenyl groups substituted with 1 to 3 (preferably 3) substituents selected from halogen atoms and alkoxy groups A benzene ring substituted with 1 to 3 (preferably 1) substituents, or (2) 1 substituted with 1 to 3 (preferably 3) substituents selected from a halogen atom and an alkoxy group Or a compound representing a pyridine ring substituted with an amino group substituted with two (preferably one) phenyl groups, or a salt thereof.
In the preferred compound or a salt thereof, more preferably, for example,
Partial structural formula of formula (I ₀ ):

Is

Represents
R ^1a , R ^1b , R ^2a , R ^2b , R ^3a and R ^3b each represents a hydrogen atom,
When Z is an oxygen atom, R ^4a and R ^4b are absent;
When Z is a nitrogen atom, one of R ^4a and R ^4b represents a C _1-10 alkyl group, the other is absent,
R ⁵ represents a C _1-10 alkyl group substituted with a halogen atom, and Ar is
one or more selected from (i) a di-C _1-10 alkyl-carbamoyl group and (ii) a C _1-10 alkyl group substituted with a mono- or di-C _1-10 alkyl-carbamoyl group (preferably 1 Represents a benzene ring substituted with up to 3 substituents.

Preferably also as compound (I ₀ ), for example,
Y represents a carbon atom, Z represents an oxygen atom,
R ^1a , R ^1b , R ^2a , R ^2b , R ^3a and R ^3b each represents a hydrogen atom,
R ^4a and ^{R 4b} are absent,
R ⁵ represents a substituted C _1-10 alkyl group,
Ar is a compound representing a substituted benzene ring or a salt thereof.

Preferably also as compound (I ₀ ), for example,
R ⁵ represents a C _1-10 alkyl group substituted with a halogen atom,
Ar is a compound representing a benzene ring substituted with a C _1-10 alkyl group substituted with a mono- or di-C _1-10 alkyl-carbamoyl group or a salt thereof.
In the preferred compound or a salt thereof, more preferably, for example,
R ⁵ represents a C _1-10 alkyl group substituted with 1 to 3 halogen atoms,
Ar is a compound or a salt thereof which is a benzene ring substituted with 1 to 3 C _1-10 alkyl groups substituted with 1 to 3 mono- or di-C _1-10 alkyl-carbamoyl groups. Yes, more preferably
Ar is a compound or a salt thereof which is a benzene ring substituted with one C _1-10 alkyl group substituted with one mono- or di-C _1-10 alkyl-carbamoyl group.
Specifically preferable as the compound (I ₀ ) is, for example, the following compound or a salt thereof.
N-methyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
N, N-dimethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
N, N-diethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.

In addition, among the compounds (I ₀ ), the formula (I)

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R ^1a and R ^1b each independently represent an absence, a hydrogen atom or a substituent (excluding a phenyl group);
R ^2a and R ^2b each independently represent a hydrogen atom or a substituent,
R ^3a and R ^3b each independently represent a hydrogen atom or a substituent,
R ^4a and R ^4b each independently represent an absence, a hydrogen atom or a substituent,
R ⁵ represents a substituent, and Ar represents a substituted benzene ring or an optionally substituted monocyclic aromatic heterocyclic ring, and the benzene ring or the monocyclic aromatic heterocyclic ring is 2 When substituted with two or more substituents, two of them may be joined together to form an optionally substituted ring. ]
A compound represented by (provided that
4- {4-[(Benzyloxy) amino] -3- (difluoromethyl) -6,6-dimethyl-5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl} -2- Bromo-6-[(1-glycylpyrrolidin-3-yl) amino] benzamide,
4- {4-[(Benzyloxy) amino] -3,6,6-trimethyl-5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl} -2-[(2-hydroxy Cyclohexyl) amino] -6-methoxybenzamide and glycine 2-[(5- {4-[(benzyloxy) amino] -3- (hydroxymethyl) -5,6-dihydropyrano [2,3-c] pyrazole- Except for 1 (4H) -yl} -2-carbamoylpyridin-3-yl) amino] cyclohexyl ester. ),
Or its salt (namely, compound (I)) is a novel compound.

When the compound (I ₀ ) is a salt, examples of such a salt include a salt with an inorganic base, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a basic or acidic amino acid, And the like.
Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; aluminum salt; ammonium salt and the like.
Preferable examples of the salt with an organic base include salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N, N-dibenzylethylenediamine and the like.
Preferable examples of the salt with inorganic acid include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
Preferable examples of the salt with organic acid include formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p- Examples thereof include salts with toluenesulfonic acid and the like.
Preferable examples of the salt with basic amino acid include salts with arginine, lysine, ornithine and the like.
Preferable examples of the salt with acidic amino acid include salts with aspartic acid, glutamic acid and the like.

Like the compound _{(I 0),} may be used prodrugs of the compounds _{(I 0).} Prodrugs of the compounds (I _0), the compound by a reaction due to an enzyme, gastric acid under the physiological condition in the living body compound which is converted into (I _0), i.e. enzymatic oxidation, reduction, hydrolysis etc. caused by compound ( A compound that changes to I ₀ ), a compound that undergoes hydrolysis or the like due to gastric acid or the like and changes to compound (I ₀ ).

Examples of a prodrug of compound (I _0), the compound (I ₀₎ amino group acylation of alkylated, phosphorylated compounds (e.g., amino group eicosanoylated compound (I _0), alanylation, pentyl Aminocarbonylation, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation, tert-butylated compounds A compound in which the hydroxyl group of the compound (I ₀ ) is acylated, alkylated, phosphorylated, borated (for example, the hydroxyl group of the compound (I ₀ ) is acetylated, palmitoylated, propanoylated, pivaloylated, Succinylated, fumarylated, alanylated, dimethylaminomethylcarbonylated compounds, etc.) The carboxy group of the compound (I ₀ ) is esterified, amidated (for example, the carboxy group of the compound (I ₀ ) is ethyl esterified, phenyl esterified, carboxymethyl esterified, dimethylaminomethyl esterified, Valoyloxymethyl esterification, ethoxycarbonyloxyethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methyl esterification, cyclohexyloxycarbonylethyl esterification, methylamide Compound etc.). These compounds can be produced from compound (I ₀ ) by a known method. The prodrug of the compound (I ₀₎ is changed to the compound (I ₀₎ under physiological conditions as described in 198, pages Hirokawa "Development of Pharmaceuticals" Shoten 1990 annual Volume 7 Molecular Design 163, pp. It may be a thing.

[Production method]
A method for producing compound (I ₀ ) will be described below.
Compound (I ₀ ) can be produced, for example, by the following method or a method analogous thereto.
The compound in the reaction formula may form a salt. Examples of such salts include the same salts as those in the compound (I ₀ ).

<Production of Compound (I ₀ )>
Manufacturing method A
Compound (I ₀ ) is, for example,
Compound (II):

(Wherein each symbol is as defined above) and compound (III):

(Wherein X represents a leaving group, and Ar has the same meaning as described above).
Examples of the “leaving group” represented by X include halogen atoms; sulfonyloxy groups such as p-toluenesulfonyloxy group, methanesulfonyloxy group, trifluoromethanesulfonyloxy group, etc., preferably chlorine, bromine And halogen atoms such as iodine.

Manufacturing method A-1
The reaction between compound (II) and compound (III) is performed using, for example, a base and a palladium catalyst or a copper catalyst. A phosphine ligand may be used as necessary.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salts; alkali metal hydrides such as sodium hydride and potassium hydride; sodium amides; alkali metal alkoxides such as sodium methoxide and sodium ethoxide; amines such as trimethylamine, triethylamine and diisopropylamine; pyridine, 4-dimethylaminopyridine And cyclic amines such as 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU).
Examples of the palladium catalyst used in this reaction include tetrakis (triphenylphosphine) palladium (0), bis (triphenylphosphine) palladium (II) dichloride, tris (dibenzylideneacetone) dipalladium (0), trans -Dichlorobis (tri-o-tolylphosphine) palladium (II), palladium (II) trifluoroacetate, palladium (II) acetate and the like.
Examples of the copper catalyst used in this reaction include copper iodide, copper bromide, copper chloride, copper acetate and the like.
Examples of the phosphine ligand used in this reaction include triphenylphosphine, 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl, 2- (di-tert-butylphosphino) biphenyl, 2- (Dicyclohexylphosphino) biphenyl, 2- (dicyclohexylphosphino) -2 ′, 6′-dimethoxy-1,1′-biphenyl, 2- (dicyclohexylphosphino) -2 ′,-4 ′, 6′-triisopropyl -1,1′-biphenyl, 2- (dicyclohexylphosphino) -2 ′-(N, N-dimethylamino) biphenyl, 1,1′-bis (diphenylphosphino) ferrocene, tri-tert-butylphosphine, tri And cyclohexylphosphine.
In this reaction, for example, cyclohexyl-1,2-diamine, N, N′-dimethylcyclohexyl-1,2-diamine and the like may be used as necessary.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And the like; and sulfoxides such as dimethyl sulfoxide. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction may be performed under an atmosphere of nitrogen, argon, or the like, if necessary.
In this reaction, preferably, compound (II) and compound (III) are dissolved in a solvent such as toluene, and N, N in the presence of a copper catalyst such as copper iodide and a base such as potassium carbonate, if necessary. '-Dimethylcyclohexyl-1,2-diamine is added and the reaction is performed in an atmosphere of argon or the like.
In this reaction, compound (III) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of starting compound (compound (II)), and a base is used. , About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, and about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents of palladium catalyst or copper catalyst. The phosphine ligand is used in an amount of about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents, and the cyclohexyl-1,2-diamine is about 0.01 to about 2 equivalents, Preferably, it is carried out using about 0.01 to about 1 equivalent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 50 ° C. to 150 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Manufacturing method A-2
The reaction of compound (II) and compound (III) can also be carried out without using a palladium catalyst or a copper catalyst.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salts; alkali metal hydrides such as sodium hydride and potassium hydride; sodium amides; alkali metal alkoxides such as sodium methoxide and sodium ethoxide; amines such as trimethylamine, triethylamine and diisopropylamine; pyridine, 4-dimethylaminopyridine And cyclic amines such as 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU).
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And the like; and sulfoxides such as dimethyl sulfoxide. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction may be performed under an atmosphere of nitrogen, argon, or the like, if necessary.
This reaction is preferably carried out by dissolving compound (II) and compound (III) in a solvent such as 1-methyl-2-pyrrolidinone and in the presence of a base such as sodium hydride.
In this reaction, compound (III) is usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of starting compound (compound (II)), It is carried out using 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 50 ° C. to 150 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Manufacturing method B
Compound (I ₀ ) is, for example,
Compound (IVa) or Compound (IVb):

(Wherein each symbol has the same meaning as above) compound (V):

(The symbols in the formula are as defined above).

Manufacturing method B-1
In the production method B, for example, the compound (IVa) or the compound (IVb) is reacted with the compound (V) using an acid, if necessary, to give a compound (VIa) or a compound (VIb):

(The symbols in the formula have the same meanings as described above) and then cyclization is carried out using a dehydration condensing agent or an activator as necessary.
Examples of the acid used as necessary in the reaction of compound (IVa) or compound (IVb) with compound (V) include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron fluoride. An acid etc. are mentioned.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And ketones; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by mixing compound (IVa) or compound (IVb) and compound (V) in a solvent such as toluene.
In this reaction, compound (V) is usually used in an amount of usually about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of raw material compound (compound (IVa) or compound (IVb)). Done. When an acid is used, the amount is usually about 0.1 to excess, preferably about 0.1 to about 10 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.
The intramolecular cyclization reaction of compound (VIa) or compound (VIb) is performed, for example, by intramolecular dehydration condensation.
Examples of the “dehydration condensation agent or activator” used as necessary in the intramolecular cyclization reaction of compound (VIa) or compound (VIb) include, for example, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid Acids such as acetic acid chloride, propionic acid chloride and benzoic acid chloride; sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine Tetrabutylammonium bromide; sodium acetate; Burgess reagent; N, N'-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N'- Carbonyldiimidazole, 1H-benzoto Azol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate, O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2 -Condensing agents such as chloro-1,3-dimethylimidazolium chloride and bromotripyrrolidinophosphonium hexafluorophosphate; Lawson's reagent and the like.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And ketones; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out in the presence of Lawesson's reagent by dissolving compound (VIa) or compound (VIb) in a solvent such as tetrahydrofuran.
In this reaction, preferably, about 1 to about 10 equivalents, preferably about 1 to about 5 equivalents of the dehydration condensing agent or activator is usually used per 1 mol of the starting compound (compound (VIa) or compound (VIb)). Performed using equivalent amounts. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Manufacturing method B-2
The reaction of compound (IVa) or compound (IVb) with compound (V) can be carried out in one step using, for example, a dehydration condensing agent or an activator as necessary.
Examples of the “dehydration condensing agent or activator” used as necessary in this reaction include acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron trifluoride; acetic acid Acid halides such as chloride, propionic acid chloride, benzoic acid chloride; bases such as sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine; tetrabutylammonium bromide; sodium acetate; Burgess Reagent; N, N′-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N′-carbonyldiimidazole, 1H-benzotriazol-1-yloxy Tris (Dimethyla F) Phosphonium hexafluorophosphate, O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3-dimethylimidazo Condensing agents such as lithium chloride and bromotripyrrolidinophosphonium hexafluorophosphate; and Lawson's reagent.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And ketones; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (IVa) or compound (IVb) and compound (V) in a solvent such as ethanol, and optionally in the presence of p-toluenesulfonic acid or the like.
In this reaction, compound (V) is usually used in an amount of usually about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of raw material compound (compound (IVa) or compound (IVb)). Done. When a dehydrating condensing agent or activator is used, the amount used is usually about 1 to about 10 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (Ia)>
Manufacturing method C
Compound (I ₀ ) is Compound (Ia):

(Wherein the symbols in the formula are as defined above), the compound (I ₀ ) is, for example,
Compound (VII):

(Wherein, Xa represents a sulfonyl group such as p-toluenesulfonyloxy group, methanesulfonyloxy group, trifluoromethanesulfonyloxy group, or an acyl group such as acetyl group, and other symbols are as defined above). It can be produced by intramolecular cyclization.
The intramolecular cyclization reaction of compound (VII) is performed using, for example, a nucleophile and a base, or using only an inorganic base.
Examples of the nucleophile used in this reaction include amines such as methylamine, ethylamine, isopropylamine, and benzylamine.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salts; alkali metal hydrides such as sodium hydride and potassium hydride; sodium amides; alkali metal alkoxides such as sodium methoxide and sodium ethoxide; amines such as trimethylamine, triethylamine and diisopropylamine; pyridine, 4-dimethylaminopyridine And cyclic amines such as 2,6-lutidine and 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU).
Examples of the inorganic base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate Cesium salts of sodium hydride; alkali metal hydrides such as sodium hydride and potassium hydride; sodium amides; alkali metal alkoxides such as sodium methoxide and sodium ethoxide.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And the like; and sulfoxides such as dimethyl sulfoxide. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably performed in the presence of a base such as 2,6-lutidine by dissolving compound (VII) and a nucleophile such as benzylamine in a solvent such as N, N-dimethylformamide.
In this reaction, the nucleophilic agent is usually about 1 to about 10 mol, preferably about 1 to about 5 mol, and the base is usually about 1 to About 10 equivalents, preferably about 1 to about 5 equivalents are used. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Manufacturing method D
Compound (I ₀ ) is Compound (Ia):

(Wherein the symbols in the formula are as defined above), the compound (I ₀ ) is, for example,
Compound (VIII):

(Wherein each symbol has the same meaning as described above) can be produced by intramolecular cyclization.
Manufacturing method D-1
The intramolecular cyclization reaction of compound (VIII) is performed by using, for example, phosphines and azocarboxylic acid esters.
Examples of phosphines used in this reaction include triphenylphosphine and tributylphosphine.
Examples of azocarboxylic acid esters used in this reaction include diethyl azodicarboxylate and diisopropyl azodicarboxylate.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; halogenation such as chloroform and dichloromethane Hydrocarbons; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Ketones such as acetone and 2-butanone; Dimethyl sulfoxide and the like And sulfoxides. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (VIII) and a phosphine such as triphenylphosphine in a solvent such as tetrahydrofuran and using an azocarboxylic acid ester such as diethyl azodicarboxylate.
In this reaction, phosphines are usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, and azocarboxylic acid esters are usually used with respect to 1 mol of the starting compound (compound (VIII)). , About 1 to about 10 moles, preferably about 1 to about 5 moles. The reaction temperature is usually -78 ° C to 100 ° C, preferably -78 ° C to 30 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

Manufacturing method D-2
The intramolecular cyclization reaction of compound (VIII) may be performed, for example, under acidic conditions.
Examples of the acid used in this reaction include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron fluoride acid.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone Ketones such as sulfoxides such as dimethyl sulfoxide; acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid and the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (VIII) in a solvent such as methanol and, if necessary, in the presence of p-toluenesulfonic acid or the like.
This reaction is preferably carried out using usually about 0.1 to about 10 moles, preferably about 0.1 to about 5 moles of acid per mole of starting compound (compound (VIII)). An acid may be used as a solvent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 25 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (Ib)>
Manufacturing method E
Compound (I ₀ ) is Compound (Ib):

(Wherein ring A and ring B represent an optionally substituted benzene ring or an optionally substituted monocyclic aromatic heterocycle, and Y ^a represents —NR ^a —, —O—, Or -S- (wherein R ^a represents a hydrogen atom or an optionally substituted hydrocarbon group), and other symbols are as defined above), the compound (I ₀ ) is, for example,
Compound (Ic):

(Wherein X represents a leaving group, and other symbols are as defined above) compound (IIIa):

(In the formula, each symbol has the same meaning as described above).
Examples of the “leaving group” represented by X include halogen atoms; sulfonyloxy groups such as p-toluenesulfonyloxy group, methanesulfonyloxy group, trifluoromethanesulfonyloxy group, etc., preferably chlorine, bromine And halogen atoms such as iodine.

Manufacturing method E-1
The reaction between compound (Ic) and compound (IIIa) is performed using, for example, a base and a palladium catalyst or a copper catalyst. A phosphine ligand may be used as necessary.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salt; alkali metal hydride such as sodium hydride and potassium hydride; sodium amide; alkali metal alkoxide such as sodium methoxide, sodium ethoxide and sodium t-butoxide; amine such as trimethylamine, triethylamine and diisopropylamine; pyridine, And cyclic amines such as 4-dimethylaminopyridine and 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU).
Examples of the palladium catalyst used in this reaction include tetrakis (triphenylphosphine) palladium (0), bis (triphenylphosphine) palladium (II) dichloride, tris (dibenzylideneacetone) dipalladium (0), trans -Dichlorobis (tri-o-tolylphosphine) palladium (II), palladium (II) trifluoroacetate, palladium (II) acetate and the like.
Examples of the copper catalyst used in this reaction include copper iodide, copper bromide, copper chloride, copper acetate and the like.
Examples of the phosphine ligand used in this reaction include triphenylphosphine, 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl, 2- (di-tert-butylphosphino) biphenyl, 2- (Dicyclohexylphosphino) biphenyl, 2- (dicyclohexylphosphino) -2 ′, 6′-dimethoxy-1,1′-biphenyl, 2- (dicyclohexylphosphino) -2 ′,-4 ′, 6′-triisopropyl -1,1′-biphenyl, 2- (dicyclohexylphosphino) -2 ′-(N, N-dimethylamino) biphenyl, 1,1′-bis (diphenylphosphino) ferrocene, tri-tert-butylphosphine, tri And cyclohexylphosphine.
In this reaction, for example, cyclohexyl-1,2-diamine, N, N′-dimethylcyclohexyl-1,2-diamine and the like may be used as necessary.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And the like; and sulfoxides such as dimethyl sulfoxide. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction may be performed under an atmosphere of nitrogen, argon, or the like, if necessary.
In this reaction, compound (IIIa) is usually used in an amount of about 0.5 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of starting compound (compound (Ic)), and a base is used. , About 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents, and about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents of palladium catalyst or copper catalyst. The phosphine ligand is used in an amount of about 0.01 to about 2 equivalents, preferably about 0.01 to about 0.5 equivalents, and the cyclohexyl-1,2-diamine is about 0.01 to about 2 equivalents, Preferably, it is carried out using about 0.01 to about 1 equivalent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 50 ° C. to 150 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Manufacturing method E-2
The reaction of compound (Ic) and compound (IIIa) can also be carried out without using a palladium catalyst or a copper catalyst.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salts; alkali metal hydrides such as sodium hydride and potassium hydride; sodium amides; alkali metal alkoxides such as sodium methoxide and sodium ethoxide; amines such as trimethylamine, triethylamine and diisopropylamine; pyridine, 4-dimethylaminopyridine And cyclic amines such as 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU).
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And the like; and sulfoxides such as dimethyl sulfoxide. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction may be performed under an atmosphere of nitrogen, argon, or the like, if necessary.
In this reaction, compound (IIIa) is usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of starting compound (compound (Ic)), It is carried out using 0.1 to about 100 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 50 ° C. to 150 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (II)>
The compound (II) is, for example,
Compound (IX):

(Wherein R ^6a and R ^6b are each independently an alkyl group such as a methyl group or an ethyl group, and R ^6a and R ^6b together form a 4- to 8-membered ring; Other symbols are as defined above, and hydrazine can be produced.
The reaction of compound (IX) may be performed using an acid or the like as necessary.
Examples of the acid used in this reaction include p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boron fluoride acid.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone Ketones such as sulfoxides such as dimethyl sulfoxide; acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid and the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (IX) in a solvent such as ethanol and, if necessary, in the presence of p-toluenesulfonic acid or the like.
This reaction is preferably carried out using usually about 0.1 to about 10 moles, preferably about 0.1 to about 5 moles of acid per mole of starting compound (compound (IX)). An acid may be used as a solvent. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (VII)>
The compound (VII) can be produced, for example, by reacting the compound (VIII) with a sulfonylating agent.
The reaction of compound (VIII) is performed using a base.
Examples of the sulfonylating agent used in this reaction include sulfonyl chlorides such as methanesulfonyl chloride, trifluoromethanesulfonyl chloride, p-toluenesulfonyl chloride; methanesulfonic anhydride, trifluoromethanesulfonic anhydride, p-toluenesulfone. Examples thereof include sulfonic acid anhydrides such as acid anhydrides.
Examples of the base used in this reaction include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide; alkali metal hydrogen carbonates such as sodium hydrogen carbonate; alkali metal carbonates such as sodium carbonate and potassium carbonate; cesium carbonate and the like. Cesium salts; alkali metal hydrides such as sodium hydride and potassium hydride; sodium amides; alkali metal alkoxides such as sodium methoxide and sodium ethoxide; amines such as trimethylamine, triethylamine and diisopropylamine; pyridine, 4-dimethylaminopyridine And cyclic amines such as 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU).
This reaction can be performed in a solvent, if necessary. Examples of the solvent include ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; halogenated carbonization such as chloroform and dichloromethane. Hydrogen; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Ketones such as acetone and 2-butanone; Sulfoxides such as dimethyl sulfoxide And the like. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (VIII) in a solvent such as dichloromethane and using a sulfonylating agent such as methanesulfonyl chloride and a base such as 2,6-lutidine.
In this reaction, the sulfonylating agent is usually used in an amount of about 1 to about 10 equivalents, preferably about 1 to about 5 equivalents, and the base is usually about 1 mol, relative to 1 mol of the starting compound (compound (VIII)). It is carried out using 1 to about 10 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (VIII)>
Compound (VIII) is, for example, compound (Xa) or compound (Xb):

(Each symbol in the formula has the same meaning as described above) and compound (V) can be produced.
The reaction between the compound (Xa) or the compound (Xb) and the compound (V) is performed using, for example, a dehydration condensing agent or an activator as necessary.
Examples of the “dehydration condensing agent or activator” used as necessary in this reaction include acids such as p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, hydrochloric acid, sulfuric acid, and boroboric acid; , Acid halides such as propionic acid chloride and benzoic acid chloride; sodium methoxide, potassium tert-butoxide, sodium hydride, potassium carbonate, cesium carbonate, triethylamine, diisopropylamine and other bases, tetrabutylammonium bromide, sodium acetate, Burgess reagent N, N′-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N′-carbonyldiimidazole, 1H-benzotriazol-1-yloxytris (Dimethylamino ) Phosphonium hexafluorophosphate, O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU), 2-chloro-1,3-dimethylimidazolium Condensing agents such as chloride and bromotripyrrolidinophosphonium hexafluorophosphate; and Lawson's reagent.
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And ketones; sulfoxides such as dimethyl sulfoxide; acids such as acetic acid and hydrochloric acid. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (Xa) or compound (Xb) and compound (V) in a solvent such as methanol, and if necessary, in the presence of p-toluenesulfonic acid or the like.
In this reaction, compound (V) is usually used in an amount of about 1 to about 10 mol, preferably about 1 to about 5 mol, relative to 1 mol of starting compound (compound (Xa) or compound (Xb)). Done. When a dehydrating condensing agent or activator is used, the amount used is usually about 1 to about 10 equivalents, preferably about 1 to about 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

<Production of Compound (IX)>
The compound (IX) is, for example,
Compound (XI):

(Each symbol in the formula is as defined above)
Compound (XII):

(In the formula, each symbol has the same meaning as described above).
This reaction can be performed in a solvent, if necessary. Examples of the solvent include water; alcohols such as methanol and ethanol; ethers such as diethyl ether, 1,4-dioxane and tetrahydrofuran; aromatic hydrocarbons such as benzene, toluene and xylene; esters such as ethyl acetate; Halogenated hydrocarbons such as chloroform and dichloromethane; Nitriles such as acetonitrile; Amides such as N, N-dimethylformamide, N, N-dimethylacetamide and 1-methyl-2-pyrrolidinone; Acetone and 2-butanone And the like; and sulfoxides such as dimethyl sulfoxide. These solvents may be used alone or in a mixture of two or more at an appropriate ratio.
This reaction is preferably carried out by dissolving compound (XI) in a solvent such as dichloromethane and reacting with compound (XII).
This reaction is preferably carried out using compound (XII) usually in an amount of about 0.5 to about 10 equivalents, preferably about 1 to about 5 equivalents, relative to 1 mol of the starting compound (compound (XI)). The reaction temperature is generally −78 ° C. to 100 ° C., preferably −40 ° C. to 50 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.1 to about 50 hours.

In the compounds (I ₀ ) and (Ia) thus obtained, the functional group in the molecule can be converted to the target functional group by combining known chemical reactions. Examples of the chemical reaction include an oxidation reaction, a reduction reaction, an alkylation reaction, a hydrolysis reaction, an amination reaction, an amidation reaction, an esterification reaction, an aryl coupling reaction, and a deprotection reaction.
In each of the above reactions, when the raw material compound has an amino group, a carboxy group, a hydroxy group, or a carbonyl group as a substituent, a protective group generally used in peptide chemistry or the like is introduced into these groups. In addition, the target compound can be obtained by removing the protecting group as necessary after the reaction.
Examples of the amino-protecting group include, for example, formyl, C _1-10 alkylcarbonyl (eg, acetyl, ethylcarbonyl, etc.), phenylcarbonyl, C _1-6 alkoxy-carbonyl (optionally substituted). Examples thereof include methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), phenyloxycarbonyl, C _7-16 aralkyl-carbonyl (eg, benzylcarbonyl), trityl, phthaloyl, N, N-dimethylaminomethylene and the like. . Substituents for the “amino-protecting group” include halogen atoms (eg, fluorine, chlorine, bromine, iodine), C _1-10 alkyl-carbonyl (eg, methylcarbonyl, ethylcarbonyl, butylcarbonyl, etc.), and The number of substituents including a nitro group is 1 to several (eg, 3).
Examples of the protecting group for the carboxy group include a C _1-10 alkyl group, a C _7-16 aralkyl group (eg, benzyl), a phenyl group, a trityl group, a substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl), C _2-10 alkenyl groups (eg, 1-allyl), and the like. These groups may be substituted with 1 to 3 halogen atoms, C _1-6 alkoxy groups, nitro groups and the like.
Examples of the protecting group for the hydroxy group include a C _1-10 alkyl group, a phenyl group, a trityl group, a C _7-16 aralkyl group (eg, benzyl), a formyl group, a C _1-10 alkyl-carbonyl group, a benzoyl group, C _7-16 aralkyl-carbonyl group (eg, benzylcarbonyl), 2-tetrahydropyranyl group, 2-tetrahydrofuranyl group, substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert - butyldiethylsilyl), and _{C 3-10} alkenyl groups (e.g., 1-allyl) and the like. These groups may be substituted with 1 to 3 halogen atoms, a C _1-10 alkyl group, a C _1-6 alkoxy group, a nitro group and the like.
Examples of the protecting group for the carbonyl group include cyclic acetals (eg, 1,3-dioxane), acyclic acetals (eg, di-C _1-10 alkylacetal) and the like.
The method for removing the protecting group can be carried out according to a known method such as the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980). For example, a method using acid, base, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate, trialkylsilyl halide (eg, trimethylsilyl iodide, trimethylsilyl bromide), A reduction method or the like is used.
Compounds (I ₀ ) and (Ia) can be isolated and purified by known means such as solvent extraction, liquid conversion, phase transfer, concentration, concentration under reduced pressure, crystallization, recrystallization, chromatography and the like. The starting compounds of the compounds (I ₀ ) and (Ia) or salts thereof can be isolated and purified by the same known means as described above. It may be provided as a raw material.

In any case, a known deprotection reaction, acylation reaction, alkylation reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbon chain extension reaction or substituent exchange reaction may be carried out singly or in combination, as desired. By combining the above, compound (I ₀ ) can be synthesized.
When the compound (I ₀ ) has an isomer such as an optical isomer, a stereoisomer, a positional isomer, a rotational isomer, etc., any one of the isomers and a mixture are included in the compound (I ₀ ). . For example, when compound (I ₀ ) has an optical isomer, the optical isomer resolved from the racemate is also encompassed in compound (I ₀ ). Each of these isomers can be obtained as a single product by a known synthesis method or separation method (concentration, concentration under reduced pressure, solvent extraction, column chromatography, recrystallization, etc.).

Compound (I ₀ ) may be a crystal, and is included in compound (I ₀ ) regardless of whether it is a single crystal form or a mixture of crystal forms. Crystals can be produced by crystallization by applying a crystallization method known per se.
Compound (I ₀ ) may be a pharmaceutically acceptable cocrystal or cocrystal salt. Here, co-crystals or co-crystal salts are two or more unique at room temperature, each having different physical properties (eg structure, melting point, heat of fusion, hygroscopicity, solubility and stability). Means a crystalline substance composed of a solid. The cocrystal or cocrystal salt can be produced according to a cocrystallization method known per se.
Compound (I ₀ ) may be a solvate (eg, hydrate etc.) or a solvate (eg anhydride), and both are encompassed in compound (I ₀ ). The
A compound labeled or substituted with an isotope (eg, ² H, ³ H, ¹⁴ C, ³⁵ S, ¹²⁵ I and the like) is also encompassed in the compound (I ₀ ) and the like.

The compound of the present invention having an excellent AMPA receptor function-enhancing action is effective against mammals (eg, mouse, rat, hamster, rabbit, cat, dog, cow, sheep, monkey, human, etc.)
(1) Psychiatric disorders [eg, depression, major depression, bipolar depression, mood disorders, affective disorders (such as seasonal affective disorders), recurrent depression, postpartum depression, stress disorder, depressive symptoms, Gonorrhea, anxiety, generalized anxiety disorder, anxiety syndrome, panic disorder, phobia, social phobia, social anxiety disorder, obsessive compulsive disorder, post-traumatic stress syndrome, post-traumatic stress disorder, taurette syndrome, autism , Adaptation disorder, bipolar disorder, neurosis, schizophrenia (schizophrenia), neurosis, chronic fatigue syndrome, anxiety, obsessive-compulsive disorder, panic disorder, epilepsy, anxiety symptoms, uncomfortable mental state, emotional abnormalities , Emotional circulation temperament, nervousness, fainting, sputum, decreased libido, attention deficit hyperactivity disorder (ADHD), psychotic major depression, refractory major depression, treatment-resistant depression],
(2) Neurodegenerative diseases [eg, Alzheimer's disease, Alzheimer type senile dementia, Parkinson's disease, Huntington's chorea, multiple cerebral infarction dementia, frontotemporal dementia, Parkinson's type frontotemporal dementia, progressive nucleus Upper palsy, Pick syndrome, Niemann-Pick syndrome, cerebral cortex basal degeneration, Down syndrome, vascular dementia, Parkinson's disease after encephalitis, Lewy body dementia, HIV dementia, amyotrophic spinal cord sclerosis (ALS), motor neurogenic disease (MND), Creutzfeldt-Jakob disease or prion disease, cerebral palsy, progressive supranuclear palsy, multiple sclerosis],
(3) Cognitive / memory impairment associated with aging [eg, age-related memory impairment, senile dementia]
(4) Sleep disorders [eg, intrinsic sleep disorders (eg, psychophysiological insomnia, etc.), extrinsic sleep disorders, circadian rhythm disorders (eg, time zone change syndrome (time difference blur), shift work sleep disorders) , Irregular sleep-wake patterns, sleep phase regression syndrome, sleep phase advance syndrome, non-24-hour sleep awakening, etc.), parasomnia, internal or psychiatric disorders (eg, chronic obstructive pulmonary disease, Alzheimer's disease, Parkinson's disease) , Cerebrovascular dementia, schizophrenia, depression, anxiety), sleep disorders associated with stress insomnia, insomnia, insomnia, sleep apnea syndrome],
(5) Respiratory depression caused by anesthetics, traumatic diseases, or neurodegenerative diseases,
(6) Traumatic brain injury, anorexia nervosa, eating disorders, anorexia nervosa, bulimia, other eating disorders, alcoholism, alcohol abuse, alcoholic amnesia, alcohol paranoia, alcohol preference Sex, alcohol withdrawal, alcoholic psychosis, alcoholism, alcoholic manic, alcoholic manic, alcohol-dependent mental disorder, alcohol psychosis, drug preference, drug phobia, drug craving, drug withdrawal, migraine, stress headache, tension Headache, diabetic neuropathy, obesity, diabetes, muscle spasm, Meniere's disease, autonomic ataxia, alopecia, glaucoma, hypertension, heart disease, tachycardia, congestive heart failure, hyperventilation, bronchial asthma, apnea, sudden infants Death syndrome, inflammatory disease, allergic disease, impotence, menopause, infertility, cancer, immunodeficiency syndrome due to HIV infection, Immunodeficiency syndrome due to loess, encephalomyelitis, acromegaly, incontinence, metabolic syndrome, osteoporosis, peptic ulcer, irritable bowel syndrome, inflammatory bowel disease, ulcerative colitis, Crohn's disease, stress gastrointestinal It is useful as a prophylactic / therapeutic agent for diseases such as disorders, neurogenic vomiting, peptic ulcer, diarrhea, constipation, postoperative ileus, and stress gastrointestinal disorders.
The compound of the present invention is particularly useful as a prophylactic / therapeutic agent for diseases such as depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).

Since the compound of the present invention has an excellent AMPA receptor function enhancing action, an excellent therapeutic effect on the above diseases can be expected.

The compound of the present invention has low toxicity (for example, it is superior as a pharmaceutical from the viewpoint of acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, drug interaction, carcinogenicity, etc.), and it is used as it is as a pharmaceutical. Or mammals (eg, humans, monkeys, cows, horses, pigs, mice, rats, hamsters, rabbits, cats, dogs, sheep, goats, etc.) as pharmaceutical compositions mixed with pharmaceutically acceptable carriers, etc. ) Can be safely administered orally or parenterally.
The medicament containing the compound of the present invention is pharmaceutically acceptable in accordance with a method known per se as a method for producing a pharmaceutical preparation (eg, a method described in the Japanese Pharmacopoeia, etc.) alone or with the compound of the present invention. It can be used as a pharmaceutical composition mixed with a carrier. Examples of the medicament containing the compound of the present invention include tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (soft capsules, microcapsules). Capsules), lozenges, syrups, solutions, emulsions, suspensions, controlled-release formulations (eg, immediate-release formulations, sustained-release formulations, sustained-release microcapsules), aerosols, films ( E.g., orally disintegrating film, buccal mucosa adhesive film), injection (eg, subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), instillation, transdermal preparation, ointment, Lotions, patches, suppositories (eg, rectal suppositories, vaginal suppositories), pellets, nasal preparations, pulmonary preparations (inhalants), eye drops, etc., orally or parenterally (eg, intravenously) Intramuscular, subcutaneous, organ, intranasal, intradermal, eye drop, brain , It can be safely administered rectally, intravaginally, intraperitoneally, lesion, etc.).

The dose of the compound of the present invention varies depending on the administration route, symptoms and the like. For example, when administered orally to a schizophrenic patient (adult, body weight 40 to 80 kg, eg 60 kg), for example, 0.001 to 1000 mg per day. / Kg body weight, preferably 0.01 to 100 mg / kg body weight per day, more preferably 0.1 to 10 mg / kg body weight per day. This amount can be administered in 1 to 3 divided doses per day.

As the above-mentioned “pharmaceutically acceptable carrier”, various organic or inorganic carriers commonly used as starting materials are used. For example, in solid preparations, excipients, lubricants, binders and disintegrants are used, and in liquid preparations, solvents, solubilizers, suspending agents, isotonic agents, buffering agents, and the like Soothing agents and the like are used. If necessary, preparation additives such as preservatives, antioxidants, colorants, sweeteners and the like can also be used.

The pharmaceutical composition varies depending on the dosage form, administration method, carrier, etc., but the compound of the present invention is usually 0.01 to 100% (w / w), preferably 0.1 to 95% (w / W), it can be produced according to a conventional method.

The compound of the present invention may be used in combination with other active ingredients (hereinafter abbreviated as concomitant drugs).

Examples of the concomitant drug include the following.
Benzodiazepines (chlordiazepoxide, diazepam, potassium chlorazebuate, lorazepam, clonazepam, alprazolam, etc.), L-type calcium channel inhibitors (pregabalin, etc.), tricyclic or tetracyclic antidepressants (imipramine hydrochloride, amitriptyline hydrochloride, desipramine hydrochloride, Clomipramine hydrochloride, etc.), selective serotonin reuptake inhibitors (fluvoxamine maleate, floxetine hydrochloride, citalopram hydrochloride, sertraline hydrochloride, paroxetine hydrochloride, escitalopram oxalate, etc.), serotonin-noradrenaline reuptake inhibitors (venlafaxine hydrochloride, hydrochloric acid) Duroxetine, desvenlafaxine hydrochloride, etc.), noradrenaline reuptake inhibitors (eg, reboxetine mesylate), mirtazapine, trazodone hydrochloride, nefazodone hydrochloride, Acid bupropion, setiptiline maleate, _{5-HT 1A} agonists, (buspirone hydrochloride, tandospirone citrate, such as hydrochloric acid Osemozotan), 5-HT ₃ antagonist (Cyamemazine, etc.), cardiac selective and no β inhibitors (propranolol hydrochloride, Oxyprenolol hydrochloride, etc.), histamine H ₁ antagonists (hydroxyzine hydrochloride, etc.), schizophrenia drugs (chlorpromazine, haloperidol, sulprid, clozapine, trifluoperazine hydrochloride, fluphenazine hydrochloride, olanzapine, quetiapine fumarate, risperidone , Aripiprazole, etc.), CRF antagonists, other anxiolytic drugs (meprobamate, etc.), tachykinin antagonists (MK-869, saledurant etc.), drugs acting on metabotropic glutamate receptors, CCK antagonists, β3 adrenergic antagonists ( Hydrochloric acid Beglon, etc.), GAT-1 inhibitors (tiagabine hydrochloride, etc.), N-type calcium channel inhibitors, type 2 carbonic anhydrase inhibitors, NMDA glycine site agonists, NMDA antagonists (memantine, etc.), peripheral benzodiazepine receptors Body agonist, vasopressin antagonist, vasopressin V1b antagonist, vasopressin V1a antagonist, phosphodiesterase inhibitor, opioid antagonist, opioid agonist, uridine, nicotinic acid receptor agonist, thyroid hormone (T3, T4), TSH, TRH, MAO inhibitor (phenelzine sulfate, tranylcypromine sulfate, moclobemide, etc.), 5-HT _2A antagonist, 5-HT _2A inverse agonist, COMT inhibitor (entacapone, etc.), bipolar disorder treatment (lithium carbonate, Sodium valproate, lamotrigine, riluzole, fe Rubamate, etc.), cannabinoid CB1 antagonists (such as rimonabant), FAAH inhibitors, sodium channel inhibitors, anti-ADHD drugs (methylphenidate hydrochloride, methamphetamine hydrochloride, etc.), drugs for alcoholism, drugs for autism, chronic fatigue Syndrome treatment, spasm treatment, fibromyalgia treatment, headache treatment, insomnia treatment (etizolam, zopiclone, triazolam, zolpidem, ramelteon, indiplon, etc.), smoking cessation treatment, myasthenia gravis treatment Medicine, cerebral infarction medicine, gonorrhea medicine, hypersomnia medicine, pain medicine, mood dysfunction medicine, autonomic dysfunction medicine, male and female sexual dysfunction medicine, migraine medicine, disease Gambling treatment, restless leg syndrome, substance dependence treatment, alcohol-related treatment, irritable bowel syndrome treatment, Alzheimer Therapeutic drugs (donepezil, galantamine, memantine, etc.), Parkinson's disease drugs, ALS drugs (riluzole, neurotrophic factors, etc.), dyslipidemic drugs such as cholesterol-lowering drugs (statin series (pravastatin sodium, atorvastatin, Simvastatin, rosuvastatin, etc.), fibrates (clofibrate, etc.), squalene synthesis inhibitors), abnormal behavioral treatments or dementia wandering inhibitors (sedatives, anxiolytics, etc.), apoptosis inhibitors, antiobesity agents, Diabetes treatment, hypertension treatment, hypotension treatment, rheumatism treatment (DMARD), anticancer agent, parathyroid treatment (PTH), calcium receptor antagonist, sex hormone or derivatives thereof (progesterone, estradiol, estradiol benzoate, etc.) ), Nerve differentiation-promoting drug, nerve re- Promoters, non-steroidal anti-inflammatory drugs (meloxicam, tenoxicam, indomethacin, ibuprofen, celecoxib, rofecoxib, aspirin, indomethacin, etc.), steroids (dexamethasone, cortisone acetate, etc.), anti-cytokine drugs (TNF inhibitors, MAP kinase inhibitors, etc.) ), Antibody drugs, nucleic acids or nucleic acid derivatives, aptamer drugs and the like.

By combining the compound of the present invention and a concomitant drug,
(1) Compared with the case where the compound of the present invention or the concomitant drug is administered alone, the dose can be reduced.
(2) The drug used in combination with the compound of the present invention can be selected according to the patient's symptoms (mild, severe, etc.),
(3) By selecting a concomitant drug having a different mechanism of action from the compound of the present invention, the treatment period can be set longer.
(4) By selecting a concomitant drug having a different mechanism of action from the compound of the present invention, the therapeutic effect can be sustained.
(5) By using the compound of the present invention in combination with a concomitant drug, excellent effects such as a synergistic effect can be obtained.

Hereinafter, the combined use of the compound of the present invention and the concomitant drug is referred to as “the combination drug of the present invention”.
When using the concomitant drug of the present invention, the timing of administration of the compound of the present invention and the concomitant drug is not limited, and the compound of the present invention or the pharmaceutical composition thereof and the concomitant drug or the pharmaceutical composition thereof are administered to an administration subject They may be administered at the same time or may be administered with a time difference. The dose of the concomitant drug may be determined according to the dose used clinically, and can be appropriately selected depending on the administration subject, administration route, disease, combination and the like.
The administration mode of the concomitant drug of the present invention is not particularly limited as long as the compound of the present invention and the concomitant drug are combined at the time of administration. Examples of such dosage forms include (1) administration of a single preparation obtained by simultaneously formulating the compound of the present invention and a concomitant drug, and (2) separate preparation of the compound of the present invention and the concomitant drug. (2) The same route of administration of the two preparations obtained by separately formulating the compound of the present invention and the concomitant drug. (4) Simultaneous administration by different administration routes of two preparations obtained by separately formulating the compound of the present invention and a concomitant drug, (5) Concomitant use with the compound of the present invention Administration of two preparations obtained by separately formulating a drug at different time intervals by different administration routes (for example, the compound of the present invention; administration in the order of concomitant drugs, or administration in the reverse order) Etc.

The concomitant drug of the present invention has low toxicity. For example, the compound of the present invention or (and) the above concomitant drug is mixed with a pharmacologically acceptable carrier according to a known method, for example, a pharmaceutical composition such as a tablet (sugar-coated tablet). , Including film-coated tablets), powders, granules, capsules (including soft capsules), liquids, injections, suppositories, sustained-release agents, etc., orally or parenterally (eg, topical, rectal, intravenous) Administration, etc.). An injection can be administered intravenously, intramuscularly, subcutaneously, or into an organ, or directly to a lesion.
Examples of the pharmacologically acceptable carrier that may be used in the production of the concomitant drug of the present invention include various organic or inorganic carrier substances commonly used as a pharmaceutical material. For example, in solid preparations, excipients, lubricants, binders and disintegrants can be used. In liquid preparations, solvents, solubilizers, suspending agents, tonicity agents, buffers, soothing agents, and the like can be used. If necessary, additives such as conventional preservatives, antioxidants, colorants, sweeteners, adsorbents, wetting agents and the like can be used in appropriate amounts.

The compounding ratio of the compound of the present invention and the concomitant drug in the concomitant drug of the present invention can be appropriately selected depending on the administration subject, administration route, disease and the like.
For example, the content of the compound of the present invention in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, based on the whole preparation. More preferably, it is about 0.5 to 20% by weight.
The content of the concomitant drug in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, more preferably about the whole preparation. About 0.5 to 20% by weight.
The content of additives such as carriers in the combination agent of the present invention varies depending on the form of the preparation, but is usually about 1 to 99.99% by weight, preferably about 10 to 90% by weight, based on the whole preparation. .
The same content may be used when the compound of the present invention and the concomitant drug are formulated separately.

Hereinafter, the present invention will be described more specifically with reference to Reference Examples, Examples, Formulation Examples and Experimental Examples, but the present invention is not limited thereto.
“Room temperature” in the following Reference Examples and Examples usually indicates about 10 ° C. to about 35 ° C. “%” Indicates weight percent unless otherwise specified. Other abbreviations used in the text have the following meanings. s is a singlet, d is a doublet, t is a triplet, q is a quartet, m is a multiplet, br is broad, and J is a coupling constant (coupling) constant).

The meanings of the abbreviations in Examples and Reference Examples are as follows.
LC-MS: liquid chromatography-mass spectrometry spectrum ESI: electrospray ionization method TLC: thin layer chromatography DCM: dichloromethane DMF: N, N-dimethylformamide THF: tetrahydrofuran EDCI: 1-ethyl-3- (3-dimethylamino Propyl) carbodiimide PE: petroleum ether DMSO: dimethyl sulfoxide
HOBt: 1-hydroxybenzotriazole DIEA: N, N-diisopropylethylamine DIAD: azodicarboxylic acid diisopropyl LDA: lithium diisopropylamide M: molar concentration N: specified

The LC-MS analysis in the following examples was measured under the following conditions.
HPLC part: Agilent 1200
MS Department: Agilent 6300
Column: Welchrom XB-C18, 5 μm, 4.6 × 50 mm
Solvent: Liquid A; Water, Liquid B; Acetonitrile Gradient Cycle: 0.00 min (A liquid / B liquid = 95/5), 6.00 min (A liquid / B liquid = 5/95), 6.50 Minutes (A liquid / B liquid = 5/95); or 0.00 minutes (A liquid / B liquid = 90/10), 6.00 minutes (A liquid / B liquid = 5/95), 6.50 minutes (A liquid / B liquid = 5/95); or 0.00 minutes (A liquid / B liquid = 80/20), 6.00 minutes (A liquid / B liquid = 5/95), 6.50 minutes ( A liquid / B liquid = 5/95); or 0.00 minutes (A liquid / B liquid = 70/30), 6.00 minutes (A liquid / B liquid = 5/95), 6.50 minutes (A Liquid / B liquid = 5/95); or 0.00 minutes (A liquid / B liquid = 60/40), 6.00 minutes (A liquid / B liquid = 5/95), 6.50 minutes (A liquid) / B liquid = 5/95); or 0.00 minutes (A liquid / B liquid = 50/50), 6.00 minutes (A liquid / B liquid = 5/95), 6.50 minutes ( A liquid / B liquid = 5/95); or 0.00 minutes (A liquid / B liquid = 40/60), 6.00 minutes (A liquid / B liquid = 5/95), 6.50 minutes (A Liquid / B liquid = 5/95)
Flow rate: 1.5 mL / min, detection method: UV214 or 254 nm
Ionization method: ESI

Further, purification by preparative HPLC in the following examples was carried out under the following conditions.
[conditions]
Equipment: Gilson purification system Column: Welchrom XB-C18, 5 μm, 150 × 20 mm
Solvent: Solution A; 0.1% trifluoroacetic acid-containing acetonitrile, Solution B; 0.1% trifluoroacetic acid-containing water gradient cycle: 0.00 min (A solution / B solution = 10/90), 5.00 Minutes (A liquid / B liquid = 10/90), 20.00 minutes (A liquid / B liquid = 70/30), 25.00 minutes (A liquid / B liquid = 70/30), 30.00 minutes ( A liquid / B liquid = 10/90); or 0.00 minutes (A liquid / B liquid = 10/90), 5.00 minutes (A liquid / B liquid = 10/90), 20.00 minutes (A Liquid / B liquid = 80/20), 25.00 minutes (A liquid / B liquid = 80/20), 30.00 minutes (A liquid / B liquid = 10/90); etc. Flow rate: 25 mL / min, detection Method: UV220nm

Reference example 1
1- [1-acetyl-3- (pyrrolidin-1-yl) -1,4,5,6-tetrahydropyridin-2-yl] -2,2,2-trifluoroethanone Crude 1- [5- To a mixture of (pyrrolidin-1-yl) -3,4-dihydropyridin-1 (2H) -yl] ethanone (approximately 7.1 mmol) and DCM (30 mL) at −20 ° C., N-methyl-N- [1 -(Trifluoroacetyl) pyridine-4 (1H) -2,5-dien-1-ylidene] methanaminium trifluoroacetate (4.0 g, 12 mmol) was added and the mixture was allowed to reach room temperature overnight. . The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to give the title compound as a brown residue, which was directly used in the next step.

Reference example 2
1- [3- (Trifluoromethyl) -1,5,6,7-tetrahydro-4H-pyrazolo [4,3-b] pyridin-4-yl] ethanone 1- [1-acetyl-3- (pyrrolidine- 1-yl) -1,4,5,6-tetrahydropyridin-2-yl] -2,2,2-trifluoroethanone (approximately 3.5 mmol) and hydrazine monohydrate in absolute ethanol (15 mL) (110 μL, 3.5 mmol) and p-toluenesulfonic acid monohydrate (67 mg, 0.35 mmol) were added and refluxed for 6 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by flash column chromatography [developing solvent: DCM-methanol (100: 0-97: 3)] to give a brown residue (about 500 mg). Dissolved in diethyl ether (1 mL), PE (4 mL) was added. The precipitate was washed with DCM (0.5 mL) to give the title compound (124 mg).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ 1.85-1.91 (m, 2H), 2.10 (br s, 3H), 2.76 (t, J = 6.9 Hz, 2H), 3.66 (br s, 2H) , 13.25 (br s, 1H).

Reference example 3
3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [4,3-b] pyridine 1- [3- (trifluoromethyl) -1,5,6,7-tetrahydro- To 4H-pyrazolo [4,3-b] pyridin-4-yl] ethanone (90 mg, 0.39 mmol) was added 1.0 M superhydride / THF solution (trade name, 2.5 mL, 2.5 mmol), and methanol ( 1 mL) and silica gel were added. The reaction mixture was concentrated under reduced pressure and purified by silica gel flash chromatography [developing solvent: DCM-methanol (100: 0-97: 3)] to give the title compound (67 mg, 92%) as a white solid.
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.93-1.99 (m, 2H), 2.74 (t, J = 6.5 Hz, 2H), 3.22 (bt, J = 5.5 Hz, 3H).

Reference example 4
3- (2,2,2-trifluoro-1-hydroxyethylidene) piperidin-2-one 2-oxopiperidinecarboxylate tert-butyl (5000 mg, 25 mmol) dissolved in dimethoxyethane (50 mL) The resulting solution was cooled to -78 ° C. 1M lithium hexamethyldisilazide / THF solution (30 mL, 30 mmol) was added dropwise and stirred for about 1 hour, and then ethyl trifluoroacetate (3.9 mL, 33 mmol) was added dropwise. After stirring at -78 ° C for 1 hour, the mixture was stirred at room temperature for about 2 hours. The reaction mixture was poured into an aqueous ammonium chloride solution, extracted with ethyl acetate, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: PE-DCM (1: 1)] to obtain the product (3260 mg, yield 44%) as a white solid. The obtained solid was dissolved in ethyl acetate (50 mL), and a 4 N hydrogen chloride / ethyl acetate solution (20 mL) solution was added. The mixture was stirred at room temperature for 5 hours and concentrated in vacuo. The residue was poured into a mixture of aqueous sodium carbonate and aqueous ammonia (3: 1, 40 mL) and extracted with ethyl acetate (50 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The crude product was suspended in ether, filtered, washed with ether and dried to give the title compound (1850 mg, 86% yield) as a colorless gel.
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.84-1.92 (m, 2H), 2.56-2.62 (m, 2H), 3.35-3.40 (m, 2H), 5.99 (br s, 1H), 15.31 (m , 1H).

Reference Example 5
4-amino-N, N-dimethylbenzamide of 4-aminobenzoic acid (100.0 g, 0.73 mol), dimethylamine hydrochloride (356.9 g, 4.38 mol), triethylamine (516.0 g, 5.11 mol) and DMF (1500 mL) To the mixture was added HOBt (295.6 g, 2.19 mol) and EDCI (420.5 g, 2.19 mol) at room temperature. The mixture was stirred at room temperature for 2 days. The solvent was distilled off under reduced pressure. The residue was poured into an aqueous sodium hydrogen carbonate solution (1000 mL) and extracted with DCM (1000 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: PE-DCM (1: 4)] to give the title compound (35.9 g, yield 30%) as a brown solid.
MS Calcd .: 164; MS Found: 165 (M + H).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ 2.95 (s, 6 H), 5.47 (s, 2 H), 6.51 (d, J = 8.4 Hz, 2 H), 7.23 (d, J = 8.4 Hz, 2 H).

Reference Example 6
4-Hydrazinyl-N, N-dimethylbenzamide To a solution of 4-amino-N, N-dimethylbenzamide (25.0 g, 152 mmol) in concentrated hydrochloric acid (120 mL) and water (80 mL) was added sodium nitrite (10.6 g , 153 mmol) in water (74 mL) was added dropwise at about -3 ° C. After further stirring at this temperature for 30 minutes, a solution of tin chloride dihydrate (120.0 g, 532 mmol) in concentrated hydrochloric acid (120 mL) was added dropwise at about −10 ° C. After stirring for 1 hour, the reaction mixture was allowed to reach room temperature. The mixture was cooled again, and a 50% aqueous sodium hydroxide solution (197 mL) was gradually added to make it basic. The resulting precipitate was collected by filtration and added to a mixture of THF and 5 N aqueous sodium hydroxide (2: 1). The aqueous layer was extracted 3 times with THF, and the combined organic layers were concentrated under reduced pressure. DCM-ethyl acetate was added to the residue, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain a free form of the title compound. Hydrogen chloride / ethyl acetate solution was added to the resulting free form, and the solvent was removed under reduced pressure. The obtained crude crystals were recrystallized from methanol to obtain the hydrochloride of the title compound (21.3 g, yield 65%) as a white solid.
MS Calcd .: 179; MS Found: 180 (M + H).
¹ H NMR (300 MHz, D ₂ O): δ 3.02-3.08 (m, 6 H), 7.06 (d, J = 8.1 Hz, 2 H), 7.44-7.47 (m, 2 H).
Ethyl acetate (50 mL) was added to a solution of the obtained hydrochloride (1.0 g, 4.65 mmol) in water (1 mL). The mixture was cooled to 0 ° C. and saturated aqueous sodium carbonate solution (5 mL) was added dropwise. After stirring vigorously for 10 minutes, anhydrous sodium sulfate (10 g) was added, and the mixture was filtered and concentrated under reduced pressure. Ethyl acetate (20 mL) was added to the obtained solid residue, and the mixture was pulverized using ultrasonic waves. The mixture was concentrated under reduced pressure to give the title compound (541 mg, yield 65%) as a yellow oil.

Reference Example 7
3- (2,2,2-trifluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one A mixture of valerolactone (10.6 g, 106 mmol) and THF (300 mL) was cannulated at -78 ° C. A cold solution of LDA (127 mmol) in THF (200 mL) was added. After 15 minutes, 2,2,2-trifluoroethyl 2,2,2-trifluoroacetic acid (25.0 g, 127 mmol) was added dropwise over 5 minutes. After 25 minutes, the reaction solution was poured into 5% hydrochloric acid (500 mL). The obtained aqueous solution was extracted with diethyl ether (200 mL × 2). The combined organic layers were washed with water (200 mL), brine (200 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (18.7 g, 90% yield) as a pink solid Obtained.
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.93-2.01 (m, 2H), 2.63-2.68 (m, 2H), 4.34-4.43 (m, 2H), 13.94 (br s, 1H).

Reference Example 8
4- [5-Hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] -N, N-dimethylbenzamide 3- (2,2,2-trifluoro -1-hydroxyethylidene) tetrahydro-2H-pyran-2-one (1.4 g, 7.2 mmol), 4-hydrazinyl-N, N-dimethylbenzamide (1.3 g, 7.2 mmol), p-toluenesulfonic anhydride (140 mg, 0.7 mmol) and benzene (50 mL) were refluxed for 4 hours. The reaction mixture was concentrated under reduced pressure, and the residue was washed with PE (5 mL) to give the title compound (2.08 g, yield 81%) as a white hygroscopic powder.
MS Calcd .: 357; MS Found: 358 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.79 (q, J = 6.0 Hz, 2H), 2.65 (t, J = 6.3 Hz, 2H), 3.00 (bs, 3H), 3.14 (bs, 3H), 3.64 (t, J = 5.7 Hz, 2H), 7.42 (d, J = 8.7 Hz, 2H), 7.82 (d, J = 8.7 Hz, 2H).

Reference Example 9
Concentrated sulfuric acid (6.3 mL) was added to a solution of methyl (4-aminophenyl) acetate (4-aminophenyl) acetic acid (15.63 g, 103.5 mmol) in methanol (32 mL), and the mixture was refluxed for 4 hours. The reaction mixture was extracted with ethyl acetate (200 mL), washed with water (200 mL) and saturated aqueous sodium bicarbonate solution (100 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (16.5 g, Yield 97%).
¹ H NMR (300 MHz, CDCl3): δ 3.51 (s, 2H), 3.63 (br s, 2H), 3.65 (s, 3H), 6.65 (d, J = 11.4 Hz, 2H), 7.05 (d, J = 11.4 Hz, 2H).

Reference Example 10
(4-Hydrazinylphenyl) acetic acid hydrochloride hydrochloride To a solution of (4-aminophenyl) acetic acid (16.5 g, 100 mmol) cooled to −5 ° C. in concentrated hydrochloric acid (50 mL), 2N aqueous sodium nitrite solution: (50 mL, 100 mmol) was added dropwise. The reaction mixture was stirred for 15 minutes, and then a solution of tin chloride dihydrate (67.50 g, 300 mmol) in concentrated hydrochloric acid (200 mL) was added dropwise at 0 ° C. over 1 hour. The mixture was stirred at room temperature for 1 hour. The reaction mixture was collected by filtration and washed with water to give the title compound (3.00 g, yield 14%) as a yellow solid.
¹ H NMR (400 MHz, DMSO-d6): δ 3.47 (s, 3H), 3.58 (s, 2H), 6.93-6.98 (m, 2H), 7.11-7.15 (m, 2H), 10.36 (br s, 3H).

Reference Example 11
{4- [5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] phenyl} methyl acetate (4-hydrazinylphenyl) methyl acetate hydrochloride ( 3.00 g, 13.9 mmol), 3- (2,2,2-trifluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one (2.70 g, 13.9 mmol) in methanol (150 mL) overnight Refluxed. After allowing to cool, the mixture was concentrated under reduced pressure to give a crude product of the title compound (853 mg, yield 17%) as a yellow solid.
¹ H NMR (400 MHz, CDCl3): δ 1.83-1.87 (m, 2H), 2.36 (t, J = 7.2 Hz, 1H), 2.70 (t, J = 6.4 Hz, 2H), 3.65 (t, J = 7.2 Hz, 2H), 3.70 (s, 2H), 3.73 (s, 3H), 7.35 (d, J = 8.4 Hz, 2H), 7.72 (d, J = 8.4 Hz, 2H).

Reference Example 12
1- (4-Bromophenyl) -4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol 3- (2,2,2-trimethyl) obtained in Reference Example 7 Fluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one (6.1 g, 31.1 mmol), 4-bromophenylhydrazine hydrochloride (6.95 g, 31.1 mmol), p-toluenesulfonic acid monohydrate (590 mg, 3.1 mmol) and toluene (200 mL) were refluxed for 24 hours. Water and ethyl acetate were added to the reaction mixture, the aqueous layer was extracted with ethyl acetate, and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 2)] to give the title compound (6.56 g, 58%) as a dark brown amorphous.
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.86 (2H, dt, J = 12.1, 6.0 Hz), 2.68-2.76 (2H, m), 3.76-3.83 (2H, m), 7.52-7.59 (2H, m), 7.66-7.73 (2H, m) (No two "OH group" peaks were observed).

Reference Example 13
1- (4-Bromophenyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 1- (4-Bromophenyl) obtained in Reference Example 12 ) -4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol (6.56 g, 18.0 mmol) and triphenylphosphine (6.30 g, 24.0 mmol) in THF (200 mL) DIAD (4.85 g, 24.0 mmol) was added to the solution at −78 ° C., and the temperature was gradually returned from −78 ° C. to room temperature with stirring, followed by stirring at room temperature overnight. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-3: 1)] to give the title compound (1.20 g, yield 11%). Was obtained as a light brown solid.
MS Calcd .: 347, 349; MS Found: 347, 349 (M +).
^{1 H NMR (300 MHz, CDCl} 3): δ 2.00 - 2.10 (2H, m), 2.71 (2H, t, J = 6.2 Hz), 4.36 - 4.43 (2H, m), 7.51 - 7.58 (2H, m) , 7.64-7.70 (2H, m).

Reference Example 14
1- (3-Bromophenyl) -4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol 3- (2,2,2-trimethyl) obtained in Reference Example 7 Fluoro-1-hydroxyethylidene) tetrahydro-2H-pyran-2-one (4.1 g, 21.2 mmol), 3-bromophenylhydrazine hydrochloride (4.70 g, 21.1 mmol), p-toluenesulfonic acid monohydrate (400 mg, 2.1 mmol) and toluene (200 mL) were refluxed for 24 hours. Water and ethyl acetate were added to the reaction mixture, the aqueous layer was extracted with ethyl acetate, and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 2)] to give the title compound (4.33 g, 56%) as a dark brown amorphous product.
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.86 (2 H, dt, J = 12.1, 6.0 Hz), 2.69-2.76 (2 H, m), 3.80 (2 H, t, J = 5.8 Hz), 7.27-7.34 (1 H, m), 7.41-7.46 (1 H, m), 7.77 (1 H, dq, J = 8.2, 0.9 Hz), 8.01 (1 H, t, J = 1.9 Hz) (2 The peak of “OH group” was not observed.)

Reference Example 15
1- (3-bromophenyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 1- (3-bromophenyl obtained in Reference Example 14 ) -4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol (4.33 g, 11.8 mmol) and triphenylphosphine (4.67 g, 17.8 mmol) in THF (200 mL) DIAD (3.60 g, 17.8 mmol) was added to the solution at −78 ° C., and the temperature was gradually returned from −78 ° C. to room temperature with stirring, followed by stirring at room temperature overnight. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (6: 1)] to give the title compound (3.43 g, yield 83%) as a pale brown oil. Obtained as a thing.
MS Calcd .: 347, 349; MS Found: 347, 349 (M +).
¹ H NMR (300 MHz, CDCl ₃ ): δ 2.00-2.10 (2 H, m), 2.71 (2 H, t, J = 6.0 Hz), 4.38-4.44 (2 H, m), 7.29-7.33 (1 H, m), 7.39-7.45 (1 H, m), 7.72-7.77 (1 H, m), 7.98 (1 H, t, J = 2.1 Hz).

Reference Example 16
4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-5-ol 3- (2,2,2-trifluoro-1-hydroxyethylidene) tetrahydro- obtained in Reference Example 7 2H-pyran-2-one (43.1 g, 220 mmol), hydrazine monohydrate (14.3 g, 286 mmol), p-toluenesulfonic acid monohydrate (2.09 g, 11 mmol) and toluene (400 mL) The mixture was heated and stirred at 80 ° C. for 4 hours under a nitrogen atmosphere. Water and ethyl acetate were added to the reaction mixture, and then the aqueous layer was extracted with an ethyl acetate / THF mixed solvent (3: 1), and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by recrystallization from THF-ethyl acetate-hexane to give the title compound (24.0 g, 52%) as pink crystals.
¹ H NMR (300 MHz, DMSO-d ₆ ): δ 1.46-1.69 (2H, m), 2.36 (2H, t, J = 7.8Hz), 3.38 (2H, t, J = 6.6Hz), 12.66 (1H , d, J = 0.8 Hz) (No two “OH group” peaks were observed).

Reference Example 17
3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 4- (3-hydroxypropyl) -3- (trifluoromethyl) obtained in Reference Example 16 -1H-pyrazol-5-ol (24.0 g, 114 mmol), triphenylphosphine (45.0 g, 171 mmol) and ammonium chloride (12.2 g, 228 mmol) in THF (750 mL) in diethyl azodicarboxylate (DEAD) (2.2M toluene solution, 78 mL, 171 mmol) was added dropwise over 40 minutes, followed by stirring at room temperature for 4 hours. Water and ethyl acetate were added to the reaction mixture, and then the aqueous layer was extracted with an ethyl acetate / THF mixed solvent (3: 1), and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was saturated with hot ethyl acetate, and white needle crystals formed by standing at room temperature were filtered off. The residue obtained by concentrating the filtrate was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (84: 16-67: 33)] to give the title compound (20.0 g, yield 91%) as yellow Obtained as crystals.
MS Calcd .: 192; MS Found: 193 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.95-2.04 (2H, m), 2.66 (2H, t, J = 6.4Hz), 4.20-4.36 (2H, m), 9.67 (1H, brs).

Reference Example 18
1- (6-Chloropyridin-2-yl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole 3- ( (Trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (0.38 g, 2.0 mmol) in DMF (3 mL) at room temperature with sodium hydride (60% oily, 80 mg, 2.0 mmol) was added, and the mixture was stirred at room temperature for 30 minutes. Then, 2,6-dichloropyridine (1.37 g, 9.3 mmol) was added, and the mixture was heated with stirring at 120 ° C. for 48 hours. Water and ethyl acetate were added to the reaction mixture, and the aqueous layer was extracted with ethyl acetate. The combined organic layers were washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: hexane-ethyl acetate (6: 1)] to give the title compound (142 mg, 23%) as a white solid.
MS Calcd .: 303; MS Found: 304 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 2.00-2.12 (2H, m), 2.70 (2H, t, J = 6.2 Hz), 4.40-4.48 (2H, m), 7.29 (1H, d, J = 1.1 Hz), 7.61-7.90 (2H, m).

Example 1
4- [4-Acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [4,3-b] pyridin-1-yl] -N, N-dimethylbenzamide

1- [3- (Trifluoromethyl) -1,5,6,7-tetrahydro-4H-pyrazolo [4,3-b] pyridin-4-yl] ethanone (84 mg, 0.36 mmol) and toluene (4 mL ) Under a argon atmosphere, (4-iodophenyl) -N, N-dimethylcarboxamide (118 mg, 0.36 mmol), trans-N, N′-dimethylcyclohexane-1,2-diamine (18 mg, 0.145 mmol), copper (I) iodide (7 mg, 0.036 mmol) and potassium carbonate (104 mg, 0.76 mmol) were added and the mixture was refluxed for 3 hours. After cooling, the mixture was diluted with ethyl acetate (40 mL), washed with 2N hydrochloric acid (2 mL), water (5 mL), brine (5 mL), and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: DCM-methanol (97: 3)] to give the title compound (85 mg, 62%) as a white solid.
MS Calcd .: 380; MS Found: 381 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 2.03-2.06 (m, 2H), 2.26 (br s, 3H), 2.89 (t, J = 6.9 Hz, 2H), 2.99 (br s, 3H), 3.13 (Br s, 3H), 3.77 (br s, 2H), 7.55 (br s, 4H).

Example 2
N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [4,3-b] pyridin-1-yl] benzamide

To a mixture of 3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [4,3-b] pyridine (64 mg, 0.33 mmol) and toluene (4 mL) under an argon atmosphere , (4-iodophenyl) -N, N-dimethylcarboxamide (106 mg, 0.33 mmol), trans-N, N'-dimethylcyclohexane-1,2-diamine (19 mg, 0.13 mmol), copper iodide (I ) (6 mg, 0.033 mmol) and potassium carbonate (95 mg, 0.70 mmol) were added. The mixture was passed through silica gel [developing solvent: DCM-methanol (95: 5)] and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: DCM-methanol (98: 2)] to give the title compound (91 mg, 81%) as a yellow oil.
MS Calcd .: 338; MS Found: 339 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.91-1.98 (m, 2H), 2.83 (t, J = 6.3 Hz, 2H), 2.99 (br s, 3H), 3.12 (br s, 3H), 3.26 (T, J = 5.4 Hz, 2H), 3.50 (bs, 1H), 7.49-7.58 (m, 4H).

Example 3
N, N-dimethyl-4- [4-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [4,3-b] pyridin-1-yl] benzamide

N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [4,3-b] pyridin-1-yl] benzamide (54 mg, 0.160 mmol ) And DMF (1.4 mL) were added sodium hydride (60% oil dispersion: 10 mg, 0.36 mmol), and after 5 minutes, 0.38 M iodomethane DMF solution (0.5 mL, 0.19 mmol) was added. After 48 hours, water (10 mL) and DCM (20 mL) were added. The aqueous layer was extracted twice with DCM (10 mL), and the combined organic layers were washed with brine (10 mL) and concentrated under reduced pressure. The residue was purified by preparative HPLC to give the title compound (16 mg, 28%) as a yellow oil.
MS Calcd .: 352; MS Found: 353 (M + H).
^{1 H NMR (300 MHz, CDCl} 3): δ 1.91-1.96 (m, 2H), 2.75 (t, J = 6.6 Hz, 2H), 2.83 (s, 3H), 2.99 (br s, 3H), 3.04 ( t, J = 5.4 Hz, 2H), 3.12 (br s, 3H), 7.50-7.57 (m, 4H).

Example 4
4- [3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzoic acid

A mixture of 3- (2,2,2-trifluoro-1-hydroxyethylidene) piperidin-2-one (1.0 g, 5.1 mmol), 4-hydrazinobenzoic acid (870 mg, 5.8 mmol) and toluene (50 mL) The solution was concentrated under reduced pressure at 55 ° C., and this operation was repeated once more. THF (50 mL) and Lawesson's reagent (2.3 g, 5.8 mmol) were added and the mixture was stirred at room temperature for 15 minutes and at 55 ° C. for 5 hours. The reaction solution was cooled to room temperature and silica gel (15 g) was added. The mixture was concentrated under reduced pressure and washed with acetic acid / ethyl acetate / PE (2:18:80). The solution was concentrated under reduced pressure, and the residue was purified by silica gel flash chromatography [developing solvent: acetic acid-ethyl acetate-PE (0: 10: 90-2: 13: 85)] to give the title compound (1.1 g, yield 69). %) As a yellow solid.
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.92-1.96 (m, 2H), 2.69 (t, J = 6.2 Hz, 2H), 3.22-3.36 (m, 2H), 5.74 (br s, 2H), 7.77 (d, J = 8.7 Hz, 2H), 8.20 (d, J = 8.7 Hz, 2H).

Example 5
N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzamide

4- [3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzoic acid (1.1 g, 3.5 mmol) and DCM (35 mL) at 0 ° C. with DIEA (3.7 mL, 21.2 mmol), dimethylamine hydrochloride (860 mg, 10.6 mmol), HOBt (1.4 g, 10.6 mmol), and EDCI (2.1 g, 10.6 mmol). added. After stirring overnight at room temperature, the reaction mixture was washed with saturated aqueous sodium hydrogen carbonate solution (20 mL). The aqueous layer was extracted twice with ethyl acetate (50 mL). The organic layer was washed with water (20 mL), 1N hydrochloric acid (20 mL), water (20 mL), saturated aqueous sodium hydrogen carbonate (10 mL), and brine (30 mL), dried over anhydrous sodium sulfate, Filtration and concentration under reduced pressure gave the title compound (980 mg, yield 82%). The residue was purified by silica gel flash chromatography [developing solvent: DCM-methanol (100: 0-98: 2)] to obtain a white powder.
MS Calcd .: 338; MS Found: 339 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.90-1.96 (m, 2H), 2.67 (t, J = 6.3 Hz, 2H), 2.97 (br s, 3H), 3.10 (br s, 3H), 3.28 -3.33 (m, 2H), 3.99 (br s, 1H), 7.50 (d, J = 8.7 Hz, 2H), 7.64 (d, J = 8.7 Hz, 2H).

Example 6
4- [7-Ethyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] -N, N-dimethylbenzamide

N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzamide (100 mg, 0.295 mmol ), Ethyl bromide (39 mg, 0.355 mmol) in anhydrous DMF (1 mL), sodium hydride (60% oil dispersion: 18 mg, 0.443 mmol) was added and the mixture was stirred at 35 ° C. overnight. did. The reaction solution was poured into ice water (20 mL) and extracted with ether (20 mL × 2). The combined organic layers were dried over anhydrous sodium sulfate and passed through silica gel [developing solvent: DCM-methanol (10: 1)] to obtain the title compound (60 mg, yield 56%) as a white solid.
MS Calcd .: 366; MS Found: 367 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 0.97 (t, J = 6.9 Hz, 3H), 1.71-1.81 (m, 2H), 2.65 (t, J = 6.0 Hz, 2H), 2.72 (q, J = 6.9 Hz, 2H), 2.98 (s, 3H), 3.12 (s, 3H), 3.14-3.18 (m, 2H), 7.51 (dd, J = 6.6, 1.8 Hz, 2H), 7.75 (d, J = (6.6, 1.8 Hz, 2H).

Example 7
4- [7- (Cyclopropylmethyl) -3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] -N, N- Dimethylbenzamide

N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzamide (100 mg, 0.295 mmol ), Bromocyclopropylmethane (48 mg, 0.355 mmol) and tetra (tert-butyl) ammonium iodide (12 mg, 0.035 mmol) in anhydrous DMF (1 mL) and sodium hydride (18 mg, 0.443 mmol). ) And stirred at 35 ° C. overnight. The reaction solution was poured into ice water (20 mL) and extracted with ether (20 mL × 2). The combined organic layers were dried over anhydrous sodium sulfate and passed through silica gel [developing solvent: DCM-methanol (10: 1)] to give the title compound (16 mg, yield 14%) as a white solid.
MS Calcd .: 392; MS Found: 393 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ -0.05-0.02 (m, 2H), 0.36-0.45 (m, 2H), 0.81-0.90 (m, 1H), 1.75-1.91 (m, 2H), 2.59 (D, J = 6.3 Hz, 2H), 2.64 (t, J = 6.3 Hz, 2H), 2.97 (s, 3H), 3.12 (s, 3H), 3.32-3.37 (m, 2H), 7.51 (d, J = 8.4 Hz, 2H), 7.81 (d, J = 8.4 Hz, 2H).

Example 8
4- [7-Acetyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] -N, N-dimethylbenzamide

N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzamide (100 mg, 0.295 mmol ) And acetic anhydride (48 mg, 0.355 mmol) in anhydrous DMF (1 mL), sodium hydride (60% oil dispersion: 18 mg, 0.443 mmol) was added and the mixture was stirred at 35 ° C. overnight. . The reaction solution was poured into ice water (20 mL) and extracted with ether (20 mL × 2). The combined organic layers were dried over anhydrous sodium sulfate and passed through silica gel [developing solvent: DCM-methanol (10: 1)] to give the title compound (21 mg, yield 17%) as a white solid.
MS Calcd .: 380; MS Found: 381 (M + H).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ 1.92 (br s, 2H), 2.10 (br s, 3H), 2.72 (t, J = 6.6 Hz, 2H), 2.91 (s, 3H), 2.99 (S, 3H), 3.88 (br s, 2H), 7.41-7.66 (m, 4H).

Example 9
N, N-dimethyl-4- [7-methyl-3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzamide

N, N-dimethyl-4- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-pyrazolo [3,4-b] pyridin-1-yl] benzamide (100 mg, 0.30 mmol ) And DMF (1 mL) at 0 ° C. was added sodium hydride (60% oil dispersion: 18 mg, 0.45 mmol). After 10 minutes, 0.36 M methyl iodide / DMF solution (1 mL, 0.36 mmol) was added and the mixture was stirred at 35 ° C. overnight. Water (10 mL) was added to the reaction mixture, filtered and washed twice with water (2 mL). The precipitated solid was dissolved in ethyl acetate (20 mL), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. PE (1 mL) was added to the residue, the mixture was pulverized using ultrasonic waves, dissolved in methanol (0.5 mL), and water (5 mL) was added. The precipitated solid was filtered, washed twice with water (1 mL), and dissolved in ethyl acetate (20 mL). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give the title compound (43 mg, yield 41%) as white crystals.
MS Calcd .: 352; MS Found: 353 (M + H).
^{1 H NMR (300 MHz, CDCl} 3): δ 1.76-1.85 (m, 2H), 2.49 (s, 3H), 2.65 (t, J = 6.3 Hz, 2H), 2.98 (br s, 3H), 3.12 ( br s, 3H), 3.13-3.16 (m, 2H), 7.50 (d, J = 8.7 Hz, 2H), 7.79 (d, J = 8.7 Hz, 2H).

Example 10
N, N-dimethyl-4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] benzamide

4- [5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] -N, N-dimethylbenzamide (357 mg, 1.0 mmol) and 2,6 -To a solution of lutidine (521 μL, 4.5 mmol) in DCM (5 mL) at 0 ° C. was added methanesulfonyl chloride (240 μL, 3.10 mmol). After stirring at room temperature overnight, 1N hydrochloric acid (5 mL) and DCM (30 mL) were added. The organic layer was washed with water (10 mL), brine (5 mL), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and 1- [4- (dimethylcarbamoyl) phenyl] -4- {3-[( Methylsulfonyl) oxy] propyl} -3- (trifluoromethyl) -1H-pyrazol-5-ylmethanesulfonic acid (480 mg, 82% yield) was obtained as a white solid.
Obtained methanesulfonic acid (240 mg, 0.465 mmol), benzylamine (55 mg, 0.513 mmol), 2,6-lutidine (150 mg, 1.40 mmol) in DMF (10 mL) at 50 ° C. overnight. Stir under a nitrogen atmosphere. The solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel chromatography [developing solvent: DCM-methanol (98: 2)] to give the title compound (60 mg, yield 18%). This compound was further purified by recrystallization using DCM and PE to obtain a white solid.
MS Calcd .: 339; MS Found: 340 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 2.06 (tt, J = 6.5, 5.1 Hz, 2H), 2.71 (t, J = 6.3 Hz, 2H), 2.97 (br s, 3H), 3.08 (br s , 3H), 4.41 (t, J = 5.1 Hz, 2H), 7.50 (d, J = 8.7 Hz, 2H), 7.83 (d, J = 8.7 Hz, 2H).

Example 11
{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} methyl acetate

{4- [5-hydroxy-4- (3-hydroxypropyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl] phenyl} methyl acetate (144 mg, 0.40 mmol) and triphenylphosphine (210 mg, 0.80 mmol) in THF (4.2 mL) was added DIAD (0.15 mL, 0.80 mmol), and the mixture was stirred at −78 ° C. for 1 hour. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography [developing solvent: PE-diethyl ether (7: 3)] to give the title compound (96 mg, yield 70%) as a white solid. Obtained.
¹ H NMR (400 MHz, CDCl ₃ ): δ 2.01-2.07 (m, 2H), 2.70 (t, J = 6.4 Hz, 2H), 3.65 (s, 2H), 3.69 (s, 3H), 4.37 (t , J = 5.2 Hz, 2H), 7.34 (d, J = 8.4 Hz, 2H), 7.71 (d, J = 8.4 Hz, 2H).

Example 12
{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetic acid

{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} methyl acetate (722 mg, 2.12 mmol) and lithium hydroxide monohydrate A mixed solution of the Japanese product (267 mg, 6.36 mmol) in THF (4.2 mL), methanol (4.2 mL) and water (2.1 mL) was stirred at room temperature for 1.5 hours. The solvent was distilled off under reduced pressure, and the resulting residue was washed with ethyl acetate (50 mL). The aqueous layer was neutralized with 1 N hydrochloric acid (20 mL) and extracted twice with ethyl acetate (10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the title compound (680 mg, yield 98%) as a white solid.
MS Calcd .: 326; MS Found: 327 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ 2.05-2.09 (m, 2H), 2.73 (t, J = 6.0 Hz, 2H), 3.70 (s, 2H), 4.40 (t, J = 5.2 Hz, 2H ), 7.38 (d, J = 8.0 Hz, 2H), 7.75 (d, J = 8.0 Hz, 2H).

Example 13
N-methyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide

{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetic acid (130 mg, 0.40 mmol) in DCM (2 mL) To the mixture, oxalyl chloride (0.052 mL, 0.60 mmol) and DMF (1 drop) were added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the resulting residue was dissolved in THF (2 mL). To a 40% aqueous methylamine solution (0.16 mL, 1.2 mmol) was added the THF solution of the acid chloride at room temperature, and the mixture was stirred at room temperature for 5 hours. The reaction mixture was washed with 1 N hydrochloric acid (10 mL). The aqueous layer was extracted twice with ethyl acetate (20 mL). The combined organic layers were washed with saturated sodium bicarbonate (20 mL) and water (20 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by preparative TLC [developing solvent: PE-ethyl acetate (1: 1)] to give the title compound (71 mg, yield 52%) as a white solid.
MS Calcd .: 339; MS Found: 340 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 2.02-2.10 (m, 2H), 2.72 (t, J = 6.6 Hz, 2H), 2.76 (d, J = 4.8 Hz, 3H), 3.60 (s), 4.38-4.42 (m, 2H), 5.41 (br s, 1H), 7.33 (dd, J = 6.9, 2.1 Hz, 2H); 7.75 (dd, J = 6.9, 2.1 Hz, 2H).

Example 14
N, N-dimethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide

{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetic acid (130 mg, 0.40 mmol) in DCM (4.2 mL) DIEA (0.44 mL, 2.40 mmol), dimethylamine hydrochloride (101 mg, 1.20 mmol), HOBt (165 mg, 1.20 mmol) and EDCI (248 mg, 1.20 mmol) at 0 ° C., and under nitrogen atmosphere, Stir at room temperature. Add DCM (20 mL) to the mixture and wash with saturated aqueous sodium carbonate (15 mL), water (30 mL), 1N hydrochloric acid (15 mL), saturated sodium bicarbonate (15 mL), and brine (15 mL). The extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by preparative TLC [developing solvent: PE-ethyl acetate (1: 1)] to obtain the title compound (94 mg, yield 67%) as a yellow solid.
MS Calcd .: 353; MS Found: 354 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ 2.05 (t, J = 5.6 Hz, 2H), 2.72 (t, J = 6.4 Hz, 2H), 2.98 (s, 3H), 3.01 (s, 3H), 3.75 (s, 2H), 4.39 (t, J = 5.2 Hz, 2H), 7.34 (d, J = 8.4 Hz, 2H), 7.71 (d, J = 8.4 Hz, 2H).

Example 15
N, N-diethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide

{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetic acid (130 mg, 0.40 mmol) in DCM (4.2 mL) DIEA (0.44 mL, 2.40 mmol), diethylamine hydrochloride (0.13 mL, 1.20 mmol), HOBt (165 mg, 1.20 mmol) and EDCI (248 mg, 1.20 mmol) at 0 ° C, and at room temperature under nitrogen atmosphere , Stirred. Add DCM (20 mL) to the reaction mixture and wash with saturated sodium bicarbonate (15 mL), water (30 mL), 1N hydrochloric acid (15 mL), saturated sodium bicarbonate (15 mL) and brine (15 mL). The extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by preparative TLC [developing solvent: PE-ethyl acetate (1: 1)] to obtain the title compound (92 mg, yield 59%) as a white solid.
MS Calcd .: 381; MS Found: 382 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ 1.11-1.16 (m, 6H), 2.03-2.08 (m, 2H), 2.72 (t, J = 6.0 Hz, 2H), 3.30 (q, J = 7.2 Hz , 2H), 3.41 (q, J = 7.2 Hz, 2H), 3.73 (s, 2H), 4.39 (t, J = 5.2 Hz, 2H), 7.35 (d, J = 8.4 Hz, 2H), 7.71 (d , J = 8.4 Hz, 2H).

Example 16
N- (1-Methylethyl) -2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide

{4- [3- (Trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetic acid (130 mg, 0.40 mmol) in DCM (4.2 mL) DIEA (0.44 mL, 2.40 mmol), isopropylamine (0.11 mL, 1.20 mmol), HOBt (165 mg, 1.20 mmol) and EDCI (248 mg, 1.20 mmol) at 0 ° C., and at room temperature under a nitrogen atmosphere. Stir overnight. Add DCM (20 mL) to the reaction mixture and wash with saturated sodium bicarbonate (15 mL), water (30 mL), 1N hydrochloric acid (15 mL), saturated sodium bicarbonate (15 mL) and brine (15 mL). The extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was purified by preparative TLC [developing solvent: PE-ethyl acetate (1: 1)] to obtain the title compound (103 mg, yield 70%) as a white solid.
MS Calcd .: 367; MS Found: 368 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ 1.10 (d, J = 6.4 Hz, 6H), 2.05-2.11 (m, 2H), 2.74 (t, J = 6.4 Hz, 2H), 3.59 (s, 2H ), 4.07-4.12 (m, 1H), 4.42 (t, J = 5.2 Hz, 2H), 5.15-5.18 (m, 1H), 7.35 (d, J = 8.4 Hz, 2H), 7.78 (d, J = (8.4 Hz, 2H).

Example 17
5-Chloro-2,4-dimethoxy-N- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} aniline

1- (4-Bromophenyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (0.35 g, 1.0 mmol) obtained in Reference Example 13 , 5-chloro-2,4-dimethoxyaniline (0.37 g, 2.0 mmol), (+/-)-2,2'-bis (diphenylphosphino) -1,1'-binaphthyl (180 mg, 0.3 mmol) , Tris (dibenzylideneacetone) dipalladium (0) (92 mg, 0.1 mmol) and sodium tert-butoxide (0.25 g, 2.6 mmol) in toluene (10 mL) at 80 ° C. for 72 hours under nitrogen atmosphere Stir with. Water and ethyl acetate were added to the reaction mixture, the aqueous layer was extracted with ethyl acetate, and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by basic silica gel chromatography [developing solvent: hexane-ethyl acetate (2: 1)], and further purified by recrystallization using hexane and ethyl acetate to give the title compound (0.19 g, 42%). Obtained as a white solid.
MS Calcd .: 453; MS Found: 454 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 1.99-2.09 (2H, m), 2.71 (2H, t, J = 6.2 Hz), 3.89 (3H, s), 3.90 (3H, s), 4.34-4.40 (2H, m), 5.84 (1H, brs), 6.58 (1H, s), 7.02-7.10 (2H, m), 7.28 (1H, s), 7.54-7.61 (2H, m).

Example 18
5-Chloro-2,4-dimethoxy-N- {3- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} aniline

1- (3-Bromophenyl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (0.35 g, 1.0 mmol) obtained in Reference Example 15 , 5-chloro-2,4-dimethoxyaniline (0.37 g, 2.0 mmol), (+/-)-2,2'-bis (diphenylphosphino) -1,1'-binaphthyl (180 mg, 0.3 mmol) , Tris (dibenzylideneacetone) dipalladium (0) (92 mg, 0.1 mmol) and sodium tert-butoxide (0.25 g, 2.6 mmol) in toluene (10 mL) at 80 ° C. for 18 hours under nitrogen atmosphere Stir with. Water and ethyl acetate were added to the reaction mixture, the aqueous layer was extracted with ethyl acetate, and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by basic silica gel chromatography [developing solvent: hexane-ethyl acetate (3: 1-2: 1)], and further purified by recrystallization using hexane and ethyl acetate to give the title compound (0.15 g, 33%) was obtained as a white solid.
MS Calcd .: 453; MS Found: 454 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ1.97-2.10 (2H, m), 2.70 (2H, t, J = 6.2 Hz), 3.89 (3H, s), 3.90 (3H, s), 4.37- 4.45 (2H, m), 5.95 (1H, s), 6.58 (1H, s), 6.93 (1H, dt, J = 6.9, 2.2 Hz), 7.27-7.35 (2H, m), 7.38 (1H, s) , 7.43-7.47 (1H, m).

Example 19
N- (5-Chloro-2,4-dimethoxyphenyl) -6- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] pyridine-2 -Amine

1- (6-chloropyridin-2-yl) -3- (trifluoromethyl) -1,4,5,6-tetrahydropyrano [2,3-c] pyrazole (0.14 g) obtained in Reference Example 18 0.46 mmol), 5-chloro-2,4-dimethoxyaniline (0.19 g, 1.0 mmol), (+/-)-2,2'-bis (diphenylphosphino) -1,1'-binaphthyl (93 mg 0.15 mmol), tris (dibenzylideneacetone) dipalladium (0) (46 mg, 0.05 mmol), and sodium tert-butoxide (125 mg, 1.3 mmol) in toluene (10 mL) at 80 ° C. for 18 hours. And stirred under a nitrogen atmosphere. Water and ethyl acetate were added to the reaction mixture, the aqueous layer was extracted with ethyl acetate, and the combined organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel chromatography [developing solvent: hexane-ethyl acetate (3: 1-2: 1)], and further purified by recrystallization using hexane and ethyl acetate to give the title compound (0.13 g, 62% ) Was obtained as a white solid.
MS Calcd .: 454; MS Found: 455 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ 2.03-2.16 (2H, m), 2.72 (2H, t, J = 6.2 Hz), 3.90 (3H, s), 3.92 (3H, s), 4.54-4.61 (2H, m), 6.54-6.61 (2H, m), 6.97 (1H, s), 7.21 (1H, d, J = 7.2 Hz), 7.55-7.64 (1H, m), 8.77 (1H, s).

Formulation Example 1
(1) 10.0 g of the compound of Example 1
(2) Lactose 70.0g
(3) Corn starch 50.0g
(4) 7.0g soluble starch
(5) Magnesium stearate 3.0 g

The compound of Example 1 (10.0 g) and magnesium stearate (3.0 g) are granulated with 70 ml of an aqueous solution of soluble starch (7.0 g as soluble starch), dried, lactose (70.0 g) and corn starch ( (Lactose, corn starch, soluble starch and magnesium stearate are all conforming to the 14th revised Japanese Pharmacopoeia). The mixture is compressed to obtain tablets.

Test example 1
(1) Construction of the expressed gene Human GluR1 flip cDNA is a PCR method using the forward primer ACTGAATTCGCCACCATGCAGCACATTTTTGCCTTCTTCTGC (SEQ ID NO: 1) and reverse primer CCGCGGCCGCTTACAATCCCGTGGCTCCCAAG (SEQ ID NO: 2) artificially synthesized using human brain-derived cDNA (BD Bioscience) as a template. Amplified by The amplified product was digested with restriction enzymes EcoRI and NotI (Takara Shuzo) and then integrated into the same site of pcDNA3.1 (+) (Invitrogen) to construct pcDNA3.1 (+) / human GluR1 flip gene. Human stargazin cDNA was amplified by PCR using a forward primer GGTCTCGAGGCCACCATGGGGCTGTTTGATCGAGGTGTTCA (SEQ ID NO: 3) and a reverse primer GTTGGATCCTTATACGGGGGTGGTCCGGCGGTTGGCTGTG (SEQ ID NO: 4) synthesized using human hippocampal cDNA as a template. The amplified product was digested with restriction enzymes XhoI and BamHI (Takara Shuzo) and then integrated into the same site of pcDNA3.1 (-) (Invitrogen) to construct pcDNA3.1 Zeo (-) / human stargazin gene.
(2) Construction of GluR1 flip / stargazin-expressing cells CHO that had been passaged in culture medium (Ham's F12 medium (Invitrogen) supplemented with 10% inactivated fetal bovine serum (Morgate) and penicillin, streptomycin (Invitrogen)) -K1 cells were detached using 0.05% trypsin diluted with D-PBS (-) and 0.53 mM EDTA (Invitrogen). The detached cells were suspended using a culture medium and collected by centrifugation at 1,000 rpm. The collected cells were resuspended with D-PBS (−) and added to a 0.4 cm electroporation cuvette (BioRad). pcDNA3.1 (+) / human GluR1 flip gene 5μg and pcDNA3.1 Zeo (-) / human stargazin gene 15μg were added and introduced into CHO-K1 cells using Gene Pulser II (BioRad) at 950μFd and 250mV did. Introduced cells are cultured overnight in culture medium, and the following day using selection medium (with zeocin (Invitrogen) added to the culture medium at 250 μg / mL) in 96 wells at 250 cells / well. Plates were seeded. Clones exhibiting drug resistance were selected, and GluR1 flip / stargazin expression clones were selected by the assay method using calcium influx as an index.
(3) AMPA receptor function-enhancing activity measurement method for compounds using calcium influx as an indicator CHO-K1 / GluR1 flip / stargazin-expressing cells are seeded on a 96-well black bottom transparent plate (coaster) at 2 × 10 ⁴ cells / well. The cells were cultured at 37 ° C. in a CO ₂ incubator (Sanyo) for 2 days. The medium of the cell plate was removed, and assay buffer A (D-MEM (Invitrogen), 0.1% BSA (Serogical Protein Inc.), 20 mM HEPES (Invitrogen)) was added to 50 μl / well. Furthermore, 50 μl / well of a calcium indicator (Calcium Kit II-Fluo4 for TKB, Dojindo Chemical) supplemented with 2.5 mM probenecid (Dojindo Chemical Co., Ltd.) was added and allowed to stand in a CO ₂ incubator at 37 ° C. for 1 hour. Set the cell plate in CellLux (PerkinElmer), and 50 μl of a mixture of 9 mM glutamic acid (final concentration 3 mM) and test compound diluted with assay buffer B (HBSS (Invitrogen), 0.1% BSA, 20 mM HEPES) and test compound. Compound concentration 30 μM) was added, and the change in fluorescence amount for 3 minutes was measured. 100% is defined as the amount of change in the fluorescence value of wells with final concentration of 3 mM glutamic acid and 300 μM cyclothiazide (TOCRIS), and 0% is defined as the amount of change in fluorescence value of wells with final concentration of 3 mM glutamic acid alone. Calculated by the formula.
Activity (%) = (XC) / (TC) x 100
T: Change in fluorescence value in wells with final concentration of 3 mM glutamic acid and 300 μM cyclothiazide
C: Change in fluorescence value of well with final concentration of 3 mM glutamic acid only
X: Change in fluorescence value of wells to which test compound was added

The results are shown in the following table.

The compound of the present invention is useful as a preventive or therapeutic agent for depression, schizophrenia, attention deficit hyperactivity disorder (ADHD) and the like.

SEQ ID NO: 1 is a forward primer for GluR1 flip cDNA.
SEQ ID NO: 2 is a reverse primer for GluR1 flip cDNA.
SEQ ID NO: 3 is a forward primer for stargazin cDNA cDNA.
SEQ ID NO: 4 is a reverse primer for stargazin cDNA cDNA.

Claims

formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent (excluding a phenyl group);
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents a substituted benzene ring or an optionally substituted monocyclic aromatic heterocyclic ring, and the benzene ring or the monocyclic aromatic heterocyclic ring is 2 When substituted with two or more substituents, two of them may be joined together to form an optionally substituted ring. ]
A compound represented by (provided that
4- {4-[(Benzyloxy) amino] -3- (difluoromethyl) -6,6-dimethyl-5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl} -2- Bromo-6-[(1-glycylpyrrolidin-3-yl) amino] benzamide,
4- {4-[(Benzyloxy) amino] -3,6,6-trimethyl-5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl} -2-[(2-hydroxy Cyclohexyl) amino] -6-methoxybenzamide and glycine 2-[(5- {4-[(benzyloxy) amino] -3- (hydroxymethyl) -5,6-dihydropyrano [2,3-c] pyrazole- Except for 1 (4H) -yl} -2-carbamoylpyridin-3-yl) amino] cyclohexyl ester. ) Or a salt thereof.
Partial structural formula of formula (I):

Is

Represents
R 1a and R 1b each independently represents an absence, a hydrogen atom, a C 1-10 alkyl group, or a C 1-10 alkyl-carbonyl group,
R 2a, R 2b, R 3a and R 3b independently represent a hydrogen atom,
R 4a and R 4b each independently represent an absence, a hydrogen atom, a C 1-10 alkyl group, a C 3-10 cycloalkyl-C 1-10 alkyl group, or a C 1-10 alkyl-carbonyl group. ,
R 5 represents a C 1-10 alkyl group substituted with a halogen atom, and Ar is
(1) (i) di-C 1-10 alkyl-carbamoyl group, (ii) carboxy group, (iii) C 1-10 alkoxy-carbonyl group, carboxy group, and mono or di-C 1-10 alkyl-carbamoyl A C 1-10 alkyl group substituted with one or more substituents selected from the group, and (iv) an amino group substituted with a phenyl group substituted with one or more substituents selected from a halogen atom and an alkoxy group A benzene ring substituted with one or more substituents selected from a group, or (2) an amino group substituted with a phenyl group substituted with one or more substituents selected from a halogen atom and an alkoxy group. The compound or a salt thereof according to claim 1, which is represented by a pyridine ring.
(1) Partial structural formula of formula (I):

But,

R 1a and R 1b each represents a hydrogen atom, and R 4a and R 4b are absent,
(2) Partial structural formula of formula (I):

But,

R 1a and R 1b each represents a hydrogen atom, and one of R 4a and R 4b is a hydrogen atom, a C 1-10 alkyl group, a C 3-10 cycloalkyl-C 1-10 Represents an alkyl group, or a C 1-10 alkyl-carbonyl group, the other is absent, and (3) a partial structural formula of formula (I):

But,

One of R 1a and R 1b represents a C 1-10 alkyl group or a C 1-10 alkyl-carbonyl group, the other is absent, and R 4a and R 4b are each a hydrogen atom Represents
The compound according to claim 2 or a salt thereof.
Y represents a carbon atom, Z represents an oxygen atom,
R 1a , R 1b , R 2a , R 2b , R 3a and R 3b each represents a hydrogen atom,
R 4a and R 4b are absent,
R 5 represents a substituted C 1-10 alkyl group,
Ar represents a substituted benzene ring,
The compound according to claim 1 or a salt thereof.
R 5 represents a C 1-10 alkyl group substituted with a halogen atom,
Ar represents a benzene ring substituted with a C 1-10 alkyl group substituted with a mono or di-C 1-10 alkyl-carbamoyl group;
The compound or its salt of Claim 4.
N-methyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
N, N-dimethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
N, N-diethyl-2- {4- [3- (trifluoromethyl) -5,6-dihydropyrano [2,3-c] pyrazol-1 (4H) -yl] phenyl} acetamide, or a salt thereof.
A prodrug of the compound according to claim 1 or a salt thereof.
A pharmaceutical comprising the compound according to claim 1 or a salt thereof, or a prodrug thereof.
A prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), comprising the compound according to claim 1 or a salt thereof, or a prodrug thereof.
An AMPA receptor function enhancer comprising the compound according to claim 1 or a salt thereof, or a prodrug thereof.
formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent,
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof, or an AMPA receptor function enhancer comprising a prodrug thereof.
formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent,
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
A prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), comprising a compound represented by:
For mammals, the formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent,
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
A method for enhancing AMPA receptor function, which comprises administering an effective amount of a compound represented by the formula:
For mammals, the formula

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent,
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
A method for preventing or treating depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), which comprises administering an effective amount of the compound represented by: or a salt thereof, or a prodrug thereof.
Formula for producing an AMPA receptor function enhancer

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent,
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof, or a prodrug thereof.
Formula for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD)

[Where:
One of Y and Z represents a nitrogen atom or an oxygen atom, and the other represents a carbon atom;
R 1a and R 1b each independently represent an absence, a hydrogen atom or a substituent,
R 2a and R 2b each independently represent a hydrogen atom or a substituent,
R 3a and R 3b each independently represent a hydrogen atom or a substituent,
R 4a and R 4b each independently represent an absence, a hydrogen atom or a substituent,
R 5 represents a substituent, and Ar represents an optionally substituted benzene ring, or an optionally substituted monocyclic aromatic heterocycle, the benzene ring or the monocyclic aromatic heterocycle When a ring is substituted with two or more substituents, two of them may be combined to form an optionally substituted ring. ]
Or a salt thereof, or a prodrug thereof.