WO2011036885A1 - Heterocyclic compound - Google Patents

Abstract

Disclosed is a heterocyclic compound which has an effect of enhancing AMPA receptor function. Specifically disclosed is a compound represented by formula (I) or a salt thereof. (In the formula, R¹ represents a C_1-6 alkyl group which may be substituted by a halogen atom; ring A represents an optionally substituted carbon ring having 5-8 carbon atoms; the fused ring bonded to the nitrogen atom in the amide bond represents an optionally substituted fused heterocyclic group which contains only 1-4 nitrogen atoms as heteroatoms; and n represents 1 or 2.)

Description

Heterocyclic compounds

The present invention relates to a heterocyclic compound, in particular, a heterocyclic compound having an AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptor function enhancing action.

Glutamate is the most abundant excitatory neurotransmitter in the mammalian central nervous system. Glutamate has an important role in the regulation of cognition, mood, and motor function, and these processes become unstable in psychiatric and neurological disorders. Glutamate receptors are classified into ion channel receptors and G protein-coupled receptors, and the ion channel receptors are further α-amino-3-hydroxy-5-methyl 4-isoxazolepropionic acid (AMPA) receptors, It is classified into N-methyl-D-aspartate (NMDA) receptor and kainic acid (KA) receptor. (Non-Patent Document 1)
The AMPA receptor is a type of receptor for the excitatory neurotransmitter glutamate and was named based on the selective activation of AMPA by AMPA. The AMPA receptor is composed of four subunits (GluR1, GluR2, GluR3, GluR4). There are homomeric receptors composed of homologous subunits and heteromeric receptors composed of heterogeneous subunits. It has been reported that the physiological properties of AMPA receptors vary depending on the subunits that comprise them. (Non-patent documents 1, 2, 3)
The importance of AMPA receptors in brain physiology is well known, and compounds having an AMPA receptor function enhancing action are expected to be useful as preventive or therapeutic agents for mental disorders, neurodegenerative diseases, memory disorders, sleep disorders, etc. ing. (Non-Patent Documents 4 and 5)

As such compounds,
Patent Document 1 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect | action represented by these is disclosed.
Patent Document 2 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 3 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 4 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 5 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 6 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 7 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 8 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 9 includes a general formula.

(R ² and X ³ may form a 5- to 7-membered ring)
The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.
Patent Document 10 discloses a general formula.

The heterocyclic compound which has the AMPA receptor function enhancement effect represented by these is disclosed.

However, development of a heterocyclic compound having an AMPA receptor function enhancing action is still desired.

International Publication No. 2007/107539 Pamphlet International Publication No. 2008/003452 Pamphlet International Publication No. 2008/053031 Pamphlet International Publication No. 2008/110656 Pamphlet International Publication No. 2008/113795 Pamphlet International Publication No. 2008/148836 Pamphlet International Publication No. 2008/148832 Pamphlet International Publication No. 2009/062930 Pamphlet International Publication No. 2009/147167 pamphlet International Publication No. 2009/119088 Pamphlet

The present invention relates to a heterocyclic compound having an AMPA receptor function-enhancing action (AMPA receptor function potentiator (AMPA receptor receptor potentiator); The purpose is to provide positive allosteric modulator, positive allosteric activator of AMPA receptor).

The present inventors have found that a compound represented by the following formula (I) or a salt thereof (sometimes referred to herein as compound (I)) has an AMPA receptor function enhancing action. As a result of further research, the present invention has been completed.

That is, the present invention provides the compounds, medicaments, methods, uses and the like described in the following [1] to [22].
[1]
Formula (I)

[Where:
R ¹ represents a C _1-6 alkyl group which may be substituted with a halogen atom,
Ring A represents an optionally substituted carbocyclic ring having 5 to 8 carbon atoms,
Partial structural formula of formula (I)

Represents a condensed heterocyclic group which may have a substituent, containing only 1 to 4 nitrogen atoms as a hetero atom,
n represents 1 or 2.
(However,
N- [6- (1H-pyrazol-4-yl) isoquinolin-3-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] Acetamide,
N- [4-Cyclopropyl-6- (trifluoromethyl) -1H-pyrazolo [3,4-b] pyridin-3-yl] -2- [3- (difluoromethyl) -4,5,6,7 -Tetrahydro-1H-indazol-1-yl] acetamide,
2- [3- (difluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- (1-ethyl-1H-benzimidazol-2-yl) acetamide,
N- {1- [2- (Diethylamino) ethyl] -1H-benzimidazol-2-yl} -2- [3- (difluoromethyl) -4,5,6,7-tetrahydro-1H-indazole-1- Yl] acetamide,
N, 5-dimethyl-4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5, 6,7-tetrahydropyrazolo [1,5-a] pyrazine-2-carboxamide,
5-methyl-4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6, 7-tetrahydropyrazolo [1,5-a] pyrazine-2-carboxamide,
4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6,7-tetrahydropyra Zolo [1,5-a] pyrazine-2-carboxamide,
4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6,7-tetrahydropyra Zolo [1,5-a] pyridine-2-carboxamide,
N- (6-Chloroimidazo [1,2-b] pyridazin-3-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] Acetamide, and
N- (3-oxo-2,3-dihydro-1H-isoindol-4-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazole-1- Yl] acetamide))]
Or a salt thereof.
[2]
Partial structural formula of formula (I)

The group represented by may have a substituent,

(Wherein X, Y and Z are the same or different and represent a nitrogen atom or a carbon atom which may have a substituent, provided that all of X, Y and Z are simultaneously nitrogen atoms. Absent.)
The compound or its salt of the said [1] description which is group represented by these.
[3]
Partial structural formula of formula (I)

The group represented by

(Where
R ² represents a halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group or a _{C 1-6} alkoxycarbonyl Kishi carbonyl group,
X ^a represents a nitrogen atom or —CH═;
Y ^a represents a nitrogen atom or —CR ³ ═ (R ³ represents a hydrogen atom or a C _1-6 alkyl group);
Z ^a represents a nitrogen atom or —CR ⁴ ═ (R ⁴ represents a hydrogen atom or a C _1-6 alkyl group). However, not all of X ^a , Y ^a and Z ^a are nitrogen atoms at the same time. Is a group represented by
The compound according to the above [1], or a salt thereof.
[4]
The compound of the above-mentioned [1], wherein the ring A is cyclohexene, or a salt thereof.
[5]
Ring A represents cyclohexene,
R ¹ represents a C _1-6 alkyl group substituted with a halogen atom,
Indicate
Partial structural formula of formula (I)

The group represented by

(Where
D ¹ ~ ^{D 4} ring are each halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group, and _{C 1-6} alkoxy - selected from a carbonyl group Represents a ring substituted with 1 to 3 substituents of
The E ¹ to E ⁴ rings each represent a ring optionally substituted with 1 or 2 C _1-6 alkyl groups. Is a group represented by
The compound according to the above [1], or a salt thereof.
[6]
Ring A represents cyclohexene,
R ¹ represents a C _1-6 alkyl group substituted with a halogen atom,
Partial structural formula of formula (I)

Is

(Wherein D ⁵ to D ⁷ rings each represent a ring substituted with 1 to 3 C _1-6 alkyl groups substituted with a halogen atom, and E ⁵ to E ⁷ rings each represent 1 Or a ring optionally substituted with two C _1-6 alkyl groups.) Or a salt thereof according to the above-mentioned [1].
[7]
N- [3-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro- 1H-indazol-1-yl] acetamide, or a salt thereof.
[8]
N- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazole- 1-yl] acetamide or a salt thereof.
[9]
N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
[10]
N- [2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
[11]
2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2,4] triazolo [1 , 5-a] pyridin-8-yl] acetamide, or a salt thereof.
[12]
2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2,4] triazolo [4 , 3-a] pyridin-8-yl] acetamide, or a salt thereof.
[13]
A prodrug of the compound or a salt thereof according to the above [1].
[14]
The pharmaceutical containing the compound or its salt as described in said [1], or its prodrug.
[15]
The medicament according to the above [14], which is an AMPA receptor function enhancer.
[16]
The medicament according to [14] above, which is a prophylactic or therapeutic drug for depression, schizophrenia, or attention deficit hyperactivity disorder.
[17]
A method for enhancing AMPA receptor function, comprising administering an effective amount of the compound according to [1] above or a salt thereof, or a prodrug thereof to a mammal.
[18]
A method for preventing or treating depression, schizophrenia, or attention deficit / hyperactivity disorder, which comprises administering an effective amount of the compound or salt thereof, or prodrug thereof according to [1] to a mammal. Method.
[19]
Use of the compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof for producing an AMPA receptor function potentiator.
[20]
Use of the compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder.
[21]
The compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof, for use in enhancing AMPA receptor function.
[22]
The compound of the above-mentioned [1] or a salt thereof, or a prodrug thereof for use in the prevention or treatment of depression, schizophrenia, or attention deficit hyperactivity disorder.

The present invention also provides the compounds, medicaments, methods, uses and the like described in [1 ′] to [10 ′] below.
[1 ']
Formula (I)

[Where:
R ¹ represents a C _1-6 alkyl group which may be substituted with a halogen atom,
Ring A represents an optionally substituted carbocyclic ring having 5 to 8 carbon atoms,
Partial structural formula of formula (I)

A group represented by the formula (1) represents a condensed heterocyclic group which may have a substituent, containing only 1 to 4 nitrogen atoms as a hetero atom,
n represents 1 or 2.
(However,
N- [6- (1H-pyrazol-4-yl) isoquinolin-3-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] Acetamide,
N- [4-Cyclopropyl-6- (trifluoromethyl) -1H-pyrazolo [3,4-b] pyridin-3-yl] -2- [3- (difluoromethyl) -4,5,6,7 -Tetrahydro-1H-indazol-1-yl] acetamide,
2- [3- (difluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- (1-ethyl-1H-benzimidazol-2-yl) acetamide,
N- {1- [2- (Diethylamino) ethyl] -1H-benzimidazol-2-yl} -2- [3- (difluoromethyl) -4,5,6,7-tetrahydro-1H-indazole-1- Yl] acetamide,
N, 5-dimethyl-4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5, 6,7-tetrahydropyrazolo [1,5-a] pyrazine-2-carboxamide,
5-methyl-4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6, 7-tetrahydropyrazolo [1,5-a] pyrazine-2-carboxamide,
4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6,7-tetrahydropyra Zolo [1,5-a] pyrazine-2-carboxamide,
4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6,7-tetrahydropyra Zolo [1,5-a] pyridine-2-carboxamide,
N- (6-Chloroimidazo [1,2-b] pyridazin-3-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] Acetamide, and
N- (3-oxo-2,3-dihydro-1H-isoindol-4-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazole-1- Yl] acetamide))]
Or a salt thereof (sometimes referred to as compound (I) in the present specification).
[2 ']
Partial structural formula of formula (I)

The group represented by may have a substituent,

(Wherein X, Y and Z are the same or different and represent a nitrogen atom or a carbon atom which may have a substituent, provided that all of X, Y and Z are simultaneously nitrogen atoms. Absent.)
The compound of said [1] description which is group represented by these.
[3 ']
A prodrug of the compound described in [1 ′] above.
[4 ']
The pharmaceutical containing the compound of said [1 '], or its prodrug.
[5 ']
The medicament according to [4 ′] above, which is an AMPA receptor function enhancer.
[6 ']
The medicament according to [4 ′] above, which is a prophylactic or therapeutic drug for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).
[7 ']
A method for enhancing AMPA receptor function, comprising administering an effective amount of the compound or prodrug thereof according to [1 ′] to a mammal.
[8 ']
A method for preventing or treating depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD), comprising administering an effective amount of the compound or prodrug thereof according to [1 '] to a mammal Method.
[9 ']
Use of the compound according to the above [1 ′] or a prodrug thereof for producing an AMPA receptor function potentiator.
[10 ']
Use of the compound according to [1 ′] above or a prodrug thereof for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).

According to the present invention, there is provided a compound having an AMPA receptor function enhancing action and useful as a preventive or therapeutic agent for depression, schizophrenia, attention deficit hyperactivity disorder (ADHD) and the like.

In the present specification, unless otherwise specified, the “aromatic ring” means a ring that is interpreted according to the Hückel rule and has 4n + 2 electrons (n is a natural number) involved in aromaticity in the ring. Examples of the “aromatic ring” include “aromatic carbocycle” and “aromatic heterocycle”.
On the other hand, “non-aromatic ring” means a ring that is not an aromatic ring. Examples of the “non-aromatic ring” include “non-aromatic carbocycle” and “non-aromatic heterocycle”.

In the present specification, examples of the “halogen atom” include a fluorine atom, a chlorine atom, a bromine atom, and an iodine atom.
In this specification, examples of the “C _1-6 alkyl (group)” include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 1-ethylpropyl. Hexyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2-ethylbutyl and the like.
In the present specification, examples of the “C _3-6 cycloalkyl (group)” include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.
In the present specification, examples of the “C _1-6 alkoxy (group)” include methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy, neopentyloxy, and hexyl. Oxy is mentioned.
In the present specification, examples of the “C _1-6 alkoxy-carbonyl (group)” include methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, and tert-butoxycarbonyl.
In the present specification, examples of the “carbocycle having 5 to 8 carbon atoms” include:
Benzene ring,
C _5-8 cycloalkane (eg, cyclopentane, cyclohexane, cycloheptane, cyclooctane),
C _5-8 cycloalkene (e.g., cyclopentene, cyclohexene, cycloheptene, cyclooctene), and _{C 5-8} cycloalkadiene (e.g., cyclopentadiene, cyclohexadiene, cycloheptadiene, cyclooctadiene), and the like.

The symbols in formula (I) are described below.
R ¹ represents a C _1-6 alkyl group which may be substituted with a halogen atom.
The number of the halogen atoms is 1 or more (preferably 1 to 3).
R ¹ is preferably, for example, trifluoromethyl.

The A ring represents a carbocyclic ring having 5 to 8 carbon atoms which may have a substituent.
The “carbon ring having 5 to 8 carbon atoms” is preferably, for example, C _5-8 cycloalkene (eg, cyclopentene, cyclohexene, cycloheptene, cyclooctene), and more preferably cyclohexene.
The “carbocycle having 5 to 8 carbon atoms” may have one or more (preferably 1 to 3) substituents at substitutable positions.

As the substituent, for example,
(i) a halogen atom,
(ii) a cyano group,
(iii) a hydroxy group,
(iv) a nitro group,
(v) formyl group,
(vi) an amino group,
(vii) mono- or di-C _1-6 alkylamino group (eg methylamino, ethylamino, propylamino, dimethylamino, diethylamino, dipropylamino),
(viii) a C _1-6 alkyl-carbonylamino group (eg acetylamino, ethylcarbonylamino),
(ix) a C _1-6 alkoxy-carbonylamino group (eg, methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino),
(x) a C _3-8 cycloalkyl group optionally substituted with one or more (preferably 1 to 3) substituents selected from (a) a halogen atom, and (b) a hydroxy group (example: Cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl),
(xi) C _3-8 cycloalkenyl group (eg, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl),
(xii) (a) a halogen atom,
(b) a C _1-6 alkyl group (eg, methyl),
one or more (preferably 1 to 3) substituents selected from (c) a C _3-6 cycloalkyl group (eg, cyclopropyl), and (d) a C _1-6 alkoxy group (eg, methoxy). A C _6-14 aryl group _optionally substituted by (eg, phenyl, 1-naphthyl, 2-naphthyl),
(xiii) a C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, optionally substituted with one or more (preferably 1 to 3) halogen atoms; tert-butoxy),
(xiv) a C _3-6 cycloalkyl-oxy group (eg, cyclopropoxy) optionally substituted with one or more (preferably 1 to 2) halogen atoms,
(xv) C _7-16 aralkyloxy group (eg, benzyloxy),
(xvi) (a) a C _1-6 alkoxy group (eg, methoxy),
(b) a C _1-6 alkyl group (eg, methyl),
(c) C _3-6 cycloalkyl group (e.g. cyclopropyl), and (d) 1 or more selected from halogen atom (preferably 1 to 3) which may be substituted with a substituent of C _{6 A -14} aryloxy group (eg phenoxy),
(xvii) carboxyl group,
(xviii) a C _1-6 alkoxy-carbonyl group,
(xix) C _7-16 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl),
(xx) C _6-14 aryloxy-carbonyl group (eg, phenoxycarbonyl),
(xxi) a C _1-6 alkyl-carbonyl group (eg, acetyl, ethylcarbonyl, propylcarbonyl, isopropylcarbonyl, 2,2-dimethylpropylcarbonyl),
(xxii) a C _3-8 cycloalkyl-carbonyl group (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl),
(xxiii) a C _7-16 aralkyl-carbonyl group (eg, benzylcarbonyl),
(xxiv) C _6-14 aryl-carbonyl group (eg benzoyl)
(xxv) carbamoyl group,
(xxvi) a thiocarbamoyl group,
(xxvii) mono- or di-C _1-6 alkyl-carbamoyl groups (eg, methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl, isopropylcarbamoyl, dimethylcarbamoyl, diethylcarbamoyl, dipropylcarbamoyl),
(xxviii) mono- or di-C _7-16 aralkyl-carbamoyl group (eg, benzylcarbamoyl, dibenzylcarbamoyl),
(xxix) thiol group,
(xxx) C _1-6 alkylthio group (eg, methylthio, ethylthio, propylthio),
(xxxi) C _7-16 aralkylthio group (eg, benzylthio),
(xxxii) a C _3-6 cycloalkyl-thio group (eg, cyclopropylthio),
(xxxiii) C _1-6 alkylsulfinyl group (eg, methylsulfinyl, ethylsulfinyl, propylsulfinyl, butylsulfinyl),
(xxxiv) a C _3-8 cycloalkylsulfinyl group (eg, cyclopropylsulfinyl, cyclobutylsulfinyl, cyclopentylsulfinyl),
(xxxv) C _6-10 arylsulfinyl group (eg, phenylsulfinyl, naphthylsulfinyl),
(xxxvi) C _1-6 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl),
(xxxvii) a C _3-8 cycloalkylsulfonyl group (eg, cyclopropylsulfonyl, cyclobutylsulfonyl, cyclopentylsulfonyl),
(xxxviii) C _6-14 arylsulfonyl group (eg, phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl),
(xxxix) C _7-16 aralkylsulfonyl group (eg, benzylsulfonyl),
(xl) a 5- to 8-membered non-aromatic heterocyclic group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (eg, pyrrolidinyl, tetrahydrofuryl, tetrahydrothienyl, Piperidyl, tetrahydropyranyl, morpholinyl, thiomorpholinyl, piperazinyl) [the non-aromatic heterocyclic group includes (a) a halogen atom, (b) a C _1-6 alkyl group (eg, methyl), (c) C _1-6 alkoxy A group (eg, methoxy), and (d) one or more (preferably 1 to 3) substituents selected from a C _3-6 cycloalkyl group (eg, cyclopropyl) may be substituted] ,
(xli) a 5- to 8-membered aromatic heterocyclic group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (eg, furyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl) , Thiazolyl, isothiazolyl, imidazolyl, pyrazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, furazanyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl 1,3,4-thiadiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl), the aromatic heterocyclic group is (a) halogen atoms, _{(b) C 1-6} alkyl group (e.g. methyl), _{(c) C 1-6} alkoxy group (e.g. methoxy), and _{(d) C 3-6} cycloalkyl It may be substituted with one or more (preferably 1 to 3) substituents selected from an alkyl group (eg, cyclopropyl), and may be condensed with a benzene ring (eg, benzothienyl). ),
(xlii) a 5- to 8-membered non-aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom (eg, pyrrolidinylcarbonyl, tetrahydro Furylcarbonyl, tetrahydrothienylcarbonyl, piperidylcarbonyl, tetrahydropyranylcarbonyl, morpholinylcarbonyl, thiomorpholinylcarbonyl, piperazinylcarbonyl),
(xliii) a 5- to 8-membered aromatic heterocyclic-carbonyl group having 1 to 4 heteroatoms selected from a nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms (eg, furylcarbonyl, thienylcarbonyl, pyrrole) Rucarbonyl, oxazolylcarbonyl, isoxazolylcarbonyl, thiazolylcarbonyl, isothiazolylcarbonyl, imidazolylcarbonyl, pyrazolylcarbonyl, 1,2,3-oxadiazolylcarbonyl, 1,2,4-oxadiazolyl Carbonyl, 1,3,4-oxadiazolylcarbonyl, furazanylcarbonyl, 1,2,3-thiadiazolylcarbonyl, 1,2,4-thiadiazolylcarbonyl, 1,3,4-thiadiazolylcarbonyl 1,2,3-triazolylcarbonyl, 1,2,4-triazolylcarbonyl, tetrazolylcarbonyl Pyridylcarbonyl, pyridazinyl carbonyl, pyrimidinyl carbonyl, pyrazinylcarbonyl, triazinyl carbonyl),
(xliv) ureido group,
(xlv) mono- or di-C _1-6 alkyl-ureido groups (eg methylureido, ethylureido, propylureido, N, N′-dimethylureido, N, N′-diethylureido),
(xlvi) C _6-14 aryl-ureido group (eg, phenylureido, 1-naphthylureido, 2-naphthylureido),
(xlvii) C _1-4 alkylenedioxy group (eg, methylenedioxy, ethylenedioxy, propylenedioxy)
(xlviii) an aminosulfonyl group,
(xlix) mono-N—C _1-6 alkylaminosulfonyl group (eg, methylaminosulfonyl, ethylaminosulfonyl),
(l) di-N, N—C _1-6 alkylaminosulfonyl group (eg, dimethylaminosulfonyl, diethylaminosulfonyl),
(li) mono-N—C _3-6 cycloalkylaminosulfonyl group (eg, mono-N-cyclopropylaminosulfonyl group),
(lii) a bridged C _7-10 cycloalkyl group (eg bicyclo [3.1.1] heptyl, adamantyl) optionally substituted with a C _1-6 alkyl group (eg methyl), and
(liii) a C _6-14 arylthio group (eg, phenylthio),
(liv) a C _1-6 alkyl group _optionally substituted with one or more (preferably 1 to 3) halogen atoms and a hydroxy group (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec- Butyl, tert-butyl, pentyl, neopentyl, hexyl),
(lv) a C _2-6 alkenyl group (eg, vinyl, 1-propenyl, allyl, isopropenyl, butenyl, isobutenyl) optionally substituted with one or more (preferably 1 to 3) halogen atoms,
(lvi) a C _2-6 alkynyl group (eg, ethynyl, propargyl, butynyl, 1-hexynyl) optionally substituted with one or more (preferably 1 to 3) halogen atoms,
(lvii) a C _7-16 aralkyl group (eg, benzyl, 2-phenylethyl, 1-phenylethyl, 3-phenylpropyl, 4-phenylbutyl),
(lviii) a 5- to 8-membered aromatic heterocyclic-oxy group containing 1 to 4 heteroatoms selected from a nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms (eg, furyloxy, thienyloxy, pyrrolyloxy) , Oxazolyloxy, isoxazolyloxy, thiazolyloxy, isothiazolyloxy, imidazolyloxy, pyrazolyloxy, 1,2,3-oxadiazolyloxy, 1,2,4-oxadiazolyloxy, 1,3, 4-oxadiazolyloxy, furazanyloxy, 1,2,3-thiadiazolyloxy, 1,2,4-thiadiazolyloxy, 1,3,4-thiadiazolyloxy, 1,2,3-triazoly Ruoxy, 1,2,4-triazolyloxy, tetrazolyloxy, pyridyloxy, pyridazinyloxy, pyrimidinyloxy, pyrazinyloxy, tri Jiniruokishi), and
(lix) oxo group may be mentioned.
Ring A is preferably, for example, an unsubstituted carbocyclic ring having 5 to 8 carbon atoms (more preferably, for example, C _5-8 cycloalkene, particularly preferably, for example, cyclohexene).

Partial structural formula of formula (I)

Is a condensed heterocyclic group which may have a substituent and contains only 1 to 4 nitrogen atoms as a hetero atom. Here, n represents 1 or 2. As will be apparent to those skilled in the art, the fused heterocyclic group is linked to the nitrogen atom constituting the amide bond represented by formula (I) at any atom constituting the 5-membered ring or 6-membered ring.
As the condensed heterocyclic group, for example,

And a group formed by removing one hydrogen atom from.

Partial structural formula of the formula (I)

As the group represented by

(Wherein X, Y and Z are the same or different and represent a nitrogen atom or a carbon atom which may have a substituent, provided that all of X, Y and Z are simultaneously nitrogen atoms. Absent.)
The group represented by these is preferable. When the “optionally substituted carbon atom” does not have a substituent, X, Y and Z are —CH═.
Partial structural formula of the formula (I)

More preferably, the group represented by

(Where
R ² represents a halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group or _{C 1-6} alkoxy, - indicates a carbonyl group,
X ^a represents a nitrogen atom or —CH═;
Y ^a represents a nitrogen atom or —CR ³ ═ (R ³ represents a hydrogen atom or a C _1-6 alkyl group);
Z ^a represents a nitrogen atom or —CR ⁴ ═ (R ⁴ represents a hydrogen atom or a C _1-6 alkyl group). However, not all of X ^a , Y ^a and Z ^a are nitrogen atoms at the same time. )
It is group represented by these.
The partial structure:

Preferably,

It is.

Specifically, as such a group, for example,

Is mentioned.
These fused heterocyclic groups may have one or more (preferably 1 to 3) substituents at substitutable positions.
Examples of such a substituent include those exemplified as the substituent for ring A and the same ones.
Among them, the substituent is preferably, for example,
(1) a halogen atom (preferably a fluorine atom, a chlorine atom, a bromine atom),
(2) a C _1-6 alkyl group (preferably, optionally substituted with one or more (preferably 1 to 3) substituents selected from (a) a halogen atom, and (b) a hydroxy group Methyl, ethyl, trifluoromethyl),
and
(3) a C _1-6 alkoxy-carbonyl group (preferably methoxycarbonyl).

As the group represented by the partial structure, specifically, more preferably, for example,

(Where
D ¹ ~ ^{D 4} ring are each halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group, and _{C 1-6} alkoxy - selected from a carbonyl group A ring substituted with 1 to 3 substituents of
The E ¹ to E ⁴ rings each represent a ring optionally substituted with 1 or 2 C _1-6 alkyl groups. ), More preferably

(Wherein, ^{R a} is halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group or _{C 1-6} alkoxy, - indicates a carbonyl radical, R ^b and R ^c are the same or different and each represents a hydrogen atom or a C _1-6 alkyl group.
It is group represented by these.
Here, the number of substituents on the D ¹ to D ⁴ rings is preferably one, and the number of substituents on the E ¹ to E ⁴ rings is preferably 0 or 1.

Partial structural formula of formula (I)

And the ring A is, for example, an unsubstituted carbocyclic ring having 5 to 8 carbon atoms (more preferably, for example, a C _5-8 cycloalkene, particularly preferably, for example, And cyclohexene) are more preferable.

Compound (I) is preferably, for example,
R ¹ is trifluoromethyl;
Ring A is a C _5-8 cycloalkene,
Partial structural formula of formula (I)

Each of the groups represented by
(1) a halogen atom (preferably a fluorine atom, a chlorine atom, a bromine atom),
(2) (a) one or more (preferably 1 to 3) halogen atoms, and (b) a C _1-6 alkyl group optionally substituted with a substituent selected from a hydroxy group (preferably, Methyl, ethyl, trifluoromethyl), and
(3) C _1-6 alkoxy-carbonyl group (preferably methoxycarbonyl)
May be substituted with one or more (preferably 1 to 3) substituents selected from

A compound which is a group selected from:

Also preferably as compound (I), for example, in formula (I), ring A represents cyclohexene,
R ¹ represents a C _1-6 alkyl group substituted with a halogen atom,
Indicate
Partial structural formula of formula (I)

Is

(Where
D ¹ ~ ^{D 4} ring are each halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group, and _{C 1-6} alkoxy - selected from a carbonyl group A ring substituted with 1 to 3 substituents of
The E ¹ to E ⁴ rings each represent a ring optionally substituted with 1 or 2 C _1-6 alkyl groups. ) Represents a group represented by
A compound.
Here, the number of substituents on the D ¹ to D ⁴ rings is preferably one, and the number of substituents on the E ¹ to E ⁴ rings is preferably 0 or 1.

Partial structural formula

The group represented by

(Wherein, ^{R a} is halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group or _{C 1-6} alkoxy, - indicates a carbonyl radical, R ^b and R ^c are the same or different and each represents a hydrogen atom or a C _1-6 alkyl group.
It is group represented by these.

Also preferably as compound (I), for example, in formula (I), ring A represents cyclohexene,
R ¹ represents a C _1-6 alkyl group substituted with a halogen atom,
Partial structural formula

Is

(Wherein D ⁵ to D ⁷ rings each represent a ring substituted with 1 to 3 C _1-6 alkyl groups substituted with a halogen atom, and E ⁵ to E ⁷ rings each represent 1 Or a ring optionally substituted with two C _1-6 alkyl groups.)
A compound.

Here, the number of substituents in the D ⁵ to D ⁷ rings is preferably 1, and the number of substituents in the E ⁵ to E ⁷ rings is preferably 0 or 1.

Also, here, the partial structural formula

The group represented by

(In the formula, R ^a represents a C _1-6 alkyl group substituted with a halogen atom, and R ^b and R ^c are the same or different and each represents a hydrogen atom or a C _1-6 alkyl group.)
It is group represented by these.

The following compounds are particularly preferable as the compound (I).
Example 6 N- [3-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6 , 7-Tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
Example 8 N- [6- (Trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro -1H-indazol-1-yl] acetamide, or a salt thereof.
Example 11 N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl ) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
Example 12 N- [2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl ) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
Example 13 2- [3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2, 4] Triazolo [1,5-a] pyridin-8-yl] acetamide, or a salt thereof.
Example 14 2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2, 4] Triazolo [4,3-a] pyridin-8-yl] acetamide, or a salt thereof.

When the compound (I) is a salt, examples of such a salt include a salt with an inorganic base, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, and a basic or acidic amino acid. Examples include salts.
Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; aluminum salt; ammonium salt and the like.
Preferable examples of the salt with an organic base include salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N, N-dibenzylethylenediamine and the like.
Preferable examples of the salt with inorganic acid include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
Preferable examples of the salt with organic acid include formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p- Examples thereof include salts with toluenesulfonic acid and the like.
Preferable examples of the salt with basic amino acid include salts with arginine, lysine, ornithine and the like.
Preferable examples of the salt with acidic amino acid include salts with aspartic acid, glutamic acid and the like.

[Production method]
A method for producing compound (I) will be described below.
Compound (I) can be produced, for example, by the following method or a method analogous thereto.
The compound in the reaction formula may form a salt. Examples of such salts include those similar to the salts in compound (I).

<Production of Compound (I)>
Process A
Compound (I) is, for example,
1) Compound (II):

(Wherein each symbol is as defined above) and compound (III):

(Wherein n represents an integer of 0 or 1) is condensed with a known dehydrating condensing agent; or 2) the carboxyl group of compound (II) is activated by a known activation method, and then the compound ( A method of reacting III);
Etc. can be manufactured.

Method 1) Compound (I) can be produced by condensing compound (II) and compound (III) with a known dehydration condensation agent.
Examples of the dehydrating condensing agent used in this reaction include N, N′-dicyclohexylcarbodiimide, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (WSC) or its hydrochloride, N, N′-carbonyl Diimidazole, 1H-benzotriazol-1-yloxytris (dimethylamino) phosphonium hexafluorophosphate (BOP), O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluro Nitrohexafluorophosphate (HATU), 2-chloro-1,3-dimethylimidazolium chloride, and bromotripyrrolidinophosphonium hexafluorophosphate (PyBrop), diethylphosphorocyanidate (diethyl cyanophosphate; DEPC), diphenylphosphoryl Azide (diphenyl phosphate azide; DPPA), 4- (4,6- dimethoxy [1,3,5] triazin-2-yl) -4-methyl morpholinium chloride (DMTMM), or the like.
This reaction may be carried out as necessary, for example, 1-hydroxybenzotriazole (HOBt); or a base such as N, N-diisopropylethylamine, N-methylmorpholine, triethylamine, and 4- (N, N-dimethylamino) pyridine. May be performed in the presence of
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane; or solvents such as nitriles such as acetonitrile Done in.
In this reaction, preferably, compound (II) and compound (III) are dissolved in a solvent such as N, N-dimethylformamide, and O- (7-aza) is used as a dehydrating condensing agent in the presence of N, N-diisopropylethylamine. This is done by adding benzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU).
In this reaction, the compound (III) is usually used in an amount of about 1 to about 5 moles per mole of the raw material compound (compound (II)), and the amount of the condensing agent is about 1 to about 100 equivalents, preferably 1 to 5 equivalents. The reaction temperature is usually 0 ° C. to 100 ° C., preferably 0 ° C. to 60 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 60 hours.

Method 2) Compound (I) can also be produced by reacting compound (III) after activating the carboxyl group of compound (II) by a known activation method.
As a method for activating the carboxyl group of compound (II), a general method is adopted, for example, acid anhydride using chloroformate, pivaloyl chloride, 2,4,6-trichlorobenzoyl chloride or the like. How to make;
Examples thereof include a method of forming an acid halide using thionyl chloride or oxalyl chloride; and a method of forming an ester with 1-hydroxybenzotriazole or pentafluorophenol using a dehydrating condensing agent.
A typical example is a method of acid halide, and as acid halide,
Compound (IIa):

(Wherein X represents a halogen atom, and other symbols are as defined above). The acid halide can be produced, for example, by treating compound (II) with a halogenating agent such as thionyl chloride or oxalyl chloride. In this case, for example, N, N-dimethylformamide may be added as an additive.
This reaction is preferably performed in a known solvent, for example, halogenated hydrocarbons such as dichloromethane; ethers such as tetrahydrofuran and diethyl ether; or aromatic hydrocarbons such as toluene or without solvent. .
This reaction is preferably carried out by adding oxalyl chloride to compound (II) in the presence of N, N-dimethylformamide in tetrahydrofuran.
In this reaction, the halogenating agent is usually used in an amount of about 1 to about 100 equivalents, preferably 1 to 5 equivalents, relative to 1 mol of the starting compound (Compound II). The reaction temperature is usually −78 ° C. to 100 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.
The reaction of compound (IIa) with compound (III) is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone; halogenation such as dichloromethane Hydrocarbons; Esters such as ethyl acetate; Hydrocarbons such as cyclohexane and n-hexane; Aromatic hydrocarbons such as toluene; Ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane It is carried out in a solvent. These solvents may be mixed in an appropriate ratio or may not be used.
This reaction preferably uses about 0.5 to about 10 moles, preferably about 1 to about 5 moles of compound (III) per mole of compound (IIa), and the base is about 0.1 To about 100 equivalents, preferably from about 1 to about 5 equivalents. The reaction temperature is generally 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Process B
Compound (I) is, for example,
Compound (IV):

(Wherein R ² represents an optionally substituted C _1-6 alkyl (eg, methyl, ethyl, n-propyl, i-propyl, n-butyl, tert-butyl, etc.) ester; Wherein each symbol is as defined above) and compound (III):

It can also be produced by reacting.
This reaction is performed, for example, by a method in which compound (IV) and compound (III) coexist and are heated.
This reaction may be carried out in the presence of a base such as sodium hydride, sodium methoxide, alkyllithium, Grignard reagent; and a metal reagent such as trimethylaluminum as necessary.
This reaction is preferably carried out in a known solvent, for example, amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as dichloromethane; esters such as ethyl acetate Hydrocarbons such as cyclohexane and n-hexane; aromatic hydrocarbons such as toluene; ethers such as tetrahydrofuran, diethyl ether, dioxane and 1,2-dimethoxyethane. These solvents may be mixed in an appropriate ratio or may not be used.

In this reaction, about 1 to about 5 mol of compound (III) is usually used per 1 mol of the raw material compound (compound (IV)), and the reaction temperature is usually 0 ° C. to 200 ° C., preferably 40 ° C. to It is carried out at a reaction temperature of 200 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (II)>
Process C
Compound (II) used for the production of compound (I) is, for example,
Compound (IV):

(Wherein each symbol is as defined above) can be produced by the method 1) or 2) of hydrolysis.

Method 1) This reaction generally employs a method in which an ester is hydrolyzed under basic conditions. For example, the reaction is carried out by treatment with an alkali such as lithium hydroxide, sodium hydroxide, or potassium hydroxide. Preferably, the compound (IV) is dissolved in an alcohol such as methanol and ethanol; or a water-soluble solvent such as tetrahydrofuran and dioxane; or a mixed solvent thereof, an aqueous sodium hydroxide solution, an aqueous lithium hydroxide solution, or the like. It is carried out by treating with an alkaline aqueous solution.
In this reaction, about 1 to about 10 equivalent of an aqueous alkaline solution is usually used per 1 mol of the raw material compound (compound (IV)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

Method 2) Compound (II) can also be produced by a method in which an ester of compound (IV) is hydrolyzed under acidic conditions. For example, it is carried out by treatment with an acid such as hydrochloric acid, sulfuric acid, and nitric acid. Preferably, compound (IV) is dissolved in alcohols such as methanol and ethanol; or water-soluble solvents such as tetrahydrofuran and dioxane; or a mixed solvent thereof, and treated with an aqueous acid solution such as hydrochloric acid and sulfuric acid. Is done.
In this reaction, about 1 to about 10 equivalent of an aqueous acid solution is usually used per 1 mol of the raw material compound (compound (IV)). The reaction temperature is generally 0 ° C. to 100 ° C., preferably 20 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

<Production of Compound (IV)>
Process D
Compound (IV) used for the production of compound (II) is, for example,
Compound (V):

(Each symbol in the formula is as defined above) and Compound (VI):

(Wherein, Xa represents a leaving group, and other symbols are as defined above).
Examples of the “leaving group” represented by Xa include halogen atoms; sulfonyloxy groups such as p-toluenesulfonyloxy group, methanesulfonyloxy group, trifluoromethanesulfonyloxy group, etc., preferably chlorine, bromine And halogen atoms such as iodine.
The reaction between compound (V) and compound (VI) is preferably potassium tert-butoxide, sodium hydride, triethylamine, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), carbonic acid In the presence of a base such as potassium and cesium carbonate in a solvent such as aromatic hydrocarbons such as toluene; ethers such as 1,4-dioxane and tetrahydrofuran; or amides such as N, N-dimethylformamide Done.
This reaction is preferably carried out by dissolving compound (V) in a solvent such as N, N-dimethylformamide, adding potassium tert-butoxide, and then adding compound (VI).
In this reaction, about 1 to about 5 mol of compound (VI) is usually used per 1 mol of the starting compound (compound (V)), and the amount of the base is about 0.1 to about 100 equivalents, preferably 1 ~ 5 equivalents. The reaction temperature is usually 0 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C. The reaction time is about 0.1 to about 100 hours, preferably about 0.5 to about 50 hours.

In the compounds (I), (II) and (IV) thus obtained, the functional group in the molecule can be converted to the target functional group by combining known chemical reactions. Examples of the chemical reaction include an oxidation reaction, a reduction reaction, an alkylation reaction, a hydrolysis reaction, an amination reaction, an amidation reaction, an esterification reaction, an aryl coupling reaction, and a deprotection reaction.
In each of the above reactions, when the raw material compound has an amino group, a carboxyl group, a hydroxy group, or a carbonyl group as a substituent, a protective group generally used in peptide chemistry or the like is introduced into these groups. In addition, the target compound can be obtained by removing the protecting group as necessary after the reaction.
Examples of the amino-protecting group include, for example, formyl, C _1-6 alkylcarbonyl (eg, acetyl, ethylcarbonyl, etc.), phenylcarbonyl, C _1-6 alkoxy-carbonyl (which may each have a substituent) For example, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), phenyloxycarbonyl, C _7-10 aralkyl-carbonyl (eg, benzylcarbonyl, etc.), trityl, phthaloyl, N, N-dimethylaminomethylene, etc. . Substituents for the “amino-protecting group” include halogen atoms (eg, fluorine, chlorine, bromine, iodine), C _1-6 alkyl-carbonyl (eg, methylcarbonyl, ethylcarbonyl, butylcarbonyl, etc.), and The number of substituents including a nitro group is 1 to several (eg, 3).
Examples of the protecting group for the carboxyl group include a C _1-6 alkyl group, a C _7-11 aralkyl group (eg, benzyl), a phenyl group, a trityl group, a substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl), and C _2-6 alkenyl groups (eg, 1-allyl). These groups may be substituted with 1 to 3 halogen atoms, C _1-6 alkoxy groups, nitro groups and the like.
Examples of the protecting group for the hydroxy group include a C _1-6 alkyl group, a phenyl group, a trityl group, a C _7-10 aralkyl group (eg, benzyl), a formyl group, a C _1-6 alkyl-carbonyl group, a benzoyl group, C _7-10 aralkyl-carbonyl group (eg, benzylcarbonyl), 2-tetrahydropyranyl group, 2-tetrahydrofuranyl group, substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert -Butyldiethylsilyl), C _2-6 alkenyl groups (eg, 1-allyl) and the like. These groups may be substituted with 1 to 3 halogen atoms, a C _1-6 alkyl group, a C _1-6 alkoxy group, a nitro group and the like.
Examples of the protecting group for the carbonyl group include cyclic acetals (eg, 1,3-dioxane), acyclic acetals (eg, di-C _1-6 alkylacetal) and the like.
The above-mentioned method for removing the protecting group can be carried out according to a known method, for example, the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980). For example, a method using acid, base, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate, trialkylsilyl halide (eg, trimethylsilyl iodide, trimethylsilyl bromide), A reduction method or the like is used.
Compounds (I), (II) and (IV) can be isolated and purified by known means, for example, solvent extraction, liquid conversion, phase transfer, concentration, crystallization, recrystallization, chromatography and the like. The starting compounds of compounds (I), (II) and (IV) or salts thereof can be isolated and purified by the same known means as described above, but the following reaction mixture can be used as it is without isolation. It may be used as a raw material for the process.

In any case, a known deprotection reaction, acylation reaction, alkylation reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbon chain extension reaction or substituent exchange reaction may be carried out singly or in combination, as desired. By combining the above, compound (I) can be synthesized.
When compound (I) has an isomer such as an optical isomer, a stereoisomer, a positional isomer, a rotational isomer, etc., any one of the isomers and a mixture are encompassed in compound (I). For example, when compound (I) has an optical isomer, the optical isomer resolved from the racemate is also encompassed in compound (I). Each of these isomers can be obtained as a single product by a known synthesis method or separation method (concentration, solvent extraction, column chromatography, recrystallization, etc.).

Compound (I) may be a crystal, and it is included in compound (I) regardless of whether the crystal form is a single crystal form or a mixture of crystal forms. Crystals can be produced by crystallization by applying a crystallization method known per se.
Compound (I) may be a pharmaceutically acceptable cocrystal or cocrystal salt. Here, co-crystals or co-crystal salts are two or more unique at room temperature, each having different physical properties (eg structure, melting point, heat of fusion, hygroscopicity, solubility and stability). Means a crystalline substance composed of a solid. The cocrystal or cocrystal salt can be produced according to a cocrystallization method known per se.
Compound (I) may be a solvate (eg, a hydrate) or a non-solvate (eg, an anhydride), and both are encompassed in compound (I).
A compound labeled or substituted with an isotope (eg, ² H, ³ H, ¹¹ C, ¹⁴ C, ¹⁸ F, ³⁵ S, ¹²⁵ I and the like) is also encompassed in the compound (I) and the like.
The prodrug of compound (I) is a compound that is converted to compound (I) by a reaction with an enzyme, gastric acid, or the like under physiological conditions in vivo, that is, compound (I) that is enzymatically oxidized, reduced, hydrolyzed, etc. A compound that changes to compound (I) by hydrolysis or the like due to gastric acid or the like. As a prodrug of the compound (I), a compound in which the amino of the compound (I) is acylated, alkylated or phosphorylated (eg, the amino of the compound (I) is eicosanoylated, alanylated, pentylaminocarbonylated, ( 5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation or tert-butylated compounds); compounds ( Compounds wherein the hydroxy group of I) is acylated, alkylated, phosphorylated or borated (eg, hydroxy of compound (I) is acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, fumarylated, alanylated Or a dimethylaminomethylcarbonylated compound, etc.); a carbohydrate of compound (I) Compounds in which the silyl group is esterified or amidated (eg, carboxy of the compound (I) is ethyl esterified, phenyl esterified, carboxymethyl esterified, dimethylaminomethyl esterified, pivaloyloxymethyl esterified, ethoxycarbonyl Oxyethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methyl esterification, cyclohexyloxycarbonylethyl esterification or methylamidated compounds, etc.); Can be mentioned. These compounds can be produced from compound (I) by a method known per se.
The prodrug of compound (I) changes to compound (I) under physiological conditions as described in Hirokawa Shoten, 1990, “Development of Drugs”, Volume 7, Molecular Design, pages 163 to 198. There may be.
Compound (I) and prodrugs thereof (hereinafter sometimes simply referred to as the compound of the present invention) exhibit an excellent AMPA receptor function-enhancing action, and are therefore useful as safe drugs based on these actions. is there.

The compound of the present invention having an excellent AMPA receptor function-enhancing action is effective against mammals (eg, mouse, rat, hamster, rabbit, cat, dog, cow, sheep, monkey, human, etc.)
(1) Psychiatric disorders [eg, depression, major depression, bipolar depression, mood disorders, affective disorders (such as seasonal affective disorders), recurrent depression, postpartum depression, stress disorder, depressive symptoms, Gonorrhea, anxiety, generalized anxiety disorder, anxiety syndrome, panic disorder, phobia, social phobia, social anxiety disorder, obsessive compulsive disorder, post-traumatic stress syndrome, post-traumatic stress disorder, taurette syndrome, autism , Adaptation disorder, bipolar disorder, neurosis, schizophrenia (schizophrenia), neurosis, chronic fatigue syndrome, anxiety, obsessive-compulsive disorder, panic disorder, epilepsy, anxiety, uncomfortable mental state, emotional abnormalities , Emotional temperament, nervousness, fainting, sputum, decreased libido, attention deficit hyperactivity disorder (ADHD), psychotic major depression, refractory major depression, treatment-resistant depression],
(2) Neurodegenerative diseases [eg, Alzheimer's disease, Alzheimer type senile dementia, Parkinson's disease, Huntington's chorea, multiple cerebral infarction dementia, frontotemporal dementia, Parkinson's type frontotemporal dementia, progressive nucleus Upper palsy, Pick syndrome, Niemann-Pick syndrome, cerebral cortex basal degeneration, Down syndrome, vascular dementia, Parkinson's disease after encephalitis, Lewy body dementia, HIV dementia, amyotrophic spinal cord sclerosis (ALS), motor neurogenic disease (MND), Creutzfeldt-Jakob disease or prion disease, cerebral palsy, progressive supranuclear palsy, multiple sclerosis],
(3) Cognitive / memory impairment associated with aging [eg, age-related memory impairment, senile dementia]
(4) Sleep disorders [eg, intrinsic sleep disorders (eg, psychophysiological insomnia, etc.), extrinsic sleep disorders, circadian rhythm disorders (eg, time zone change syndrome (time difference blur), shift work sleep disorders) , Irregular sleep-wake patterns, sleep phase regression syndrome, sleep phase advance syndrome, non-24-hour sleep awakening, etc.), parasomnia, internal or psychiatric disorders (eg, chronic obstructive pulmonary disease, Alzheimer's disease, Parkinson's disease) , Cerebrovascular dementia, schizophrenia, depression, anxiety), sleep disorders associated with stress insomnia, insomnia, insomnia, sleep apnea syndrome],
(5) Respiratory depression caused by anesthetics, traumatic diseases, or neurodegenerative diseases,
(6) Traumatic brain injury, anorexia nervosa, eating disorders, anorexia nervosa, bulimia, other eating disorders, alcoholism, alcohol abuse, alcoholic amnesia, alcohol paranoia, alcohol preference Sex, alcohol withdrawal, alcoholic psychosis, alcoholism, alcoholic manic, alcoholic manic, alcohol-dependent mental disorder, alcohol psychosis, drug preference, drug phobia, drug craving, drug withdrawal, migraine, stress headache, tension Headache, diabetic neuropathy, obesity, diabetes, muscle spasms, Meniere's disease, autonomic dysfunction, alopecia, glaucoma, hypertension, heart disease, tachycardia, congestive heart failure, hyperventilation, bronchial asthma, apnea, sudden infants Death syndrome, inflammatory disease, allergic disease, impotence, menopause, infertility, cancer, immunodeficiency syndrome due to HIV infection, Immunodeficiency syndrome due to loess, encephalomyelitis, acromegaly, incontinence, metabolic syndrome, osteoporosis, peptic ulcer, irritable bowel syndrome, inflammatory bowel disease, ulcerative colitis, Crohn's disease, stress gastrointestinal It is useful as a prophylactic / therapeutic agent for diseases such as disorders, neurogenic vomiting, peptic ulcer, diarrhea, constipation, postoperative ileus, and stress gastrointestinal disorders.
The compound of the present invention is particularly useful as a prophylactic / therapeutic agent for diseases such as depression, schizophrenia, or attention deficit hyperactivity disorder (ADHD).

Since the compound of the present invention has an excellent AMPA receptor function enhancing action, an excellent therapeutic effect on the above diseases can be expected.

The compounds of the present invention have excellent pharmacokinetics (eg, blood drug half-life) and low toxicity (eg, acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, drug interaction, carcinogenicity, etc.) In terms of medicine), as it is, or as a pharmaceutical composition mixed with a pharmaceutically acceptable carrier or the like, a mammal (eg, human, monkey, cow, horse, pig, mouse, Rats, hamsters, rabbits, cats, dogs, sheep, goats, etc.) and can be safely administered orally or parenterally. “Parenteral” includes intravenous, intramuscular, subcutaneous, intraorgan, intranasal, intradermal, instillation, intracerebral, rectal, intravaginal, intraperitoneal, and direct lesion administration. Including.
The medicament containing the compound of the present invention can be obtained by singly using the compound of the present invention alone or pharmaceutically with the compound of the present invention according to a method known per se (eg, a method described in the Japanese Pharmacopoeia) as a method for producing a pharmaceutical preparation. It can be used as a pharmaceutical composition mixed with an acceptable carrier. Examples of the medicament containing the compound of the present invention include tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (soft capsules, microcapsules). Capsules), lozenges, syrups, solutions, emulsions, suspensions, controlled-release formulations (eg, immediate-release formulations, sustained-release formulations, sustained-release microcapsules), aerosols, films ( E.g., orally disintegrating film, buccal mucosa adhesive film), injection (eg, subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), instillation, transdermal preparation, ointment, Lotions, patches, suppositories (eg, rectal suppositories, vaginal suppositories), pellets, nasal preparations, pulmonary preparations (inhalants), eye drops, etc., orally or parenterally (eg, intravenously) Intramuscular, subcutaneous, organ, intranasal, intradermal, ophthalmic, brain , It can be safely administered rectally, intravaginally, intraperitoneally, lesion, etc.).
Examples of the excipient include lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like.
Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like.
Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose, and the like.
Examples of the disintegrant include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, carboxymethyl starch sodium, L-hydroxypropyl cellulose, and the like.
Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like.
Examples of the solubilizer include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like.
Examples of the suspending agent include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate; for example, polyvinyl alcohol, polyvinylpyrrolidone And hydrophilic polymers such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and the like.

Examples of the isotonic agent include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like.
Examples of the buffer include buffer solutions of phosphate, acetate, carbonate, citrate and the like.
Examples of soothing agents include benzyl alcohol.
Examples of preservatives include p-hydroxybenzoates, chlorobutanol, benzyl alcohol, phenylethyl alcohol, dehydroacetic acid, sorbic acid, and the like.
Examples of the antioxidant include sulfite, ascorbic acid, α-tocopherol and the like.

The dose of the compound of the present invention varies depending on the administration route, symptoms and the like. For example, when administered orally to a schizophrenic patient (adult, body weight 40 to 80 kg, eg 60 kg), for example, 0.001 to 1000 mg per day. / Kg body weight, preferably 0.01 to 100 mg / kg body weight per day, more preferably 0.1 to 10 mg / kg body weight per day. This amount can be administered in 1 to 3 divided doses per day.

As the above-mentioned “pharmaceutically acceptable carrier”, various organic or inorganic carriers conventionally used as pharmaceutical materials can be used. For example, in solid preparations, excipients, lubricants, binders and disintegrants are used, and in liquid preparations, solvents, solubilizers, suspending agents, isotonic agents, buffering agents, and the like Soothing agents and the like are used. If necessary, preparation additives such as preservatives, antioxidants, colorants, sweeteners and the like can also be used.

The pharmaceutical composition varies depending on the dosage form, administration method, carrier, etc., but the compound of the present invention is usually 0.01 to 100% (w / w), preferably 0.1 to 95% (w / W), it can be produced according to a conventional method.

The compound of the present invention may be used in combination with other active ingredients (hereinafter abbreviated as concomitant drugs).

Examples of the concomitant drug include the following.
Benzodiazepines (chlordiazepoxide, diazepam, potassium chlorazebuate, lorazepam, clonazepam, alprazolam, etc.), L-type calcium channel inhibitors (pregabalin, etc.), tricyclic or tetracyclic antidepressants (imipramine hydrochloride, amitriptyline hydrochloride, desipramine hydrochloride, Clomipramine hydrochloride, etc.), selective serotonin reuptake inhibitors (fluvoxamine maleate, floxetine hydrochloride, citalopram hydrochloride, sertraline hydrochloride, paroxetine hydrochloride, escitalopram oxalate, etc.), serotonin-noradrenaline reuptake inhibitors (venlafaxine hydrochloride, hydrochloric acid) Duroxetine, desvenlafaxine hydrochloride, etc.), noradrenaline reuptake inhibitors (eg, reboxetine mesylate), mirtazapine, trazodone hydrochloride, nefazodone hydrochloride, Acid bupropion, setiptiline maleate, _{5-HT 1A} agonists, (buspirone hydrochloride, tandospirone citrate, such as hydrochloric acid Osemozotan), 5-HT ₃ antagonist (Cyamemazine, etc.), cardiac selective and no β inhibitors (propranolol hydrochloride, Oxyprenolol hydrochloride, etc.), histamine H ₁ antagonists (hydroxyzine hydrochloride, etc.), schizophrenia drugs (chlorpromazine, haloperidol, sulprid, clozapine, trifluoperazine hydrochloride, fluphenazine hydrochloride, olanzapine, quetiapine fumarate, risperidone , Aripiprazole, etc.), CRF antagonists, other anxiolytic drugs (meprobamate, etc.), tachykinin antagonists (MK-869, saledurant etc.), drugs acting on metabotropic glutamate receptors, CCK antagonists, β3 adrenergic antagonists ( Hydrochloric acid Beglon, etc.), GAT-1 inhibitors (tiagabine hydrochloride, etc.), N-type calcium channel inhibitors, type 2 carbonic anhydrase inhibitors, NMDA glycine site agonists, NMDA antagonists (memantine, etc.), peripheral benzodiazepine receptors Body agonist, vasopressin antagonist, vasopressin V1b antagonist, vasopressin V1a antagonist, phosphodiesterase inhibitor, opioid antagonist, opioid agonist, uridine, nicotinic acid receptor agonist, thyroid hormone (T3, T4), TSH, TRH, MAO inhibitor (phenelzine sulfate, tranylcypromine sulfate, moclobemide, etc.), 5-HT _2A antagonist, 5-HT _2A inverse agonist, COMT inhibitor (entacapone, etc.), bipolar disorder treatment (lithium carbonate, Sodium valproate, lamotrigine, riluzole, fe Rubamate, etc.), cannabinoid CB1 antagonists (such as rimonabant), FAAH inhibitors, sodium channel inhibitors, anti-ADHD drugs (methylphenidate hydrochloride, methamphetamine hydrochloride, etc.), drugs for alcoholism, drugs for autism, chronic fatigue Syndrome treatment, spasm treatment, fibromyalgia treatment, headache treatment, insomnia treatment (etizolam, zopiclone, triazolam, zolpidem, ramelteon, indiplon, etc.), smoking cessation treatment, myasthenia gravis treatment Medicine, cerebral infarction medicine, gonorrhea medicine, hypersomnia medicine, pain medicine, mood dysfunction medicine, autonomic dysfunction medicine, male and female sexual dysfunction medicine, migraine medicine, disease Gambling treatment, restless leg syndrome treatment, substance dependence treatment, alcohol-related treatment, irritable bowel syndrome treatment, Alzheimer Therapeutic drugs (donepezil, galantamine, memantine, etc.), Parkinson's disease drugs, ALS drugs (riluzole, neurotrophic factors, etc.), dyslipidemic drugs such as cholesterol-lowering drugs (statin series (pravastatin sodium, atorvastatin, Simvastatin, rosuvastatin, etc.), fibrates (clofibrate, etc.), squalene synthesis inhibitors), abnormal behavioral treatments or dementia wandering inhibitors (sedatives, anxiolytics, etc.), apoptosis inhibitors, antiobesity agents, Diabetes treatment, hypertension treatment, hypotension treatment, rheumatism treatment (DMARD), anticancer agent, parathyroid treatment (PTH), calcium receptor antagonist, sex hormone or derivatives thereof (progesterone, estradiol, estradiol benzoate, etc.) ), Nerve differentiation-promoting drug, nerve re- Promoters, non-steroidal anti-inflammatory drugs (meloxicam, tenoxicam, indomethacin, ibuprofen, celecoxib, rofecoxib, aspirin, indomethacin, etc.), steroids (dexamethasone, cortisone acetate, etc.), anti-cytokine drugs (TNF inhibitors, MAP kinase inhibitors, etc.) ), Antibody drugs, nucleic acids or nucleic acid derivatives, aptamer drugs and the like.

By combining the compound of the present invention and a concomitant drug,
(1) Compared with the case where the compound of the present invention or the concomitant drug is administered alone, the dosage can be reduced.
(2) The drug used in combination with the compound of the present invention can be selected according to the patient's symptoms (mild, severe, etc.),
(3) By selecting a concomitant drug having a different mechanism of action from the compound of the present invention, the treatment period can be set longer.
(4) By selecting a concomitant drug having a different mechanism of action from the compound of the present invention, the therapeutic effect can be sustained.
(5) By using the compound of the present invention in combination with a concomitant drug, excellent effects such as a synergistic effect can be obtained.

Hereinafter, the combined use of the compound of the present invention and the concomitant drug is referred to as “the combination drug of the present invention”.
When using the concomitant drug of the present invention, the administration time of the compound of the present invention and the concomitant drug is not limited, and the compound of the present invention or the pharmaceutical composition thereof and the concomitant drug or the pharmaceutical composition thereof are administered to the subject of administration. They may be administered at the same time or may be administered with a time difference. The dose of the concomitant drug may be determined according to the dose used clinically, and can be appropriately selected depending on the administration subject, administration route, disease, combination and the like.
The administration form of the concomitant drug of the present invention is not particularly limited as long as the compound of the present invention and the concomitant drug are combined at the time of administration. Examples of such administration forms include (1) administration of a single preparation obtained by simultaneously formulating the compound of the present invention and a concomitant drug, and (2) separate preparation of the compound of the present invention and the concomitant drug. Simultaneous administration of the preparations of the two types of preparations obtained by the same administration by the same route of administration, (3) two types of preparations obtained by separately formulating the compound of the present invention and the concomitant drug in the same route of administration Administration at a time lag, (4) simultaneous administration of two different preparations obtained by separately formulating the compound of the present invention and a concomitant drug by different administration routes, and (5) the compound of the present invention and the concomitant drug Administration of two types of preparations obtained by separately formulating at different time intervals in different administration routes (for example, the compound of the present invention; administration in the order of concomitant drugs, or administration in the reverse order) Can be mentioned.

The medicament containing the compound of the present invention is a pharmacologically acceptable compound of the present compound alone or with the compound of the present invention according to a method known per se as a method for producing a pharmaceutical preparation (eg, a method described in the Japanese Pharmacopoeia). It can be used as a pharmaceutical composition mixed with a carrier. Examples of the medicament containing the compound of the present invention include tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (soft capsules, microcapsules). Capsules), lozenges, syrups, solutions, emulsions, suspensions, controlled release formulations (eg, immediate release formulations, sustained release formulations, sustained release microcapsules), aerosols, films ( E.g., orally disintegrating film, buccal mucosa adhesive film), injection (eg, subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), instillation, transdermal preparation, ointment, Lotions, patches, suppositories (eg, rectal suppositories, vaginal suppositories), pellets, nasal agents, pulmonary agents (inhalants), eye drops, etc., orally or parenterally (eg, intravenously) , Intramuscular, subcutaneous, intraorgan, intranasal, intradermal, eye drop, Among them, it can be safely administered rectally, intravaginally, intraperitoneally, lesion, etc.).
Examples of the pharmacologically acceptable carrier that may be used in the production of the concomitant drug of the present invention include various organic or inorganic carrier substances commonly used as a pharmaceutical material. For example, in solid preparations, excipients, lubricants, binders and disintegrants can be used. In liquid preparations, solvents, solubilizers, suspending agents, tonicity agents, buffers, soothing agents, and the like can be used. If necessary, additives such as conventional preservatives, antioxidants, colorants, sweeteners, adsorbents, wetting agents and the like can be used in appropriate amounts.
Examples of the excipient include lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like.
Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like.
Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose, and the like.
Examples of the disintegrant include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, carboxymethyl starch sodium, L-hydroxypropyl cellulose, and the like.
Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like.
Examples of the solubilizer include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like.
Examples of the suspending agent include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate; for example, polyvinyl alcohol, polyvinylpyrrolidone And hydrophilic polymers such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and the like.

Examples of the isotonic agent include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like.
Examples of the buffer include buffer solutions of phosphate, acetate, carbonate, citrate and the like.
Examples of soothing agents include benzyl alcohol.
Examples of preservatives include p-hydroxybenzoates, chlorobutanol, benzyl alcohol, phenylethyl alcohol, dehydroacetic acid, sorbic acid, and the like.
Examples of the antioxidant include sulfite, ascorbic acid, α-tocopherol and the like.

The compounding ratio of the compound of the present invention and the concomitant drug in the concomitant drug of the present invention can be appropriately selected depending on the administration subject, administration route, disease and the like.
For example, the content of the compound of the present invention in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, based on the whole preparation. More preferably, it is about 0.5 to 20% by weight.
The content of the concomitant drug in the concomitant drug of the present invention varies depending on the form of the preparation, but is usually about 0.01 to 100% by weight, preferably about 0.1 to 50% by weight, more preferably about the whole preparation. About 0.5 to 20% by weight.
The content of additives such as carriers in the combination agent of the present invention varies depending on the form of the preparation, but is usually about 1 to 99.99% by weight, preferably about 10 to 90% by weight, based on the whole preparation. .
The same content may be used when the compound of the present invention and the concomitant drug are formulated separately.

Hereinafter, the present invention will be described more specifically with reference to Reference Examples, Examples, Formulation Examples, and Experimental Examples, but the present invention is not limited thereto.
In the following Reference Examples and Examples, “room temperature” usually indicates about 10 ° C. to about 35 ° C. “%” Indicates weight percent unless otherwise specified. Other abbreviations used in the text have the following meanings. s is a singlet, d is a doublet, t is a triplet, q is a quartet, m is a multiplet, brs is a broad singlet, J is a coupling constant (Coupling constant).

The meanings of the abbreviations in Examples and Reference Examples are as follows.
LC-MS: Liquid chromatography-mass spectrometry spectrum ESI: Electrospray ionization method TLC: Thin layer chromatography M: Molar concentration N: Normal BINAP: 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl BSA: bovine serum albumin DCM: dichloromethane DIAD: diisopropyl azodicarboxylate DIEA: N, N-diisopropylethylamine DMA: N, N-dimethylacetamide DMF: N, N-dimethylformamide DMSO: dimethyl sulfoxide EDCI: 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide EDTA: ethylenediaminetetraacetic acid HATU: O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate OBt: 1-hydroxybenzotriazole LDA: lithium diisopropylamide NBS: N-bromosuccinimide PE: petroleum ether THF: Tetrahydrofuran

Further, nuclear magnetic resonance spectrum (1H-NMR) analysis in the following Reference Examples and Examples was measured under the following conditions.
Measuring equipment: Burker AVANCE III plus 400 MHz, Bruker AVANCE 300, Varian VNMRS-400
Internal standard: trimethylsilane MS values in the following examples were measured under the following conditions.
Measuring instrument: Waters LC-MS system HPLC part: Agilent HP1100
MS Department: Waters company micromassZQ
Ionization method: ESI
Or
HPLC part: Agilent 1200
MS Department: Agilent 6300
Ionization method: ESI
Or
Measuring equipment: FINNIGAN Thermo LCQ Advantage MAX, Agilent LC 1200 series
Ionization method: ESI

Further, purification by preparative HPLC in the following examples was carried out under the following conditions.
[conditions]
Equipment: Waters Purification System Column: YMC CombiPrep ODS-A, 5 μm, 50 × 20 mm
Solvent: Solution A; 0.1% trifluoroacetic acid-containing water, Solution B; 0.1% trifluoroacetic acid-containing acetonitrile gradient cycle: 0.00 minutes (A solution / B solution = 90/10), 4.20 minutes (A liquid / B liquid = 0/100), 6.30 minutes (A liquid / B liquid = 0/100), 6.30 minutes (A liquid / B liquid = 90/10), 7.50 minutes (A Liquid / B liquid = 90/10)
Flow rate: 25 mL / min, detection method: UV 220 nm

Reference example 1
Methyl 8-bromo-2,3-dimethylimidazo [1,2-a] pyridine-6-carboxylate methyl 6-amino-5-bromopyridine-3-carboxylate (4.11 g, 17.8 mmol), 3- A mixture of bromobutan-2-one (2.09 mL, 19.6 mmol), disodium hydrogen phosphate (3.79 g, 26.7 mmol) and n-butanol (50 mL) was heated to reflux for 60 hours. A saturated aqueous sodium hydrogen carbonate solution was added at room temperature, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (87: 13-40: 60)] to give the title compound (589 mg) as pale yellow crystals (yield 12%).
MS Found: 283 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ) δ ppm 2.46 (3H, s), 2.48 (3H, s), 3.96 (3H, s), 7.95 (1H, s), 8.57 (1H, d, J = 1.51 Hz).

Reference example 2
Methyl 8-[(diphenylmethylidene) amino] -2,3-dimethylimidazo [1,2-a] pyridine-6-carboxylate Methyl 8-bromo-2,3-dimethylimidazo obtained in Reference Example 1 1,2-a] pyridine-6-carboxylate (635 mg, 2.24 mmol), benzophenone imine (0.52 mL, 3.36 mmol), palladium acetate (25 mg, 0.11 mmol), sodium tert-butoxide (280 mg, 2 .91 mmol), 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl (BINAP) (209 mg, 0.34 mmol) and toluene (15 mL) were stirred at 90 ° C. for 5 hours under a nitrogen atmosphere. did. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: hexane-ethyl acetate (87: 13-50: 50)] to give the title compound (359 mg) as pale-yellow crystals (yield 42%).
MS Found: 384 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 2.41 (3H, s), 2.44 (3H, s), 3.83 (3H, s), 6.64 (1H, d, J = 1) .89 Hz), 7.13-7.31 (5H, m), 7.33-7.54 (3H, m), 7.82 (2H, d, J = 7.19 Hz), 8.24 (1H) , D, J = 1.51 Hz).

Reference example 3
Methyl 8-amino-2,3-dimethylimidazo [1,2-a] pyridine-6-carboxylate

Methyl 8-[(diphenylmethylidene) amino] -2,3-dimethylimidazo [1,2-a] pyridine-6-carboxylate obtained in Reference Example 2 (350 mg, 0.91 mmol), 2N hydrochloric acid (1 mL ) And tetrahydrofuran (THF) (3 mL) were stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, saturated aqueous sodium hydrogen carbonate solution was added to the residue, and the crystals were collected by filtration and washed with water to give the title compound (208 mg) as pale yellow crystals (yield 100%). ).
MS Found: 220 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ) δ ppm 2.41 (6H, s), 3.92 (3H, s), 4.55 (2H, brs), 6.85 (1H, d, J = 1. 51 Hz), 8.10 (1H, d, J = 1.51 Hz).

Reference example 4
8-Bromo-6-chloro-2,3-dimethylimidazo [1,2-a] pyridine 3-bromo-5-chloropyridin-2-amine (4.97 g, 24.0 mmol), 3-bromobutane-2- A mixture of ON (2.81 mL, 26.3 mmol), disodium hydrogen phosphate (5.11 g, 36 mmol) and n-butanol (50 mL) was heated to reflux for 120 hours. A saturated aqueous sodium hydrogen carbonate solution was added at room temperature, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (87: 13-35: 65)] to give the title compound (4.75 g) as white crystals (yield). 76%).
MS Found: 259 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 2.39 (3H, s), 2.46 (3H, s), 7.38 (1H, d, J = 1.51 Hz), 7.82 (1H , D, J = 1.88 Hz).

Reference Example 5
6-Chloro-N- (diphenylmethylidene) -2,3-dimethylimidazo [1,2-a] pyridin-8-amine 8-bromo-6-chloro-2,3-dimethyl obtained in Reference Example 4 Imidazo [1,2-a] pyridine (2.47 g, 9.52 mmol), benzophenone imine (2.19 mL, 14.3 mmol), palladium acetate (107 mg, 0.48 mmol), sodium tert-butoxide (1.19 g, 12.4 mmol), BINAP (889 mg, 1.43 mmol) and toluene (30 mL) were stirred at 90 ° C. for 24 hours under nitrogen atmosphere. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (87: 13-50: 50)] to give the title compound (2.24 g) as pale yellow crystals (yield) 65%).
MS Found: 360 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ) δ ppm 2.35 (3H, s), 2.42 (3H, s), 6.05 (1H, s), 7.17-7.33 (5H, m) , 7.33-7.44 (2H, m), 7.46 (2H, s), 7.81 (2H, d, J = 7.57 Hz).

Reference Example 6
6-Chloro-2,3-dimethylimidazo [1,2-a] pyridin-8-amine hydrochloride Methyl 6-chloro-N- (diphenylmethylidene) -2,3-dimethylimidazo obtained in Reference Example 5 A mixture of [1,2-a] pyridin-8-amine (2.2 g, 6.11 mmol), 2N hydrochloric acid (13 mL) and THF (26 mL) was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the crystals were collected by filtration to give the title compound (1.53 g) as pale yellow crystals (yield 99%).
¹ H NMR (300 MHz, DMSO-d ₆ ): δ ppm 7.16 (3H, brs), 7.17 (3H, brs), 11.50 (3H, brs), 11.58 (1H, s), 12.86 (1H, s).

Reference Example 7
6,8-dibromo-2,3-dimethylimidazo [1,2-a] pyrazine 3,5-dibromopyrazin-2-amine (5.09 g, 20.1 mmol), 3-bromobutan-2-one (2. A mixture of 36 mL, 22.1 mmol), disodium hydrogen phosphate (4.28 g, 30.2 mmol) and n-butanol (50 mL) was heated at 90 ° C. for 3 hours. After stirring at 110 ° C. for 6 hours and at 130 ° C. for 15 hours, 3-bromobutan-2-one (1.07 mL, 10.1 mmol) was added, and the mixture was heated to reflux for 48 hours. Water was added at room temperature, followed by extraction with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (87: 13-35: 65)] to give the title compound (260 mg) as white crystals (yield 4 %).
MS Found: 304 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ) δ ppm 2.44 (3H, s), 2.51 (3H, s), 7.91 (1H, s).

Reference Example 8
6-bromo-2,3-dimethylimidazo [1,2-a] pyrazin-8-amine 6,8-dibromo-2,3-dimethylimidazo [1,2-a] pyrazine (255 mg, 1.06 mmol) and A mixture of aqueous ammonia (28%, 2.5 mL) was stirred at 100 ° C. for 7 hours. The crystals were collected by filtration and washed with water to give the title compound (161 mg) as a brown solid (yield 63%).
¹ H NMR (300 MHz, CDCl ₃ ) δ ppm 2.34 (3H, s), 2.39 (3H, s), 5.70 (2H, brs), 7.38 (1H, s).

Reference Example 9
To a solution of 3-bromopentane-2,4-dioneacetylacetone (5.00 mL, 48.9 mmol) in carbon tetrachloride (49 mL) was added N-bromosuccinimide (NBS) (9.15 g, 51.4 mmol) and ammonium acetate (377 mg). 4.89 mmol) was added. The reaction mixture was stirred at 80 ° C. for 1.5 hours and cooled to room temperature. The mixture was washed with saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by distillation under reduced pressure (2 torr, 35 ° C.) to give the title compound (6.50 g) as a colorless oil (yield 36%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.34 (6H, s), 4.73 (1H, s).

Reference Example 10
A mixture of 2-bromopentan-3-one 3-pentanone (5.00 g, 58.1 mmol) and NBS (11.3 g, 63.9 mmol) in carbon tetrachloride (58 mL) described in the literature (J. Org Chem. 1997, 62, 8952-8954) was added sodium hydrogen sulfate-silica gel (5.81 g, 27.4 mmol) at room temperature. The reaction mixture was stirred at 80 ° C. for 1.5 hours, cooled to room temperature and filtered. The filtrate was concentrated under reduced pressure, hexane was added to the residue, the precipitated white solid was removed by filtration, and the filtrate was concentrated under reduced pressure to give the title compound (6.97 g) as a brown oil (yield 72%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.11 (3H, t, J = 7.2 Hz), 1.74 (3H, d, J = 6.8 Hz), 2.53-2.64 ( 1H, m), 2.81-2.91 (1H, m), 4.41 (1H, q, J = 6.8 Hz).

Reference Example 11
8-Bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (2.50 g, 10.4 mmol) and chloroacetaldehyde (45% aqueous solution) A mixture of 1.99 g, 11.4 mmol) in ethanol (19.0 mL) was refluxed for 24 hours, cooled to room temperature, and concentrated under reduced pressure. The residue was diluted with water (80 mL), washed with saturated aqueous sodium bicarbonate and extracted with dichloromethane (3 × 80 mL). The organic layers were combined, washed with saturated brine (80 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1-1: 2)] to give the title compound (2.33 g) as a yellow solid (yield 85%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 7.61 (1H, s), 7.79 (1H, d, J = 1.2 Hz), 7.82 (1H, d, J = 1.2 Hz) 8.52 (1H, d, J = 1.6 Hz).

Reference Example 12
N- (diphenylmethylidene) -6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-6- (trifluoromethyl) imidazo [1,2-a] pyridine (2 .20 g, 8.30 mmol), benzophenone imine (2.08 mL, 12.4 mmol), tris (dibenzylideneacetone) dipalladium (0) (380 mg, 0.415 mmol), 2,2′-bis (diphenylphosphino) A mixture of -1,1′-binaphthyl (BINAP) (775 mg, 1.24 mmol) and sodium tert-butoxide (1.03 g, 10.7 mmol) in toluene (41.5 mL) was heated at 85 ° C. for 6 hours, Cooled to room temperature. The mixture was diluted with dichloromethane, filtered through celite, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1-1: 1)] to give the title compound (2.61 g) as a yellow oil (yield 86%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 6.35 (1H, d, J = 1.6 Hz), 7.18-7.23 (5H, m), 7.42 (2H, t, J = 7.2 Hz), 7.51 (1H, t, J = 7.2 Hz), 7.61 (1H, d, J = 1.2 Hz), 7.67 (1H, d, J = 1.6 Hz), 7.86 (2H, d, J = 1.6 Hz), 8.13 (1H, t, J = 1.6 Hz).

Reference Example 13
6- (Trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (2 Sodium acetate (1.40 g, 17.1 mmol) and hydroxylamine hydrochloride (894 mg, 12.8 mmol) were added at room temperature to a solution of .61 g, 7.14 mmol) in methanol (71.4 mL). The reaction mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1-1: 5)] to give the title compound (812 mg) as a yellow solid (yield 56%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 4.74 (2H, s), 6.41 (1H, d, J = 0.9 Hz), 7.60 (2H, s), 7.97 (1H , T, J = 0.9 Hz).

Reference Example 14
8-bromo-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (3.00 g, 12.4 mmol), 2- A mixture of bromopropanal (3.41 g, 24.9 mmol) and disodium hydrogen phosphate (2.65 g, 18.6 mmol) in n-butanol (25 mL) was stirred at 120 ° C. for 3 days and cooled to room temperature. . The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, washed with saturated brine (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (2.24 g) as a yellow solid (yield 64%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.52 (3H, s), 7.56 (2H, s), 5.20 (1H, s).

Reference Example 15
N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-3-methyl-6- (trifluoromethyl) imidazo [1 , 2-a] pyridine (2.20 g, 7.88 mmol), benzophenone imine (1.98 mL, 11.8 mmol), tris (dibenzylideneacetone) dipalladium (0) (361 mg, 0.394 mmol), BINAP (736 mg) , 1.18 mmol) and sodium tert-butoxide (985 mg, 10.2 mmol) in toluene (42.0 mL) was heated at 85 ° C. for 6 h and cooled to room temperature. The mixture was diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-2: 1)] to give the title compound (2.40 g) as a yellow oil. Obtained (yield 81%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.45 (3H, s), 6.33 (1H, s), 7.19 (5H, s), 7.37-7.47 (4H, m ), 7.82-7.84 (3H, m).

Reference Example 16
3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) imidazo [1,2-a ] Sodium acetate (1.25 g, 15.2 mmol) and hydroxylamine hydrochloride (794 mg, 11.4 mmol) were added to a solution of pyridine-8-amine (2.40 g, 6.35 mmol) in methanol (64.0 mL) at room temperature. It was. The mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (1.06 g) as a yellow solid (yield 78%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.46 (3H, s), 4.72 (2H, brs), 6.39 (1H, d, J = 1.2 Hz), 7.34 (1H , S), 7.68 (1H, s).

Reference Example 17
8-Bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (3.00 g, 12.4 mmol), bromoacetone A mixture of (1.14 mL, 13.6 mmol) and disodium hydrogen phosphate (2.65 g, 18.6 mmol) in n-butanol (25 mL) was stirred at 120 ° C. for 3 days and cooled to room temperature. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, washed with saturated brine (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (1.92 g) as a yellow solid (yield 55%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.52 (3H, d, J = 0.8 Hz), 7.52-7.57 (2H, m), 8.40 (1H, d, J = 1.2 Hz).

Reference Example 18
N- (diphenylmethylidene) -2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-2-methyl-6- (trifluoromethyl) imidazo [1 , 2-a] pyridine (1.80 g, 6.45 mmol), benzophenone imine (1.62 mL, 9.68 mmol), tris (dibenzylideneacetone) dipalladium (0) (295 mg, 323 mmol), BINAP (602 mg, 0 .968 mmol) and sodium tert-butoxide (806 mg, 8.39 mmol) in toluene (33 mL) were heated at 85 ° C. for 6 h and cooled to room temperature. The mixture was diluted with dichloromethane, filtered through celite, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1-1: 1)] to give the title compound (1.40 g) as a yellow oil (yield 57%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.46 (3H, d, J = 0.8 Hz), 6.20 (1H, d, J = 1.6 Hz), 7.18-7.24 ( 5H, m), 7.34-7.42 (4H, m), 7.84 (1H, s), 7.86 (1H, s), 8.01-8.03 (1H, m).

Reference Example 19
2-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -2-methyl-6- (trifluoromethyl) imidazo [1,2-a ] Sodium acetate (1.25 g, 15.2 mmol) and hydroxylamine hydrochloride (794 mg, 11.4 mmol) were added to a solution of pyridine-8-amine (1.40 g, 3.69 mmol) in methanol (40.0 mL) at room temperature. It was. The mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (689 mg) as a yellow solid (yield 87%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.45 (3H, s), 4.66 (2H, brs), 6.38 (1H, d, J = 1.2 Hz), 7.33 (1H , D, J = 0.8 Hz), 7.87 (1H, d, J = 1.4 Hz).

Reference Example 20
1- [8-Bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-3-yl] ethanone 2-amino-3-bromo-5-trifluoromethylpyridine (2. 00 g, 8.30 mmol), 3-bromopentane-2,4-dione (2.97 g, 16.6 mmol) and disodium hydrogen phosphate (1.76 g, 12.4 mmol) in n-butanol (20 mL). The mixture was stirred at 120 ° C. for 3 days and cooled to room temperature. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, washed with saturated brine (50 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (339 mg) as a brown solid (yield 12%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.68 (3H, s), 2.88 (3H, s), 7.86 (1H, d, J = 1.6 Hz), 10.13 (1H , S).

Reference Example 21
1- [8-Bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-3-yl] ethanol in a mixture of THF (3.00 mL) and methanol (6.00 mL) Of 1- [8-bromo-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-3-yl] ethanone (610 mg, 1.90 mmol) to sodium borohydride (94.0 mg) 2.47 mmol) was added at room temperature. The reaction mixture was stirred for 1 hour at room temperature and quenched with water. After concentration under reduced pressure, the residue was diluted with water (15 mL) and extracted with dichloromethane (3 × 15 mL). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure to give the title compound (650 mg, quantitative), which was used in the next reaction without purification.
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.64 (3H, d, J = 6.8 Hz), 2.31 (3H, s), 5.35 (1H, q, J = 6.8 Hz) 7.51 (1H, d, J = 1.2 Hz), 8.88 (1H, s). * OH peak was not observed.

Reference Example 22
8-Bromo-3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 1- [8-bromo-2-methyl-6- (trifluoromethyl) imidazo [1, To a solution of 2-a] pyridin-3-yl] ethanol (550 mg, 1.70 mmol) in trifluoroacetic acid (2.62 mL, 34.0 mmol) was added triethylsilane (1.69 mL, 10.2 mmol) at 0 ° C. . The reaction mixture was stirred for 1 hour at room temperature and then heated to 80 ° C. for 16 hours under an argon atmosphere. After concentration under reduced pressure, the residue was dissolved in ethyl acetate (50 mL) and neutralized with a saturated aqueous solution. The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (7: 1-4: 1)] to give the title compound (472 mg) as a white solid (yield 90%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.26 (3H, t, J = 7.6 Hz), 2.50 (3H, s), 2.92 (2H, q, J = 7.6 Hz) 7.53 (1H, d, J = 1.2 Hz), 8.18 (1H, t, J = 1.2 Hz).

Reference Example 23
N- (diphenylmethylidene) -3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-3-ethyl-2-methyl-6- (Trifluoromethyl) imidazo [1,2-a] pyridine (550 mg, 1.79 mmol), benzophenone imine (451 μl, 2.69 mmol), tris (dibenzylideneacetone) dipalladium (0) (42.0 mg, 0. 179 mmol), BINAP (167 mg, 0.269 mmol) and sodium tert-butoxide (224 mg, 2.32 mmol) in toluene (9 mL) were heated at 85 ° C. for 6 hours and cooled to room temperature. The mixture was diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-3: 1)] to give the title compound (700 mg) as a yellow oil. (Yield 96%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.23 (3H, t, J = 7.6 Hz), 2.45 (3H, s), 2.88 (2H, q, J = 7.6 Hz) 6.16 (1H, d, J = 1.6 Hz), 7.18-7.25 (4H, m), 7.36-7.52 (5H, m), 7.82-7.85 ( 2H, m).

Reference Example 24
3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -3-ethyl-2-methyl-6- (trifluoromethyl ) A solution of imidazo [1,2-a] pyridin-8-amine (700 mg, 1.71 mmol) in methanol (17.0 mL) with sodium acetate (338 mg, 4.12 mmol) and hydroxylamine hydrochloride (215 mg, 3.09 mmol) Was added at room temperature. The reaction mixture was stirred for 6 hours at room temperature and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (25 mL) and dichloromethane (25 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1-1: 5)] to give the title compound (319 mg) as a yellow solid (yield 76%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.23 (3H, t, J = 7.6 Hz), 2.45 (3H, s), 2.88 (2H, q, J = 7.6 Hz) 4.62 (2H, brs), 6.38 (1H, d, J = 1.6 Hz), 7.68 (1H, d, J = 1.2 Hz).

Reference Example 25
8-bromo-2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (500 mg, 2.07 mmol), A mixture of 2-bromopentan-3-one (856 mg, 5.19 mmol), titanium tetrachloride (171 μL, 1.55 mmol) and triethylamine (173 μL, 1.24 mmol) in chloroform (2.0 mL) was stirred with 110 Microwave irradiation at 25 ° C. for 25 minutes. The reaction mixture was diluted with dichloromethane (15 mL) and 10% aqueous potassium carbonate (15 mL). The aqueous layer was extracted with dichloromethane (2 × 15 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1-5: 1)] to give the title compound (505 mg) as a yellow solid (yield 79%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.30 (3H, t, J = 7.6 Hz), 2.45 (3H, s), 2.82 (2H, q, J = 7.6 Hz) 7.51 (1H, d, J = 1.6 Hz), 8.12 (1H, t, J = 1.2 Hz).

Reference Example 26
N- (diphenylmethylidene) -2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-2-ethyl-3-methyl-6- (Trifluoromethyl) imidazo [1,2-a] pyridine (560 mg, 1.82 mmol), benzophenone imine (459 μL, 2.74 mmol), tris (dibenzylideneacetone) dipalladium (0) (42.7 mg, 0.82 mmol). 182 mmol), BINAP (341 mg, 0.547 mmol) and sodium tert-butoxide (228 mg, 2.37 mmol) in toluene (9 mL) were heated at 85 ° C. for 6 h and cooled to room temperature. The mixture was diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (4: 1-2: 1)] to give the title compound (708 mg) as a yellow oil. (Yield 95%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.26 (3H, t, J = 7.6 Hz), 2.40 (3H, s), 2.79 (2H, q, J = 7.6 Hz) 6.27 (1H, d, J = 1.6 Hz), 7.17-7.24 (4H, m), 7.38-7.52 (5H, m), 7.78-7.85 ( 2H, m).

Reference Example 27
2-Ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -2-ethyl-3-methyl-6- (trifluoromethyl ) A solution of imidazo [1,2-a] pyridin-8-amine (708 mg, 1.73 mmol) in methanol (30 mL) was added sodium acetate (342 mg, 4.15 mmol) and hydroxylamine hydrochloride (217 mg, 3.13 mmol) at room temperature. Added in. The mixture was stirred for 6 hours at room temperature and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (25 mL) and dichloromethane (25 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1-1: 5)] to give the title compound (339 mg) as a yellow solid (yield 68%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.30 (3H, t, J = 7.6 Hz), 2.41 (3H, s), 2.77 (2H, q, J = 7.6 Hz) 4.63 (2H, brs), 6.39 (1H, d, J = 1.6 Hz), 7.64 (1H, t, J = 1.2 Hz).

Reference Example 28
8-bromo-2,3-dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridine 2-amino-3-bromo-5-trifluoromethylpyridine (3.00 g, 12.4 mmol), A mixture of 3-bromobutan-2-one (2.76 g, 18.2 mmol) and disodium hydrogen phosphate (3.53 g, 23.9 mmol) in n-butanol (33.0 mL) was stirred at 120 ° C. for 3 days. And cooled to room temperature. The reaction mixture was diluted with water (75 mL) and extracted with ethyl acetate (3 × 75 mL). The organic layers were combined, washed with saturated brine (75 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-2: 1)] to give the title compound (3.40 g) as a yellow solid (yield 69%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.46 (3H, s), 2.50 (3H, s), 7.54 (1H, s), 8.14 (1H, s).

Reference Example 29
N- (diphenylmethylidene) -2,3-dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine 8-bromo-2,3-dimethyl-6- (trifluoromethyl) ) Imidazo [1,2-a] pyridine (1.42 g, 4.85 mmol), benzophenone imine (1.22 mL, 7.27 mmol), tris (dibenzylideneacetone) dipalladium (0) (222 mg, 0.242 mmol) , BINAP (453 mg, 0.727 mmol) and sodium tert-butoxide (605 mg, 6.30 mmol) in toluene (25.0 mL) were heated at 85 ° C. for 6 hours and cooled to room temperature. The mixture was diluted with dichloromethane, filtered through celite, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (5: 1-1: 1)] to give the title compound (1.34 g) as a yellow oil (yield 70%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.40 (3H, s), 2.43 (3H, s), 6.18 (1H, d, J = 1.2 Hz), 7.18-7 .25 (5H, m), 7.36-7.42 (2H, m), 7.46-7.52 (1H, m), 7.76-7.85 (3H, m).

Reference Example 30
2,3-Dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine N- (diphenylmethylidene) -2,3-dimethyl-6- (trifluoromethyl) imidazo [1 , 2-a] Pyridin-8-amine (1.32 g, 3.36 mmol) in methanol (34.0 mL) was added sodium acetate (661 mg, 8.05 mmol) and hydroxylamine hydrochloride (420 mg, 6.04 mmol) at room temperature. Added in. The reaction mixture was stirred at room temperature for 6 hours and concentrated under reduced pressure. The residue was partitioned between 0.1N aqueous sodium hydroxide (50 mL) and dichloromethane (50 mL). The organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (2: 1-1: 4)] to give the title compound (397 mg) as a yellow solid (yield 51%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.40 (3H, s), 2.42 (3H, s), 4.61 (2H, s), 6.40 (1H, d, J = 1) .6 Hz), 7.63 (1H, t, J = 1.6 Hz).

Reference Example 31
2-Hydrazino-5- (trifluoromethyl) pyridine 2-chloro-5- (trifluoromethyl) pyridine (20.0 g, 110 mmol) in ethanol (370 mL) in hydrazine monohydrate (10.8 mL, 220 mmol) Was added at room temperature. The resulting reaction mixture was refluxed for 6 hours and then concentrated under reduced pressure to give the title compound (18.5 g, yield 95%) as a yellow oil, which was used in the next step without purification.
¹ H NMR (400 MHz, DMSO-d ₆ ): δ ppm 5.63 (2H, brs), 6.82 (1H, d, J = 8.8 Hz), 7.70 (1H, dd, J = 8. 8, 1.6 Hz), 8.27 (1H, s), 8.28 (1H, brs).

Reference Example 32
3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 2-hydrazino-5- (trifluoromethyl) pyridine (18.5 g, 104 mmol) and acetic acid (500 mL ) Was refluxed for 24 hours and then concentrated under reduced pressure. The residue was partitioned between ethyl acetate (100 mL) and water (100 mL). The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution (100 mL) and saturated brine (100 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: ethyl acetate only] to give the title compound (16.0 g)
Was obtained as a yellow solid (76% yield).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.83 (3H, s), 7.37 (1H, dd, J = 10.0, 1.6 Hz), 7.86 (1H, d, J = 9.6 Hz), 8.25 (1H, d, J = 1.2 Hz).

Reference Example 33
8-Bromo-3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 3-methyl-6- (trifluoromethyl) [1,2,4] triazolo To a solution of [4,3-a] pyridine (16.0 g, 80.0 mmol) in acetonitrile (260 mL) was added NBS (17.0 g, 95 mmol) at room temperature. The reaction mixture was refluxed for 6 hours, cooled to room temperature, and then quenched with water (100 mL). The mixture was extracted with ethyl acetate (150 mL), washed with water (3 × 150 mL), dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1)] to obtain the title compound (8.00 g) as a yellow solid (yield 36%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.84 (3H, s), 7.63 (1H, d, J = 1.2 Hz), 8.27 (1H, t, J = 1.2 Hz) .

Reference Example 34
N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine 8-bromo-3-methyl-6- ( Trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine (1.50 g, 5.36 mmol), benzophenone imine (1.35 mL, 8.03 mmol), tris (dibenzylideneacetone) dipalladium A mixture of (0) (1.47 g, 1.61 mmol), BINAP (2.00 g, 3.21 mmol) and sodium tert-butoxide (0.720 g, 7.50 mmol) in toluene (26.8 mL) Heat at 3 ° C. for 3 hours. The reaction mixture was cooled to room temperature, diluted with dichloromethane and filtered through celite. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (3: 1)] to give the title compound (430 mg) as a yellow solid (yield 21%). .
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.76 (3H, s), 6.37 (1H, d, J = 1.6 Hz), 7.24-7.27 (5H, m), 7 .39-7.46 (2H, m), 7.50-7.54 (1H, m), 7.83 (1H, t, J = 1.2 Hz), 7.82-7.89 (2H, m).

Reference Example 35
3-methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine N- (diphenylmethylidene) -3-methyl-6- (trifluoromethyl) To a solution of [1,2,4] triazolo [4,3-a] pyridin-8-amine (430 mg, 1.13 mmol) in methanol (10 mL), sodium acetate (223 mg, 2.71 mmol) and hydroxylamine hydrochloride (141 mg, 2.04 mmol) was added at room temperature. The reaction mixture was stirred at room temperature for 5 hours and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: ethyl acetate only] to give the title compound (100 mg) as a white solid (yield 41%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 2.77 (3H, s), 5.17 (2H, brs), 6.38 (1H, d, J = 1.2 Hz), 7.66 (1H , T, J = 1.2 Hz).

Reference Example 37
2-Methyl-8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridine 3-methyl-6- (trifluoromethyl) [1,2,4] triazolo To a mixture of [4,3-c] pyridine (compound of Reference Example 32) (1000 mg, 5.0 mmol), trifluoroacetic acid (8.4 mL) and trifluoroacetic anhydride (4.9 mL), ammonium nitrate (800 mg, 10 mmol) was added. ) Was added at room temperature and stirred for 1 hour. The reaction mixture was added to saturated aqueous sodium hydrogen carbonate solution at 0 ° C., and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the title compound (280 mg) as a green solid (yield 23%).
MS Found: 247 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 2.76 (3H, s), 8.66 (1H, d, J = 3.0 Hz), 9.14-9.15 (1H, m).

Reference Example 38
2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine 2-methyl-8-nitro-6- (trifluoromethyl) [1,2 , 4] triazolo [1,5-a] pyridine (compound of Reference Example 37) (10 mg, 0.04 mmol), and ethanol (0.5 mL) were added with 10% palladium carbon (10 mg) at room temperature. The mixture was stirred for 14 hours under a hydrogen stream. Ethyl acetate was added and the reaction mixture was filtered through celite and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (80: 20-50: 50)] to give the title compound (7.5 mg) as colorless crystals (yield 85 %).
MS Found: 217 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 2.60 (3H, s), 4.70 (2H, brs), 6.68 (1H, s), 8.27 (1H, s).

Reference Example 39
A mixture of 2-chloro-3-nitro-5- (trifluoromethyl) pyridine 3-nitro-5- (trifluoromethyl) pyridin-2-ol (50.0 g, 240 mmol) and phosphoryl chloride (224 mL) was added at 110 ° C. Heated overnight. The reaction mixture was cooled to room temperature, diluted with water (300 mL), neutralized with saturated aqueous sodium bicarbonate (300 mL), and extracted three times with ethyl acetate (200 mL). The combined organic layers were dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1)] to give the title compound (52.8 g) as a yellow oil (yield 97%).
MS Found: 208 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 8.47 (1H, d, J = 1.6 Hz), 8.89 (1H, dd, J = 2.4, 0.8 Hz).

Reference Example 40
2-Hydrazino-3-nitro-5- (trifluoromethyl) pyridine 2-chloro-3-nitro-5- (trifluoromethyl) pyridine (20.0 g, 88.0 mmol) in ethanol (100 mL) in hydrazine Hydrate (9.13 mL, 88.0 mmol) was added at room temperature. The reaction mixture was stirred for 0.5 hours at room temperature and then concentrated under reduced pressure. The resulting residue was diluted with water (100 mL) and extracted three times with ethyl acetate (100 mL). The combined organic layers were dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give the title compound (19.0 g, yield 96%) as a dark brown oil, which was used in the next step without purification.
¹ H NMR (400 MHz, DMSO-d ₆ ): δ ppm 4.43 (2H, s), 8.67 (2H, d, J = 10.4 Hz), 9.28 (1H, s).

Reference Example 41
8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridine 2-hydrazino-3-nitro-5- (trifluoromethyl) pyridine (30.0 mg,. 135 mmol) and formic acid (3 mL) were heated at 85 ° C. for 16 h. The reaction mixture was cooled to room temperature, diluted with water (10 mL), and extracted three times with ethyl acetate (10 mL). The combined organic layers were dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1)] to give the title compound (20 mg) as a yellow oil (yield 64%).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 8.72 (1H, s), 8.73 (1H, d, J = 1.6 Hz), 9.29 (1H, dd, J = 1.6, 1.2 Hz).

Reference Example 42
6- (Trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine 8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [1,5 -A] To a mixture of pyridine (15.0 mg, 0.065 mmol) and ethanol (2 mL) was added 10% palladium carbon (13.7 mg) at room temperature, and the mixture was stirred under a hydrogen stream for 3 hours. The reaction mixture was filtered through celite and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (10: 1)] to give the title compound (11.4 mg) as white crystals (yield 87%).
MS Found: 203 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.10 (2H, s), 6.73 (1H, d, J = 1.2 Hz), 8.32 (1H, s), 8.38 (1H , S).

Reference Example 43
8-Nitro-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridine 2-hydrazino-3-nitro-5- (trifluoromethyl) pyridine (10.0 g, 45. 0 mmol) and triethyl orthoformate (50 mL) were heated at 85 ° C. for 16 h. The precipitated solid was collected by filtration, washed 3 times with ether (100 mL), and dried at 25 ° C. to give the title compound (6.77 g) as a yellow solid (yield 65%).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 8.46 (1H, d, J = 1.6 Hz), 9.17 (1H, d, J = 1.2 Hz), 9.33 (1H, s) .

Reference Example 44
6- (Trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine 8-nitro-6- (trifluoromethyl) [1,2,4] triazolo [4,3 -A] Iron powder (15.6 g, 28.0 mmol) was added to a mixed solution of pyridine (6.50 g, 28.0 mmol) in water (100 mL) and acetic acid (20 mL) at room temperature. The mixture was heated at 50 ° C. for 2 hours and then cooled to room temperature. The reaction mixture was filtered through Celite, and the filtrate was diluted with water (100 mL) and ethyl acetate (200 mL), and then the mixture was stirred at room temperature for 30 minutes. After separating the aqueous layer and extracting three times with ethyl acetate (10 mL). The combined organic layers were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (1: 1)] to obtain the title compound (1.50 g) as a brown solid (yield 27%).
MS Found: 203 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 5.25 (2H, s), 6.41 (1H, s), 7.96 (1H, s), 8.86 (1H, s).

Example 1
Methyl 2,3-dimethyl-8-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) imidazo [1,2-a] Pyridine-6-carboxylate

[3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (265 mg, 1.07 mmol), methyl 8-amino-2,3 synthesized in Reference Example 3 -A mixture of dimethylimidazo [1,2-a] pyridine-6-carboxylate (195 mg, 0.89 mmol), diisopropylethylamine (0.46 mL, 2.67 mmol) and N, N-dimethylformamide (DMF) (5 mL) Was added O- (7-azabenzotriazol-1-yl) -1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (407 mg, 1.07 mmol) at room temperature, and then at 60 ° C. Stir for 60 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (70: 30-20: 80)] and washed with n-hexane to give the title compound (84 mg) as a colorless product. Obtained as crystals (yield 18%).
MS Found: 450 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.74-1.92 (4H, m), 2.39 (3H, s), 2.43 (3H, s), 2.64 (4H, t , J = 6.03 Hz), 3.93 (3H, s), 4.95 (2H, s), 8.38 (1H, d, J = 1.51 Hz), 8.48 (1H, d, J = 1.51 Hz), 9.19 (1H, brs).

Example 2
N- [6- (1-hydroxy-1-methylethyl) -2,3-dimethylimidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide

Methyl 2,3-dimethyl-8-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) imidazo synthesized in Example 1 [ 1,2-a] pyridine-6-carboxylate (42 mg, 0.09 mmol) and THF (0.5 mL) were mixed with methylmagnesium bromide (3 M solution in diethyl ether) (0.16 mL, 0.47 mmol) at 0 ° C. And then stirred at room temperature for 2 hours and at 50 ° C. for 1 hour. Methanol, water and 1N hydrochloric acid were added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (60: 40-25: 75)] to give the title compound (13 mg) as a colorless amorphous powder ( Yield 31%).
MS Found: 450 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.61 (6H, s), 1.72-1.91 (4H, m), 2.35 (6H, s), 2.52-2.69 (5H, m), 4.96 (2H, s), 7.79 (1H, d, J = 1.51 Hz), 8.06 (1H, d, J = 1.51 Hz), 9.34 (1H , Brs).

Example 3
N- (6-Chloro-2,3-dimethylimidazo [1,2-a] pyridin-8-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H- Indazol-1-yl] acetamide

[3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (133 mg, 0.54 mmol), 6-chloro-2,3-synthesized in Reference Example 6 HATU (205 mg, 0.54 mmol) was added to a mixture of dimethylimidazo [1,2-a] pyridin-8-amine hydrochloride (104 mg, 0.45 mmol), diisopropylethylamine (0.35 mL, 2.02 mmol) and DMF (5 mL). ) Was added at room temperature, followed by stirring at 60 ° C. for 36 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (70: 30-15: 85)] to give the title compound (30 mg) as a colorless solid (yield 13 %).
MS Found: 426 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.74-1.91 (4H, m), 2.36 (3H, s), 2.37 (3H, s), 2.51-2.74 (4H, m), 4.95 (2H, s), 7.59 (1H, d, J = 1.51 Hz), 8.06 (1H, d, J = 1.88 Hz), 9.43 (1H , Brs).

Example 4
N- (6-Bromo-2,3-dimethylimidazo [1,2-a] pyrazin-8-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H- Indazol-1-yl] acetamide

[3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (152 mg, 0.63 mmol), 6-bromo-2,3- synthesized in Reference Example 8 HATU (264 mg, 0.69 mmol) was added to a mixture of dimethylimidazo [1,2-a] pyrazin-8-amine (172 mg, 0.69 mmol), diisopropylethylamine (0.18 mL, 1.04 mmol) and DMF (2 mL). After adding at room temperature, it stirred at 60 degreeC for 20 hours. HATU (264 mg, 0.69 mmol) and diisopropylethylamine (0.18 mL, 1.04 mmol) were added, and the mixture was stirred at 60 ° C. for 5 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (60: 40-20: 80)] and preparative HPLC to give the title compound (13 mg) as a colorless solid. (Yield 4%).
MS Found: 471 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.72-1.91 (4H, m), 2.41 (3H, s), 2.43 (3H, s), 2.61 (4H, dt , J = 11.83, 6.01 Hz), 5.49 (2H, s), 7.69 (1H, s), 9.07 (1H, brs).

Example 5
N- [2,3-Dimethyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7- Tetrahydro-1H-indazol-1-yl] acetamide

[3- (Trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (39 mg, 0.157 mmol), 2,3-dimethyl-6- synthesized in Reference Example 30 To a mixture of (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (36 mg, 0.157 mmol), triethylamine (0.066 mL, 0.47 mmol) and DMF (6 mL) was added bromotripyrrolidinophosphonium hexa Fluorophosphate (PyBrop) (110 mg, 0.236 mmol) was added at 0 ° C., followed by stirring at room temperature for 18 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by basic silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (75: 25-40: 60)] and washed with n-hexane to give the title compound (40 mg). Obtained as colorless crystals (yield 55%).
MS Found: 460 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.72-1.93 (4H, m), 2.40 (3H, s), 2.42 (3H, s), 2.64 (4H, t , J = 6.0 Hz), 4.95 (2H, s), 7.89 (1H, s), 8.18 (1H, t, J = 1.5 Hz), 9.37 (1H, brs).

Example 6
N- [3-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro- 1H-Indazol-1-yl] acetamide

To a solution of 3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine synthesized in Reference Example 16 in DMF (3.50 mL), HATU (530 mg, 1.39 mmol), N, N-diisopropylethylamine (244 μL, 1.39 mmol) and [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (346 mg, 1.39 mmol) at room temperature Added. The reaction mixture was stirred at room temperature for 3 days, diluted with water (20 mL) and extracted with ethyl acetate (3 × 20 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (370 mg) as a yellow solid (yield 89%).
MS Found: 446.2 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.69-1.76 (4H, m), 2.49-2.55 (5H, m), 2.60 (2H, t, J = 5. 8 Hz), 5.31 (2H, s), 7.55 (1 H, d, J = 1.2 Hz), 8.15 (1 H, d, J = 1.6 Hz), 8.59 (1 H, t, J = 1.4 Hz), 10.9 (1H, s).

Example 7
N- [2-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro- 1H-Indazol-1-yl] acetamide

HATU (795 mg, 795 mg, 2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (300 mg, 1.39 mmol) synthesized in Reference Example 19 was added to a DMF (3.5 mL) solution. 2.09 mmol), N, N-diisopropylethylamine (365 μL, 2.09 mmol) and [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (519 mg, 2.09 mmol) was added at room temperature. The reaction mixture was stirred at room temperature for 3 days, diluted with water (40 mL) and extracted with ethyl acetate (3 × 40 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (150 mg) as a yellow solid (43% yield).
MS Found: 446.2 (M + H).
¹ H NMR (400 MHz, DMSO-d ₆ ): δ ppm 1.76-1.69 (4H, m), 2.43 (3H, s), 2.50-2.55 (2H, m), 2 .60 (2H, t, J = 5.8 Hz), 5.31 (2H, s), 7.87 (1H, d, J = 1.2 Hz), 8.12 (1H, d, J = 1. 6 Hz), 8.91 (1 H, d, J = 1.4 Hz), 10.80 (1 H, s).

Example 8
N- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazole- 1-yl] acetamide

To a solution of 6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine synthesized in Reference Example 13 in DMF (8.00 mL), HATU (368 mg, 0.967 mmol), N, N-diisopropylethylamine (160 μL, 0.967 mmol) and [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (195 mg, 0.967 mmol) were added at room temperature. The reaction mixture was stirred for 3 days at room temperature, diluted with water (20 mL) and extracted with ethyl acetate (3 × 20 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (150 mg) as a yellow solid (43% yield).
MS Found: 432.2 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.75-1.82 (2H, m), 1.83-1.91 (2H, m), 2.65 (4H, t, J = 4. 0 Hz), 4.97 (2H, s), 7.63 (1 H, t, J = 1.2 Hz), 7.66 (1 H, t, J = 1.2 Hz), 8.26 (2H, t, J = 1.2 Hz), 9.31 (1H, s).

Example 9
N- [2-Ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6 7-Tetrahydro-1H-indazol-1-yl] acetamide

To a solution of 2-ethyl-3-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine (339 mg, 3.39 mmol) synthesized in Reference Example 27 in DMF (3.50 mL). HATU (795 mg, 2.09 mmol), N, N-diisopropylethylamine (365 μL, 2.09 mmol) and 3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (519 mg, 2.09 mmol) was added at room temperature. The reaction mixture was stirred for 3 days at room temperature, diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: ethyl n-hexane acetate (2: 1-1: 3)] to give the title compound (554 mg) as a yellow solid (yield 84%).
MS Found: 474.3 (M + H).
¹ H NMR (400 MHz, DMSO-d ₆ ): δ ppm 1.26 (3H, t, J = 7.6 Hz), 1.70-1.77 (4H, m), 2.49-2.55 ( 5H, m), 2.61 (2H, t, J = 5.8 Hz), 2.77 (2H, q, J = 7.4 Hz), 5.33 (2H, s), 8.12 (1H, d, J = 1.6 Hz), 8.51 (1H, d, J = 1.6 Hz), 10.7 (1H, s).

Example 10
N- [3-Ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6 7-Tetrahydro-1H-indazol-1-yl] acetamide

HATU (352 mg, 0.925 mmol) was added to a solution of 3-ethyl-2-methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-amine synthesized in Reference Example 24 in DMF (2.60 mL). ), N, N-diisopropylethylamine (162 μL, 0.925 mmol) and 3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (230 mg, 0.925 mmol) Was added at room temperature. The reaction mixture was stirred at room temperature for 3 days, diluted with water (20 mL) and extracted with ethyl acetate (3 × 20 mL). The organic layers were combined, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (2: 1-1: 3)] to give the title compound (150 mg) as a yellow solid (43% yield).
MS Found: 474.3 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.23 (3H, t, J = 7.4 Hz), 1.77-1.91 (4H, m), 2.40 (3H, s), 2 .64 (4H, t, J = 6.0 Hz), 2.89 (2H, q, J = 7.6 Hz), 4.95 (2H, s), 7.94 (1H, d, J = 1. 2 Hz), 8.16 (1 H, d, J = 1.2 Hz), 9.41 (1 H, brs).

Example 11
N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide

A mixture of oxalyl chloride (0.671 mL, 1.34 mmol), DMF (5.20 μL, 0.067 mmol) and dichloromethane (2.50 mL) was stirred at room temperature for 20 minutes, then 3- (trifluoromethyl) -4, A solution of 5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (250 mg, 1.01 mmol) in dichloromethane (2.50 mL) was added at 0 ° C. The resulting mixture was stirred at room temperature for 1 hour and then concentrated under reduced pressure to obtain a crude acid chloride.
Triethylamine (0.374 mL, 2.69 mmol) was added to a solution of the resulting acid chloride in dichloromethane (5.00 mL), and then 3-methyl-6- (trifluoromethyl) [1,2,4] synthesized in Reference Example 35 was obtained. Triazolo [4,3-a] pyridin-8-amine (150 mg, 0.694 mmol) was added at 0 ° C. The reaction mixture was stirred at room temperature for 4 hours and concentrated under reduced pressure. The residue was extracted with saturated aqueous sodium hydrogen carbonate solution and ethyl acetate (50 mL). The organic layer was extracted with water (2 × 50 mL) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography [developing solvent: n-hexane-ethyl acetate (5: 1)] to give the title compound (70.0 mg) as a yellow solid (yield 24%).
MS Found: 447.3 (M + H).
¹ H NMR (400 MHz, CDCl ₃ ): δ ppm 1.78-1.81 (2H, m), 1.85-1.89 (2H, m), 2.65 (4H, q, J = 6. 4 Hz), 2.79 (3 H, s), 5.07 (2 H, s), 7.97 (1 H, t, J = 1.2 Hz), 8.35 (1 H, d, J = 1.2 Hz) , 9.97 (1H, brs).

Example 12
N- [2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide

A mixture of [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (34 mg, 0.14 mmol), THF (0.7 mL) and DMF (1 drop) Was added with oxalyl chloride (35 mg, 0.28 mmol) at 0 ° C. and stirred for 10 minutes, and then stirred at room temperature for 40 minutes. The reaction mixture was concentrated under reduced pressure, and N, N-dimethylacetamide (DMA) (0.7 mL) was added. This was mixed with 2-methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine (compound of Reference Example 38) (30 mg, 0.14 mmol), triethylamine ( 17 mg, 0.17 mmol) and DMA (0.7 mL) were added at 0 ° C. and stirred for 10 minutes, and then stirred at room temperature for 20 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (100: 0-70: 30)] and preparative HPLC and recrystallized from petroleum ether-diethyl ether to give the title compound ( 1.0 mg) was obtained as pale yellow crystals (yield 1.6%).
MS Found: 447 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.67-2.01 (4H, m), 2.50-2.85 (7H, m), 4.94 (2H, s), 8.47 -8.72 (2H, m), 9.56 (1H, brs).

Example 13
2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2,4] triazolo [1 , 5-a] pyridin-8-yl] acetamide

Mixture of [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (248 mg, 1.00 mmol), THF (5.0 mL) and DMF (5 drops) Was added with oxalyl chloride (169 μL, 2.00 mmol) at 0 ° C. and stirred for 1 hour. The reaction mixture was concentrated under reduced pressure, and THF (3.0 mL) was added. This was treated with 6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-amine (the compound of Reference Example 42) (182 mg, 0.90 mmol), triethylamine (418 μL, 3. 00 mmol) and THF (3.0 mL) at 0 ° C. and stirred for 30 minutes, and then stirred at room temperature for 3.5 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (100: 0-60: 40)] and recrystallized from ethyl acetate-hexane to give the title compound (184 mg) as colorless crystals. Obtained (yield 33%).
MS Found: 433 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.73-1.83 (2H, m), 1.83-1.94 (2H, m), 2.65 (4H, t, J = 6. 2 Hz), 4.96 (2H, s), 8.37 (1 H, s), 8.61 (1 H, d, J = 1.5 Hz), 8.65-8.70 (1 H, m), 9 .46 (1H, s).

Example 14
2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2,4] triazolo [4 , 3-a] pyridin-8-yl] acetamide

Mixture of [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetic acid (248 mg, 1.00 mmol), THF (5.0 mL) and DMF (5 drops) Was added with oxalyl chloride (169 μL, 2.00 mmol) at 0 ° C. and stirred for 1 hour. The reaction mixture was concentrated under reduced pressure, and THF (3.0 mL) was added. This was treated with 6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-amine (the compound of Reference Example 44) (182 mg, 0.90 mmol), triethylamine (418 μL, 3. 00 mmol) and THF (3.0 mL) were added at 0 ° C. and stirred for 30 minutes, and then stirred at room temperature for 4 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography [developing solvent: hexane-ethyl acetate (100: 0-40: 60)] and recrystallized from ethyl acetate-hexane to give the title compound (83 mg) as pale orange crystals. (Yield 21%).
MS Found: 433 (M + H).
¹ H NMR (300 MHz, CDCl ₃ ): δ ppm 1.75-1.84 (2H, m), 1.84-1.93 (2H, m), 2.65 (4H, t, J = 6. 0 Hz), 5.02 (2H, s), 8.22-8.30 (1H, m), 8.37 (1H, s), 8.91 (1H, s), 9.60 (1H, brs) ).

Formulation Example 1
(1) 10.0 g of the compound of Example 1
(2) Lactose 70.0g
(3) Corn starch 50.0g
(4) 7.0g soluble starch
(5) Magnesium stearate 3.0 g

The compound of Example 1 (10.0 g) and magnesium stearate (3.0 g) were granulated with 70 mL of an aqueous solution of soluble starch (7.0 g as soluble starch), dried, lactose (70.0 g) and corn starch ( (Lactose, corn starch, soluble starch and magnesium stearate are all conforming to the 14th revised Japanese Pharmacopoeia). The mixture is compressed to obtain tablets.

Test example 1
(1) Construction of expression gene Human GluR1 flip cDNA was artificially synthesized using human brain-derived cDNA (BD Bioscience) as a template. Amplified by The amplified product was digested with restriction enzymes EcoRI and NotI (Takara Shuzo) and then incorporated into the same site of pcDNA3.1 (+) (trade name) (Invitrogen) to construct pcDNA3.1 (+) / human GluR1 flip gene. Human stargazin cDNA was artificially synthesized using human hippocampal cDNA as a template, forward primer GGTCTCGAGGCCACCATGGGGCTGTTTGATCGAGGTGGTTCA (SEQ ID NO: 3) and reverse primer GTTGGATCCTTATAGGGGGGTGGTCCCGGTG The amplified product was digested with restriction enzymes XhoI and BamHI (Takara Shuzo) and then incorporated into the same site of pcDNA3.1 (-) (Invitrogen) to construct pcDNA3.1 Zeo (-) / human stargazin gene.
(2) Construction of GluR1 flip / stargazin expressing cells Subcultured in culture medium (Ham's F12 medium (Invitrogen) supplemented with 10% inactivated fetal bovine serum (Morgate) and penicillin, streptomycin (Invitrogen)) The CHO-K1 cells were detached using 0.05% trypsin diluted with D-PBS (−) and 0.53 mM EDTA (Invitrogen). The detached cells were suspended using a culture medium and collected by centrifugation at 1,000 rpm. The collected cells were resuspended with D-PBS (−) and added to a 0.4 cm electroporation cuvette (BioRad). 5 μg of pcDNA3.1 (+) / human GluR1 flip gene and 15 μg of pcDNA3.1 Zeo (−) / human stargazin gene were added to CHO-K1 cells using Gene Pulser II (BioRad) at 950 μFd and 250 mV. Introduced. The introduced cells are cultured overnight in a culture medium, and the following day, a selection medium (Zeosin (Invitrogen) is added to the culture medium to 250 μg / mL) is added to a density of 250 cells / well. Seed well plate. Clones that showed drug resistance were selected, and GluR1 flip / stargazin expression clones were selected by the assay method using calcium influx as an index as described below.
(3) AMPA receptor function-enhancing activity assay method for compounds using calcium influx as an indicator CHO-K1 / GluR1 flip / stargazin expressing cells were seeded at 2 × 10 ⁴ cells / well in a 96-well black bottom transparent plate (coaster). And cultured at 37 ° C. in a CO ₂ incubator (SANYO) for 2 days. The medium of the cell plate was removed, and assay buffer A (D-MEM (Invitrogen), 0.1% BSA (Serological Protein), 20 mM HEPES (Invitrogen))) was added to 50 μL / well. Further, a calcium indicator (Calcium 4 Assay Kit, Molecular Device) supplemented with 2.5 mM probenecid (Invitrogen) was added at 50 μL / well and allowed to stand in a CO ₂ incubator at 37 ° C. for 1 hour. A cell plate is set in CellLux (PerkinElmer), and a mixture of 9 mM glutamic acid (final concentration 3 mM) and test compound diluted with assay buffer B (HBSS (Invitrogen), 0.1% BSA, 20 mM HEPES) is prepared. 50 μL (test compound concentration: 30 μM) was added, and the change in fluorescence amount for 3 minutes was measured. 100% is defined as the amount of change in fluorescence value of wells added with final concentration of 3 mM glutamic acid and 300 μM cyclothiazide (TOCRIS), and 0% is defined as the amount of change in fluorescence value of wells with final concentration of 3 mM glutamic acid alone. Calculated by the formula.
Activity (%) = (X−C) / (TC) × 100
T: Change amount of fluorescence value of well added with final concentration of 3 mM glutamic acid and 300 μM cyclothiazide C: Change amount of fluorescence value of well containing only final concentration of 3 mM glutamate X: Fluorescence value of well added with test compound Change

The results are shown in the following table.

The compound of the present invention is useful as a preventive or therapeutic agent for depression, schizophrenia, attention deficit hyperactivity disorder (ADHD) and the like.

SEQ ID NO: 1 is a forward primer for GluR1 flip cDNA.
SEQ ID NO: 2 is a reverse primer for GluR1 flip cDNA.
SEQ ID NO: 3 is a forward primer for stargazin cDNA cDNA.
SEQ ID NO: 4 is a reverse primer for stargazin cDNA cDNA.

Claims (22)

1. Formula (I)
   

   

   [Where:
   R ¹ represents a C _1-6 alkyl group which may be substituted with a halogen atom,
   Ring A represents an optionally substituted carbocyclic ring having 5 to 8 carbon atoms,
   Partial structural formula of formula (I)
   

   

   Represents a condensed heterocyclic group which may have a substituent, containing only 1 to 4 nitrogen atoms as a hetero atom,
   n represents 1 or 2.
   (However,
   N- [6- (1H-pyrazol-4-yl) isoquinolin-3-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] Acetamide,
   N- [4-Cyclopropyl-6- (trifluoromethyl) -1H-pyrazolo [3,4-b] pyridin-3-yl] -2- [3- (difluoromethyl) -4,5,6,7 -Tetrahydro-1H-indazol-1-yl] acetamide,
   2- [3- (difluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- (1-ethyl-1H-benzimidazol-2-yl) acetamide,
   N- {1- [2- (Diethylamino) ethyl] -1H-benzimidazol-2-yl} -2- [3- (difluoromethyl) -4,5,6,7-tetrahydro-1H-indazole-1- Yl] acetamide,
   N, 5-dimethyl-4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5, 6,7-tetrahydropyrazolo [1,5-a] pyrazine-2-carboxamide,
   5-methyl-4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6, 7-tetrahydropyrazolo [1,5-a] pyrazine-2-carboxamide,
   4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6,7-tetrahydropyra Zolo [1,5-a] pyrazine-2-carboxamide,
   4-oxo-3-({[3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] acetyl} amino) -4,5,6,7-tetrahydropyra Zolo [1,5-a] pyridine-2-carboxamide,
   N- (6-Chloroimidazo [1,2-b] pyridazin-3-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] Acetamide, and
   N- (3-oxo-2,3-dihydro-1H-isoindol-4-yl) -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazole-1- Yl] acetamide))]
   Or a salt thereof.
2. Partial structural formula of formula (I)
   

   

   The group represented by may have a substituent,
   

   

   (Wherein X, Y and Z are the same or different and represent a nitrogen atom or a carbon atom which may have a substituent, provided that all of X, Y and Z are simultaneously nitrogen atoms. Absent.)
   The compound of Claim 1 which is group represented by these, or its salt.
3. Partial structural formula of formula (I)
   

   

   The group represented by
   

   

   (Where
   R ² represents a halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group or _{C 1-6} alkoxy, - indicates a carbonyl group,
   X ^a represents a nitrogen atom or —CH═;
   Y ^a represents a nitrogen atom or —CR ³ ═ (R ³ represents a hydrogen atom or a C _1-6 alkyl group);
   Z ^a represents a nitrogen atom or —CR ⁴ ═ (R ⁴ represents a hydrogen atom or a C _1-6 alkyl group). However, not all of X ^a , Y ^a and Z ^a are nitrogen atoms at the same time. Is a group represented by
   The compound according to claim 1, or a salt thereof.
4. The compound according to claim 1, wherein the ring A is cyclohexene, or a salt thereof.
5. Ring A represents cyclohexene,
   R ¹ represents a C _1-6 alkyl group substituted with a halogen atom,
   Indicate
   Partial structural formula of formula (I)
   

   

   The group represented by
   

   

   (Where
   D ¹ ~ ^{D 4} ring are each halogen atom, _{C 1-6} alkyl group substituted by a halogen atom, _{C 1-6} alkyl group substituted by a hydroxy group, and _{C 1-6} alkoxy - selected from a carbonyl group Represents a ring substituted with 1 to 3 substituents of
   The E ¹ to E ⁴ rings each represent a ring optionally substituted with 1 or 2 C _1-6 alkyl groups. Is a group represented by
   The compound according to claim 1, or a salt thereof.
6. Ring A represents cyclohexene,
   R ¹ represents a C _1-6 alkyl group substituted with a halogen atom,
   Partial structural formula of formula (I)
   

   

   Is
   

   

   (Wherein D ⁵ to D ⁷ rings each represent a ring substituted with 1 to 3 C _1-6 alkyl groups substituted with a halogen atom, and E ⁵ to E ⁷ rings each represent 1 Or a salt thereof, or a salt thereof, which represents a group represented by the following formula: or a ring optionally substituted by two C _1-6 alkyl groups.
7. N- [3-Methyl-6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro- 1H-indazol-1-yl] acetamide, or a salt thereof.
8. N- [6- (trifluoromethyl) imidazo [1,2-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazole- 1-yl] acetamide or a salt thereof.
9. N- [3-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [4,3-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
10. N- [2-Methyl-6- (trifluoromethyl) [1,2,4] triazolo [1,5-a] pyridin-8-yl] -2- [3- (trifluoromethyl) -4,5 , 6,7-Tetrahydro-1H-indazol-1-yl] acetamide, or a salt thereof.
11. 2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2,4] triazolo [1 , 5-a] pyridin-8-yl] acetamide, or a salt thereof.
12. 2- [3- (trifluoromethyl) -4,5,6,7-tetrahydro-1H-indazol-1-yl] -N- [6- (trifluoromethyl) [1,2,4] triazolo [4 , 3-a] pyridin-8-yl] acetamide, or a salt thereof.
13. A prodrug of the compound according to claim 1 or a salt thereof.
14. A medicament comprising the compound according to claim 1 or a salt thereof, or a prodrug thereof.
15. The medicament according to claim 14, which is an AMPA receptor function enhancer.
16. The medicament according to claim 14, which is a prophylactic or therapeutic drug for depression, schizophrenia, or attention deficit hyperactivity disorder.
17. A method for enhancing AMPA receptor function, comprising administering an effective amount of the compound according to claim 1 or a salt thereof, or a prodrug thereof to a mammal.
18. A method for preventing or treating depression, schizophrenia, or attention deficit / hyperactivity disorder, which comprises administering an effective amount of the compound according to claim 1 or a salt thereof, or a prodrug thereof to a mammal. .
19. Use of the compound according to claim 1 or a salt thereof, or a prodrug thereof for producing an AMPA receptor function potentiator.
20. Use of the compound according to claim 1 or a salt thereof, or a prodrug thereof for the manufacture of a prophylactic or therapeutic agent for depression, schizophrenia, or attention deficit hyperactivity disorder.
21. The compound according to claim 1 or a salt thereof, or a prodrug thereof, for use in enhancing AMPA receptor function.
22. The compound according to claim 1, or a salt thereof, or a prodrug thereof for use in the prevention or treatment of depression, schizophrenia, or attention deficit hyperactivity disorder.