WO2011008117A2 - The use of a sirna oligonucleotide - Google Patents

The use of a sirna oligonucleotide Download PDF

Info

Publication number
WO2011008117A2
WO2011008117A2 PCT/PL2010/000059 PL2010000059W WO2011008117A2 WO 2011008117 A2 WO2011008117 A2 WO 2011008117A2 PL 2010000059 W PL2010000059 W PL 2010000059W WO 2011008117 A2 WO2011008117 A2 WO 2011008117A2
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
rna
artificial
wnt
sequence
Prior art date
Application number
PCT/PL2010/000059
Other languages
French (fr)
Other versions
WO2011008117A3 (en
Inventor
Monika Lamparska-Przybysz
Piotr Guzenda
Joanna Hucz
Maria Majorek
Aleksandra STAŃCZAK
Maciej Wieczorek
Original Assignee
Celon Pharma Sp. Z.O.O.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Celon Pharma Sp. Z.O.O. filed Critical Celon Pharma Sp. Z.O.O.
Publication of WO2011008117A2 publication Critical patent/WO2011008117A2/en
Publication of WO2011008117A3 publication Critical patent/WO2011008117A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • siRNA oligonucleotide The use of a siRNA oligonucleotide
  • the present invention relates to the use double-stranded interfering mRNA oligonucleotides as novel anticancer drugs for systemic administration.
  • RNAi RNA interference
  • siRNA short, double-stranded RNA molecules
  • RNAse III binds with a complementary mRNA sequence, which facilitates the exonucleolytic cleavage of the mRNA by the enzyme contained in the complex.
  • RNAi is initiated in the cytoplasm when long, double-stranded RNA (dsRNA) or hairpin structure RNA (shRNA). Regardless of its sequence, dsRNA is recognised and hydrolysed by the Dicer nuclease, which belongs to the type III ribonuclease family.
  • the dsRNA digestion product consists of short, double-stranded interfering iRNA , 21-23 nucleotides long [6].
  • the resulting siRNA, along with the RISC silencing complex participate in the degradation of complementary mRNA.
  • the RISC complex preferentially binds one of the siRNA strands.
  • Single-strand siRNA complementarily binds the target mRNA sequence.
  • the Ago2 cleaves the arising mRNA/siRNA duplexes, and further degradation occurs due to exonuclease activity [18, 19].
  • the RISC complex is released and becomes available for further RNAi.
  • RNAi in cancer therapy is possible when the target of the therapy is to lower the expression or activity of a particular protein.
  • tumour cells there are many proteins which are overexpressed in comparison to normal cells.
  • One such protein group consists of the member proteins of the WNT/beta-catenin signalling pathway, which includes 19 WNT ligands.
  • Tumour development mainly involves the following ligands: WNT1, WNT2, WNT3a, WNTSa and WNT8 (see Fig. 1).
  • WNT1 which is a secretory protein which binds to the Frizzled (Fzd) receptor, which activates cytoplasmic phosphatases, which inhibit the activity of glycogen synthase kinase 3 beta (GSK-3beta) (Polakis et al., Wnt signaling and cancer, Genes Dev. 2000 Aug 1;14(15):1837- 51 ).
  • GSK-3beta glycogen synthase kinase 3 beta
  • beta-catenin is not ubiquitinylated and it is transferred into the nucleus, where it activates transcription factors.
  • WNT1 overexpression occurs in many types of cancers, including cancers of the lung, colon, breast, head and neck as well as in sarcomas (Katoh et al. Expression and regulation of WNT1 in human cancer: up-regulation of WNT1 by beta-estradiol in MCF-7, In JOncol, 2003 Jan;22(1):20912).
  • DvI cytoplasmic protein Dishevelled
  • CK1 alpha casein kinase 1 alpha
  • beta-catenin This prevents the phosphorylation of beta-catenin.
  • the phosphorylation of beta-catenin by the kinases GSK-3beta and CK1 alpha is necessary for recognition by the E3 ubiquitinyl ligase complex which is responsible for hydrolysis in lysosomes.
  • the lack of phosphorylation of beta-catenin stabilises it and allows it to be translocated into the nucleus where it is activates the Tcf/Lef transcription factors. Activated Tcf/Lef induce the expression of Wnt dependent genes [8,9]. Many of these genes play a significant role in the regulation of the cell cycle, apoptosis, proliferation and progression of tumours (Tab. 1 ).
  • beta-catenin In the absence of a signal from the WNT/Fzd complex, beta-catenin is phosphorylated by GSK-3beta and CK1 alpha, leading to its ubiquitination and degradation in the proteasome. In this case, Tcf/Lef factors are not activated by beta-catenin, in this case transcription suppressors.
  • cancer therapy requires the systemic administration of drugs, because, in contrast to local treatment, systemic treatments facilitate the distribution of the drug throughout the patient.
  • the active substance is absorbed into the blood from site it enters the bloodstream. This allows the active ingredient to access the target site, which is often far removed from the site of administration.
  • the distribution process consists of the penetration of drugs and their metabolites from the blood into target tissues through biological barriers via active and passive transport.
  • Systemic tumour treatment encompasses chemotherapy, hormone therapy and biological methods.
  • dermal and inhalative administration can also be viewed to be systemic.
  • Drugs absorbed from the gastrointestinal tract access the bloodstream almost exclusively through the hepatic vein, which means that almost the entire dose of the drug passes through the liver.
  • the drugs are subjected to the activity of liver enzymes and metabolised, which lowers their bioavailability. This is called the first pass effect.
  • the biotransformation processes are so rapid that the achievement of therapeutic concentrations of drugs is impossible in target tissues.
  • the rate of metabolic processes is dependent on many individual characteristics, such as sex, age, ethnicity, and physiological status. As a result of this, it is difficult to dose a narrow range of blood concentrations of a drug in different patients.
  • Extraintestinal drugs can be given intravenously, intramuscularly, subcutaneously, cutaneously, intraperitoneally or intracardially.
  • the most failsafe method is injection or an IV drip.
  • IV administration there is no absorption, and the drug mixed with the blood reaches the target tissue.
  • Most IV drugs have a rapid and strong effect. Knowing the patient's weight, one can precisely define the dose necessary to achieve the desired concentration in the blood.
  • Drugs to be administered intravenously should be sterile, free of insoluble contaminants and pyrogens, as well as isohydronic and iso-osmotic.
  • the goal of the present invention is to deliver antitumor drugs for systemic administration, which could be used both to combat existing tumours as well as to prevent metastases.
  • the goal of the present invention is the use of a siRNA oligonucleotide containing a sequence comprising at least 19 nucleotides complementary to the target mRNA sequence encoding a protein of the WNT/beta-catenin pathway in the production of a drug for systemic administration in the treatment of tumours.
  • the target mRNA sequence is selected from among mRNA of the WNT1 gene containing the sequence SEQ ID No. 1 , mRNA of WNT2 containing the sequence SEQ ID No. 2, mRNA of the DVL3 gene containing the sequence SEQ ID No. 3 or the mRNA of the LEF1 gene containing the sequence SEQ ID No. 4.
  • the oligonucleotide complementary to mRNA WNT-1 is an oligonucleotide containing a sequence selected from among SEQ ID Nos. 5-58, as the oligonucleotide complementary to the mRNA of WNT-2 an oligonucleotide containing a sequence selected from among SEQ ID Nos. 59-121 is used, as the oligonucleotide complementary to the mRNA of DVL3 an oligonucleotide containing a sequence selected from among SEQ ID Nos.
  • siRNA is used in the form of a complex with a pharmaceutically permissible carrier.
  • the carrier is polyethylenylimine (PEI), wherein the N/P ratio is less than 12, preferably from 2 to 10, or octoarginine (8R) is used as the carrier, wherein the preferable N/P ratio is from 2 do 60.
  • the drug produced is used for the treatment of cancer, encompassing cancers of the breast, lung, skin, prostate or pancreas.
  • the drug produced is meant for parenteral administration, through intravenous administration or through intraperitoneal injection.
  • the drug is meant for preventing metastases and/or combating tumours.
  • Figure 1 shows a schematic of the WNT1 signalling pathway
  • Figure 2 shows the inhibition of the proliferation of the MCF7 cell line following 72 h of incubation with siWNTI (50 nM).
  • siWNTI 50 nM.
  • Figure 3 shows the dose dependence effect following the use of 12 pmol siWNT1_15 (SEQ ID No. 19) on various cell lines over 72 h.
  • SiTOX - positive transfection control, siWNT1_15 designed siRNA molecule;
  • FIG. 4 shows the inhibition of the proliferation of the H4GO cell line following
  • siWNT2_1 - siWNT2_15 SEQ ID No. 59-744 - designed siRNA molecules against WNT2;
  • Figure 5 shows the varied antiproliferative effect following 72 h of using 100 nM siWNT2, depending on the cell line and the level of expression of WNT2;
  • Figure 6 shows the inhibition of the proliferation of cells following 72 h of incubation with siRNA
  • Figure 7 shows the level of inhibition of genes encoding ligands of the WNT/beta- catenin pathway and genes activated via this pathway, as examined using PCR, a) decrease of mRNA levels, b) dependence of the level of inhibition on siRNA concentration;
  • Figure 8 shows the results of an experiment in which MCF7 breast cancer cells were treated with 100 nM of siRNA specific for WNT1 , and expression measurements of the silenced gene and cyclin Dl made 6, 12, 24 and 48 h after transfection;
  • Figure 9 shows experimental results in which MCF-7 cells treated with siWNT1_15 (SEQ ID No. 19) showed the decreased expression of CCND1 after silencing WNT1 with a specific siRNA sequence;
  • FIG 10 shows the results of an experiment in which LEF1 expression silencing was performed in cells of the line H460;
  • Figure 1 1 shows experimental results for WNT/beta-catenin pathway ligands silenced in lung (H460) and b) breast (MCF7) cancer;
  • Figure 11c shows experimental results for decreased levels of proteins participating in the WNT/beta-catenin pathway and proteins activated via this pathway
  • Figure 11d shows experimental results, in which the decrease in the level of cyclin D1 (CCND1 ) was examined in and MCF7 cell lines;
  • Figure 11e shows experimental results, in which in order to confirm the blocking of the pathway we examined the level of the c-Myc protein activated via the
  • WNT/beta-catenin pathway following the use of specific siRNA that silenced the expression of WNT1 and WNT2 ligands;
  • Figure 12 shows siRNA/PEI (a) and siRNA/R8 where expression was examined in cells of a) cancer, electrophoretic separation of complexes in (b) agarose.
  • Figure 13 shows a comparison of the effectiveness and toxicity of transfection carriers after 48h following transfection with 100 nM siTOX (positive transfection control) and siKneg. (transfection negative control) depending on the N/P ratio.
  • Figure 14a shows the inhibition of tumour growth following the use of the siWNT1_15 (SEQ ID No. 19) siRNA sequence in a dose of 2.5 mg/kg BW; administration to mice bearing a human breast cancer were given siRNA intraperitoneally, black arrows indicate days of administration of the siRNA;
  • Figure 14b shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence in a dose of 5 mg/kg BW; intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;
  • Figure 14c shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence at a dose of 10 mg/kg BW;
  • Figure 14d shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence at a dose of 20 mg/kg BW; intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;
  • Figure 14e shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence at a dose of 40 mg/kg m. c. ; intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;
  • Figure 15 shows a comparison of the effects depending on the frequency of siRNA administration.
  • Mice bearing human breast cancer were given intraperitoneal siRNA daily (continuous line) of a siRNA sequence at a dose of 10 mg/kg BW and every three days (dashed line) of a siRNA sequence at a dose of
  • Figure 16 shows the number of metastases to other organs 28 days following the inoculation of animals that were given siRNA systemically;
  • Figure 17a shows a comparison of the therapeutic effect of siWNT1_15 (SEQ ID No. 19) and docetaxel; Mice bearing human breast cancer were given intravenous siRNA at a dose of 5 mg/kg BW every three days and docetaxel at a dose of 15 mg/kg BW every 6 days;
  • Figure 17b shows a comparison of the effect of siWNT1_15 (SEQ ID No. 19) and docetaxel on body mass in Nu/J mice; The decrease of bodyweight in the docetaxel group indicates cytotoxicity characteristic of cytostatic drugs; No toxic effect observed for siWNT1_15;
  • Figure 18 shows a comparison of the effect of siWNT1_15 (SEQ ID No. 19) and reference substances on cytokine release which is indicative of immunotoxicity;
  • algorhythms are known from prior art, such as Elbashir SM et al. (2001 ) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411 :494-498; Elbahir SM et al. (2001). Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20:6877-6888; Elbashir SM et al. (2002). Analysis of gene function in somatic mammalian cells using small interfering RNAs.
  • nucleotide sequences of mRNA and cDNA corresponding to the proteins connected with the present invention are known from prior art and publically available (i.e. from the GENMED database: www.ncbi.nlm.nih.gov).
  • Appropriate sequences for the WNT1 protein are available from GENMED under the NCBI Reference Sequences (RefSeq) accession NM 005430.
  • the mRNA of WNT1 are shown as SEQ ID No. 1.
  • Appropriate sequences for the WNT2 protein (Homo sapiens wingless-type MMTV integration site family member 2) are available from the GENMED DATABASE under the reference number NCBI Reference Sequences (RefSeq) NM 003391.1.
  • the mRNA of WNT2 are shown as SEQ ID No. 2.
  • Appropriate sequences for the DVL3 Homo sapiens dishevelled, dsh homolog 3 (Drosophila» are available from the GENMED DATABASE under the reference number NCBI Reference Sequences (RefSeq) NM 004423. 3.
  • mRNA of DVL3 are shown as SEQ ID No. 3.
  • Appropriate sequences for the LEF1 Homo sapiens lymphoid enhancer-binding factor 1
  • LEF1 Homo sapiens lymphoid enhancer-binding factor 1
  • RefSeq NCBI Reference Sequences
  • mRNA LEF1 are shown as SEQ ID No. 4.
  • siRNA sequences for WNT-1 are shown as SEQ ID Nos. 5-58,
  • siRNA sequences for WNT-2 are shown as SEQ ID Nos. 59-121 .
  • siRNA sequences for DVL3 are shown as SEQ ID Nos. 122-183,
  • siRNA sequences for LEF1 are shown as SEQ ID Nos. 184- 230.
  • RNA synthesis was performed using the solid phase technique, using typical nucleic acid synthesis protocols using ⁇ -cyanoethyl ester derivatives of phosphoamide esters with the use of a tertbutyldimethylsilane safeguard on group 2 and the -OH of ribose.
  • Phosphoamide oligomers bind to the free 5'-OH group of ribose following activation with 5-benzylmercapto-1H-tetrazole. This reaction proceeds rapidly yielding products, oligomers, very efficiently.
  • the formed oligomers are additionally purified using chromatography (HPLC) or electrophoresis (PAGE).
  • the synthesis was performed on an Applied Biosystems 962 RNA synthesizer.
  • the siRNA was made by gently mixing for 1 hour equimolar amounts complementary RNA strands in 2M acetate buffer in ethanol. This solution was centrifuged for 15 min. and dried with 70% .
  • Example 3 Use of siRNA against genes of the pathway inhibits the proliferation of cancer cells.
  • the siRNA and transfection factor were suspended in OptiMEM and incubated for 20 min at room temperature, wherafter the suspension was transferred into the wells.
  • the cells were incubated for 24h at 37° C, 5% CO 2 , the medium was exchanged and they were incubated for another 48h. After 48h, we performed the MTT test for proliferation (Invitrogen) or ATPIite (Perkin Elmer) according to the manufacturer's instructions.
  • Figure 2 shows the observed inhibition of the proliferation of the cell line MCF7 following 72 h of incubation with siWNTI (SEQ ID No. 19) at a concentration of 50 nM.
  • siWNTI SEQ ID No. 19
  • siWNT-15 sequence siWNT-15 (SEQ ID No. 19), and it was selected for further testing.
  • siWNT1_15 on other cell lines (A549, H460 - lung cancer, PC3 - prostate cancer) also resulted in the inhibition of growth, and the observed effect was dose dependent (Fig. 3).
  • Figure 3 shows the dose-effect dependence following the use of 12 pmol siWNT1_15 (SEQ ID No. 19) on various cell lines for 72 h.
  • SiTOX - positive transfection control siWNT1_15 - designed siRNA molecule. No differences were observed between the untreated cells and the negative transfection control.
  • siRNA directed against WNT2 SEQ ID No. 59-744 inhibited the proliferation of the cell line lung cancer H460 (Fig. 4).
  • Figure 4 shows the observed inhibition of the proliferation of the cell line H460 following 72 h of incubation with siWNT2 in two doses, 50 and 100 nM.
  • No differences were observed between the untreated cells and the negative transfection control siRNA molecules with the greatest antiproliferative activity were also tested against the cell lines A549 and MCF7.
  • the inhibition of proliferation was only observed for the line A549.
  • the use of selected siWNT2 on MCF7, which does not express WNT2 proteins, as expected had not effect on proliferation, giving indirect evidence of the specificity of the designed sequences (Fig. 5)
  • Figure 5 shows the varied antiproliferative effect following 72 h of using 100 nM siWNT2, depending on the cell line and the level of expression of the WNT2. protein.
  • the silencing of two other genes of the Wnt/beta-catenin pathway, DVL3 and LEF1 inhibited of the proliferation of the cell line MCF7.
  • Figure 6 shows the inhibition of the proliferation of cells following 72 h of incubation with siRNA.
  • the MCF7 cells were incubated with 100 nM siLEFI (SEQ ID No. 184-191 ) (a).
  • the MCF7 and H460 cells were incubated with 100 nM siDVL3 (SEQ ID No. 122-129) (b).
  • Example 4 The use of siRNA against ligands of the Wnt/beta-catenin pathway decreases the mRNA level of the target gene and of genes activated by WNT ligands.
  • cDNA synthesis was performed using the ImProm-llTM Reverse Transcriptase kit (Promega). Real-time PCR was performed on a RotorGene 6000 system (Corbett Research). To amplify the genes we used the FastStart TaqMan® Probe Master kit (Roche) and Universal ProbeLibrary probes. Gene expression was expressed as the relative expression in relation to reference genes (GAPD, HPRT1, PBGD, 18S RNA). To calculate the relative expression, we used the Relative Expression Software Tool for Rotor-Gene ⁇ package (REST-RG ⁇ ).
  • the degree of silencing of the genes encoding Wnt/beta-catenin pathway ligands and the genes they activate was examined using real-time PCR.
  • the H460 cells were treated with 100 nM and 50 nM siRNA specific for WNT1 and WNT2 (Fig. 7).
  • the cells were incubated with the siRNA for 18 h and we measured the level of expression of the silenced WNT1 and WNT2 genes, as well as the gene activated by this pathway, the D1 cyclin (CCND1).
  • the attached graphs show that the degree of silencing of the control was 0%, whereas maximum silencing was 100%.
  • siWNT2_2 SEQ ID No. 60
  • siWNT2_11 SEQ ID No. 70
  • Fig. 7a Likewise, only following the use of these sequences did we observe a decrease in CCND1 mRNA.
  • siWNT1_15 SEQ ID No. 19
  • Fig. 7b The breast cancer cells, MCF7, were treated with 100 nM siRNA specific for WNT1.
  • the expression measurements of the silenced genes and cyclin D1 were made 6, 12, 24 and 48 h after transfection (Fig. 8). Like in the case of cells of the H460 line, after treating MCF-7 cells with siWNT1_15 (SEQ ID No. 19) we achieved a decrease in the expression of the CCND1 gene after silencing WNT1 with a specific siRNA sequence. The level of silencing of the WNT1 gene following the use of siWNT1_15 was also measured in prostate cancer cells (PC3), lung cancer cells (A549) and malignant breast cancer cells (MDA-MB-231) (Fig. 9).
  • Example 5 Use of siRNA against WNT/beta-catenin decreases the levels of proteins activated by WNT ligands.
  • Protein isolation reagents were purchased from Sigma-Aldrich.
  • Western blotting reagents were purchased from BioRad, Pierce, Sigma-Aldrich, anti-WNT1 antibodies from Zymed Invitrogen, anti-WNT2 from R&D, anti-actin, anti-GAPDH, anti-cyclin D1, anti-cMyc from Santa Cruz Biotechnology, anti-beta- catenin w Becton Dickinson, anti-active beta-catenin (non-phosphorylated at
  • transfection cell lines 24h prior to the planned transfection cell lines were inoculated onto medium in bottles of 25 or 75 cm 2 at an appropriate density such that on the day of transfection the confluence was at 50%.
  • the medium was replaced with transfection medium, OptiMEM (Gibco).
  • the siRNA and transfection factor were suspended in OptiMEM and incubated for 20 min at room temperature, wherafter the suspension was transferred into the wells.
  • the cells were incubated for 48h at 37° C, 5% CO 2 .
  • the suspension was centrifuged fo r 10 min. at 9000 g. After centrifugation, the supernatant containing cellular proteins was stored.
  • the concentration of proteins in cell lysates was measured using the BCA test
  • the cell lysates were mixed with Laemmli sample buffer (BioRad) at a ratio of 1:1
  • WNT1 and WNT2 (Fig. 11e.). Again, decreased protein levels were observed in both cases.
  • Example 6 A polymer carrier ensures functional siRNA delivery into cells.
  • linear PEI is obtained through the cationic polymerisation of 2-ethyl-2-oxazoline (2-EtOXZ) via decyclization initiated by methyl p-toluenylsulphonate, and the subsequent acid-catalyzed hydrolysis of the resulting poly(N-acetylethylenylimine) 1-4.
  • 2-ethyl-2-oxazoline (1g, 10.09 mmol) is added to a solution of methyl p- toluenosulphonate (9.4 mg, 50.3 mmol), in acetonitrile (10 ml_). The entirety is mixed and heated to boiling for 6 days. The solvent is removed on an evaporator.
  • the raw product is precipitated out using ether and then filtered and dried under reduced pressure. 800 mg of product, a yellow powder, are produced.
  • the octoarginine carrier (R8) was designed by the authors of the present invention and ordered from GLS, China.
  • siRNA-carrier complexes were inoculated onto medium in 48-well plates at an appropriate density such that on the day of transfection the confluence was at 30-50%.
  • transfection carriers suspended in DEPC-treated water (PEI and R8) and 1% acetic acid (4-vinylimidasole).
  • OptiMEM transfection medium
  • siControl TOX siTOX, Dharmacon
  • siKneg. a non-coding siRNA molecule
  • siRNA molecules were suspended in PBS (for complexing with R8) or in 150 mM NaCI (for complexing with PEI), such that the final suspension pH was 5.5 - 6.
  • the siRNA 100 nM/well was supplemented with transfection carriers at various N/P ratios and were incubated for 30 min at room temperature, whereafter the suspension was transferred into the plate wells.
  • the cells were incubated for 24h at 37° C, 5% CO 2 , the medium was exchanged and they were incubated for another 48h. After 48h, we performed the MTT test for proliferation (Invitrogen) according to the manufacturer's instructions.
  • the carriers were complexed with non-coding siRNA (transfection negative control) and siControl TOX (positive transfection control) at various NH 3 + group ratios (from the carrier) and PO 4 groups (from the siRNA), the N/P ratio.
  • the complexing of siRNA with the carriers R8 and PEI was performed at varying N/P ratios.
  • the resulting complexes were separated electrophoretically in an agarose gel and stained with ethidium bromide (Fig. 12).
  • N/P ratio at which a slowed or no migration of complexes in the gel is observed is taken as the moment at which the negatively charged siRNA molecules are equilibrated and active complexes are formed. Active complexes were formed at N/P 6 for carrier PEI and N/P 12 for R8.
  • the resulting complexes were used to transfect MCF7 and H460 cell lines. After 48 h from transfection, we performed the MTT proliferation assay in order to determine the most effective N/P ratio (where the siRNA is introduced into the cells - positive transfection control) at minimal toxicity (transfection negative control) (Fig. 13).
  • the PEI carrier effectively introduces siTOX at N/P 6 and 8 (Fig. 13a).
  • the effective N/P ratios of PEI are not toxic to cells (Fig. 13b).
  • R8 does not show toxicity even at an N/P of 100 (Fig. 13d).
  • oligonucleotides produced according to the present invention oligonucleotide were put into a pharmaceutical form, a solution for parenteral use in complex with the carrier. Due to the limited stability of the drug in an aqueous solution, it is necessary to ensure the proper quality of the drug during its shelf-life. This is achieved by delivering the oligonucleotide in the form of a powder for preparing the solution and a separate carrier solution in a pharmaceutically acceptable medium or through storing the solution at a low temperature, most preferably below - 20 0 C.
  • Oligonucleotides are dried as appropriate, such as lyophilisation or spray-drying.
  • Lyophilisation is the method of choice for an oligonucleotide.
  • Oligonucleotides obtained according to the present invention are dissolved in water such that their concentration prior to lyophilisation is 10-40% by mass, wherein the choice of the appropriate concentration is dependent on the type of lyophiliser and lyophilisation protocol.
  • the resulting solution is passed through sterilising filters, whereafter it is sterile loaded into sterile vials.
  • the oligonucleotides are died via lyophilisation, where the duration and parameters of the process are dependent on the type of lyophiliser and the amount of material.
  • the end of the lyophilisation is determined by temperature measurement.
  • the moisture content of the material after the completion of the lyophilisation should not exceed 5%, more preferentially 2%.
  • a parallel stage in the preparation of a drug form is the preparation of a sterile carrier solution in a pharmaceutically permissible medium such as water for injection, physiological saline solution and, most preferably, a 5% glucose solution, and other media permitted for parenteral use.
  • a pharmaceutically permissible medium such as water for injection, physiological saline solution and, most preferably, a 5% glucose solution, and other media permitted for parenteral use.
  • the resulting solution is filtered through sterilising filters under sterile conditions.
  • the resulting solution is transferred into previously sterilised vials.
  • siRNa 1 g siRNa was dissolved in w 5 ml injectible water. The resulting solution was passed through a filter with 0.22 ⁇ m pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 0.25 ml, which corresponds to a 50 mg dose of oligonucleotide in each vial. The solution was dried for 4 hours via lyophilisation and the resulting lyophilisate was maintained at a temperature of - 20 0 C for further use.
  • the vial with the carrier solution was prepared by dissolving 440 mg carrier in
  • siRNa 1 g siRNa was dissolved in w 5 ml injectible water. The resulting solution was passed through a filter with 0.22 ⁇ m pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 0.25 ml, which corresponds to a 50 mg dose of oligonucleotide in each vial. The solution was stored at a temperature of -70 0 C for further use.
  • the vial with the carrier solution was prepared by dissolving 440 mg carrier in
  • Oligonucleotides In the case of oligonucleotides, the most preferable way of administering is parenterally. Oligonucleotides can be given in the form of injections or drips.
  • the siRNA may be supplied as a powder for preparing solutions, a concentrate, with a separate carrier solution, or as a ready-to-use form of the drug, a siRNA solution in complex with the carrier for storage at a temperature below 0 0 C.
  • the directly prepared or defrosted injectible solution can be given directly to a patient or put into an IV drip, for example a 5% glucose solution.
  • a vial containing 50 mg of lyophilised siRNA was supplemented with 5 ml of carrier solution.
  • the vial was mixed by inversion for about 1 minute.
  • the solution was added to 500 ml of 5% glucose and given as an IV drip.
  • the concentrate solution of siRNA in injectible water was defrosted and 5 ml of carrier in 5% glucose were added. This resulted in a solution with a concentration of 10 mg /ml.
  • the solution was mixed by inverting the vial for about 1 minute.
  • the siRNA complexed with the carrier was administered through IV injection.
  • Example 9 Systemic administration of siWNT1_15 inhibits tumour growth.
  • mice were inoculated intradermally with cells of human breast cancer, MCF-7, at a rate of 3x10 s cells/mouse. Following the attainment of an appropriate size by the tumours, we began to administer siRNA sequences siWNT1_15 (SEQ ID No.
  • mice were given intraperitoneal doses of siWNT1_15 and non-silencing siRNA sequences: 2.5, 5, 10, 20 and 40 mg/kg BW. Likewise, a control was given containing only glucose as well as a control containing only the carrier. Starting from the second administration of siRNA we measured tumour volume (fig. 14).
  • siWNT1_15 (SEQ ID No. 19) was administered intraperitoneally daily as well, at a dose of 10 mg/kg BW.
  • a dose 40 mg/kg BW of siWNT1_15 40 mg/kg every three days (Fig. 15).
  • Example 10 The systemic administration of siWNT1_15 decreases the number of tumour metastases to other organs.
  • tumour metastases After 28 days from the moment of inoculation with tumour cells, we dissected the animals to evaluate the number and localisation of tumour metastases. We observed a decreasing number of metastases to other organs with an increase in the dose, for example to the lung (Fig. 16).
  • Example 11 The systemic administration of siWNT1_15 inhibits tumour growth in a comparable manner to a classic chemotherapeutic, without showing adverse effects.
  • mice were inoculated intradermally with cells of human breast cancer, MCF-7, at a rate of 3x10 s cells/mouse. Following the attainment of an appropriate size by the tumours, we began to administer the siRNA sequence siWNT1_15 (SEQ ID No.
  • mice were given intraperitoneal doses of siWNT1_15 and at a dose of 5 mg/kg BW, or twice docetaxel at 15 mg/kg BW at 6 day intervals.
  • tumour volume (fig. 17a).
  • Example 12 The systemic administration of siWNT1_15 inhibits tumour growth. siWNT1_15 exhibits no immunotoxic activity.
  • the cytokin release test in unfractionated blood facilitates the initial evaluation whether an examined chemical substance exhibits an effect on the immune system (Langezaal and in. 2001 ).
  • Cytokine production was measured (interleukin-2, interferon-a, interferon-y and tumour necrosis factor- ⁇ ) using ELISA assays from MABTECH.
  • 96-well ELISA plates were coated with monoclonal antibodies against selected cytokines. After an overnight incubation at 4O, the plates were was hed with PBS, incubated for 1 h with PBS containing 0.05% Tween 20 and 0.1 % BSA. Following 5 rinses in PBS with Tween 20, the plates were incubated for 2h with serum samples or appropriately diluted standards. Next, the plates were rinsed 5x in PBS with Tween 20 and were incubated with for 1h at room temperature with antibodies against appropriate cytokines tagged with biotin.
  • siRNA specifically blocks the WNT/beta-catenin pathway, inhibits tumour growth and decreases the number of metastases without toxic effects.
  • ⁇ 400> 2 agcagagcgg acgggcgcgc gggaggcgcg cagagctttc gggctgcagg cgctcgctgc 60 cgctggggaa ttgggctgtg ggcgaggcgg tccgggctgg cctttatcgc tcgctgggcc 120 catcgtttga aactttatca gcgagtcgcc actcgtcgca ggaccgagcg gggggcgggg 180 gcgcggcgag gcggcggccg tgacgaggcg ctccggagagcgcttctgggc 240 acgcatggcg cccgcacacg gagtctgacc tgat

Abstract

We disclose the use of a siRNA oligonucleotide comprising at least 19 nucleotides, complementary to the target mRNA encoding proteins of the WNT/beta-catenin pathway, in the production of a drug for systemic administration in the treatment of cancer.

Description

The use of a siRNA oligonucleotide
The present invention relates to the use double-stranded interfering mRNA oligonucleotides as novel anticancer drugs for systemic administration.
Despite many years of research and efforts to treat tumours, medicine has not made significant progress in treating these diseases. Traditional chemotherapy does not give expected therapeutic benefits to many patients and always entails serious undesirable side effects. A serious problem that arises in this type of therapy is multi-drug resistance. Scientists and physicians have so far been unable to rectify this problem. This makes it necessary to use several chemotherapeutics simultaneously. New biotechnological drugs, such as monoclonal antibodies have not fulfilled the hopes placed in them. To the contrary, there are more and more reports of a very narrow group of patients who have benefitted from these therapies. The high specificity of novel biotechnological drugs makes them very sensitive to tumour variability and to mutations which change the antigen or its availability. In the case of monoclonal antibodies, a similar tendency is beginning to appear to that observed during chemotherapy. As the duration of the therapy is prolonged, the percentage of patients who fails to respond it increases. Multi-drug resistance, tumour variability and the narrowness of the group patients who benefit from novel therapies all male tumours a continuing, serious clinical problem and indicate a need for novel therapies using new drugs.
A hope for a shift in this situation is borne by the recently discovered phenomenon of the specific silencing of genes based on RNA interference (RNAi). RNAi is initiated by short, double-stranded RNA molecules (siRNA). The degradation of the target mRNA occurs due to the complementarities of siRNA and mRNA molecules.
A siRNA molecule complexed with the enzyme RNAse III binds with a complementary mRNA sequence, which facilitates the exonucleolytic cleavage of the mRNA by the enzyme contained in the complex. Merely a few siRNA molecules are necessary to completely silence a gene. RNAi is initiated in the cytoplasm when long, double-stranded RNA (dsRNA) or hairpin structure RNA (shRNA). Regardless of its sequence, dsRNA is recognised and hydrolysed by the Dicer nuclease, which belongs to the type III ribonuclease family. The dsRNA digestion product consists of short, double-stranded interfering iRNA , 21-23 nucleotides long [6]. The resulting siRNA, along with the RISC silencing complex participate in the degradation of complementary mRNA. The RISC complex preferentially binds one of the siRNA strands. Single-strand siRNA complementarily binds the target mRNA sequence. The Ago2 cleaves the arising mRNA/siRNA duplexes, and further degradation occurs due to exonuclease activity [18, 19]. After the mRNA molecule is degraded, the RISC complex is released and becomes available for further RNAi.
The use of RNAi in cancer therapy is possible when the target of the therapy is to lower the expression or activity of a particular protein. In tumour cells, there are many proteins which are overexpressed in comparison to normal cells. One such protein group consists of the member proteins of the WNT/beta-catenin signalling pathway, which includes 19 WNT ligands. Tumour development mainly involves the following ligands: WNT1, WNT2, WNT3a, WNTSa and WNT8 (see Fig. 1). The best known oncogenic ligand is WNT1 which is a secretory protein which binds to the Frizzled (Fzd) receptor, which activates cytoplasmic phosphatases, which inhibit the activity of glycogen synthase kinase 3 beta (GSK-3beta) (Polakis et al., Wnt signaling and cancer, Genes Dev. 2000 Aug 1;14(15):1837- 51 ). As a result of the GSK-3beta blocking, beta-catenin is not ubiquitinylated and it is transferred into the nucleus, where it activates transcription factors. WNT1 overexpression occurs in many types of cancers, including cancers of the lung, colon, breast, head and neck as well as in sarcomas (Katoh et al. Expression and regulation of WNT1 in human cancer: up-regulation of WNT1 by beta-estradiol in MCF-7, In JOncol, 2003 Jan;22(1):20912). After WNT1 binds to Fzd, the cytoplasmic protein Dishevelled (DvI) is activated through phosphorylation binds to the complex APC-Axin-Conductin. This complex inhibits the activity of GSK3beta. and casein kinase 1 alpha (CK1 alpha) [7]. This prevents the phosphorylation of beta-catenin. The phosphorylation of beta-catenin by the kinases GSK-3beta and CK1 alpha is necessary for recognition by the E3 ubiquitinyl ligase complex which is responsible for hydrolysis in lysosomes. The lack of phosphorylation of beta-catenin stabilises it and allows it to be translocated into the nucleus where it is activates the Tcf/Lef transcription factors. Activated Tcf/Lef induce the expression of Wnt dependent genes [8,9]. Many of these genes play a significant role in the regulation of the cell cycle, apoptosis, proliferation and progression of tumours (Tab. 1 ). In the absence of a signal from the WNT/Fzd complex, beta-catenin is phosphorylated by GSK-3beta and CK1 alpha, leading to its ubiquitination and degradation in the proteasome. In this case, Tcf/Lef factors are not activated by beta-catenin, in this case transcription suppressors.
Studies on mice have shown that tumour growth is directly dependent on WNT1 [12,13]. Chemotherapy-resistant cells are characterised by the increased expression of this gene. The effect of the WNT protein on tumour induction occurs via the increase of the pool of unphosphorylated beta-catenin that acts as the oncogen. It was shown that mutations of this gene at the phosphorylation site for the CK1 alpha and GSK-3beta kinases as well as the region recognised by TrCP leads to increased beta-catenin stability and protects it against degradation. This type of mutation occurs in many tumours, such as those of the intestine, ovary, endometrium, pancreas, prostate, stomach as well as the head and neck [18]. In vitro beta-catenin silencing studies are also known, but due to the important role of this protein in cellular physiological processes, such as intercellular connections. Thus the system-wide silencing of this protein bears a great risk of serious side effects.
In vivo silencing of WNT with siRNA has been described previously. In the work by Pu et al. (Cancer Gene Ther. 2008-11-24 online publication) it was shown that siRNA against Wnt2 inhibited tumour growth, but the siRNA was administered into the tumour, so it was a local, not a systemic application.
In most cases, cancer therapy requires the systemic administration of drugs, because, in contrast to local treatment, systemic treatments facilitate the distribution of the drug throughout the patient. The active substance is absorbed into the blood from site it enters the bloodstream. This allows the active ingredient to access the target site, which is often far removed from the site of administration. The distribution process consists of the penetration of drugs and their metabolites from the blood into target tissues through biological barriers via active and passive transport.
Systemic tumour treatment encompasses chemotherapy, hormone therapy and biological methods.
The following paths of administration can be discerned in systemic treatment.: oral,
parenteral (extraintestinal)
into cavities - mainly rectal, more rarely nasally or intravaginally.
Additionally, in the case of some preparations, dermal and inhalative administration can also be viewed to be systemic.
The path of administration and pharmaceutical form often are of critical significance to the strength and duration of the activity. Oral administration, though most comfortable to the patient, has numerous drawbacks. Many drugs, particularly those that are proteins, polypeptides and nucleic acid derivatives are inactivated and degraded in acidic stomach contents under the influence of pH and enzymes.
Drugs absorbed from the gastrointestinal tract access the bloodstream almost exclusively through the hepatic vein, which means that almost the entire dose of the drug passes through the liver. In the liver, the drugs are subjected to the activity of liver enzymes and metabolised, which lowers their bioavailability. This is called the first pass effect. In many cases the biotransformation processes are so rapid that the achievement of therapeutic concentrations of drugs is impossible in target tissues. The rate of metabolic processes is dependent on many individual characteristics, such as sex, age, ethnicity, and physiological status. As a result of this, it is difficult to dose a narrow range of blood concentrations of a drug in different patients.
The above problems of oral drug administration make it impossible to use in tumour chemotherapy. The pathway of choice is parenteral, or directly into the tissues, bypassing the gastrointestinal tract. Extraintestinal drugs can be given intravenously, intramuscularly, subcutaneously, cutaneously, intraperitoneally or intracardially. The most failsafe method is injection or an IV drip. During IV administration there is no absorption, and the drug mixed with the blood reaches the target tissue. Most IV drugs have a rapid and strong effect. Knowing the patient's weight, one can precisely define the dose necessary to achieve the desired concentration in the blood. Drugs to be administered intravenously should be sterile, free of insoluble contaminants and pyrogens, as well as isohydronic and iso-osmotic.
The goal of the present invention is to deliver antitumor drugs for systemic administration, which could be used both to combat existing tumours as well as to prevent metastases.
Such a defined goal has unexpectedly been achieved by the solution according to the present invention.
The goal of the present invention is the use of a siRNA oligonucleotide containing a sequence comprising at least 19 nucleotides complementary to the target mRNA sequence encoding a protein of the WNT/beta-catenin pathway in the production of a drug for systemic administration in the treatment of tumours. Preferentially, the target mRNA sequence is selected from among mRNA of the WNT1 gene containing the sequence SEQ ID No. 1 , mRNA of WNT2 containing the sequence SEQ ID No. 2, mRNA of the DVL3 gene containing the sequence SEQ ID No. 3 or the mRNA of the LEF1 gene containing the sequence SEQ ID No. 4.
Equally preferentially, the oligonucleotide complementary to mRNA WNT-1 is an oligonucleotide containing a sequence selected from among SEQ ID Nos. 5-58, as the oligonucleotide complementary to the mRNA of WNT-2 an oligonucleotide containing a sequence selected from among SEQ ID Nos. 59-121 is used, as the oligonucleotide complementary to the mRNA of DVL3 an oligonucleotide containing a sequence selected from among SEQ ID Nos. 122-183 is used, whereas as the oligonucleotide complementary to the mRNA of LEF1 , an oligonucleotide containing a sequence selected from among SEQ ID Nos. 184- 230 is used. According to a preferable embodiment of the present invention, siRNA is used in the form of a complex with a pharmaceutically permissible carrier. Wherein, preferentially, the carrier is polyethylenylimine (PEI), wherein the N/P ratio is less than 12, preferably from 2 to 10, or octoarginine (8R) is used as the carrier, wherein the preferable N/P ratio is from 2 do 60.
Preferentially, the drug produced is used for the treatment of cancer, encompassing cancers of the breast, lung, skin, prostate or pancreas.
Preferentially, the drug produced is meant for parenteral administration, through intravenous administration or through intraperitoneal injection. Preferably, the drug is meant for preventing metastases and/or combating tumours.
To better illustrate the nature of the present invention, the description has been supplemented with the following figures:
Figure 1 shows a schematic of the WNT1 signalling pathway;
Figure 2 shows the inhibition of the proliferation of the MCF7 cell line following 72 h of incubation with siWNTI (50 nM). SiTOX - positive transfection control, siWNT1_2 - siWNT1_15 (SEQ IDs No. 5-19) - designed siRNA molecules against the Wnt-I gene;
Figure 3 shows the dose dependence effect following the use of 12 pmol siWNT1_15 (SEQ ID No. 19) on various cell lines over 72 h. SiTOX - positive transfection control, siWNT1_15 designed siRNA molecule;
Figure 4 shows the inhibition of the proliferation of the H4GO cell line following
72 h incubation with siWNT2 in two doses, 50 and 100 nM. SiTOX - positive transfection control, siWNT2_1 - siWNT2_15 (SEQ ID No. 59-74) - designed siRNA molecules against WNT2;
Figure 5 shows the varied antiproliferative effect following 72 h of using 100 nM siWNT2, depending on the cell line and the level of expression of WNT2;
Figure 6 shows the inhibition of the proliferation of cells following 72 h of incubation with siRNA;
Figure 7 shows the level of inhibition of genes encoding ligands of the WNT/beta- catenin pathway and genes activated via this pathway, as examined using PCR, a) decrease of mRNA levels, b) dependence of the level of inhibition on siRNA concentration;
Figure 8 shows the results of an experiment in which MCF7 breast cancer cells were treated with 100 nM of siRNA specific for WNT1 , and expression measurements of the silenced gene and cyclin Dl made 6, 12, 24 and 48 h after transfection;
Figure 9 shows experimental results in which MCF-7 cells treated with siWNT1_15 (SEQ ID No. 19) showed the decreased expression of CCND1 after silencing WNT1 with a specific siRNA sequence;
Figure 10 shows the results of an experiment in which LEF1 expression silencing was performed in cells of the line H460;
Figure 1 1 shows experimental results for WNT/beta-catenin pathway ligands silenced in lung (H460) and b) breast (MCF7) cancer;
Figure 11c shows experimental results for decreased levels of proteins participating in the WNT/beta-catenin pathway and proteins activated via this pathway;
Figure 11d shows experimental results, in which the decrease in the level of cyclin D1 (CCND1 ) was examined in and MCF7 cell lines;
Figure 11e shows experimental results, in which in order to confirm the blocking of the pathway we examined the level of the c-Myc protein activated via the
WNT/beta-catenin pathway following the use of specific siRNA that silenced the expression of WNT1 and WNT2 ligands;
Figure 12 shows siRNA/PEI (a) and siRNA/R8 where expression was examined in cells of a) cancer, electrophoretic separation of complexes in (b) agarose.
Lanes Ia and 2b - pure transfection carrier, 2a and 1 b - I μg siRNA, 3 - 7 - complexes of si RNa and transfection carrier at various N/P ratios;
Figure 13 shows a comparison of the effectiveness and toxicity of transfection carriers after 48h following transfection with 100 nM siTOX (positive transfection control) and siKneg. (transfection negative control) depending on the N/P ratio.
A) - PEI effectiveness following siTOX transfection of the cell line MCF7, b)- PEI toxicity following transfection with siK.neg of the cell lines MCF7 and H460, c) - toxicity of R8 following siTOX transfection of the cell line MCF7;
Figure 14a shows the inhibition of tumour growth following the use of the siWNT1_15 (SEQ ID No. 19) siRNA sequence in a dose of 2.5 mg/kg BW; administration to mice bearing a human breast cancer were given siRNA intraperitoneally, black arrows indicate days of administration of the siRNA;
Figure 14b shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence in a dose of 5 mg/kg BW; intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;
Figure 14c shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence at a dose of 10 mg/kg BW;
Administered to mice bearing human intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;;
Figure 14d shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence at a dose of 20 mg/kg BW; intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;
Figure 14e shows the inhibition of tumour growth following the administration of the siWNT1_15 (SEQ ID No. 19) siRNA sequence at a dose of 40 mg/kg m. c. ; intraperitoneal administration of siRNA to mice bearing a human breast cancer, black arrows indicate days of administration of the siRNA;
Figure 15 shows a comparison of the effects depending on the frequency of siRNA administration. Mice bearing human breast cancer were given intraperitoneal siRNA daily (continuous line) of a siRNA sequence at a dose of 10 mg/kg BW and every three days (dashed line) of a siRNA sequence at a dose of
40 mg/kg BW;
Figure 16 shows the number of metastases to other organs 28 days following the inoculation of animals that were given siRNA systemically;
Figure 17a shows a comparison of the therapeutic effect of siWNT1_15 (SEQ ID No. 19) and docetaxel; Mice bearing human breast cancer were given intravenous siRNA at a dose of 5 mg/kg BW every three days and docetaxel at a dose of 15 mg/kg BW every 6 days;
Figure 17b shows a comparison of the effect of siWNT1_15 (SEQ ID No. 19) and docetaxel on body mass in Nu/J mice; The decrease of bodyweight in the docetaxel group indicates cytotoxicity characteristic of cytostatic drugs; No toxic effect observed for siWNT1_15;
Figure 18 shows a comparison of the effect of siWNT1_15 (SEQ ID No. 19) and reference substances on cytokine release which is indicative of immunotoxicity;
The following examples serve to better illustrate individual aspects of the present invention.
Example 1. Design of siRNA sequences
To design effective siRNA sequences, one may use one of many available algorhythms. Such algorhythms are known from prior art, such as Elbashir SM et al. (2001 ) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411 :494-498; Elbahir SM et al. (2001). Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20:6877-6888; Elbashir SM et al. (2002). Analysis of gene function in somatic mammalian cells using small interfering RNAs.
Methods. 26:199-213; Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS,
Khvorova A. Rational siRNA design for RNA interference. Nat Biotechnol. 2004
Mar; 22 (3) : 326-30; Tuschl, T. , Elbashir, S. ,
Harborth, J. , and Weber, K. "The siRNA User Guide",
http://www.rockefeller.edu/labheads/tuschl/sirna.html (revised May 6, 2004).
There are also ready-made computer programs made for this purpose made available over the Internet:
http://www.ambion.com/techlib/misc/siRNA finder.html:
https://www.genscript.com/ssl-bin/app/rnai:
http://www1.qiaqen.com/Products/GeneSilencinq/CustomSiRna/SiRnaDesiq ner.aspx; http://sfold.wadsworth.org/sirna.pl.
The use of known algorhythms requires the foreknowledge of the sequence of the mRNA, cDNA or protein to be silenced. The nucleotide sequences of mRNA and cDNA corresponding to the proteins connected with the present invention are known from prior art and publically available (i.e. from the GENMED database: www.ncbi.nlm.nih.gov). Appropriate sequences for the WNT1 protein (Homo sapiens wingless-type MMTV integration site family, member 1 ) are available from GENMED under the NCBI Reference Sequences (RefSeq) accession NM 005430.
In the present application the mRNA of WNT1 are shown as SEQ ID No. 1. Appropriate sequences for the WNT2 protein (Homo sapiens wingless-type MMTV integration site family member 2) are available from the GENMED DATABASE under the reference number NCBI Reference Sequences (RefSeq) NM 003391.1. In the present application the mRNA of WNT2 are shown as SEQ ID No. 2. Appropriate sequences for the DVL3 (Homo sapiens dishevelled, dsh homolog 3 (Drosophila» are available from the GENMED DATABASE under the reference number NCBI Reference Sequences (RefSeq) NM 004423. 3. In the present application the mRNA of DVL3 are shown as SEQ ID No. 3. Appropriate sequences for the LEF1 (Homo sapiens lymphoid enhancer-binding factor 1 ) are available from the GENMED DATABASE under the reference number NCBI Reference Sequences (RefSeq) NM 016269.2.
In the present application mRNA LEF1 are shown as SEQ ID No. 4.
Using the methodology disclosed in patent application P.378857 and PCT/PL2007/00006, the authors of the present invention have designed many potent siRNA against the mRNA of WNT1 , WNT2, DVL3 and LEF1 , which were then subjected to initial in vitro tests according to the methodology disclosed in PCT/PL2007/00006. The nucleotide sequences of siRNA, which showed beneficial properties are shown in the sequence list.
siRNA sequences for WNT-1 are shown as SEQ ID Nos. 5-58,
siRNA sequences for WNT-2 are shown as SEQ ID Nos. 59-121 ,
siRNA sequences for DVL3 are shown as SEQ ID Nos. 122-183,
whereas siRNA sequences for LEF1 are shown as SEQ ID Nos. 184- 230.
Example 2. Synthesis of siRNA
RNA synthesis was performed using the solid phase technique, using typical nucleic acid synthesis protocols using β-cyanoethyl ester derivatives of phosphoamide esters with the use of a tertbutyldimethylsilane safeguard on group 2 and the -OH of ribose. Phosphoamide oligomers bind to the free 5'-OH group of ribose following activation with 5-benzylmercapto-1H-tetrazole. This reaction proceeds rapidly yielding products, oligomers, very efficiently. The formed oligomers are additionally purified using chromatography (HPLC) or electrophoresis (PAGE).
The synthesis was performed on an Applied Biosystems 962 RNA synthesizer. The siRNA was made by gently mixing for 1 hour equimolar amounts complementary RNA strands in 2M acetate buffer in ethanol. This solution was centrifuged for 15 min. and dried with 70% .
Example 3. Use of siRNA against genes of the pathway inhibits the proliferation of cancer cells.
To perform the proliferation assays, 24h prior to the planned transfection cell lines were inoculated onto medium in 96-well plates at an appropriate density such that on the day of transfection the confluence was at 30-50%. To transfect the cells we used commercially available transfection factors, HiPerfect (Qiagen) and Lipofectamine RNAiMAX (Invitrogen), according to the manufacturers' instructions. On the day of transfection, the medium was replaced with transfection medium, OptiMEM (Gibco). As the positive control we used siControl TOX (siTOX, Dharmacon). As the negative control, we used a non-coding siRNA molecule (siKneg.). The siRNA and transfection factor were suspended in OptiMEM and incubated for 20 min at room temperature, wherafter the suspension was transferred into the wells. The cells were incubated for 24h at 37° C, 5% CO 2, the medium was exchanged and they were incubated for another 48h. After 48h, we performed the MTT test for proliferation (Invitrogen) or ATPIite (Perkin Elmer) according to the manufacturer's instructions.
In order to show that the silencing of the genes of the Wnt/beta-catenin pathway inhibits the proliferation of tumour cells, we performed proliferation assays. The cells were transfected with siRNA directed against the genes DVL3, LEF1 , WNT1 and WNT2. Following 72 h of incubation, the inhibition of the proliferation was measured using the MTT and ATPIite tests. For this experiment, we chose the breast cancer cell line MCF7, the lung cancer cell lines H460 and A549 as well as prostate cancer line PC3, with varying levels of expression of the selected proteins. The siRNA directed against the WNT1 gene (siWNTI SEQ ID No. 5-19) caused a significant inhibition of the proliferation of the cell line MCF7 (fig. 2). Figure 2 shows the observed inhibition of the proliferation of the cell line MCF7 following 72 h of incubation with siWNTI (SEQ ID No. 19) at a concentration of 50 nM. SiTOX - positive transfection control, siWNT1_2 - siWNT1_15 (siWNTI SEQ ID No. 6-19) - designed siRNA molecules directed against the Wnt-1. No differences were observed between the untreated cells and the negative transfection control (non-silencing siRNA sequence).
The greatest inhibition of proliferation was achieved using sequence siWNT-15 (SEQ ID No. 19), and it was selected for further testing. The use of siWNT1_15 on other cell lines (A549, H460 - lung cancer, PC3 - prostate cancer) also resulted in the inhibition of growth, and the observed effect was dose dependent (Fig. 3).
Figure 3 shows the dose-effect dependence following the use of 12 pmol siWNT1_15 (SEQ ID No. 19) on various cell lines for 72 h. SiTOX - positive transfection control, siWNT1_15 - designed siRNA molecule. No differences were observed between the untreated cells and the negative transfection control. Likewise, the use of siRNA directed against WNT2 (SEQ ID No. 59-74) inhibited the proliferation of the cell line lung cancer H460 (Fig. 4).
Figure 4 shows the observed inhibition of the proliferation of the cell line H460 following 72 h of incubation with siWNT2 in two doses, 50 and 100 nM. SiTOX - positive transfection control, siWNT2_1 - siWNT2_15 (SEQ ID No. 59-74) - designed siRNA molecules directed against WNT2. No differences were observed between the untreated cells and the negative transfection control siRNA molecules with the greatest antiproliferative activity were also tested against the cell lines A549 and MCF7. The inhibition of proliferation was only observed for the line A549. The use of selected siWNT2 on MCF7, which does not express WNT2 proteins, as expected had not effect on proliferation, giving indirect evidence of the specificity of the designed sequences (Fig. 5)
Figure 5 shows the varied antiproliferative effect following 72 h of using 100 nM siWNT2, depending on the cell line and the level of expression of the WNT2. protein. SiTOX - positive transfection control, siWNT2_2 - siWNT2_11 (SEQ ID No. 59-70) - designed siRNA molecules directed against WNT2. No differences were observed between the untreated cells and the negative transfection control. The silencing of two other genes of the Wnt/beta-catenin pathway, DVL3 and LEF1 inhibited of the proliferation of the cell line MCF7. Use of siDVL3 on the cell line H460, which does not express this protein, did not affect its proliferation giving indirect evidence of the specificity of the designed sequences (Fig. 6). Figure 6 shows the inhibition of the proliferation of cells following 72 h of incubation with siRNA. The MCF7 cells were incubated with 100 nM siLEFI (SEQ ID No. 184-191 ) (a). The MCF7 and H460 cells were incubated with 100 nM siDVL3 (SEQ ID No. 122-129) (b). SiTOX - positive transfection control, siLEFI 1 - sil_EF1_7 (SEQ ID No. 184-191 ) - designed siRNA molecules directed against LEF1 , siDVL3_1 - siDVL3_7 (SEQ ID No. 122129) - designed siRNA molecules directed against DVL3. No differences were observed between the untreated cells and the negative transfection control
Example 4. The use of siRNA against ligands of the Wnt/beta-catenin pathway decreases the mRNA level of the target gene and of genes activated by WNT ligands.
In order to analyse the RNA following the use of siRNA, 24h prior to the planned transfection, we inoculated cell lines onto culture medium in 6-well plates at a sufficient density such that confluence on the day of transfection was 50%. On the day of transfection, the medium was replaced with 2 ml of transfection medium, OptiMEM (Gibco). The siRNA molecules (100nM/well) and transfection factor (8-10 μl/well) were suspended in OptiMEM and were incubated 20 min at room temperature, whereafter they were transferred in lots of 100 μl into wells. The cells were incubated for 18h w 371C, 5% C02. After incubation, RNA was isolated using the RNeasy Mini Kit (Qiagen). cDNA synthesis was performed using the ImProm-ll™ Reverse Transcriptase kit (Promega). Real-time PCR was performed on a RotorGene 6000 system (Corbett Research). To amplify the genes we used the FastStart TaqMan® Probe Master kit (Roche) and Universal ProbeLibrary probes. Gene expression was expressed as the relative expression in relation to reference genes (GAPD, HPRT1, PBGD, 18S RNA). To calculate the relative expression, we used the Relative Expression Software Tool for Rotor-Gene© package (REST-RG©).
The degree of silencing of the genes encoding Wnt/beta-catenin pathway ligands and the genes they activate was examined using real-time PCR. The H460 cells were treated with 100 nM and 50 nM siRNA specific for WNT1 and WNT2 (Fig. 7). The cells were incubated with the siRNA for 18 h and we measured the level of expression of the silenced WNT1 and WNT2 genes, as well as the gene activated by this pathway, the D1 cyclin (CCND1). The attached graphs show that the degree of silencing of the control was 0%, whereas maximum silencing was 100%.
For the silencing, we used selected sequences of siWNT2. A decrease of mRNA levels was observed only for the sequences siWNT2_2 (SEQ ID No. 60) and siWNT2_11 (SEQ ID No. 70) (Fig. 7a). Likewise, only following the use of these sequences did we observe a decrease in CCND1 mRNA. Following the use of two different concentrations of siWNT1_15 (SEQ ID No. 19), we observed the dependence of the degree of silencing of CCND1 on the concentration of the sequence used (Fig. 7b). The breast cancer cells, MCF7, were treated with 100 nM siRNA specific for WNT1. The expression measurements of the silenced genes and cyclin D1 were made 6, 12, 24 and 48 h after transfection (Fig. 8). Like in the case of cells of the H460 line, after treating MCF-7 cells with siWNT1_15 (SEQ ID No. 19) we achieved a decrease in the expression of the CCND1 gene after silencing WNT1 with a specific siRNA sequence. The level of silencing of the WNT1 gene following the use of siWNT1_15 was also measured in prostate cancer cells (PC3), lung cancer cells (A549) and malignant breast cancer cells (MDA-MB-231) (Fig. 9).
We also measured the silencing of the expression of the LEF1 gene in cells of the H460 line. The cells were transfected with 100 nM siRNA and the level of expression of LEF1 was evaluated after 18 h (Fig. 10). For two sequences, we observed a decreased LEF1 mRNA level
Example 5. Use of siRNA against WNT/beta-catenin decreases the levels of proteins activated by WNT ligands.
Protein isolation reagents were purchased from Sigma-Aldrich.
Western blotting reagents were purchased from BioRad, Pierce, Sigma-Aldrich, anti-WNT1 antibodies from Zymed Invitrogen, anti-WNT2 from R&D, anti-actin, anti-GAPDH, anti-cyclin D1, anti-cMyc from Santa Cruz Biotechnology, anti-beta- catenin w Becton Dickinson, anti-active beta-catenin (non-phosphorylated at
Ser37, Thr41) from Millipore. Chemiluminescence reagents were purchased from
Roche, and paper, Light Film BioMax, from Kodak.
24h prior to the planned transfection cell lines were inoculated onto medium in bottles of 25 or 75 cm2 at an appropriate density such that on the day of transfection the confluence was at 50%. On the day of transfection, the medium was replaced with transfection medium, OptiMEM (Gibco). The siRNA and transfection factor were suspended in OptiMEM and incubated for 20 min at room temperature, wherafter the suspension was transferred into the wells. The cells were incubated for 48h at 37° C, 5% CO 2.
After 48h, the cells were detached by trypsinization and rinsed twice with cold
PBS through centrifugation for 5 min. at 500 g. After centrifugation, the pellet was suspended in RIPA isolation buffer (Sigma-Aldrich) and incubated overnight at -
80O. Afterwards, the suspension was centrifuged fo r 10 min. at 9000 g. After centrifugation, the supernatant containing cellular proteins was stored.
The concentration of proteins in cell lysates was measured using the BCA test
(Pierce) according to the manufacturer's instructions.
The cell lysates were mixed with Laemmli sample buffer (BioRad) at a ratio of 1:1
(v/v), with 2-mercaptoethanol and boiled for 4 min. Samples containing the same amount of protein were loaded onto a polyacrylamide gel with Kaleidoscope standard (BioRad). SDS-PAGE was performed for 2 hours at 100 V in a Mini Protean III system (BioRad). After electrophoresis, the separated proteins were transferred onto a nitrocellulose membrane via electrotransfer for 1 h at 100 V in a Mini Protean III system. Following the transfer, the membrane was stained with PonceauS (Sigma) in order to visualise the proteins. Western blotting of selected proteins was performed using manufacturers' instructions for each individual antibody. To detect primary antibodies, we used secondary antibodies conjugated with horseradish peroxidase (Sigma-Aldrich). Membrane-bound proteins were visualised with LumiLight reagent (Roche), and then developed on Light Film BioMax film. The film image was analysed and band optical density was examined using the InGenius system (Syngene).
The expression of Wnt/beta-catenin pathway ligands was silenced in lung cancer cells (H460) and breast cancer cells (MCF7) (Fig.11). The cells were treated with 50 nM siRNA and Western analysis was performed after 48 h. Band optical density was measured for all of the experiments. For the H460 cell line, we achieved a 60% decrease of WNT1 protein level following transfection with siWNT1_15 (SEQ ID No. 19) (Fig. 11a).
Next, we measured the decrease of the WNT2 protein expression in the H460 cell line following the use of siWNT2 (Fig. 11 b.). The lowest protein level was observed following the use of siWNT2_11 (SEQ ID No. 70). In comparison to the control, the protein level was some 67% lower. We observed no decrease in the expression of WNT2 following the use of siRNA specific for another ligand, WNT1 (siWNT1_15). This is evidence that the examined siRNA sequences are specific.
We also tested the decrease of the levels of proteins participating in the Wnt/beta-catenin pathway and proteins activated by it. In H460 cells, we evaluated the decrease of activated beta-catenin (Fig. 11c). Following both the silencing of WNT1 and WNT2 through the use of specific siRNA (siWNT1-15 and siWNT2_11 ), we observed a decrease of the level of active beta-catenin, which means that the pathway was not active. Next, we measured the decrease of the levels of proteins activated via the WNT/beta-catenin pathway. In the cell lines H460 and MCF7, we evaluated the decrease of cyclin D1
(CCND1 ) (Fig. 11d). Like in the case of active beta-catenin, here too we observed a decrease of protein levels following the use of siRNA against both ligands, WNT1 and WNT2. This is further evidence of the blocking of the pathway by administering siRNA specific for ligands.
To confirm the effect of the blocking of the pathway, we performed an analysis of the level of the protein c-Myc activated via the WNT/beta-catenin pathway following the use of specific siRNA that silence the expression of the ligands
WNT1 and WNT2 (Fig. 11e.). Again, decreased protein levels were observed in both cases.
Example 6. A polymer carrier ensures functional siRNA delivery into cells.
I. Synthesis of linear poliethylenylimine (PEI)
According to literature reports, linear PEI is obtained through the cationic polymerisation of 2-ethyl-2-oxazoline (2-EtOXZ) via decyclization initiated by methyl p-toluenylsulphonate, and the subsequent acid-catalyzed hydrolysis of the resulting poly(N-acetylethylenylimine) 1-4.
Synthesis and characteristics of poly(2-ethyl-2-oxazoline):
2-ethyl-2-oxazoline (1g, 10.09 mmol) is added to a solution of methyl p- toluenosulphonate (9.4 mg, 50.3 mmol), in acetonitrile (10 ml_). The entirety is mixed and heated to boiling for 6 days. The solvent is removed on an evaporator.
The raw product is precipitated out using ether and then filtered and dried under reduced pressure. 800 mg of product, a yellow powder, are produced.
A mixture of 500 mg of linear poly(2-ethyl-2-oxazoline) in 10 ml_ HCI (37%) and
10 ml. water is heated to boiling for 7 days. The product is cooled to room temperature and precipitated with 30 ml_ 7M NaOH. The resulting solid body is drained off and washed with distilled water to a neutral pH, and then again precipitated out of an ethanol/water system (5/6) and dried overnight at 90"C under reduced pressure. 400 mg LPEI results.
The octoarginine carrier (R8) was designed by the authors of the present invention and ordered from GLS, China.
II. Examination of the siRNA-carrier complexes and transfection effectiveness To perform the proliferation assays, 24h prior to the planned transfection cell lines were inoculated onto medium in 48-well plates at an appropriate density such that on the day of transfection the confluence was at 30-50%. To transfect the cells we used transfection carriers suspended in DEPC-treated water (PEI and R8) and 1% acetic acid (4-vinylimidasole). On the day of transfection, the medium was replaced with transfection medium, OptiMEM (Gibco). As the positive control we used siControl TOX (siTOX, Dharmacon). As the negative control, we used a non-coding siRNA molecule (siKneg.). The siRNA molecules were suspended in PBS (for complexing with R8) or in 150 mM NaCI (for complexing with PEI), such that the final suspension pH was 5.5 - 6. The siRNA (100 nM/well) was supplemented with transfection carriers at various N/P ratios and were incubated for 30 min at room temperature, whereafter the suspension was transferred into the plate wells. The cells were incubated for 24h at 37° C, 5% CO2, the medium was exchanged and they were incubated for another 48h. After 48h, we performed the MTT test for proliferation (Invitrogen) according to the manufacturer's instructions.
The carriers were complexed with non-coding siRNA (transfection negative control) and siControl TOX (positive transfection control) at various NH3+ group ratios (from the carrier) and PO4 groups (from the siRNA), the N/P ratio.
The complexing of siRNA with the carriers R8 and PEI was performed at varying N/P ratios. The resulting complexes were separated electrophoretically in an agarose gel and stained with ethidium bromide (Fig. 12).
The N/P ratio at which a slowed or no migration of complexes in the gel is observed is taken as the moment at which the negatively charged siRNA molecules are equilibrated and active complexes are formed. Active complexes were formed at N/P 6 for carrier PEI and N/P 12 for R8.
The resulting complexes were used to transfect MCF7 and H460 cell lines. After 48 h from transfection, we performed the MTT proliferation assay in order to determine the most effective N/P ratio (where the siRNA is introduced into the cells - positive transfection control) at minimal toxicity (transfection negative control) (Fig. 13). The PEI carrier effectively introduces siTOX at N/P 6 and 8 (Fig. 13a). The effective N/P ratios of PEI are not toxic to cells (Fig. 13b). R8 does not show toxicity even at an N/P of 100 (Fig. 13d).
Example 7. Manufacturing the drug form.
The oligonucleotides produced according to the present invention oligonucleotide were put into a pharmaceutical form, a solution for parenteral use in complex with the carrier. Due to the limited stability of the drug in an aqueous solution, it is necessary to ensure the proper quality of the drug during its shelf-life. This is achieved by delivering the oligonucleotide in the form of a powder for preparing the solution and a separate carrier solution in a pharmaceutically acceptable medium or through storing the solution at a low temperature, most preferably below - 200C.
Oligonucleotides are dried as appropriate, such as lyophilisation or spray-drying.
Lyophilisation is the method of choice for an oligonucleotide.
Oligonucleotides obtained according to the present invention are dissolved in water such that their concentration prior to lyophilisation is 10-40% by mass, wherein the choice of the appropriate concentration is dependent on the type of lyophiliser and lyophilisation protocol. The resulting solution is passed through sterilising filters, whereafter it is sterile loaded into sterile vials. Next, the oligonucleotides are died via lyophilisation, where the duration and parameters of the process are dependent on the type of lyophiliser and the amount of material.
The end of the lyophilisation is determined by temperature measurement. The moisture content of the material after the completion of the lyophilisation should not exceed 5%, more preferentially 2%.
A parallel stage in the preparation of a drug form is the preparation of a sterile carrier solution in a pharmaceutically permissible medium such as water for injection, physiological saline solution and, most preferably, a 5% glucose solution, and other media permitted for parenteral use. The resulting solution is filtered through sterilising filters under sterile conditions. The resulting solution is transferred into previously sterilised vials.
Variant 1
1 g siRNa was dissolved in w 5 ml injectible water. The resulting solution was passed through a filter with 0.22 μm pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 0.25 ml, which corresponds to a 50 mg dose of oligonucleotide in each vial. The solution was dried for 4 hours via lyophilisation and the resulting lyophilisate was maintained at a temperature of - 200C for further use.
The vial with the carrier solution was prepared by dissolving 440 mg carrier in
110ml of 5% glucose solution. The resulting solution was passed through a filter with 0.22 μm pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 5.5 ml.
Variant 2
1 g siRNa was dissolved in w 5 ml injectible water. The resulting solution was passed through a filter with 0.22 μm pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 0.25 ml, which corresponds to a 50 mg dose of oligonucleotide in each vial. The solution was stored at a temperature of -700C for further use.
The vial with the carrier solution was prepared by dissolving 440 mg carrier in
110ml of 5% glucose solution. The resulting solution was passed through a filter with 0.22 μm pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 5.5 ml.
Variant 3
1 g siRNa and 400 mg of carrier were dissolved in w 100 ml of 5% glucose solution. The resulting solution was passed through a filter with 0.22 μm pores into a sterile container, under sterile conditions. The solution was poured into sterilized and pyrogen-free vials in aliquots of 5 ml, which corresponds to a 50 mg dose of oligonucleotide in each vial. The solution was stored at a temperature of -700C for further use.
Example 8. Preparation of the drug for administration.
In the case of oligonucleotides, the most preferable way of administering is parenterally. Oligonucleotides can be given in the form of injections or drips.
At room temperature, the stability of a siRNA solution is limited. The solution must thus be prepared or defrosted immediately prior to administration to the patient. The siRNA may be supplied as a powder for preparing solutions, a concentrate, with a separate carrier solution, or as a ready-to-use form of the drug, a siRNA solution in complex with the carrier for storage at a temperature below 00C.
The directly prepared or defrosted injectible solution can be given directly to a patient or put into an IV drip, for example a 5% glucose solution.
Variant 1
A vial containing 50 mg of lyophilised siRNA was supplemented with 5 ml of carrier solution. The vial was mixed by inversion for about 1 minute. We obtained a solution of siRNA complexed with the carrier with a concentration of 10 mg/ml.
The solution was added to 500 ml of 5% glucose and given as an IV drip.
Variant 2
The concentrate solution of siRNA in injectible water was defrosted and 5 ml of carrier in 5% glucose were added. This resulted in a solution with a concentration of 10 mg /ml. The solution was mixed by inverting the vial for about 1 minute. The siRNA complexed with the carrier was administered through IV injection.
Example 9. Systemic administration of siWNT1_15 inhibits tumour growth.
In vivo experiments were performed on 6-8 week female NOD/SCID mice. The mice were inoculated intradermally with cells of human breast cancer, MCF-7, at a rate of 3x10s cells/mouse. Following the attainment of an appropriate size by the tumours, we began to administer siRNA sequences siWNT1_15 (SEQ ID No.
19). Every three days, the mice were given intraperitoneal doses of siWNT1_15 and non-silencing siRNA sequences: 2.5, 5, 10, 20 and 40 mg/kg BW. Likewise, a control was given containing only glucose as well as a control containing only the carrier. Starting from the second administration of siRNA we measured tumour volume (fig. 14).
During therapy we observed a dose-dependent effect in the form of the inhibition of tumour growth (compare Fig. 14a - Fig. 14e).
The examined sequence siWNT1_15 (SEQ ID No. 19) was administered intraperitoneally daily as well, at a dose of 10 mg/kg BW. We compared the results of this experiment with the results of administering a dose 40 mg/kg BW of siWNT1_15 40 mg/kg every three days (Fig. 15).
The results obtained clearly show that regardless of the frequency of administration, a frequent low dose or a less frequent high dose, a very similar, excellent therapeutic effect is achieved without any signs of toxicity.
Example 10. The systemic administration of siWNT1_15 decreases the number of tumour metastases to other organs.
After 28 days from the moment of inoculation with tumour cells, we dissected the animals to evaluate the number and localisation of tumour metastases. We observed a decreasing number of metastases to other organs with an increase in the dose, for example to the lung (Fig. 16).
Example 11. The systemic administration of siWNT1_15 inhibits tumour growth in a comparable manner to a classic chemotherapeutic, without showing adverse effects.
In vivo experiments were performed on 6-8 week female Nu/J mice. The mice were inoculated intradermally with cells of human breast cancer, MCF-7, at a rate of 3x10s cells/mouse. Following the attainment of an appropriate size by the tumours, we began to administer the siRNA sequence siWNT1_15 (SEQ ID No.
19). Every three days, the mice were given intraperitoneal doses of siWNT1_15 and at a dose of 5 mg/kg BW, or twice docetaxel at 15 mg/kg BW at 6 day intervals. Starting from the second administration of siRNA we measured tumour volume (fig. 17a).
In this experiment we noted a significant reduction of tumour growth in both treatment groups. In the group treated with docetaxel we noted the occurrence of strong undesirable side effects, as evidenced by decreased bodyweight and poorer condition. In the group treated with siWNT1_15 (SEQ ID No. 19) we observed no such effects, which indicates the non-toxicity of the preparation in comparison to the classic chemotherapeutic, with a similar clinical effect (fig.
17b).
Example 12. The systemic administration of siWNT1_15 inhibits tumour growth. siWNT1_15 exhibits no immunotoxic activity.
The cytokin release test in unfractionated blood facilitates the initial evaluation whether an examined chemical substance exhibits an effect on the immune system (Langezaal and in. 2001 ). We performed experiments using samples of blood from three healthy donors according to a published experimental protocol (Carfi and in. 2007).
We collected samples of blood from three healthy by puncture persons using sodium citrate as the coagulant. The blood was diluted using RPMI 1640 medium containing containing 2 mM L-glutamine, 0.1 mg/ml streptomycin and 100 IU/ml penicillin. In order to evaluate the production of cytokines blood diluted 1 :10 in the medium alone or the medium with LPS (1 μg/ml) or PHA (1.25 μg/ml) was incubated with the examined substances (diluted 10x) for 24h at 37O, CO 2 concentration was 5%. After incubation, the blood was centrifuged for 5 min at 1200 rpm, and then the serum was frozen at -201O. T he effect of siWNT1_15 on the immune system was examined using a dose of 5mg/kg BW. No immunostimulatory nor immunosuppressant effects were noted for interactions with siWNT1_15-carrier complexes in comparison to reference substances (Fig. 18).
ELISA assay
Cytokine production was measured (interleukin-2, interferon-a, interferon-y and tumour necrosis factor-α) using ELISA assays from MABTECH. 96-well ELISA plates were coated with monoclonal antibodies against selected cytokines. After an overnight incubation at 4O, the plates were was hed with PBS, incubated for 1 h with PBS containing 0.05% Tween 20 and 0.1 % BSA. Following 5 rinses in PBS with Tween 20, the plates were incubated for 2h with serum samples or appropriately diluted standards. Next, the plates were rinsed 5x in PBS with Tween 20 and were incubated with for 1h at room temperature with antibodies against appropriate cytokines tagged with biotin. These were rinsed again and incubated for 1 h with streptavidin conjugated with alkaline phosphatase. After another rinse, 100 μl of p-nitrophenyl phosphate were added to each well. We measured absorbance at 405 nm. Using the GraphPad package, we calculated the cytokine concentration. For this purpose, we used calibration curves based on the relationship between absorbance and standard concentrations.
The above examples clearly show that the systemic administration of siRNA specifically blocks the WNT/beta-catenin pathway, inhibits tumour growth and decreases the number of metastases without toxic effects.
SEQUENCE LISTING
<110> Celon Pharma Sp. z o.o.
<120> The use of a siRNA oligonucleotide
<130> PK/0703/RW
<160> 230
<170> Patentln version 3.3
<210> 1
<211> 2368
<212> DNA
<213> Homo sapiens
<400> 1
gcggtgccgc ccgccgtggc cgcctcagcc caccagccgg gaccgcgagc catgctgtcc 60 gccgcccgcc cccagggttg ttaaagccag actgcgaact ctcgccactg ccgccaccgc 120 cgcgtcccgt cccaccgtcg cgggcaacaa ccaaagtcgc cgcaactgca gcacagagcg 180 ggcaaagcca ggcaggccat ggggctctgg gcgctgttgc ctggctgggt ttctgctacg 240 ctgctgctgg cgctggccgc tctgcccgca gccctggctg ccaacagcag tggccgatgg 300 tggggtattg tgaacgtagc ctcctccacg aacctgctta cagactccaa gagtctgcaa 360 ctggtactcg agcccagtct gcagctgttg agccgcaaac agcggcgtct gatacgccaa 420 aatccgggga tcctgcacag cgtgagtggg gggctgcaga σtgccgtgcg cgagtgcaag 480 tggcagttcc ggaatcgccg ctggaactgt cccactgctc cagggcccca cctcttcggc 540 aagatcgtca accgaggctg tcgagaaacg gcgtttatct tcgctatcac ctccgccggg 600 gtcacccatt cggtggcgcg ctcctgctca gaaggttcca tcgaatcctg cacgtgtgac 660 taccggcggc gcggccccgg gggccccgac tggcactggg ggggctgcag cgacaacatt 720 gacttcggcc gcctcttcgg ccgggagttc gtggactccg gggagaaggg gcgggacctg 780 cgcttcctca tgaaccttca caacaacgag gcaggccgta cgaccgtatt ctccgagatg 840 cgccaggagt gcaagtgcca cgggatgtcc ggctcatgca cggtgcgcac gtgctggatg 900 cggctgccca cgctgcgcgc cgtgggcgat gtgctgcgcg accgcttcga cggcgcctcg 960 cgcgtcctgt acggcaaccg cggcagcaac cgcgcttcgc gagcggagct gctgcgcctg 1020 gagccggaag acccggccca caaaccgccc tccccccacg acctcgtcta cttcgagaaa 1080 tcgcccaact tctgcacgta cagcggacgc ctgggcacag caggcacggc agggcgcgcc 1140 tgtaacagct cgtcgcccgc gctggacggc tgcgagctgc tctgctgcgg caggggccac 1200 cgcacgcgca cgcagcgcgt caccgagcgc tgcaactgca ccttccactg gtgctgccac 1260 gtcagctgcc gcaactgcac gcacacgcgc gtactgcacg agtgtctgtg aggcgctgcg 1320 cggactcgcc cccaggaaac gctctcctcg agccctcccc caaacagact cgctagcact 1380 caagacccgg ttattcgccc acccgagtac ctccagtcac actccccgcg gttcatacgc 1440 atcccatctc tcccacttcc tcctacctgg ggactcctca aaccacttgc ctggggcggc 1500 atgaaccctc ttgccatcct gatggacctg ccccggacct acctccctcc ctctccgcgg 1560 gagacccctt gttgcactgc cccctgcttg gccaggaggt gagagaagga tgggtcccct 1620 ccgccatggg gtcggctcct gatggtgtca ttctgcctgc tccatcgcgc cagcgacctc 1680 tctgcctctc ttcttcccct ttgtcctgcg ttttctccgg gtcctcctaa gtcccttcct 1740 attctcctgc catgggtgca gaccctgaac ccacacctgg gcatcagggc ctttctcctc 1800 cccacctgta gctgaagcag gaggttacag ggcaaaaggg cagctgtgat gatgtggaaa 1860 tgaggttggg ggaaccagca gaaatgcccc cattctccca gtctctgtcg tggagccatt 1920 gaacagctgt gagccatgcc tccctgggcc acctcctacc ccttcctgtc ctgcctcctc 1980 atcagtgtgt aaataatttg cactgaaacg tggatacaga gccacgagtt tggatgttgt 2040 aaataaaact atttattgtg ctgggtccca gcctggtttg caaagaccac ctccaaccca 2100 acccaatccc tctccactct tctctccttt ctccctgcag ccttttctgg tccctcttct 2160 ctcctcagtt tctcaaagat gcgtttgcct cctggaatca gtatttcctt ccactgtagc 2220 tattagcggc tcctcgcccc caccagtgta gcatcttcct ctgcagaata aaatctctat 2280 ttttatcgat gacttggtgg cttttccttg aatccagaac acaaccttgt ttgtggtgtc 2340 ccctatcctc cccttttacc actcccag 2368
<210> 2
<211> 2301
<212> DNA
<213> Homo sapiens
<400> 2 agcagagcgg acgggcgcgc gggaggcgcg cagagctttc gggctgcagg cgctcgctgc 60 cgctggggaa ttgggctgtg ggcgaggcgg tccgggctgg cctttatcgc tcgctgggcc 120 catcgtttga aactttatca gcgagtcgcc actcgtcgca ggaccgagcg gggggcgggg 180 gcgcggcgag gcggcggccg tgacgaggcg ctcccggagc tgagcgcttc tgctctgggc 240 acgcatggcg cccgcacacg gagtctgacc tgatgcagac gcaagggggt taatatgaac 300 gcccctctcg gtggaatctg gctctggctc cctctgctct tgacctggct cacccccgag 360 gtcaactctt catggtggta catgagagct acaggtggct cctccagggt gatgtgcgat 420 aatgtgccag gcctggtgag cagccagcgg cagctgtgtc accgacatcc agatgtgatg 480 cgtgccatta gccagggcgt ggccgagtgg acagcagaat gccagcacca gttccgccag 540 caccgctgga attgcaacac cctggacagg gatcacagcc tttttggcag ggtcctactc 600 cgaagtagtc gggaatctgc ctttgtttat gccatctcct cagctggagt tgtatttgcc 660 atcaccaggg cctgtagcca aggagaagta aaatcctgtt cctgtgatcc aaagaagatg 720 ggaagcgcca aggacagcaa aggcattttt gattggggtg gctgcagtga taacattgac 780 tatgggatca aatttgcccg cgcatttgtg gatgcaaagg aaaggaaagg aaaggatgcc 840 agagccctga tgaatcttca caacaacaga gctggcagga aggctgtaaa gcggttcttg 900 aaacaagagt gcaagtgcca cggggtgagc ggctcatgta ctctcaggac atgctggctg 960 gccatggccg acttcaggaa aacgggcgat tatctctgga ggaagtacaa tggggccatc 1020 caggtggtca tgaaccagga tggcacaggt ttcactgtgg ctaacgagag gtttaagaag 1080 ccaacgaaaa atgacctcgt gtattttgag aattctccag actactgtat cagggaccga 1140 gaggcaggct ccctgggtac agcaggccgt gtgtgcaacc tgacttcccg gggcatggac 1200 agctgtgaag tcatgtgctg tgggagaggc tacgacacct cccatgtcac ccggatgacc 1260 aagtgtgggt gtaagttcca ctggtgctgc gccgtgcgct gtcaggactg cctggaagct 1320 ctggatgtgc acacatgcaa ggcccccaag aacgctgact ggacaaccgc tacatgaccc 1380 cagcaggcgt caccatccac cttcccttct acaaggactc cattggatct gcaagaacac 1440 tggacctttg ggttctttct ggggggatat ttcctaaggc atgtggcctt tatctcaacg 1500 gaagccccct cttcctccct gggggcccca ggatgggggg ccacacgctg cacctaaagc 1560 ctaccctatt ctatccatct cctggtgttc tgcagtcatc tcccctcctg gcgagttctc 1620 tttggaaata gcatgacagg ctgttcagcc gggagggtgg tgggcccaga ccactgtctc 1680 cacccacctt gacgtttctt ctttctagag cagttggcca agcagaaaaa aaagtgtctc 1740 aaaggagctt tctcaatgtc ttcccacaaa tggtcccaat taagaaattc catacttctc 1800 tcagatggaa cagtaaagaa agcagaatca actgcccctg acttaacttt aacttttgaa 1860 aagaccaaga cttttgtctg tacaagtggt tttacagcta ccacccttag ggtaattggt 1920 aattacctgg agaagaatgg ctttcaatac ccttttaagt ttaaaatgtg tatttttcaa 1980 ggcatttatt gccatattaa aatctgatgt aacaaggtgg ggacgtgtgt cctttggtac 2040 tatggtgtgt tgtatctttg taagagcaaa agcctcagaa agggattgct ttgcattact 2100 gtccccttga tataaaaaat ctttagggaa tgagagttcc ttctcactta gaatctgaag 2160 ggaattaaaa agaagatgaa tggtctggca atattctgta actattgggt gaatatggtg 2220 gaaaataatt tagtggatgg aatatcagaa gtatatctgt acagatcaag aaaaaaagga 2280 agaataaaat tcctatatca t 2301
<210> 3
<211> 5062
<212> DNA
<213> Homo sapiens
<400> 3
gaacaaggga gctggcgccg ccagcagccg ccgagctggg ttgagccgct gggccgcgcc 60 gcgcgccgcc gccgtctggg aggctcggcc cggccgcccg agcaggccgc gcgcgggccg 120 ccgggcccga ggccagagcc atgggcgaga ccaagatcat ctaccacttg gatgggcagg 180 agacgccgta ccttgtgaag ctgcccctgc ccgccgagcg cgtcaccttg gcggacttta 240 agggcgtttt gcagcgaccc agctataagt tcttcttcaa gtctatggac gacgatttcg 300 gagtggtgaa ggaggagatc tcggatgaca atgccaagct accatgcttc aatggccggg 360 tggtgtcctg gctggtgtca gctgagggct cacacccaga cccagccccc ttctgtgctg 420 ataacccatc ggagctgcca ccacctatgg agcgcacggg aggcatcggg gactcccgac 480 ccccatcctt ccaccctcat gctggtgggg gcagccagga gaacctggac aatgacacag 540 agacggactc tttggtgtct gcccagcgag agcggccacg ccggagggat ggcccagagc 600 atgcaacccg gctaaatgga actgcgaagg gggaacggcg gcgagaacca gggggttatg 660 atagctcatc cacccttatg agcagtgagc tggagaccac cagcttcttt gactcagatg 720 aggatgactc caccagcagg ttcagcagct ccacagaaca gagcagtgcc tcacgcctga 780 tgagaagaca caagcggcgg cggcggaagc agaaggtttc tcggattgag cggtcctcgt 840 ccttcagcag catcacggac tccaccatgt cactcaacat catcacggtc actctcaaca 900 tggaaaaata taacttcttg ggcatctcca ttgtgggcca aagcaacgag cgtggtgacg 960 gcggcatcta cattggctct atcatgaagg gtggggccgt ggctgctgat ggacgcatcg 1020 agccaggaga tatgttgtta caggtaaacg agatcaactt tgagaacatg agtaatgacg 1080 atgcagtccg ggtactgcgg gagattgtgc acaaaccggg gcccatcacc ctgactgtag 1140 ccaagtgctg ggacccaagt ccacgtggtt gcttcacatt gcccaggagc gagcccatcc 1200 ggcccattga ccctgcggcc tgggtctccc acactgcagc catgaccggc accttccctg 1260 catacggcat gagcccctcc ctgagcacca tcacctccac cagctcctcc atcaccagtt 1320 ccatccctga cacagagcgc ctagacgact tccacttgtc catccacagt gacatggctg 1380 ccatcgtaaa agccatggcc tcccctgaat cagggttgga ggtccgtgac cgcatgtggc 1440 tcaagattac catccctaat gctttcatcg gctcagatgt ggtggactgg ctgtaccaca 1500 atgtggaagg cttcacggac cggagggagg cccgcaagta tgccagcaac ctgctgaaag 1560 ctggcttcat ccgccatacc gtcaacaaga tcaccttctc cgagcagtgc tactacatct 1620 tcggtgacct ctgcggcaac atggccaacc tgtctctcca cgatcacgat ggctccagtg 1680 gcgcctctga ccaggacaca ctggcccctt tgccgcaccc gggggccgcc ccttggccca 1740 tggctttccc gtaccagtac ccgccacccc cgcacccata caacccgcac ccgggcttcc 1800 cggagctggg ctacagctac ggcgggggca gcgccagcag tcagcacagc gaaggcagtc 1860 ggagcagtgg ctccaaccgt agcggcagcg atcggaggaa ggagaaggac ccgaaggccg 1920 gggactccaa gtccgggggc agcggcagcg aatcggacca caccacacgc agcagcctgc 1980 gggggccgcg ggagcgggcg cccagcgagc gctcagggcc ggcggccagc gagcacagcc 2040 accgcagcca ccattccctg gccagcagcc ttcgcagcca ccacacacac ccgagctacg 2100 gtcctcccgg agtgccccct ctctacggcc cccccatgct gatgatgccc ccgccgcccg 2160 cggccatggg gcccccagga gcccctccgg gccgcgacct ggcctcagtg cccccggaac 2220 tgaccgccag cagacagtcc ttccgcatgg ccatgggaaa ccccagtgag ttctttgtgg 2280 atgtgatgtg agcagggccc ctcccccagc tccattccgc tcccacccca gccggctgcg 2340 ttcctctctc catccgtccg tcttttttac tttgtctggt acctgaaagg gaaataaaag 2400 gaactaaatc caggtgcgct aactgctcgc agggtgctgc gagggtgggg tgcacctacc 2460 gattggctct gcagccccct aacctgcctc tggccccagt tcgtttcctc tgcccactaa 2520 tccctgcgca ggacttccca ggaccccttt tgtctctggg accagacttg ttggtgctac 2580 cccttactcc cctctgcaac ccccattttg ggagttgacc ccagcaatga ccttggtggc 2640 acgctcactc cctcattctc tcgtttcccc tttagctccc tttcaccatt tattcagcta 2700 catcatccct ctattaaccc caccccatca ggcacgtgtg caaacctctt gactttaccc 2760 cacattactg aaaccaaaat atatttgctt catctgcccc tactaaccat ccccctgcct 2820 gctgcctcag tcctgcaacc taaagctgta gtcgcctcca atagccatcc atgccatccc 2880 tgcctgtgcc tagatcagag gcccagaggg ccccctcagt tgcctgagca gctggtggct 2940 tccagggagc atctctgctc tacccctgcc ccatgcctgc cctgcgtgct ggttccttca 3000 gacccctaac cctactaacc agcaggctca tctcacctcc aggcctgaaa catttctttt 3060 ctttcttttt tcctccccca atttaccctg ggcctggagc agccaagaat ttcgggctgt 3120 ttgactttct gtgagccccc agcgagggga ggcccagcct ccgaggagac caggaaccct 3180 gcttcagcag cccctcaggg cttcccaagg atgtccagcc cccacaccca cacgttaaca 3240 taatgagtca ctaggcttct ggggagggcc caacttcacc catgcatgag agactctcct 3300 cctttccaga gagaatcgga tcgcaccacg tgtggcagcc tgcggcgggg ggaggggggc 3360 ctctttagct ctctttatct ttctctctca ctcatgtatg catacatgca cagagatgca 3420 tacacaggtg cctatgcaag ttcatttaag cctcagggct ggtccctgcc caaagggctg 3480 gaccctccta atcctctcct aggttgtggg gctggtcccc tgacaccctt ctccccttcc 3540 tggtagacct taaacctcgc acacatgtcc ccagcatttt ctcacctgga taaagcccat 3600 aagctgggtc tcaggctggg ctcagcaaag gactcgcctt gcaaccgaca ggccattccc 3660 acccccacac acaacctccc ctgttttcac attcaccatg gcatcccaga gcaaggacac 3720 aggagcccac aggccagttg aggttgggca aggagacttc caggacttcc agacagagta 3780 ccaggtttta tttttcacct tattctctac tttaaacaaa tcataacttt ctctttaagc 3840 ctctgctata aattctcctg gctctcctgg gcttccatat tttgggggct ggggtgtcaa 3900 aagtgagatg aagttcttag ctccaggttt tggggtaaac caaggtagga acattttggc 3960 atttatttca attaacaata cttccttgga cgggtgcggt ggctcacgtc tgtaatccca 4020 gcactttggg aggctgagac aggtggatca cttgaggtcg ggagttcgag accagcctgg 4080 ccaacatagc aaaaccctgt ctctactaaa aatacaaaaa ttagatgggt gttttggcac 4140 ctgcctgtaa tctcagctac tcaggaggct gaggcacaag aatcgcttga atccaggaag 4200 caagcggagg ttgcagtgag ttgagatcgc actccagcct gggtgacaga gtgagattct 4260 gtctcaaaag caaactaaca aagaaaaaca atacttcctg gggttttggt gtgcagaggg 4320 ctttgttgga agtgtgactc aatcttgcct gccttctggg agctctagaa ttgttcccaa 4380 cccagtccat ggcttctagc caccactaca gggctgtttc atgtacttct ctctctgact 4440 ctgtcttgtc cgactctctt gagaatttct caacgattgc tcatgcctgt cagtatcagt 4500 gcttccatcg ttccatcttt gattcacttc tctttccttt ctatttactc ccaaaatgga 4560 gtcattcatc ctgatgtcct caattgctgc tgatatgctg gtgattccca aatacatagc 4620 tccaaccccc aacttccccc agactttaga tctgtattgg tattacctac tggacatctc 4680 tatggacagt tccgtataga ctcaactcat ctgcccaacc aagtatgttc ctcctgaatt 4740 cctctcctgg ttacttcatc acaatctaca taggctcacc agctagaaac atttatgagc 4800 ttacattcct tcttcccata tcttatcagc atatcatatc catttcactc caacactctg 4860 tcttgaattt ggccctccct ctcccctctc tactttaatt cattggagca tgggatttgg 4920 agttaggtgg ttttgggttt gaattccagc tctactattt ttggttgtgt gatagagtta 4980 tttaacctct ctgagcctca gttccctcgt atgtaaaatg atgataataa tacctacctc 5040 acagggttgt tgtgaggatt ta 5062
<210> 4
<211> 3084
<212> DNA
<213> Homo sapiens
<400> 4
aagatctaaa aacggacatc tccaccgtgg gtggctcctt tttctttttc tttttttccc 60 acccttcagg aagtggacgt ttcgttatct tctgatcctt gcaccttctt ttggggaaac 120 ggggcccttc tgcccagatc ccctctcttt tctcggaaaa caaactacta agtcggcatc 180 cggggtaact acagtggaga gggtttccgc ggagacgcgc cgccggaccc tcctctgcac 240 tttggggagg cgtgctccct ccagaaccgg cgttctccgc gcgcaaatcc cggcgacgcg 300 gggtcgcggg gtggccgccg gggcagcctc gtctagcgcg cgccgcgcag acgcccccgg 360 agtcgccagc taccgcagcc ctcgccgccc agtgcccttc ggcctcgggg cgggcgcctg 420 cgtcggtctc cgcgaagcgg gaaagcgcgg cggccgccgg gattcgggcg ccgcggcagc 480 tgctccggct gccggccggc ggccccgcgc tcgcccgccc cgcttccgcc cgctgtcctg 540 ctgcacgaac ccttccaact ctcctttcct cccccaccct tgagttaccc ctctgtcttt 600 cctgctgttg cgcgggtgct cccacagcgg agcggagatt acagagccgc cgggatgccc 660 caactctccg gaggaggtgg cggcggcggg ggggacccgg aactctgcgc cacggacgag 720 atgatcccct tcaaggacga gggcgatcct cagaaggaaa agatcttcgc cgagatcagt 780 catcccgaag aggaaggcga tttagctgac atcaagtctt ccttggtgaa cgagtctgaa 840 atcatcccgg ccagcaacgg acacgaggtg gccagacaag cacaaacctc tcaggagccc 900 taccacgaca aggccagaga acaccccgat gacggaaagc atccagatgg aggcctctac 960 aacaagggac cctcctactc gagttattcc gggtacataa tgatgccaaa tatgaataac 1020 gacccataca tgtcaaatgg atctctttct ccacccatcc cgagaacatc aaataaagtg 1080 cccgtggtgc agccatccca tgcggtccat cctctcaccc ccctcatcac ttacagtgac 1140 gagcactttt ctccaggatc acacccgtca cacatcccat cagatgtcaa ctccaaacaa 1200 ggcatgtcca gacatcctcc agctcctgat atccctactt tttatccctt gtctccgggt 1260 ggtgttggac agatcacccc acctcttggc tggcaaggtc agcctgtata tcccatcacg 1320 ggtggattca ggcaacccta cccatcctca ctgtcagtcg acacttccat gtccaggttt 1380 tcccatcata tgattcccgg tcctcctggt ccccacacaa ctggcatccc tcatccagct 1440 attgtaacac ctcaggtcaa acaggaacat ccccacactg acagtgacct aatgcacgtg 1500 aagcctcagc atgaacagag aaaggagcag gagccaaaaa gacctcacat taagaagcct 1560 ctgaatgctt ttatgttata catgaaagaa atgagagcga atgtcgttgc tgagtgtact 1620 ctaaaagaaa gtgcagctat caaccagatt cttggcagaa ggtggcatgc cctctcccgt 1680 gaagagcagg ctaaatatta tgaattagca cggaaagaaa gacagctaca tatgcagctt 1740 tatccaggct ggtctgcaag agacaattat ggtaagaaaa agaagaggaa gagagagaaa 1800 ctacaggaat ctgcatcagg tacaggtcca agaatgacag ctgcctacat ctgaaacatg 1860 gtggaaaacg aagctcattc ccaacgtgca aagccaaggc agcgacccca ggacctcttc 1920 tggagatgga agcttgttga aaacccagac tgtctccacg gcctgcccag tcgacgccaa ■ 1980 aggaacactg acatcaattt taccctgagg tcactgctag agacgctgat ccataaagac 2040 aatcactgcc aacccctctt tcgtctactg caagagccaa gttccaaaat aaagcataaa 2100 aaggtttttt aaaaggaaat gtaaaagcac atgagaatgc tagcaggctg tggggcagct 2160 gagcagcttt tctcccccca tatctgcgtg cacttcccag agcatcttgc atccaaacct 2220 gtaacctttc ggcaaggacg gtaacttggc tgcatttgcc tgtcatgcgc aactggagcc 2280 agcaaccagc tatccatcag caccccagtg gaggagttca tggaagagtt ccctctttgt 2340 ttctgcttca tttttctttc ttttcttttc tcctaaagct tttatttaac agtgcaaaag 2400 gatcgttttt ttttgctttt ttaaacttga atttttttaa tttacacttt ttagttttaa 2460 ttttcttgta tattttgcta gctatgagct tttaaataaa attgaaagtt ctggaaaagt 2520 ttgaaataat gacataaaaa gaagccttct ttttctgaga cagcttgtct ggtaagtggc 2580 ttctctgtga attgcctgta acacatagtg gcttctccgc ccttgtaagg tgttcagtag 2640 agctaaataa atgtaatagc caaaccccac tctgttggta gcaattggca gccctatttc 2700 agtttatttt ttcttctgtt ttcttctttt ctttttttaa acagtaaacc ttaacagatg 2760 cgttcagcag actggtttgc agtgaatttt catttctttc cttatcaccc ccttgttgta 2820 aaaagcccag cacttgaatt gttattactt taaatgttct gtatttgtat ctgtttttat 2880 tagccaatta gtgggatttt atgccagttg ttaaaatgag cattgatgta cccatttttt 2940 aaaaaagcaa gcacagcctt tgcccaaaac tgtcatccta acgtttgtca ttccagtttg 3000 agttaatgtg ctgagcattt ttttaaaaga agctttgtaa taaaacattt ttaaaaattg 3060 tcatttaaaa aaaaaaaaaa aaaa 3084
<210> 5
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 5
uuguguucug gauucaagg 19
<210> 6
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 6
uuauuuacac acugaugag 19
<210> 7
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 7
ucaauguugu cgcugcagc 19
<210> 8
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 8
uuugagaaac ugaggagag 19
<210> 9
<211> 19
<212> RNA <213> artificial sequence
<220>
<223> WNT-I SiRNA
<400> 9
aagucaaugu ugucgcugc 19
<210> 10
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 10
auuuacaaca uccaaacuc 19
<210> 11
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 11
uauuuacaac auccaaacu 19
<210> 12
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 12
aauagagauu uuauucugc 19
<210> 13
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 13
uaguuuuauu uacaacauc 19
<210> 14
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 14
uucacaauac cccaccauc 19
<210> 15
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA <400> 15
aaacugagga gagaagagg 19
<210> 16
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 16
uuuacacacu gaugaggag 19
<210> 17
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 17
aaaacgcagg acaaagggg 19
<210> 18
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 18
uugagaaacu gaggagaga 19
<210> 19
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 19
auucugcaga ggaagaugc 19
<210> 20
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 20
auuuuggcgu aucagacgc 19
<210> 21
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 21
uuguugugaa gguucauga 19 <210> 22
<211> 19
<212 > RNA
<213 > artificial sequence
<220 >
<223> WNT-I siRNA
<400> 22
ugaagguuca ugaggaagc 19
<210> 23
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 23
uguauccacg uuucagugc 19
<210> 24
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 24
auuucucgaa guagacgag 19
<210> 25
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 25
aaacaagguu guguucugg 19
<210> 26
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 26
aaacgcaucu uugagaaac 19
<210> 27
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 27
uucuggauuc aaggaaaag 19
<210> 28
<211> 19
<212> RNA <213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 28
uagagauuuu auucugcag 19
<210> 29
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 29
aaacucgugg cucuguauc 19
<210> 30
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 30
uugugaaggu ucaugagga 19
<210> 31
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 31
aaauaguuuu auuuacaac 19
<210> 32
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 32
aauacugauu ccaggaggc 19
<210> 33
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 33
auaaacgccg uuucucgac 19
<210> 34
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA <400> 34
aaaaauagag auuuuauuc 19
<210> 35
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 35
aaugacacca ucaggagcc 19
<210> 36
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 36
uguaaccucc ugcuucagc 19
<210> 37
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 37
auaaccgggu cuugagugc 19
<210> 38
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 38
uuuuauucug cagaggaag 19
<210> 39
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 39
uaaacgccgu uucucgaca 19
<210> 40
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 40
uuuauucugc agaggaaga 19 <210 > 41
<211> 19
<212 > RNA
<213 > artificial sequence
<220 >
<223> WNT-I SiRNA
<400> 41
aaauacugau uccaggagg 19
<210> 42
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I SiRNA
<400> 42
ucuuugagaa acugaggag 19
<210> 43
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 43
aagaagagag gcagagagg 19
<210> 44
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 44
agacacucgu gcaguacgc 19
<210> 45
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 45
agaaaacgca ggacaaagg 19
<210> 46
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 46
uauucugcag aggaagaug 19
<210> 47
<211> 19
<212> RNA <213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 47
uugacgaucu ugccgaaga 19
<210> 48
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 48
acaacaucca aacucgugg 19
<210> 49
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 49
aauaaauagu uuuauuuac 19
<210> 50
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 50
aaaagccacc aagucaucg 19
<210> 51
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 51
aacugccacu ugcacucgc 19
<210> 52
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 52
aacgcaucuu ugagaaacu 19
<210> 53
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA <400> 53
aauuauuuac acacugaug 19
<210> 54
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 54
aaguagacga ggucguggg 19
<210> 55
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 55
auggaaccuu cugagcagg 19
<210> 56
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 56
aaauagagau uuuauucug 19
<210> 57
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 57
aacaucσaaa cucguggcu 19
<210> 58
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-I siRNA
<400> 58
aguuuuauuu acaacaucc 19
<210> 59
<211> 19
<212> RNA
<213> artificial sequence
<220>
<223> WNT-2 siRNA
<400> 59
uucguuggcu ucuuaaacc 19 <210 > 60
<211 > 19
<212 > RNA
<213 > artificial
<220 >
<223> WNT-2 siRNA
<400> 60
uugaucugua cagauauac 19
<210> 61
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 61
uugugaagau ucaucaggg 19
<210> 62
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 62
ucuuacaaag auacaacac 19
<210> 63
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 63
auuuuccacc auauucacc 19
<210> 64
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 64
uaaaccucuc guuagccac 19
<210> 65
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 65
uauuuuccac cauauucac 19
<210> 66
<211> 19
<212> RNA <213> artificial
<220>
<223> WNT-2 siRNA
<400> 66
aauaguuaca gaauauugc 19
<210> 67
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 67
uuaaaagggu auugaaagc 19
<210> 68
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 68
uuaaaguuaa gucaggggc 19
<210> 69
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 69
ucaagaaccg cuuuacagc 19
<210> 70
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 70
ucaauguuau cacugcagc 19
<210> 71
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 71
uuucuuuacu guuccaucu 19
<210> 72
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA <400> 72
uaaaaccacu uguacagac 19
<210> 73
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 73
uucuuaaacc ucucguuag 19
<210> 74
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 74
uucaaaaguu aaaguuaag 19
<210> 75
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 75
auaguuacag aauauugcc 19
<210> 76
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 76
auucucaaaa uacacgagg 19
<210> 77
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 77
uucuuuacug uuccaucug 19
<210> 78
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 78
uauugccaga ccauucauc 19 <210> 79
<211 > 19
<212 > RNA
<213 > artificial
<220 >
<223> WNT-2 siRNA
<400> 79
uuuacuucuc cuuggcuac 19
<210> 80
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 80
uucucaaaau acacgaggu 19
<210> 81
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 81
auacuucuga uauuccauc 19
<21O> 82
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 82
aucuguacag auauacuuc 19
<210> 83
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 83
uucuucucca gguaauuac 19
<210> 84
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 84
uucugauauu ccauccacu 19
<210> 85
<211> 19
<212> RNA <213> artificial
<220>
<223> WNT-2 SiRNA
<400> 85
uacagaauau ugccagacc 19
<210> 86
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 SiRNA
<400> 86
uuacuguucc aucugagag 19
<210> 87
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 SiRNA
<400> 87
uuucguuggc uucuuaaac 19
<210> 88
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 88
uuuuucuuga ucuguacag 19
<210> 89
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 89
uuuggaucac aggaacagg 19
<210> 90
<2ll> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 90
aaaaauacac auuuuaaac 19
<210> 91
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA <400> 91
uuuaauuccc uucagauuc 19
<210> 92
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 92
uaaaugccuu gaaaaauac 19
<210> 93
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 93
uuacagaaua uugccagac 19
<210> 94
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 94
uaaaguuuca aacgauggg 19
<210> 95
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 95
uucuuuggau cacaggaac 19
<210> 96
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 96
uugcucuuac aaagauaca 19
<210> 97
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 97
uuugauccca uagucaaug 19 <210> 98
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 SiRNA
<400> 98
uuuuuuucuu gaucuguac 19
<210> 99
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 99
uuauuuucca ccauauuca 19
<210> 100
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 100
uaaacaaagg cagauuccc 1S
<210 > 101
<211 > 19
<212 > RNA
<213 > arti f icial
<220 >
<223> WNT-2 SiRNA
<400> 101
uugauucugc uuucuuuac 19
<210> 102
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 102
uuguugugaa gauucauca 19
<210> 103
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 103
auucugcugu ccacucggc 19
<210> 104
<211> 19
<212> RNA <213> artificial
<220>
<223> WNT-2 siRNA
<400> 104
uacaucagau uuuaauaug 19
<210> 105
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 105
uugaucccau agucaaugu 19
<210> 106
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 106
ucuucuccag guaauuacc 19
<210> 107
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 107
aaguuaaagu uaagucagg 19
<210> 108
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 108
auuuccaaag agaacucgc 19
<210> 109
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 109
uuaauucccu ucagauucu 19
<210> 110
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA <400> 110
uucaagaacc gcuuuacag 19
<210> 111
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 111
aagauacaac acaccauag 19
<210> 112
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 112
uuuucuugau cuguacaga 19
<210> 113
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 113
uaguaccaaa ggacacacg 19
<210> 114
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 114
uaaaagggua uugaaagcc 19
<210> 115
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 115
auaaaguuuc aaacgaugg 19
<210> 116
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 116
uuacagccuu ccugccagc 19 <210> 117
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 117
uuaaaccucu cguuagcca 19
<210> 118
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 118
aaaauacaca uuuuaaacu 19
<210> 119
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 119
uuuaauaugg caauaaaug 19
<210> 120
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 120
uauaggaauu uuauucuuc 19
<210> 121
<211> 19
<212> RNA
<213> artificial
<220>
<223> WNT-2 siRNA
<400> 121
uacacgaggu cauuuuucg 19
<210> 122
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 122
aaguggaagu cgucuaggc 19
<210> 123
<211> 19
<212> RNA <213> artificial
<220>
<223> DVL3 siRNA
<400> 123
uggaagcacu gauacugac 19
<210> 124
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 124
uaugcauaca ugagugaga 19
<210> 125
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 125
uucaagacag aguguugga 19
<210> 126
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 126
aaggugaucu uguugacgg 19
<210> 127
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 127
uagcagaggc uuaaagaga 19
<210> 128
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 128
uuuuguauuu uuaguagag 19
<210> 129
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA <400> 129
agagaaagau aaagagagc 19
<210> 130
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 130
aaagucaaga gguuugcac 19
<210> 131
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 131
augcuccaau gaauuaaag 19
<210> 132
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 SiRNA
<400> 132
uuauuucccu uucagguac 19
<210> 133
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 133
augagcuauc auaaccccc 19
<210> 134
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 134
auaugauaug cugauaaga 19
<210> 135
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 135
ucauaaaugu uucuagcug 19 <210 > 136
<211 > 19
<212 > RNA
<213 > arti f icial
<220 >
<223> DVL3 SiRNA
<400> 136
uuuuuguauu uuuaguaga 19
<210> 137
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 137
uugggcagau gaguugagu 19
<210> 138
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 138
uaucagcagc aauugagga 19
<210> 139
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 139
uuauguuaac gugugggug 19
<210> 140
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 140
uuuuccaugu ugagaguga 19
<210> 141
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 141
uauuguuuuu cuuuguuag 19
<210> 142
<211> 19
<212> RNA <213> artificial
<220>
<223> DVL3 SiRNA
<400> 142
agaaguacau gaaacagcc 19
<210> 143
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 143
uaaagucaag agguuugca 19
<210> 144
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 144
uugaaauaaa ugccaaaau 19
<210> 145
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 145
uucucaagag agucggaca 19
<210> 146
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 146
auguagauug ugaugaagu 19
<210> 147
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 147
uagcugagau uacaggcag 19
<210> 148
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA <400> 148
augaaugacu ccauuuugg 19
<210> 149
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 SiRNA
<400> 149
augaagcaaa uauauuuug 19
<210> 150
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 SiRNA
<400> 150
uuuguuuaaa guagagaau 19
<210> 151
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 SiRNA
<400> 151
uaauuuuugu auuuuuagu 19
<210> 152
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 152
auaaaaccug guacucugu 19
<210> 153
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 153
auggugaaug ugaaaacag 19
<210> 154
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 154
aucacaucca caaagaacu 19 <210 > 155
<211 > 19
<212 > RNA
<213 > art i f icial
<220 >
<223> DVL3 siRNA
<400> 155
auccacaaag aacucacug 19
<210> 156
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 156
agaagugaau caaagaugg 19
<210> 157
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 157
aaugccaaaa uguuccuac 19
<210> 158
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 158
ugagagagaa agauaaaga 19
<210> 159
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 159
auugugauga aguaaccag 19
<210> 160
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 160
uaagggugga ugagcuauc 19
<210> 161
<211> 19
<212> RNA <213> artificial
<220>
<223> DVL3 siRNA
<400> 161
aaaaccugga gcuaagaac 19
<210> 162
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 162
agaaucucac ucugucacc 19
<210> 163
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 163
aaggaaagag aagugaauc 19
<210> 164
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 164
acuucaucuc acuuuugac 19
<210> 165
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 165
uucuagagcu cccagaagg 19
<210> 166
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 166
auucucaaga gagucggac 19
<210> 167
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA <400> 167
aucucacucu gucacccag 19
<210> 168
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 168
uuuguauuuu uaguagaga 19
<210> 169
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 169
aauaaaaccu gguacucug 19
<210> 170
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 170
aauccucaca acaacccug 19
<210> 171
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 171
auuuuacaua cgagggaac 19
<210> 172
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 172
aaagaguccg ucucugugu 19
<210> 173
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 173
uaagauaugg gaagaagga 19 <210> 174
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 174
uuggcauugu cauccgaga 19
<210> 175
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 175
uaaagucugg gggaaguug 19
<210> 176
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 176
uauguuaacg ugugggugu 19
<210> 177
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 177
aagauguagu agcacugcu 19
<210> 178
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 178
auccaagugg uagaugauc 19
<210> 179
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 179
uuguuaguuu gcuuuugag 19
<210> 180
<211> 19
<212> RNA <213> artificial
<220>
<223> DVL3 siRNA
<400> 180
uuuuuaguag agacagggu 19
<210> 181
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 181
uuccuaccuu gguuuaccc 19
<210> 182
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA
<400> 182
aaaauaaaac cugguacuc 19
<210> 183
<211> 19
<212> RNA
<213> artificial
<220>
<223> DVL3 siRNA 63
<400> 183
ugaucuuguu gacgguaug 19
<210> 184
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 184
gaaaggagca ggagccaaa 19
<210> 185
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 185
gaaagaaaug agagcgaau 19
<210> 186
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA <400> 186
gugaagagca ggcuaaaua 19
<210> 187
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl SiRNA
<400> 187
gaauuagcac ggaaagaaa 19
<210> 188
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 188
gagagaaacu acaggaauc 19
<210> 189
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 189
ucugaaacau gguggaaaa 19
<210> 190
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 190
cgaagaggaa ggcgauuua 19
<210> 191
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 191
ggaaagaaag acagcuaca 19
<210> 192
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 192
caagagacaa uuaugguaa 19 <210 > 193
<211 > 19
<212 > RNA
<213 > arti f icial
<220 >
<223> LEFl siRNA
<400> 193
uguaaaagca caugagaau 19
<210> 194
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 194
acggaaagaa agacagcua 19
<210> 195
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 195
gauggaagcu uguugaaaa 19
<210> 196
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 196
gagccaaguu ccaaaauaa 19
<210> 197
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 197
uggaggaguu cauggaaga 19
<210> 198
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 198
cgacaaggcc agagaacac 19
<210> 199
<211> 19
<212> RNA <213> artificial
<220>
<223> LEFl siRNA
<400> 199
gguguucagu agagcuaaa 19
<210> 200
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 200
guucaguaga gcuaaauaa 19
<210> 201
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 201
gguacagguc caagaauga 19
<210> 202
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 202
augaaagaaa ugagagcga 19
<210> 203
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl SiRNA
<400> 203
caaccagauu cuuggcaga 19
<210> 204
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 204
aaagaaagac agcuacaua 19
<210> 205
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA <400> 205
ggaaguggac guuucguua 19
<210> 206
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 206
gcgauuuagc ugacaucaa 19
<210> 207
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEPl siRNA
<400> 207
gagagagaaa cuacaggaa 19
<210> 208
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 208
caguaaaccu uaacagaug 19
<210> 209
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 209
gagcauugau guacccauu 19
<210> 210
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 210
gagcgaaugu cguugcuga 19
<210> 211
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 211
cuagagacgc ugauccaua 19 <210 > 212
<211 > 19
<212 > RNA
<213 > artif icial
<220 >
<223> LEFl siRNA
<400> 212
gugaauugcc uguaacaca 19
<210> 213
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 213
caguagagcu aaauaaaug 19
<210> 214
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 214
cagucauccc gaagaggaa 19
<21O> 215
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 215
cccgagaaca ucaaauaaa 19
<210> 216
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 216
acgugaagcc ucagcauga 19
<210> 217
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 217
gcaagagaca auuauggua 19
<210> 218
<211> 19
<212> RNA <213> artificial
<220>
<223> LEFl siRNA
<400> 218
agagagaaac uacaggaau 19
<210> 219
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 219
aaacgaagcu cauucccaa 19
<210> 220
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 220
gcucauuccc aacgugcaa 19
<210> 221
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 221
gcugauccau aaagacaau 19
<210> 222
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 222
gcaagagcca aguuccaaa 19
<210> 223
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 223
ccgaagagga aggcgauuu 19
<210> 224
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA <400> 224
agaggaagag agagaaacu 19
<210> 225
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl SiRNA
<400> 225
cauuccaguu ugaguuaau 19
<210> 226
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl SiRNA
<400> 226
gcacaaaccu cucaggagc 19
<210> 227
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 227
ggguacauaa ugaugccaa 19
<210> 228
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 228
ccacccaucc cgagaacau 19
<210> 229
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 229
uuaugaauua gcacggaaa 19
<210> 230
<211> 19
<212> RNA
<213> artificial
<220>
<223> LEFl siRNA
<400> 230
aagaaagaca gcuacauau 19

Claims

Claims
1. The use of a siRNA oligonucleotide containing a sequence comprising at least 19 nucleotides complementary to the target mRNA sequence in the production of a drug for systemic administration in the treatment of tumours, which inhibits the activity of the WNT/beta-catenin pathway.
2. The use of a siRNA oligonucleotide containing a sequence comprising at least 19 nucleotides complementary to the target mRNA sequence in the production of a drug for systemic administration in the treatment of tumours, wherein the target mRNA sequence is selected from among the mRNA of the WNT1 gene containing the sequence SEQ ID No. 1 , mRNA of the WNT2 gene containing the sequence SEQ ID No. 2, mRNA of the DVL3 gene containing the sequence SEQ ID No. 3 or the mRNA of the LEF1 gene containing the sequence SEQ ID No. 4.
3. A use according to Claim 1 , characterised in that the oligonucleotide complementary to the mRNA of WNT-1 is an oligonucleotide comprising a sequence selected from among SEQ ID Nos. 5-58, the oligonucleotide complementary to the mRNA of WNT-2 is an oligonucleotide comprising a sequence selected from among SEQ ID Nos. 59-121 , the oligonucleotide complementary to the mRNA of DVL3 is an oligonucleotide comprising a sequence selected from among SEQ ID Nos. 122-183; whereas the oligonucleotide complementary to the mRNA of LEF1 is an oligonucleotide comprising a sequence selected from among SEQ ID Nos. 184-230.
4. A use according to Claim 1 , characterised in that siRNA is used in the form of a complex with a pharmaceutically permissible carrier.
5. A use according to Claim 3, characterised in that the carrier used is PEI (poliethylenylimine), wherein preferentially, the N/P ratio is smaller than 12, and preferentially is from 2 to 10.
6. A use according to Claim 3, characterised in that the carrier used is 8R (octaarginine), wherein the N/P ratio is preferentially from 2 to 60.
7. A use according to Claim 1 , characterised in that the drug produced is meant for the treatment of cancers selected from among a group encompassing cancers of the breast, lung, skin, prostate or pancreas.
8. A use according to Claim 1 , characterised in that the drug produced is meant for parenteral administration, through intravenous injection or intraperitoneal injection.
9. A use according to Claim 1, characterised in that the drug produced is meant for preventing the formation of metastases.
10. A use according to Claim 1 , characterised in that the drug produced is meant for combating cancerous tumours.
PCT/PL2010/000059 2009-07-12 2010-07-12 The use of a sirna oligonucleotide WO2011008117A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PL388513A PL388513A1 (en) 2009-07-12 2009-07-12 Application of siRNA oligonucleotide
PLPL388513 2009-07-12

Publications (2)

Publication Number Publication Date
WO2011008117A2 true WO2011008117A2 (en) 2011-01-20
WO2011008117A3 WO2011008117A3 (en) 2011-11-17

Family

ID=43450014

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/PL2010/000059 WO2011008117A2 (en) 2009-07-12 2010-07-12 The use of a sirna oligonucleotide

Country Status (2)

Country Link
PL (1) PL388513A1 (en)
WO (1) WO2011008117A2 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL378857A1 (en) 2006-01-31 2007-08-06 Celon Pharma Spółka Z Ograniczoną Odpowiedzialnością Double twisted oligonucleotides interfering with mRNA of gene WNT1 (siRNA) used in order to inhibit polypheration of tumour cells

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100055784A1 (en) * 2007-03-02 2010-03-04 Mdrna, Inc. Nucleic acid compounds for inhibiting wnt gene expression and uses thereof
KR100807069B1 (en) * 2007-09-21 2008-02-25 고려대학교 산학협력단 Pharmaceutical composition for treating cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL378857A1 (en) 2006-01-31 2007-08-06 Celon Pharma Spółka Z Ograniczoną Odpowiedzialnością Double twisted oligonucleotides interfering with mRNA of gene WNT1 (siRNA) used in order to inhibit polypheration of tumour cells

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ELBAHIR SM ET AL.: "Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate", EMBO J., vol. 20, 2001, pages 6877 - 6888
ELBASHIR SM ET AL.: "Analysis of gene function in somatic mammalian cells using small interfering RNAs", METHODS, vol. 26, 2002, pages 199 - 213
ELBASHIR SM ET AL.: "Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells", NATURE, vol. 411, 2001, pages 494 - 498
KATOH ET AL.: "Expression and regulation of WNT1 in human cancer: up-regulation of WNT1 by beta-estradiol in MCF-7", JONCOL, vol. 22, no. 1, January 2003 (2003-01-01), pages 20912
POLAKIS ET AL., WNT SIGNALING AND CANCER, GENES DEV., vol. 14, no. 15, 1 August 2000 (2000-08-01), pages 1837 - 51
PU ET AL., CANCER GENE THER., 24 November 2008 (2008-11-24)
REYNOLDS A; LEAKE D; BOESE Q; SCARINGE S; MARSHALL WS; KHVOROVA A: "Rational siRNA design for RNA interference", NAT BIOTECHNOL., vol. 22, no. 3, March 2004 (2004-03-01), pages 326 - 30
TUSCHL, T.; ELBASHIR, S.; HARBORTH, J.; WEBER, K.: "The siRNA User Guide", 6 May 2004

Also Published As

Publication number Publication date
WO2011008117A3 (en) 2011-11-17
PL388513A1 (en) 2011-01-17

Similar Documents

Publication Publication Date Title
JP6865169B2 (en) RNA Interfering Agent for P21 Gene Regulation
D'ANGELO et al. MicroRNAs: a puzzling tool in cancer diagnostics and therapy
JP2022008404A (en) C/EBPα SMALL MOLECULE-ACTIVATING RNA COMPOSITION
Babae et al. Systemic miRNA-7 delivery inhibits tumor angiogenesis and growth in murine xenograft glioblastoma
JP2018507866A (en) Pharmaceutical composition for cancer treatment comprising microRNA as an active ingredient
JP5976643B2 (en) Methods and compositions for specific inhibition of beta-catenin by double stranded RNA
JP6457704B2 (en) SiRNA structure for high activity and off-target reduction
JP2010537640A (en) Compositions of asymmetric RNA duplexes as microRNA mimetics or inhibitors
JP2013534424A (en) Methods and compounds for the specific inhibition of androgen receptor by double-stranded RNA
Zhang et al. A miR-124/ITGA3 axis contributes to colorectal cancer metastasis by regulating anoikis susceptibility
EP2300017A2 (en) Mirnas as therapeutic targets in cancer
Zhu et al. Small interfering RNAs targeting mutant K-ras inhibit human pancreatic carcinoma cells growth in vitro and in vivo
US20200140859A1 (en) COMPOUNDS THAT TARGET MYC microRNA RESPONSIVE ELEMENTS FOR THE TREATMENT OF MYC-ASSOCIATED CANCER
Okamoto et al. The therapeutic potential of RNA interference: novel approaches for cancer treatment
Zhou et al. Role of the AKT pathway in microRNA expression of human U251 glioblastoma cells Retraction in/10.3892/ijo. 2023.5597
WO2011008117A2 (en) The use of a sirna oligonucleotide
CN111996193A (en) siRNA sequence for effectively inhibiting expression of epidermal growth factor receptor
Stedt et al. Specific inhibition of SRC kinase impairs malignant glioma growth in vitro and in vivo
WO2011074652A1 (en) Nucleic acid capable of inhibiting expression of hif-2α
WO2013075233A1 (en) Method for treating brain cancer
KR101861738B1 (en) Double Stranded Oligo RNA Structure Comprising miRNA
KR101308924B1 (en) NOVEL miRNA hc-smR-S2-5 AND USE THEREOF
KR101993894B1 (en) Double Stranded Oligo RNA Structure Comprising miRNA
Li et al. The bio-information analyses and function research of microrna-145 in human colorectal carcinoma cells
JP2013018754A (en) Therapeutic agent for treating malignant pleural mesothelioma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10747328

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10747328

Country of ref document: EP

Kind code of ref document: A2