JP2013018754A - Therapeutic agent for treating malignant pleural mesothelioma - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new therapeutic agent for treating malignant pleural mesothelioma.SOLUTION: The therapeutic agent for mesothelioma includes an RNAi molecule targeting a focal adhesion kinase and reducing an expression amount of the focal adhesion kinase in a cell.

Description

  The present invention relates to an RNAi molecule that suppresses expression of a focal adhesion kinase (FAK) gene and a composition for the treatment of malignant pleural mesothelioma containing the RNAi molecule.

  Mesothelioma is a general term for tumors derived from mesothelial cells, with pleura, peritoneum and pericardium as the main sites of development. A malignant pleural mesothelioma is a malignant tumor that develops from the mesoderm-derived pleural mesothelioma, usually originating from the wall-side pleura and extending along the pleura (Non-Patent Document 1). It is known that most of the causes of pleural mesothelioma are asbestos exposure, and unlike lung cancer, no interaction with smoking has been observed (Non-patent Document 1). In general, the incubation period after exposure to asbestos is long, and it takes 20 to 50 years (average 40 years) until mesothelioma occurs. In 2008, 1,170 patients were reported in Japan (Non-Patent Document 2), but the ban on the full use of asbestos in Japan was 2006, peaking at 2030-2051 in the next 40 years. In addition, about 100,000 patients are expected to occur (Non-patent Document 3). Unlike pulmonary cancer, malignant pleural mesothelioma is derived from the mesoderm, and therefore has the ability to differentiate in both directions, carcinoma with epithelial character and sarcoma with non-epithelial character. Are divided into epithelial type (50-60%), biphasic type (20-25%), and sarcoma type (20%). Patients usually have unilateral pleural thickening and about 80% of cases have pleural effusion. The diagnosis rate by cytology is as low as about 30%, and thoracoscopic histological examination is often performed. Differentiating from lung cancer also requires comprehensive tissue diagnosis using immunostaining for a plurality of molecular markers (Non-patent Document 4). On the other hand, the clinical course is very different from lung cancer, where metastasis to distant organs is a problem, and clinically, metastasis is rarely a problem, and local recurrence is a problem in most cases. It is resistant to treatment and is treated with surgery, radiation therapy, or chemotherapy, but is less sensitive to any treatment. As chemotherapy, combined therapy of cisplatin and pemetrexed is used (Non-patent Document 5), but the average survival time is about 12 months and the prognosis is poor.

  Integrins are the main cell surface receptors for extracellular matrix molecules and play an important role in various biological processes. Adhesion plaque kinase (hereinafter referred to as “FAK”) has recently been identified as a major component of the signal transduction pathway initiated by integrins. FAK has been proposed to be involved in FAK activation by assembling with integrins and cytoskeletal proteins in adhesion plaques. Recent results from many different approaches indicate that FAK-mediated integrin signaling increases cell migration on fibronectin and may regulate cell proliferation and survival (Non-Patent Document 6). The interaction between integrin and FAK regulates cancer cell adhesion and extracellular matrix (ECM) invasion. The trigger for the FAK signaling cascade is autophosphorylation of Y397. Phosphorylated Y397 is an SH2 docking site for the Src family of tyrosine kinases, and c-Src kinase bound to it phosphorylates other tyrosine residues in FAK. FAK phosphorylation correlates with increased cell motility and invasion. Adhesion and propagation of cancer cells to various ECM proteins, such as type IV collagen, results in increased tyrosine phosphorylation and FAK activation (7).

  RNA interference (hereinafter referred to as “RNAi”) is a method of post-transcriptional gene regulation that is conserved in many eukaryotes. RNAi molecules are induced by double-stranded RNA (hereinafter referred to as “dsRNA”) present in cells (Non-patent Document 8). dsRNA that is short, ie, less than 30 nucleotides, is referred to as short interfering RNA (hereinafter referred to as “siRNA”) and disrupts messenger RNA (mRNA) that shares sequence homology with siRNA. (Non-Patent Document 9). The siRNA and target mRNA are thought to bind to the RNA-induced silencing complex (RISC), which cleaves the target mRNA. This siRNA apparently resembles a multiple turnover enzyme and can be reused, and one siRNA molecule can induce the cleavage of about 1000 mRNA molecules. Therefore, degradation of mRNA by RNAi molecules is more effective than currently available techniques for blocking target gene expression.

  In cultured mammalian cells, it was shown that RNAi action is effective even in living mice (Non-patent Documents 10 and 11). Further, it has been disclosed that RNAi molecules targeting FAK may be applied to the treatment of breast cancer, lung cancer, and ovarian tumor (Non-patent Document 12, Non-patent Document 13, Patent Document 1).

JP 2008-536874 A

Robinson BWS, Lake RA. Advances in maligant mesothelioma. N Engl J Med 2005; 353: 1591-1603. Ministry of Health, Labor and Welfare website. Annual changes in the number of deaths from mesothelioma by prefecture (1995 to 20 years) (http://www.mhlw.go.jp/toukei/saikin/hw/jinkuu/tokuyu/chuhuisyu08/) Murayama T et al. Estimate of future mortality from full marine messmanellioma in Japan based on an age-cohort model. Am J Ind Med 2006; 49: 1-7. Robinson BWS et al. Malignant mesothelioma. 2005; 366: 397-408. Vogelzang NJ et al. Phase III study of pemetrexed in combination with cisplatin versus cisplatin alone in patients with maliintant pleural mesothelioma. J Clin Oncol. 2003; 21: 2636-2644 JL Guan, Int J Biochem Cell Biol. 29 (8-9): 1085-96 (1997 Aug-Sep) H Sawai, et al. , Molecular Cancer, 4:37 (2005). Fire A, et al. , Nature 391: 806-811 (1998). Elbashir SM, et al. , Nature, 411: 494-498 (2001). Nature, 418: 38-39 (2002). Xia H, et al. Nat. Biotech. 20: 1006-1010 (2002) BMC Cancer 2009; 9: 280 Anticancer Res 2004; 24 (6): 3899

Mesothelioma, especially malignant pleural mesothelioma, has a clear high malignant tumor resistance compared to conventional therapies, so that new targets and new treatment strategies for such mesothelioma will be developed quickly is necessary.
An object of the present invention is to provide a novel therapeutic agent for treating malignant pleural mesothelioma.

  In view of such a current situation, the present inventors searched for a novel target gene for malignant pleural mesothelioma, and as a result of repeated research on treatment methods for the mesothelioma, FAK is effective for the mesothelioma. It was found to be a target. Moreover, the novel RNAi molecule | numerator which can suppress the expression of FAK remarkably was discovered. Furthermore, the present inventors have confirmed that the RNAi molecule has the antitumor effect of the mesothelioma by remarkably suppressing the expression of FAK, and have completed the present invention.

That is, the present invention is as follows.
[1] A mesothelioma therapeutic agent comprising an RNAi molecule that targets adhesion plaque kinase and reduces the expression level of the adhesion plaque kinase in a cell.
[2] Double-stranded RNA in which an RNAi molecule is a hybrid of a sense strand consisting of the base sequence represented by AUACUGUAGAGUCCUCCACAAUUGGG (SEQ ID NO: 1) and an antisense strand that hybridizes with the sense strand under stringent conditions [1] A mesothelioma therapeutic agent comprising a portion.
[3] The RNAi molecule is a double strand formed by hybridization of a sense strand consisting of a base sequence represented by AUACUGUAGAGUCCCUCCACAAUUGGG (SEQ ID NO: 1) and an antisense strand consisting of a base sequence represented by CCCAAUUGGAGGACUCUACAGUAU (SEQ ID NO: 2) [2] A mesothelioma therapeutic agent comprising an RNA portion.
[4] The mesothelioma therapeutic agent according to any one of [1] to [3], wherein the sense strand and the antisense strand of the RNAi molecule are linked via a linker moiety.
[5] The mesothelioma therapeutic agent according to [4], wherein the RNAi molecule has a base sequence represented by SEQ ID NO: 3.
[6] A mesothelioma therapeutic agent comprising a vector expressing the RNAi molecule specified in [4] or [5], wherein the vector comprises DNA encoding the RNAi molecule. Agent.
[7] The therapeutic agent for mesothelioma according to any one of [1] to [6], wherein the mesothelioma is malignant pleural mesothelioma.
[8] The mesothelioma therapeutic agent according to any one of [1] to [7], which is for intrathoracic administration.

  The RNAi molecule in the present invention can remarkably suppress the expression of FAK, and can suppress the growth of malignant pleural mesothelioma that expresses FAK.

FIG. 1 shows FAK expression levels in NCI-H290 cells (A) and Y-MESO-14 cells (B) by siRNA molecules targeting FAK. CTRL: untreated, control siRNA: treated with control siRNA molecule, FAK siRNA: treated with siRNA targeting FAK, vertical axis: FAK expression expressed as a relative ratio to β-actin expression . FIG. 2 shows the wound healing rate (migration rate) (%) of NCI-H290 cells (A) and Y-MESO-14 cells (B) by siRNA molecules targeting FAK. CTRL: untreated, control siRNA: treated with control siRNA molecule, FAK siRNA: treated with siRNA molecule targeting FAK. FIG. 3 shows the infiltration rate (%) of NCI-H290 cells (A) and Y-MESO-14 cells (B) by siRNA molecules targeting FAK. CTRL: untreated, control siRNA: treated with control siRNA molecule, FAK siRNA: treated with siRNA molecule targeting FAK. FIG. 4 shows the cell proliferation ability (cell viability) (%) of NCI-H290 cells (A) and Y-MESO-14 cells (B) by siRNA molecules targeting FAK. Cells only: untreated, control siRNA: treated with control siRNA molecules, FAK siRNA 3, 10, 30, 60 nM: treated with siRNA molecules at various concentrations targeting FAK. FIG. 5 shows FAK expression levels in Y-MESO-14 cells and NCI-H290 cells by in vivo administration of siRNA molecules targeting FAK. MOCK: no treatment with siRNA molecules, CTRL siRNA: treated with control siRNA molecules, FAK siRNA in vivo transfection: treated with siRNA molecules targeting FAK. FIG. 6 shows intrathoracic tumors of NCI-H290 cells and Y-MESO-14 cells and bloody pleural effusions by in vivo administration of siRNA molecules targeting FAK. CTRL: No treatment with siRNA molecules, FAK siRNA: treated with siRNA molecules targeting FAK. FIG. 7 shows the tumor weight and blood pleural effusion production of NCI-H290 and Y-MESO-14 cells by in vivo administration of siRNA molecules targeting FAK. MOCK: no treatment with siRNA molecule, CTRL siRNA: treated with control siRNA molecule, FAK siRNA: treated with siRNA molecule targeting FAK.

  The RNAi molecule in the present invention is a double-stranded RNA obtained by hybridizing a sense strand having the base sequence represented by SEQ ID NO: 1 and an antisense strand having a base sequence complementary to the base sequence of the sense strand. Including parts. The RNAi molecule of the present invention targets FAK mRNA portion (hereinafter referred to as target mRNA portion) to which the antisense strand can hybridize, thereby exerting RNAi action specifically and significantly suppressing FAK expression. can do.

  Here, the RNAi molecule in the present invention refers to the target mRNA portion as a “target”. The antisense strand of the double-stranded RNA portion of the RNAi molecule of the present invention can hybridize with the target mRNA portion under stringent conditions. Say.

  The stringent condition can be determined based on the melting temperature (Tm) of the nucleic acid that forms a hybrid according to a conventional method. For example, as washing conditions that can maintain the hybridized state, it is usually about “1 × SSC, 0.1% SDS, 37 ° C.”, more strictly “0.5 × SSC, 0.1% SDS, 42 ° C.” More specifically, a condition of “0.1 × SSC, 0.1% SDS, 65 ° C.” can be mentioned.

  The antisense strand of the double-stranded RNA portion of the RNAi molecule in the present invention is preferably RNA consisting of a base sequence that is completely complementary to the target mRNA portion, but as long as it can hybridize under stringent conditions, 1 It may have a mismatch including deletion, substitution and addition of ˜3 bases, preferably 1 to 2 bases, more preferably 1 base.

  Preferably, the RNAi molecule in the present invention comprises a double-stranded RNA portion obtained by hybridizing a sense strand consisting of the base sequence represented by SEQ ID NO: 1 and an antisense strand consisting of the base sequence represented by SEQ ID NO: 2. Including.

  The sense strand or antisense strand constituting the RNAi molecule in the present invention may have an overhang at the 3 'end, if necessary. The type and number of bases of the overhang are not limited, and examples thereof include sequences consisting of 1 to 5, preferably 1 to 3, more preferably 1 or 2 bases, such as TTT, UU and TT. . In the present invention, the term “overhang” refers to a base that is added to the end of one strand of the RNAi molecule and does not have a base that can complementarily bind to the corresponding position of the other strand. The overhang may be a base constituting DNA. In addition, the sense strand or antisense strand constituting the siRNA may have 1 to 3 bases as necessary within a range that does not affect RNAi activity in order to smoothly perform various experimental operations such as gene sequencing. More preferably, it may further include substitution, addition or deletion of 1 or 2 bases.

  In addition, the sense strand or the antisense strand may be phosphorylated at the 5 'end as necessary, and triphosphate (ppp) may be bound to the 5' end.

  The RNAi molecule in the present invention includes double-stranded RNA molecules such as siRNA and shRNA (short hairpin RNA) molecules, but are preferably siRNA molecules and shRNA molecules.

  The siRNA molecule in the present invention is a double-stranded RNA molecule in which the sense strand and the antisense strand are hybridized to form a double-stranded portion.

  The sense strand and antisense strand constituting the siRNA molecule can be synthesized in vitro by chemical synthesis or a transcription system using a promoter and RNA polymerase based on a known method. It is also possible to synthesize in vivo by introducing the antisense strand and the sense strand template DNA into a suitable expression vector and administering the vector into a suitable host cell. Annealing of the synthesized sense strand and antisense strand can be performed by a general method known to those skilled in the art. The synthesized sense strand and antisense strand are each dissolved in an annealing buffer for double-stranded RNA, mixed in equal amounts (equal moles), heated until the double strands dissociate, and then gradually cooled. This can be done by incubating. Annealing conditions can be performed, for example, by leaving still at 90 ° C. for 1 minute and then at 37 ° C. for 1 hour. Then, siRNA molecules that are double-stranded RNA molecules can be obtained by performing phenol / chloroform extraction and ethanol precipitation.

  In the present invention, the shRNA molecule is a single-stranded RNA composed of 40 to 60 bases in which the sense strand and the antisense strand are linked via a linker portion, and the linker portion forms a loop. When folded, the antisense strand and the sense strand hybridize to form a double stranded portion.

The linker part contained in the shRNA molecule may be a polynucleotide linker or a non-polynucleotide linker as long as it can link the sense strand and the antisense strand to form a stem loop structure, and is not particularly limited. Polynucleotide linkers of 2 to 22 bases known to those skilled in the art are preferred. Specifically, UAGUGCUCCUGGUUG (SEQ ID NO: 4), UUCAAGGAGA, CCACC, CUCGAG, CCACACC, UUCAGAGAGA, AUG, CCC and UUCG can be exemplified, and UAGUGCUCCUGGUUG (SEQ ID NO: 4) is preferable.
As such shRNA, one containing the base sequence represented by SEQ ID NO: 3 is preferable.

  shRNA molecules can also be synthesized in vitro or in vivo based on known methods as described above. In the synthesis, a single RNA strand comprising a sense strand and an antisense strand as a reverse sequence through a linker moiety is synthesized, and then this single RNA strand is formed into a double-stranded structure by self-complementary binding. shRNA molecules can be obtained.

  An shRNA molecule can also be obtained using an expression vector comprising a template DNA encoding the shRNA molecule.

  As vectors that can be used in the present invention, plasmid vectors, viral vectors, non-viral vectors, and the like can be used. As a plasmid vector, pBAsi vector, pSUPER vector, pBAsi-hU6, etc. can be used. As a viral vector, an adenoviral vector (pAxcwit etc.), a retroviral vector, a lentiviral vector, etc. can be used. As the non-viral vector, a liposome vector or the like can be used.

  A promoter and / or other control sequences are inserted into the vector in such a way that they can function in the template DNA of the shRNA molecule. “Functionally linked and inserted” means that in the cell into which the vector is introduced, the shRNA molecule is expressed under the control of a promoter and / or other regulatory sequences, and the target FAK mRNA is expressed. It means that a promoter and / or other regulatory sequences are linked and incorporated into the vector so as to be degraded. Promoters and / or other regulatory sequences that can be incorporated into the vector are not particularly limited, but are constitutive promoters, tissue-specific promoters, time-specific promoters, tRNA promoters, H1 promoters, U6 promoters, polymerase II promoters, CMV promoters It is possible to appropriately select other regulatory elements and the like (for example, terminator sequences consisting of a sequence of at least 4 thymidine residues), promoters and / or other control sequences known in the art.

  The thus-produced vector expressing the shRNA molecule can express the shRNA molecule in the introduced cell and specifically degrade FAK mRNA.

  The administration method of the RNAi molecule in the present invention is not particularly limited as long as it has an effect in the tumor, and the RNAi molecule can be administered in the tumor or blood. When the RNAi molecule in the present invention is administered into blood, it may be modified by a known nucleic acid modification method in order to prevent degradation of the RNAi molecule. Moreover, you may use well-known drug delivery system (DDS) techniques, such as a liposome and a polymeric micelle, so that it may reach | attain a tumor easily.

  In addition, as a method of introducing the shRNA molecule expression vector in the present invention into a cell, a lipid-mediated carrier transport method (for example, lipofectamine method), a chemical substance (calcium phosphate etc.)-Mediated transport, microinjection, Examples include a method using a gene gun and an electroporation method.

  The effect of the RNAi molecule or shRNA molecule expression vector in the present invention is that the expression level of FAK mRNA or protein in the cell or tissue and the individual into which the molecule or vector is introduced does not introduce the molecule or vector (or It is possible to evaluate by using as an index the decrease in the expression level of FAK mRNA or protein in cells, tissues, and individuals (before introduction). When the measurement target is mRNA, it can be measured by Northern hybridization, RT-PCR, in situ hybridization, or the like. Moreover, when a measuring object is protein, it can measure by Western blotting, ELISA, the measurement using the protein chip | tip which couple | bonded the antibody, protein activity measurement, etc.

  The RNAi molecule or shRNA molecule expression vector in the present invention is 50% or more, 60% or more, 70% or more, preferably the expression level of FAK mRNA or protein in the introduced cell or tissue and the individual compared to the control. Can be reduced by 80% or more, or more preferably 90% or more.

  The effect of the RNAi molecule or shRNA molecule expression vector in the present invention is 2-fold, 3-fold, 4-fold, 5-fold, compared to the RNAi molecule or shRNA molecule expression vector known to those skilled in the art targeting FAK mRNA, It may have a 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold or more FAK expression inhibitory effect.

  In designing RNAi molecules, various methods are known as methods for selecting a base sequence of a target mRNA portion. For example, siRNA Design Support System (Takara Bio Inc.) or the like can be used. However, not all RNAi molecules having a base sequence selected by this method have an RNAi action. Therefore, it is very difficult to select an RNAi molecule having an action of remarkably suppressing the desired expression of FAK from candidate RNAi molecules having a base sequence selected by this method.

  As described in detail in the Examples below, the RNAi molecule or shRNA molecule expression vector of the present invention can suppress the growth of mesothelioma. Therefore, the RNAi molecule or shRNA molecule expression vector of the present invention is It can be used as an active ingredient of a pharmaceutical composition for treating and / or preventing mesothelioma.

  In the present invention, “mesothelioma” includes, but is not limited to, pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma and the like as long as FAK is expressed. There may be. Preferably, the “mesothelioma” is a malignant pleural mesothelioma.

  More specifically, the migration ability of malignant pleural mesothelioma cells is suppressed by 40% or more, preferably 50% or more, more preferably 60% or more by administering the RNAi molecule or shRNA molecule expression vector in the present invention. Can do. In addition, by administering the RNAi molecule or shRNA molecule expression vector in the present invention, the invasion ability of malignant pleural mesothelioma cells can be suppressed by 60% or more, preferably 70% or more, and more preferably 80% or more. Furthermore, the proliferation of malignant pleural mesothelioma cells is suppressed by 50% or more, 60% or more, preferably 70% or more, more preferably 80% or more by administering the RNAi molecule or shRNA molecule expression vector in the present invention. Can do. Furthermore, by administering the RNAi molecule or shRNA molecule expression vector in the present invention, the production of malignant pleural effusion can be suppressed by 50% or more, 60% or more, preferably 70% or more, and more preferably 80% or more.

  The therapeutic agent of the present invention may contain one or more of the above RNAi molecule or shRNA molecule expression vectors. Moreover, it is preferable to use an shRNA molecule expression vector as an active ingredient of the therapeutic agent of the present invention. The vector is less expensive than synthesizing RNAi molecules, and is more efficient than introducing RNAi molecules in that it can be amplified after introduction into cells and stably generate large amounts of shRNA molecules. Because it is good. The shRNA expression vector preferably expresses the shRNA molecule represented by SEQ ID NO: 3.

  The therapeutic agent of the present invention is also used with the above-mentioned RNAi molecule or shRNA molecule expression vector and appropriate carriers, diluents, emulsions, excipients, extenders, binders, infiltrant, disintegrants, and surfactants that are usually used. , Lubricants, dispersants, buffers, preservatives, solubilizers, preservatives, colorants, flavoring agents, stabilizers, and the like.

  The therapeutic agent of the present invention can be directly administered to mesothelioma by injection, and is administered orally or parenterally (for example, intravenous administration, intraarterial administration, local administration by injection, abdominal cavity or thoracic cavity) Administration can also be performed by internal administration, pulmonary administration, subcutaneous administration, intramuscular administration, sublingual administration, transdermal absorption, rectal administration, and the like. When the mesothelioma is malignant pleural mesothelioma, intrathoracic administration is more preferable in view of its in vivo progression mode (see the “Background Art” section above). As a method for intrathoracic administration, known and commonly used methods are used. For example, for intrathoracic administration of patients with malignant pleural mesothelioma, a syringe for injection and a needle are transcutaneously used for single administration. Although administration by use is common, when the necessity for repeated administration is assumed, a method in which a catheter is placed and used can be considered.

  In addition, the therapeutic agent of the present invention can be made into a suitable dosage form depending on the administration route. Specifically, injections, suspensions, emulsifiers, ointments, cream tablets, capsules, granules, powders, pills, fine granules, troches, rectal administration, oily suppositories, water-soluble suppositories Although it can be prepared in various preparation forms such as an agent, an injection is preferable.

  The RNAi molecule or shRNA molecule expression vector contained in the therapeutic agent of the present invention can vary depending on factors such as patient age, weight, severity of disease, etc., but in the range of 0.0001 mg to 100 mg per kg body weight at a time. The amount appropriately selected from can be included.

  In addition, the gene delivery to the target tissue or cell of the RNAi molecule or shRNA molecule expression vector contained in the therapeutic agent of the present invention may be performed by using various administration methods usually used in the field of gene therapy. For example, as described above, known DDS technologies such as liposomes and polymer micelles, lipid-mediated carrier transport methods (for example, lipofectamine method), chemical substances (calcium phosphate etc.)-Mediated transport Microinjection, gene gun implantation, electroporation, and the like can be used.

  The effect of the therapeutic agent of the present invention is that the therapeutic agent of the present invention is administered to a cell or tissue derived from mesothelioma and an individual suffering from mesothelioma, and the size of the tumor is not administered (or It is possible to evaluate by using as an index that the tumor is shrinking or disappearing as compared to the size of the tumor in the cells and tissues and the individual before administration. Examples of mesothelioma cells that can be used for evaluating the effects of the therapeutic agent of the present invention include human malignant pleural mesothelioma cells NCI-H290, Y-MESO-14, and the like.

  The effect of the therapeutic agent of the present invention is 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 30 times as compared with RNAi molecule or shRNA molecule expression vectors known to those skilled in the art targeting FAK mRNA. It can have an antitumor effect of fold, 40 fold, 50 fold, 100 fold, or more.

  The preparation of the therapeutic agent of the present invention can be prepared by a generally known method using a pharmacologically acceptable carrier. Examples of such carriers include various types commonly used for ordinary drugs, such as excipients, binders, disintegrants, lubricants, diluents, solubilizers, suspending agents, isotonic agents, pH. Examples include regulators, buffers, stabilizers, colorants, flavoring agents, and flavoring agents.

  Examples of excipients include lactose, sucrose, sodium chloride, glucose, maltose, mannitol, erythritol, xylitol, maltitol, inositol, dextran, sorbitol, albumin, urea, starch, calcium carbonate, kaolin, crystalline cellulose, silica Examples include acid, methylcellulose, glycerin, sodium alginate, gum arabic, and mixtures thereof. Examples of the lubricant include purified talc, stearate, borax, polyethylene glycol, and a mixture thereof. Examples of the binder include simple syrup, glucose solution, starch solution, gelatin solution, polyvinyl alcohol, polyvinyl ether, polyvinyl pyrrolidone, carboxymethyl cellulose, shellac, methyl cellulose, ethyl cellulose, water, ethanol, potassium phosphate, and a mixture thereof. Can be mentioned. Examples of the disintegrant include dry starch, sodium alginate, agar powder, laminaran powder, sodium hydrogen carbonate, calcium carbonate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, starch, lactose and mixtures thereof. Is mentioned. Examples of the diluent include water, ethyl alcohol, macrogol, propylene glycol, ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters, and mixtures thereof. Examples of the stabilizer include sodium pyrosulfite, ethylenediaminetetraacetic acid, thioglycolic acid, thiolactic acid, and a mixture thereof. Examples of the isotonic agent include sodium chloride, boric acid, glucose, glycerin and a mixture thereof. Examples of the pH adjuster and buffer include sodium citrate, citric acid, sodium acetate, sodium phosphate, and mixtures thereof. Examples of the soothing agent include procaine hydrochloride, lidocaine hydrochloride and a mixture thereof.

  The dosage form of each of the above preparations is not particularly limited and can be appropriately selected depending on the purpose of treatment. Specifically, oral preparations (tablets, coated tablets, powders, granules, capsules, liquids, etc.), injections, suppositories An agent, a patch, an ointment and the like can be exemplified, but an injection is preferable.

  The administration sequence and administration interval in the therapeutic agent of the present invention are not particularly limited as long as the effect of each active ingredient can be obtained, but once a day, once every two days, once every two weeks, Examples include administration every 3 times a week or once a week.

  The present invention also relates to a method for treating mesothelioma using the therapeutic agent of the present invention. Mesothelioma that can be treated by the method includes mesothelioma as defined above. Further, in this method, the usage and dosage of the therapeutic agent of the present invention are as described above.

  EXAMPLES Hereinafter, although an Example and a test example are given and this invention is demonstrated further in detail, this invention is not limited to these Examples and a test example.

Example 1: Preparation of siRNA molecules targeting FAK The following RNAs were synthesized for the purpose of producing siRNA molecules capable of suppressing FAK expression by the action of RNAi:
Sense strand RNA
5′-AUACUGUAGAGUCUCCUCCACAUUGGG-3 ′ (SEQ ID NO: 1);
Antisense strand side RNA
5′-CCCAAUGUGGAGGACUCUCACAGUAU-3 ′ (SEQ ID NO: 2).

  The sense strand side RNA and the antisense strand side RNA are equidistant so as to have a final concentration of 20 μM, diethylpyrocarbonate (DEPC) having a final concentration of 0.1%, Tris-HCl, pH 8.0 having a final concentration of 10 mM. Then, an aqueous solution to which NaCl having a final concentration of 20 mM and EDTA having a final concentration of 1 mM were added was prepared.

Example 2: Inhibition of FAK expression in malignant pleural mesothelioma by siRNA molecules Malignant pleural mesothelioma cells NCI-H290 and Y-MESO-14 were cultured in RPMI 1640 medium in a 6-well plate. At the stage when the cell density in the well reached about 30-50%, 7.5 μL of RNAi molecule of Example 1 adjusted to 10 nM and 7.5 μL of Lipofectamine 2000 (Invitrogen) were mixed and cultured. Treatments added to the cells were performed. In addition, untreated and treated with control siRNA molecules were also prepared.

  48 hours after the addition, cells were collected, mRNA was immediately extracted, and Taqman real-time PCR method (Assays-on-Demand Gene Expression system, assay ID Hs99999905_m1, PCR product size 122p bp; Biosystems) confirmed the expression of FAK. GAPDH was used as an internal standard. The expression of each gene was confirmed by ABI PRISM 7700 Sequence Detection System (Applied Biosystems).

  The results are shown in FIG. It was confirmed that the siRNA molecule targeting FAK prepared in Example 1 significantly suppresses FAK expression in malignant pleural mesothelioma cells.

Example 3: Effect of suppressing migration ability of malignant pleural mesothelioma cells by siRNA molecule In the same manner as in Example 2, cells treated with the siRNA molecule of Example 1 were prepared. In addition, untreated cells and cells treated with control siRNA molecules were also prepared.

  24 hours after addition of the siRNA molecule, a linear cell peeling wound was created at the bottom of the plate with the tip of a sterilized chip. After another 24 hours, the state of wound healing by cell migration was observed. The migration ability was evaluated by measuring the wound width between cell peeling wound boundaries and the wound healing width between cell migration tip boundaries and calculating the wound healing rate (migration rate) (%).

  The results are shown in FIG. It was confirmed that the wound healing rate of malignant pleural mesothelioma cells was significantly reduced by the treatment with siRNA molecules targeting FAK prepared in Example 1, and the migration ability of malignant pleural mesothelioma cells could be suppressed. .

Example 4: Effect of suppressing invasion ability of malignant pleural mesothelioma cells by siRNA molecules As in Example 2, cells treated with the siRNA molecules of Example 1 were prepared. In addition, untreated cells and cells treated with control siRNA molecules were also prepared.

Cells were collected 24 hours after the addition of siRNA molecules, and a cell concentration solution of 5 × 10 ⁵ / ml was prepared in RMI1640 medium supplemented with 10% FBS. Cell invasion ability was measured using a Matrigel invasion chamber (Becton Dickinson). That is, 0.5 ml (2.5 × 10 ⁴ cells) of cell suspension was added to a 24-well plate with an 8 μm pore insert in a 24-well plate of a Matrigel invasion chamber, cultured for 24 hours, and then infiltrated the lower surface of the membrane. Cell invasion ability was evaluated by measuring the number of cells (%).

  The results are shown in FIG. It was confirmed that the number of malignant pleural mesothelioma cells infiltrated significantly decreased by the treatment with siRNA molecules targeting FAK prepared in Example 1, and the invasion ability of malignant pleural mesothelioma cells could be suppressed.

Example 5: Inhibitory effect on growth of malignant pleural mesothelioma cells by siRNA molecules As in Example 2, cells treated with the siRNA molecules of Example 1 were prepared. However, the concentration of the siRNA molecule of Example 1 was 3 nM, 10 nM, 30 nM, and 60 nM. In addition, untreated cells and cells treated with a control siRNA molecule (10 nM) were also prepared.

  Cells were once collected 24 hours after the addition of siRNA molecules, and then seeded with 5000 / well cells in a 96-well plate. After 24, 48 and 72 hours of incubation, 0.2% MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphenyltetrazolium) solution was added. After culturing for 3 hours, 100 μL of dimethyl sulfoxide (DMSO) was added, the absorbance at 550 nm and 630 nm was measured, and the ratio of the absorbance of the siRNA molecule treated group to the absorbance of the untreated group (number of cells) (%) was calculated. Cell proliferation ability was evaluated.

  The results are shown in FIG. It was confirmed that the treatment with the siRNA molecule targeting FAK prepared in Example 1 significantly reduced the absorbance ratio compared to no treatment, and could suppress cell growth of malignant pleural mesothelioma cells.

Example 6: Inhibition of FAK expression of malignant pleural mesothelioma cells by siRNA molecules In order to form intrathoracic disseminated tumors with bloody pleural effusion in SCID mice, malignant pleural mesothelioma cells NCI-H290 (3 × 10 ⁵ ) And Y-MESO-14 (1 × 10 ⁶ ) were seeded intrathoracically. On day 10 after seeding, the siRNA molecule of Example 1 was combined with 100 μL of Invivofectamine (registered trademark) (manufactured by Invitrogen) so as to be 5 mg per kg of mouse body weight, and was administered into the mouse thoracic cavity. The FAK expression level in the tumor tissue 1 day, 4 days and 7 days after administration was measured and confirmed by Western blotting method.

  The results are shown in FIG. It was confirmed that the FAK expression in the tumor tissue of malignant pleural mesothelioma in the mouse thoracic cavity was suppressed from the first day after administration by the treatment with the siRNA molecule targeting FAK prepared in Example 1.

Example 7: Inhibitory effect on growth of malignant pleural mesothelioma cells by siRNA molecule In order to form intrathoracic disseminated tumors with bloody pleural effusion in SCID mice, malignant pleural mesothelioma cells NCI-H290 (3 × 10 ⁵ ) and Y-MESO-14 (1 × 10 ⁶ ) was seeded in the thoracic cavity. From the 10th day after seeding, the siRNA molecule of Example 1 was combined with 100 μL of Invivofectamine (registered trademark) (manufactured by Invitrogen) at a total of 4 times every 3 days for a total of 4 mg / kg of the mouse body weight. Administered.
Intrathoracic disseminated tumors and bloody pleural effusions were evaluated 21 days after seeding.

  The results are shown in FIGS. It was confirmed that treatment with the RNAi molecule of the example suppressed intrathoracic tumor growth and malignant pleural effusion production.

  The RNAi molecule targeting FAK mRNA in the present invention can suppress the expression level of FAK in malignant pleural mesothelioma cells, and can suppress the growth of malignant pleural mesothelioma cells. is there. Thus, it is possible to efficiently treat and / or prevent malignant pleural mesothelioma.

Claims (8)

  A therapeutic agent for mesothelioma, comprising an RNAi molecule that targets adhesion plaque kinase and reduces the expression level of adhesion plaque kinase in a cell.   The RNAi molecule includes a double-stranded RNA portion obtained by hybridizing a sense strand consisting of a base sequence represented by AUACUGUAGAGUCCUCCACAAUUGGG (SEQ ID NO: 1) and an antisense strand that hybridizes with the sense strand under stringent conditions. The mesothelioma therapeutic agent of Claim 1.   The RNAi molecule comprises a double-stranded RNA portion obtained by hybridizing a sense strand consisting of a base sequence represented by AUACUGUAGAGUCCUCCCACAAUUGGG (SEQ ID NO: 1) and an antisense strand consisting of a base sequence represented by CCCAAUGUGGAGGACUCUACAGUAU (SEQ ID NO: 2) The mesothelioma therapeutic agent of Claim 2 containing.   The mesothelioma therapeutic agent according to any one of claims 1 to 3, wherein a sense strand and an antisense strand of the RNAi molecule are linked via a linker moiety.   The mesothelioma therapeutic agent according to claim 4, wherein the RNAi molecule consists of a base sequence represented by SEQ ID NO: 3.   A mesothelioma therapeutic agent comprising a vector that expresses the RNAi molecule specified in claim 4 or 5, wherein the vector comprises DNA encoding the RNAi molecule.   The mesothelioma therapeutic agent according to any one of claims 1 to 6, wherein the mesothelioma is malignant pleural mesothelioma.   The mesothelioma therapeutic agent according to any one of claims 1 to 7, which is for intrathoracic administration.

Images