WO2010150982A2 - Recombinant hemagglutinin protein having superior biocompatibility for an influenza virus vaccine, and method for preparing biodegradable plga microspheres containing same - Google Patents

Abstract

The present invention relates to a recombinant hemagglutinin protein serving as an antigenic epitope for an influenza virus vaccine, which lacks or has a low membrane fusion function, and thus has superior biocompatibility, to a method for preparing poly(lactic-co-glycolic acid) (PLGA) containing said recombinant hemagglutinin protein, and to PLGA microspheres prepared by the method.

Description

Highly Safe Recombinant Hemagglutinin Protein for Influenza Virus Vaccine and Production Method of Biodegradable PLAA Particles Containing the Same

The present invention provides a HA2 protein fragment with excellent biosafety and improved water solubility by removing the fusion peptide consisting of hydrophobic amino acid residues and the TMD site, thereby improving water solubility, and C30S to prevent inclusion body formation by intramolecular disulfide bond. HA-protein similar to wild-type with amino acid substitution, PLGA microparticles containing it as antigenic epitope, using W / O / W double emulsion method and PLGA microparticles for influenza virus vaccine It is about.

Influenza virus belongs to the Orthomyxoviridae family and has a genome of seven to eight single-stranded RNAs. Divided into A, B and C type according to the antigenic difference between the nucleoprotein and intercellular protein. Influenza virus A is divided into 15 types (H1-H15) and 9 types (N1-N9), respectively, according to the antigenic differences of the surface proteins hemagglutinin (HA) and neuraminidase (NA) in the virus envelope (Cross et al. 2001. EMBO J., 20: 4432-4442.

The HA protein is expressed as a membrane glycoprotein as one polypeptide (precursor HA0), which is then divided into HA1 and HA2 by proteolytic cleavage, and in nature, a disulfide bond (the 30th amino acid residue of HA1, cysteine and HA2). The first amino acid, between cysteines) (Swelley et al. 2004. Biochemistry, 43: 5902-5911) (see (a) of FIG. 1).

For influenza virus to invade host cells, a membrane fusion must occur between the viral envelope membrane and the host cell membrane. This process involves HA2, a membrane protein with a transmembrane domain (TMD) at the C-terminus, which is composed of a fusion peptide consisting of hydrophobic amino acid residues at the N-terminus of HA2. The two membrane systems are known to fuse by acting to partially stir the cell membrane of the target cell, and so the HA2 protein is called a membrane fusion protein (Cross et al. 2001. EMBO J., 20: 4432- 4442).

PLGA [poly (lactic-co-glycolic acid)] is a biodegradable, biocompatible, biodegradable biodegradable lactic acid and glycolic acid and finally released to carbon dioxide and water. Khang et al., 2004, Tissue Eng. Regen. Med., 1, 9).

The technology for producing biodegradable polymer nano- / particulates has received much attention in recent years through research into not only vaccine preparation but also use as a delivery system and treatment of bioimmune diseases (Lemoine D, 1998, J Control Release. 54 ( 1): 15-27). Encapsulating antigenic proteins / peptides for the manufacture of viral vaccines is of interest for reports on the preparation of polymeric microparticles using biodegradable, biodegradable poly (lactic-co-glycolic acid) (PLGA). (Tamber et al., 2005, Adv Drug Deliv Rev. 57 (3): 357-76).

Encapsulation of cationic liposomes in consideration of DNA characteristics has been mainly used for the manufacture of DNA vaccines (vaccine), but recently, attempts to prepare PLGA or polycationic polymeric microparticles have been reported (Jilek et al., 2005, Adv). Drug Deliv Rev. 57 (3): 377-90).

As a method for delivering drugs, W / O monolayer emulsion method microparticles have a high initial release rate and have the disadvantage of having a low drug duration and a delay occurring after a certain amount is released ( G Khang et al., 2004, Tissue Eng. Regen. Med., 1, 9).

In addition, since most protein drugs are water-soluble, the microparticles are mainly prepared by using W / O / W double emulsion method and solvent evaporation (KJ Cho, 2008, Tissue Eng Regen Med, 5, 172). . In the present invention, fine particles were prepared using the W / O / W double emulsion method. However, this method has the disadvantage of being difficult to control and limited in inclusion drugs than monolayer emulsion particles (JT Ko et al., 2007, Key Eng Mater, 342, 513).

Vaccines against influenza viruses have traditionally been using inactivated viruses or HA and NA proteins extracted from virus particles, but contain viral lipids that have not been completely removed during purification. It is still a problem for the elderly in terms of safety. In addition, IgA responses are not induced in nasal secretions that induce high serum IgG responses but become viral penetration pathways. Recently, studies have been conducted to use live attenuated viruses (eg, temperature-sensitive) as vaccines, but high dosages due to the possibility of being converted into active viruses and the induction of low antibody production It has been reported that there is a problem such as the need to administer or to inactivate the inactivated virus, and despite the many possibilities it is not practical yet.

Two research papers on influenza virus vaccines using PLGA polymer nano- / particulates containing HA protein have been reported.However, influenza virus particles grown in egg were inactivated with an organic solvent, and then extracted and purified in the native HA protein. The study used was to extract and purify HA proteins using a method similar to the process for preparing traditional inactivated viral vaccines (Lemoine D, 1998, J Control Release. 54 (1): 15-27; Hilbert et al. , Vaccine. 1999 17 (9-10): 1065-73). Although the above methods have shown that PLGA polymer nano- / particulates containing hydrophilic HA1 and hydrophobic HA2 having different properties can be prepared, the components such as virus-derived lipids cannot be completely purified and mixed to prevent toxicity and infection. It has a risk.

Korean Patent Registration No. 10-0703571 discloses a peptide-based vaccine against influenza, and Korean Patent Publication No. 2008-0093382 discloses a vaccine composition for preventing influenza, but the antigenic epitope for influenza virus vaccine of the present invention. It is different from recombinant HA (hemagglutinin) protein as an antigenic epitope.

In addition, Korean Patent Registration No. 10-0702523 discloses a method for producing an attenuated parainfluenza virus from a cloned nucleotide sequence, and Korean Patent Publication No. 2009-0034297 discloses an antiviral agent and a vaccine against influenza. However, it is different from PLGA microparticles containing a recombinant HA protein as a highly stable antigenic epitope of the present invention.

The present invention has been made in accordance with the above requirements, and in the present invention, a fusion peptide composed of hydrophobic amino acid residues present at the N-terminus (1 to 22 amino acid residues) and a transmembrane domain (TMD) present at the C-terminus are provided. The modified HA2 protein expressed in E. coli removed by protein engineering method was used as an antigenic epitope for influenza virus vaccine in the present invention. This protein loses the membrane fusion function of the fusion peptide itself and can act as an antigenic epitope for novel influenza virus vaccines with excellent biosafety. In addition, to remove the N-terminal signal sequence (1-16 amino acid residues) and to prevent inclusion body formation by intramolecular disulfide bonds, a wild-type similar HA1 protein expressed in Escherichia coli after the amino acid is substituted with C30S antigen Used as a sex epitope.

PLGA microparticles containing the modified HA1 and HA2 proteins prepared as described above were prepared using a W / O / W double emulsion microencapsulation method. The fusion peptide composed of hydrophobic amino acid residues and the HA2 protein from which the TMD site was removed have an advantage in that water solubility is increased, so that microencapsulation with the hydrophilic HA1 protein can be performed relatively easily.

The optimum conditions of the W / O / W double emulsion microencapsulation method for preparing the polymer PLGA microparticles were investigated by controlling the emulsifier (PVA) content, solvent extraction method (stirring or evaporation), stirring speed during particle curing, and SEM (scanning). Electron microscopy) was used to verify the size, shape and degree of hole formation on the prepared particles.

In addition, the PLGA particles prepared as described above can be stored as a lyophilized powder, which has the advantage that the long-term stability of the protein is increased rather than in solution. PLGA microparticles containing modified HA1 and HA2 proteins together were verified through in vitro release experiments to have a good slow release that slowly releases antigenic epitopes in vivo .

In order to solve the above problems, the present invention provides a recombinant hemagglutinin (HA) protein as an antigenic epitope for influenza virus vaccines having high or low biosafety due to a lack or decrease in membrane fusion function.

The present invention also provides a method for producing PLGA [poly (lactic- co- glycolic acid)] microparticles containing the recombinant HA protein.

The present invention also provides PLGA microparticles for influenza virus vaccine prepared by the above method.

According to the present invention, (1) the production of a mutant HA2 protein as an antigenic epitope with excellent biosafety is possible, and (2) the development of an influenza virus vaccine having no toxicity and improved vaccine efficacy required for infants and the elderly. And (3) using protein engineering techniques to develop new forms of antigenic epitopes for influenza virus vaccines that can replace existing patented technologies, and (4) avian influenza virus, swine Flu, and HIV virus gp41 proteins. It can be used to develop related vaccines, (5) can be used as drug delivery system, and can be used for drug delivery treatment method using membrane fusion.

1 is a schematic diagram (a) of HA (hemagglutinin) and a type (b) of a plasmid DNA construct including the HA2 gene used in the present invention.

2 is a vector construct for recombinant HA1 and HA2 protein expression.

3 shows the result of protein purification using HPLC.

4 shows the microencapsulation process.

5 are PLGA encapsulated particulate powders comprising HA protein.

Figure 6 is a quantitative curve of the protein using the Indirect ELISA method.

7 shows the results of a test for HA (HA1 + HA2) antigen present in serum.

8 shows the results of the anti-HA (anit-HA1 + anti-HA2) antibody production.

9 shows the results of antibody (anti-HA1) production confirmation experiment.

10 shows the results of antibody (anti-HA2) production confirmation experiment.

In order to achieve the object of the present invention, the present invention is to delete amino acid residues 1 to 16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1, the 30th amino acid residue is substituted in the cysteine to serine; The 137th amino acid residue of the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with serine in cysteine, and the codons of arginine corresponding to the 123rd, 124th and 127th amino acid residues are substituted with AGT to CGT, respectively. To provide a recombinant hemagglutinin (HA) protein as an antigenic epitope for influenza virus vaccines.

In a recombinant HA protein according to an embodiment of the present invention, the first amino acid residue of the HA2 protein may be substituted with glutamic acid or valine in glycine.

In a recombinant HA protein according to an embodiment of the present invention, amino acid residues 1 to 22 corresponding to the fusion peptide of the HA2 protein may be deleted, and at the same time, correspond to the TMD (transmembrane domain) of the HA2 protein. 186 th to 221 th amino acid residues may be deleted.

In the recombinant HA protein according to an embodiment of the present invention, His7-tag and His6-tag may be attached to the C-terminus of the recombinant HA1 and HA2 proteins, respectively.

In addition, the present invention is deleted amino acid residues 1 to 16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1, the 30th amino acid residue is substituted with a serine in cysteine; The 137th amino acid residue of the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with serine in cysteine, and the codons of arginine corresponding to the 123rd, 124th and 127th amino acid residues are substituted with AGT to CGT, respectively. Method for producing PLGA microparticles for influenza virus vaccine comprising the steps of microencapsulation of recombinant HA (hemagglutinin) protein as an antigenic epitope for influenza virus vaccines To provide.

In the method according to an embodiment of the present invention, the W / O / W double emulsion microencapsulation is

(a) preparing an aqueous phase (W ₁ ) comprising the recombinant HA protein and 4-5% (w / v) of polyvinylalcohol (PVA);

(b) dissolving PLGA in a solvent (O), mixing W ₁ and O and emulsifying with a stirrer to produce W ₁ / O;

(c) adding the W ₁ / O to an aqueous solution containing 0.5 to 0.7% (w / v) of PVA and performing a double emulsion by stirring to produce W ₁ / O / W ₂ . ; And

(d) subjecting the product to solvent extraction and hardening.

The PVA added in steps (a) and (c) is preferably 4.2% (w / v) and 0.6% (w / v), respectively.

In the method according to an embodiment of the present invention, the solvent removal process may be performed by stirring or evaporation.

In the method according to an embodiment of the present invention, the solvent removal process and the curing process may be performed by stirring at 90 ~ 110 rpm, preferably 100 rpm.

The method according to an embodiment of the present invention may further include a step of freezing the PLGA fine particles that have been cured after the step (d) using liquid nitrogen, and then lyophilizing.

In a method according to an embodiment of the present invention, the first amino acid residue of the HA2 protein may be substituted with glutamic acid or valine in glycine.

In a method according to an embodiment of the present invention, amino acid residues 1 to 22 corresponding to the fusion peptide of the HA2 protein may be deleted, and at the same time, 186 corresponding to the TMD (transmembrane domain) of the HA2 protein. 221 rd amino acid residues may be deleted.

The present invention also provides PLGA microparticles for influenza virus vaccines produced by the method of the present invention.

Hereinafter, the present invention will be described in more detail.

In the case of HA2 protein, three methods were used as follows to remove membrane fusion function.

First, the G1E HA2 and G1V HA2 mutant proteins were substituted with the first amino acid residues of which the membrane fusion function of the fusion peptide itself at the N-terminus of the HA2 protein was reduced. To prevent it. The G1E HA2 and G1V HA2 mutant proteins mean that the first amino acid residue of the HA2 protein is substituted with glutamic acid and valine in glycine, respectively.

Second, the HA2 (23-185) and HA2 (23-221) protein fragments were prepared by removing the fusion peptide itself consisting of 22 hydrophobic amino acid residues present at the N-terminus of the HA2 protein. Three rare arginine codons contained in the HA2 protein were replaced with codons suitable for expression in E. coli (R123, R124, R127), and HA2, which can form an intermolecular disulfide bond with cysteine, the 30th amino acid residue of the HA1 protein Cysteine, the 137th amino acid residue of, was substituted with serine (C137S).

In the case of the HA1 protein, the N-terminal signal sequence was removed (HA1 (17-344)) and cysteine, the 30th amino acid residue of the HA1 protein, was substituted with serine to prevent inclusion body formation by intramolecular or intermolecular disulfide bonds. (C30S).

For the expression of recombinant HA1 and HA2 proteins in E. coli, the host cell strain was E. coli strain Rosetta (DE3) pLysS (Novagen) and 18-20 ° C, 110 rpm after induction into 0.5 mM IPTG at OD ₆₀₀ = 0.8. 6 to 8 hours in expression. Purification conditions were established using Ni affinity chromatography by attaching His7-tag and His6-tag to the C-terminus of the recombinant HA1 and HA2 proteins, respectively. The proteins bound to the beads were sufficiently washed with a washing buffer to which 20 mM and 50 mM imidazole were added, followed by step-wise elution. In the case of HA1 protein, cells were disrupted without adding EDTA, DTT, and β-mercaptoethanol.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Reagents and Instruments

The HA gene used in the present invention is derived from influenza virus type A X31 strain and is contained in plasmid pHA. It was expressed in E. coli strain Rosetta (DE3) pLysS (Novagen), which was inserted into the pET24b (+) vector to solve the rare codon problem of E. coli. The DNA amplification apparatus used for the preparation of mutant DNA was a T-GRADIENT 48 model of Biometra.

Experiments were performed using a homogenizer (Ultra-Turrax, IKA), scanning electron microscopy (SEM; JEOL JSM-6390, Japan), and an evaporator (RUCHI, Rotavapor R-210). PVA (polyvinyl alcohol) and dichloromethane were purchased from SIGMA-ALDRICH and PLGA (RESOMER)

                 RG 502H) was purchased from Boehringer Ingelheim.

The mouse His Tag antibody, the primary antibody used in the sustained release validation experiment, was purchased from ABGENT, and the goat HRP-conjugated anti-mouse IgG, the secondary antibody, was obtained from Molecular Probes.

Example 1: Preparation of d position mutant present at interface of coiled-coil HA2 trimer

All HA2 constructs used in the present invention were used by substituting three rare (R123, R124, R127) rare arginine codons (AGG) with codons (CGT) suitable for expression in E. coli.

HA-3R-F

ACAAGCTGTTTGAAAAAACACGTCGTCAACTGCGTGAAAATGCTGAAGA G AT (SEQ ID NO: 3)

HA-3R-R

ATCTCTTCAGCATTTTCACGCAGTTGACGACGTGTTTTTTCAAACAGCTTGT (SEQ ID NO: 4)

All site-directed mutagenesis performed in the present invention are QuickChange of Stratagene (USA)

                 The method was modified and performed using PCR (Biometra Tgradient Thermocycler). Forward and reverse mutagenic primers (Bioneer, Korea) of 30 to 35 bp in length including the same position including the site to be mutated were used. Excellent fidelity and fast synthesis rate (1kb / min) because the entire plasmid DNA must be replicatedPfuTurbo

                 PCR reactions were generally performed using DNA polymerase under the following conditions; 25 cycles (95 ° C. 45 sec; 55 ° C. 1 min; 68 ° C. 8 min).

After the PCR reaction was terminated, agarose gel electrophoresis was performed to confirm the amplification of the linear plasmid-sized DNA band, followed by treatment with Dpn I restriction enzyme for about 3 hours, followed by parental extraction from E. coli DH5α. DNA template was removed as much as possible. After transformation into E. coli DH5α, plasmid DNA miniprep was carried out from 2 or 3 colonies to confirm that the desired position was modified through DNA sequencing (Solgent, Korea).

Example 2: Preparation of N-terminal amino acid mutant HA2

G1E HA2 mutant and G1V HA2 mutant, which are considered to have excellent biosafety due to lack of infectivity, were prepared through site-directed mutagenesis for use as antigenic epitopes. The two types of HA2 mutants have been reported to retain the α-helix propensity and form a coiled-coil HA2 trimer, but have little membrane fusion activity. At this time, the plasmid DNA construct used as a template was HA2 (1-185) (B of Fig. 1 (b)).

Example 3: Preparation of Mutant HA2 with Removed Fusion Peptides

HA2 genes (1 to 221) from the influenza virus type A X31 strain used in the present invention are located after the HA1 gene on the plasmid pHA. In the case of intact HA2 proteins produced by natural viruses, the C-terminal TMD site is located in the virus envelope and the N-terminal fusion peptide site attacks the target cell membrane. This type of structure may cause structural problems in which two sites are simultaneously placed on one membrane on the micelle structure or artificial membrane (vesicle, liposome) formed by using detergent during separation and purification. Intact HA2 protein expressed for the same reason is difficult to induce normal protein expression due to cytotoxicity caused by unstable cell membrane of the expression host cell.

Therefore, such problems as HA2 (1-185), HA2 (23-221), or HA2 (23-185) from which the N-terminal fusion peptide site or the C-terminal TMD site are removed among the HA2 gene (1 to 221) sites are avoided. A modified construct was prepared and inserted into pET24b (+) vector, an expression vector that can be purified using His-tag affinity chromatography.

First, plasmid DNA having HA2 (23-221) DNA fragments from which the fusion peptide (up to the 1st to 22nd amino acids), which is the membrane fusion active site of HA2, was removed (C of FIG. 1 (b)) was prepared. Using the plasmid pHA having the entire HA gene from the influenza virus type A X31 strain as a template, the following two primers were used.PfuTurbo

                 DNA polymerase was used to amplify only the HA2 (23-221) site through the following PCR reaction; 30 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min).

HA2 (-FP) _NdeI_F: CACTTCGTCATATGGGTTTCAGGCATCAAAATTCTG (SEQ ID NO: 5)

HA2_221_SalI_R: CACTTCGTGTCGACAATGCAAATGTTGCACCTAATGT (SEQ ID NO: 6)

Each of the HA2 (23-221) DNA fragment obtained above with the Nde I and Sal I double digestion and ligated to pET-24b (+) vector with Nde I and Sal I cut sewn were transformed in DH5α. Mini-prep was performed to screen colonies that were ligated in the desired form, followed by double digestion with Nde I and Sal I or colony PCR. The plasmid DNA thus selected was again confirmed through DNA sequencing (FIG. 2).

When the HA2 (23-221) plasmid DNA construct obtained by the above method is expressed in recombinant E. coli, intramolecular or intermolecular disulfide bonds are formed, which is likely to precipitate in the form of inclusion bodies in aggregated form. So we performed site-directed mutagenesis to replace the 137th cysteine with serine; 25 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min). As a result, the HA2 (23-221) / C137S plasmid DNA construct was finally obtained.

However, the HA2 (23-221) plasmid DNA construct still retains the transmembrane domain (TMD), which has a hydrophobic nature at the C-terminus. Thus, micelle structure using a detergent such as Triton X-100 was used during the separation and purification process. Must be formed. Therefore, first of all, it was decided to prepare and use a plasmid DNA construct having only HA2 (23-185) DNA fragments in which TMD sites were removed together with fusion peptide sites (D in FIG. 1 (b)).

Using the HA2 (1-185) / C137S construct in the pET24b (+) vector directly as a template, using the following two primers, the HA2 (23-221) plasmid DNA construct was obtained under the same conditions as below. Using 2 primers of,PfuTurbo

                 DNA polymerase was used to amplify only the HA2 (23-185) / C137S site through the following PCR reaction; 30 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min).

HA2 (-FP) _NdeI_F: CACTTCGTCATATGGGTTTCAGGCATCAAAATTCTG (SEQ ID NO: 7)

HA2_185_SalI_R: CACTTCGTGTCGACCCAGTCTTTGTATCCAGACTTCA (SEQ ID NO: 8)

The HA2 (23-185) / C137S DNA fragment was inserted into Nde I and Sal I sites of the pET-24b (+) vector in the same manner as when obtaining a plasmid DNA construct to obtain a desired form.

Example 4: Preparation of recombinant HA1 from which the N-terminal signal sequence was removed

PCR was used to detect the remaining regions of the HA1 gene region, located in front of the HA2 gene on the plasmid pHA containing the HA gene from the influenza virus type A X31 strain, except for the signal sequence consisting of 16 amino acid residues located at the N-terminus. After replication, it was inserted into pET24b (+) vector, an expression vector that can be purified using His-tag affinity chromatography.

First, the plasmid pHA, which contains the entire HA gene from the influenza virus type A X31 strain, was first used to remove Nde I sites in the HA1 gene DNA (without modification of amino acids) using the following two primers. directed mutagenesis was performed.

HA1_NdeIX-F: GTAAACAAGATCACATA C GGAGCATGCCCCAAG (SEQ ID NO: 9)

HA1_NdeIX-R: CTTGGGGCATGCTCCGTATGTGATCTTGTTTAC (SEQ ID NO: 10)

Thus existing in the HA1 gene DNANde Using pHA without the I site as a template and using the two primers below,PfuTurbo

                 PCR amplification using the DNA polymerase was performed to amplify only the HA1 (17-344) site; 30 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min). In the same way as for the HA2 DNA construct, the pET-24b (+) vectorNde I andXho Inserted in position I to secure the desired shape.

HA1_NdeI-F: CGCTACTAGCATATGAAGACCATCATTGCTTTGA (SEQ ID NO: 11)

HA1_XhoI-R: CGCGTGGTCTCGAGAGTTTGTTTCTCTGGTACATT (SEQ ID NO: 12)

After DNA sequencing of the obtained HA1 (17-344) plasmid DNA construct, it was confirmed that the 173rd amino acid residue was changed from serine to leucine as compared with the HA1 gene from the influenza virus type A X31 strain reported in the literature. Could. In addition, cysteine, the 30th amino acid residue, forms an intermolecular disulfide bond with C137 of HA2 protein in its native state (see FIG. 1A). However, when only the recombinant HA1 gene was expressed in E. coli, intramolecular or intermolecular disulfide bonds could be formed at this C30 site. Finally, in order to introduce double mutations of C30S and L173S into HA1 (17-344) plasmid DNA construct, site-directed mutagenesis was performed sequentially under the following conditions, and finally HA1 (17-344) / C30S plasmid DNA construct was constructed. Prepared.

C30S mutation: 30 cycles (95 ° C 45 sec; 55 ° C 1 min; 68 ° C 10 min) / 2% DMSO

L173S mutation: 25 cycles (95 ° C 45 sec; 55 ° C 1 min; 68 ° C 10 min)

Example 5: Expression and Purification in Recombinant E. Coli

For the expression of recombinant HA1 and HA2 proteins in E. coli, E. coli strain Rosetta (DE3) pLysS (Novagen) was used as a host cell strain to solve the codon usage problem.

end. HA2 protein

Optimal conditions for protein expression of HA2 (23-185) / C137S plasmid DNA construct (His6-tag) were determined as follows. After induction with 0.5 mM IPTG at an OD ₆₀₀ value of 0.7, expression conditions were performed at 20 ° C. and 110 rpm for 6 hours, and purification conditions were established using Ni affinity chromatography. The proteins bound to the beads were washed sufficiently with a washing buffer containing 20 mM imidazole, followed by step-wise elution.

As confirmed by SDS-PAGE, HA2 was expressed in a large amount and there was little impurity (data not shown).

I. HA1 protein

Attempted expression and purification of the HA1 (17-344) / C30S plasmid DNA construct (His6-tag) in E. coli under the same conditions as the HA2 protein, but the expression amount was small and many impurity bands remained after purification. In order to solve the problem of expression and purification of recombinant HA1, first, the expression in E. coli under the same conditions as in the case of HA2 protein, and then purified HA1 protein by disrupting the cells without the addition of EDTA, DTT and β-mercaptoethanol It was. Cells were disrupted with 1 mM DTT to reduce intramolecular or intermolecular disulfide bonds that may have been formed during the previous purification conditions. However, HA1 (17-344) / C30S (His6) with added DTT was expressed. It was determined that the protein interfered with binding to Ni-NTA agarose beads, resulting in only a small amount of protein.

In order to improve the purity, His-tag was added to increase the binding strength of the beads, and more than twice the cleaning was performed to remove impurities. PET-24b (+) plasmid DNA with His6-attached HA1 (17-344) / C30S DNA construct was used as a template. As a result, it was confirmed that the cloned DNA band was visible in the sample without DMSO. By the DNA sequencing and the plasmid mini-prep DNA with the identified DNA Dpn I after rough processing from four of the colonies were obtained by performing the transformation in E. coli DH5α result, the construct Incidentally substituted with His7 and each His8 I got it.

HA1 constructs substituted with His7 and His8, respectively, were modified in E. coli strain Rosetta (DE3) pLysS by changing various conditions such as cell culture conditions, timing of induction, and expression time after induction. there was. The His7 construct was used to induce 0.5 mM IPTG at 0.8 OD ₆₀₀ and then incubated at 18 ° C. and 110 rpm for 8 hours. In the purification process, the cells were disrupted without adding EDTA, DTT, and β-mercaptoethanol. After washing the beads sufficiently with the washing buffer containing 20 mM imidazole, 50 mM imidazole was added. Two washes were performed with a washing buffer, which was sequentially eluted with 1 mL of 100 mM, 150 mM, and 200 mM imidazole buffers. As a result, the expression of HA1 protein was greatly improved, but additional purification was required to increase purity. It seems to be.

For high purity purification of the expressed HA1 and HA2 proteins, the partially purified protein was first purified using His-tag affinity chromatography using HPLC using a 5RPC column (FIG. 3). Sample volume is 200 μl, buffer A is distilled water + 0.1% TFA, buffer B is acetonitrile + 0.1% TFA and acetonitrile gradients are 37-47% and 40-52%.

Example 6: Preparation of PLGA Fine Particles Containing Recombinant HA1 and HA2

The fusion peptide consisting of hydrophobic amino acid residues and the TMD site are removed, resulting in loss of membrane fusion function, thereby replacing the amino acid with C30S to prevent formation of HA2 protein fragment with excellent biosecurity and enhanced water solubility and inclusion body by intramolecular disulfide bond. PLGA microparticles for influenza virus vaccines containing a wild-type similar HA1 protein as an antigenic epitope were prepared using a W / O / W double emulsion microencapsulation method.

The experiment of encapsulating purified HA1 and HA2 proteins in PLGA using the double emulsion (W ₁ / O / W ₂ ) method was performed as follows (FIG. 4).

The molecular weight of HA1 (His7) protein is 37347.2 and for HA2 protein is 20173.4. Since the total protein mass at the time of encapsulation was 400 µg / mL, the mass ratio was 1.85: 1 in order to make the molar ratio of HA1 and HA2 1: 1. 1 mL of an aqueous phase containing HA protein combined with HA1 and HA2 and 2.8% (w / v) of polyvinylalcohol (PVA) was made (W ₁ ). PLGA was dissolved in 6 mL of dichloromethane (methylene chloride) at 1.0% concentration (O), and then mixed with W ₁ and O and emulsified by reacting 9,500 rpm 30 sec with a homogenizer (Ultra-Turrax, IKA) (W ₁ / O). . The product was added again to 54 mL of an aqueous solution containing 0.4% (w / v) of PVA, and the homogenizer was double-emulsified by stirring at 4,000 rpm for 30 sec (W ₁ / O / W ₂ ). The resulting product was then subjected to solvent extraction for 3 hours at 150 rpm. At this time, dichloromethane on the oil escapes, causing small pores in the fine particles to harden. The resulting fine particles were subjected to a hardening process of three washing operations using tertiary distilled water to remove the unencapsulated HA protein and the solvent from the fine particles. The PLGA fine particles obtained in this manner were rapidly frozen with liquid nitrogen, and then freeze dried under reduced pressure to evaporate moisture to obtain fine particles encapsulated in PLGA.

SEM imaging was performed to obtain an accurate surface shape. The lyophilized particulate sample was fixed on the aluminum stub using a conductive carbon tape, and the gold coating was carried out in a vacuum state using an Auto Multi Coater, followed by scanning electron microscopy (SEM; JEOL JSM-6390, Japan). The surface shape photograph of the microparticles | fine-particles was taken at the magnification (A of FIG. 5). As a result of SEM imaging, large numbers and large sizes of pores were found on the surface of the particles. If there are many pore with a large size, there is a problem in the encapsulation of the protein was tested to improve this. The optimum conditions of the microencapsulation method were explored as follows while controlling the emulsifier (PVA) content, solvent extraction method (stirring or evaporation), stirring speed during particle curing, and the like.

In the second experiment, the PVA content in the aqueous phase (W ₁ ) and the aqueous phase (W ₂ ) was increased by 1.5 times compared to the first experiment, and the contents were increased by 4.2% (w / v) and 0.6% (w / v) to experiment. SEM images were taken to confirm the surface image of the fine particles thus obtained. As a result of SEM imaging, it was found that the number and size of the pore present on the surface was reduced compared to the existing fine particles, but it was found that there was still a large pore (FIG. 5B).

Third, the evaporation method was used instead of the stirrer to control the time when the dichloromethane, the organic solvent of the oil layer, was released under the condition that the PVA content was increased 1.5 times. Using a rotary evaporator (BUCHI, rotavaper R-210) with a slight decompression was carried out at the same time the solvent removal and curing process at 50 rpm for 3 hours. The other experimental method is the same as before. SEM images were taken to confirm the surface image of the fine particles obtained in the experiment. As a result, fine particles exhibiting a surface morphology with little pore were obtained (FIG. 5C).

However, these types of microparticles have a problem that they can encapsulate the protein well, but the protein may not escape well in vivo. Therefore, the following experiment was carried out to make microparticles having a proper number and small pore.

During the solvent removal and hardening process of the experiment, too low rpm may cause the organic solvent not to come out properly or a large amount of the solvent may come out at once, so all other conditions are fixed in the same manner as in the previous experiment and only the rotation speed is controlled. The fourth experiment was carried out. The experiment was carried out by increasing the rotation speed from the existing 50 rpm to 100 rpm using an evaporator with a slight decompression. SEM pictures were taken to confirm the surface image of the obtained fine particles. As a result, it was observed that the particles exist in the form similar to the existing ones, and the particles together with the small pore exist together.

In order to obtain a better surface shape, the composition and method of the reagents are the same as in the above experiment, and the solvent is removed by reducing the rotation speed to 100 rpm instead of 150 rpm, which was performed in the first experiment using a stirrer without decompression instead of the evaporator. A fifth experiment was conducted, which performed solvent extraction and a curing process. As a result of the SEM photographs, fine particles having a suitable number and small pore size were obtained as compared with the existing results (FIG. 5D).

Example 7: in vitro  Slow release verification experiment of HA protein through release experiment

PLGA microparticles containing modified HA1 and HA2 proteins together were verified through in vitro release experiments to have a good slow release that slowly releases antigenic epitopes in vivo .

First, HA1 and HA2 proteins were adjusted to a molar ratio of 1: 2, and verified using a 1X PBS (pH 7.4) solution containing a molar concentration of 0.21 nM, 0.56 nM, 0.84 nM, and 1.12 nM of HA1 and HA2 proteins, respectively. A calibration curve was created. In the case of HA1, since partially purified protein was used, molarity was calculated in consideration of impurity. With 50 μl of each solution, the absorbance was measured using the indirect ELISA method described below to prepare a verification curve (FIG. 6).

4 mg of the fine particles obtained in the fifth experiment were dispersed in 800 μl of 1 × PBS (pH 7.4), followed by stirring at 250 rpm in a shaking incubator at 37 ° C. to release the HA protein. Each constant time was centrifuged at 12,000 rpm for 10 minutes to sample 150 μl of the supernatant. Each sample was quantified as follows by subtracting the blank value using the indirect ELISA method.

50 μl of the sample was put into a 96 well plate and coated by incubating with slight shaking at RT. After washing 3-5 times with 1X PBS (pH 7.4) containing 0.05% (v / v) Tween-20 and dried. 200 μl of 1 × PBS (pH 7.4) containing 1% (w / v) BSA was added and then blocked by incubation at 37 ° C. for 2 hours. After washing 3-5 times with PBST again, it was dried. 50 μl of His-tag antibody, which was diluted to 1: 5000, was added and incubated at 37 ° C. for 2 hours. Washing with PBST again three to five times and dried. 50 μl of the secondary antibody HRP-conjugated anti-mouse IgG diluted 1: 5000 was added, and then incubated at 37 ° C. for 1 hour. Again washed with PBST 3-5 times and dried. 50 μl of TMB was added as a stop agent and allowed to stand at RT for 10 minutes. Then, 50 μl of 2 MH ₂ SO ₄ was added and allowed to stand at RT for 20 minutes. The absorbance was measured at 450 nm using an ELISA reader. The molar concentration of the protein released at was quantified.

After 60 days of experiments, it was confirmed that the HA1 and HA2 proteins in the PLGA particles were slowly released for more than 30 days.

Example 8: Using Mouse in vivo  Experiment

Experiments to determine whether antibodies were generated using a mouse were carried out by requesting the Laboratory Animal Research Center of Chungbuk National University. As a model animal used in the experiment, it was performed using mouse SPF / BALB / C (ORIENT BIO Inc.). Thirty 10-week old females were divided into four groups (Table 1).

Table 1

	Dosing method	head
Group
1	PLGA encapsulation (15 μg HA in 200 μl sol.)	10
Group 2	PLGA encapsulation + Fluid vaccine (7.5 μg HA + 7.5 μg Fluid HA in 200 μl sol.)	10
Group 3	Fluid vaccine (15㎍ Fluid HA in 200µl sol.)	5
Group 4	Fluid vaccine (7.5㎍ Fluid HA in 200µl sol.) * 2 times	5

The first group was inoculated with 15 µg PLGA encapsulation HA (HA1 + HA2) (in 200 µl solution), and the second group was inoculated with PLGA encapsulation HA (HA1 + HA2) 7.5 µg + Fluid HA 7.5 µg (in 200 µl solution) It was. The third group was inoculated with 15 μg of Fluid HA (in 200 μl solution) at once, and the fourth group was inoculated with 7.5 μg of Fluid HA (in 200 μl solution) and boosted by inoculating the same amount after 4 weeks. Blood samples were taken for 12 weeks at two-week intervals to determine whether antibodies were present and antigens were present using ELISA for blood samples.

Example 9: Confirmation of Antigen Presence Using ELISA

In order to verify whether the injected antigen is present in the blood of the mouse, a blood sample was taken and the experiment was performed as follows. First, 100 μl of serum diluted 1: 500 was added to 96 wells and coated overnight at 4 ° C. (or 2 hours at room temp). After washing 3-5 times using PBT (PBS + Tween20) pH 7.2 buffer, 200 μl of a block agent diluted with BSA was added to TB buffer, and the block step was performed at RT for 1 hour. Washing was performed 5 times using a PBT buffer. The reaction was performed at 37 ° C. for 1 hour using a His-tag antibody diluted 1: 500 with a secondary antibody. Washing was performed 5 times using a PBT buffer. Goat anti-mouse IgG HRP 1: 5000 dilution to react for one hour after the semi-put 100㎕ 37 ℃ incubator was stopped and the reaction put TMB 100㎕ of 0.5N again while leaving H ₂ SO ₄ After adding 100 μl and reacting for a while, absorbance was measured using an ELISA (FIG. 7).

As a result, it was confirmed that the antigen administered to the mouse exists in the blood. In the case of fluid vaccines using water-soluble proteins as antigens, the injected antigens are initially detected at high concentrations but are quickly lost, whereas in animal groups administered with antigens in the form of PGA microparticles, the duration of antigen presence is longer. It was confirmed that it is slowly released into the blood.

Example 10: Confirmation of Antibody Production by ELISA

HA protein (HA1 + HA2) was diluted to a concentration of 200ng / ml, and 100µl each of 96 wells was coated overnight at 4 ° C (or 2 hours at room temp). Washing was performed 3-5 times using PBT (PBS + Tween20) pH 7.2 buffer. After 200 μl of a block agent diluted with BSA in TB buffer, the block step was performed at RT for 1 hour, and then washed five times using PBT buffer. Here, the sera collected from the mouse was diluted 1:50, put into 96 wells, and reacted for one hour at 37 ° C incubator. After washing 5 times with PBT buffer, Goat anti-mouse IgG HRP was diluted 1: 5000 and put in 100 μl. The reaction was performed at 37 ° C. incubator for 1 hour. In order to stop the reaction, 100 μl of TMB was added thereto, and the mixture was left for a while. Then, 100 μl of 0.5 N H ₂ SO _{4 was} added, followed by brief reaction. For accurate data calculation, the measurement was carried out three times in the same manner as above (Fig. 8).

As a result, the antibody response to the HA antigen was confirmed, and the change in the antibody content of the vaccine containing the PLGA microparticles was observed to be small, which can be interpreted as an effect of the sustained release of the antigen.

In addition, in order to separately confirm the production of HA1 antibody and HA2 antibody, the experiment was repeated three times in the same manner as above with each HA1 and HA2 antigen (FIGS. 9 and 10). In the above experiments, it can be seen that the graphs of HA1 and HA2 in each group are similar. This means that both antibodies against HA1 and antibodies against HA2 are generated and present in the antibody. In addition, when the amounts of the HA1 antibody and the amount of the HA2 antibody were summed, they were similar to the data values measured without separating the antigens of HA1 and HA2 separately.

Claims (10)

1. The amino acid residues 1-16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1 are deleted, and the 30th amino acid residue is substituted for cysteine with serine; The 137th amino acid residue of the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with serine in cysteine, and the codons of arginine corresponding to the 123rd, 124th and 127th amino acid residues are substituted with AGT to CGT, respectively. A recombinant HA (hemagglutinin) protein as an antigenic epitope for influenza virus vaccines.
2. The recombinant HA protein of claim 1, wherein the first amino acid residue of the HA2 protein is substituted with glutamic acid or valine in glycine.
3. The recombinant HA protein according to claim 1, wherein the 1st to 22nd amino acid residues corresponding to the fusion peptide of the HA2 protein are deleted.
4. 4. The recombinant HA protein of claim 3, wherein the 186-221 amino acid residues corresponding to the TMD (transmembrane domain) of the HA2 protein are deleted.
5. The recombinant HA (hemagglutinin) protein according to claim 1, wherein His7-tag and His6-tag are attached to the C-terminus of the recombinant HA1 and HA2 proteins, respectively.
6. Influenza comprising a W / O / W double emulsion microencapsulation of a recombinant hemagglutinin protein as an antigenic epitope for influenza virus vaccines according to any one of claims 1 to 5 Method for producing PLGA microparticles for viral vaccines.
7. The method of claim 6 wherein the W / O / W double emulsion microencapsulation

   Preparing an aqueous phase (W ₁ ) containing the recombinant HA protein and 4-5% (w / v) of polyvinylalcohol (PVA);

   Dissolving PLGA in a solvent (O), mixing W ₁ and O and emulsifying using a stirrer to produce W ₁ / O;

   Adding W ₁ / O to an aqueous solution containing 0.5 to 0.7% (w / v) of PVA and performing a double emulsion by stirring to produce W ₁ / O / W ₂ ; And

   And subjecting the product to a solvent removal process and a hardening process.
8. 8. The method of claim 7, wherein the solvent removal process is performed by stirring or evaporation.
9. The method of claim 7, wherein the solvent removal process and the curing process are performed by stirring at 90 to 110 rpm.
10. PLGA microparticles for influenza virus vaccine prepared by the method of claim 6.

Images