KR101034490B1 - Recombinant influenza virus hemagglutinin protein as antigenic epitope for vaccination with enhanced biosafety - Google Patents

Abstract

The present invention uses HA (hemagglutinin) proteins (HA1 and HA2) using recombinant DNA technology to develop an antigenic epitope for influenza virus vaccines with high or low biosafety due to lack or degradation of membrane fusion. Was purified after expression in E. coli, specifically, the recombinant HA protein is deleted from amino acid residues 1 to 16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1, the 30th amino acid residue is substituted for serine in cysteine; In the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2, the 137th amino acid residue is substituted with serine at cysteine, the AGG codon corresponding to arginine at 123th, 124th and 127th amino acid residues is substituted with CGT, respectively, and the recombinant HA2 protein It is characterized by a lack or degradation of the membrane fusion function.

Influenza virus, vaccine, antigenic epitope, HA protein, HA1, HA2

Description

Recombinant influenza virus hemagglutinin protein as antigenic epitope for vaccination with enhanced biosafety}

The present invention relates to a recombinant hemagglutinin protein as an antigenic epitope for influenza virus vaccines with excellent biosafety, and more particularly, to a recombinant hemagglutinin (HA) protein as an antigenic epitope for influenza virus vaccines. The amino acid residues 1-16 of the HA1 protein consisting of the amino acid sequence of Number 1 are deleted, and the 30th amino acid residue is substituted for cysteine with serine; In the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2, the 137th amino acid residue is substituted with serine at cysteine, the AGG codon corresponding to arginine at 123th, 124th and 127th amino acid residues is substituted with CGT, respectively, and the recombinant HA2 protein Relates to a recombinant HA (hemagglutinin) protein characterized by a lack or reduced membrane fusion function.

Influenza virus belongs to the Orthomyxoviridae family and has a genome with seven to eight single-stranded RNAs. Divided into A, B and C type according to the antigenic difference between the nucleoprotein and intercellular protein. Influenza virus A is divided into 15 types (H1-H15) and 9 types (N1-N9), respectively, according to the antigenic differences of the surface proteins hemagglutinin (HA) and neuraminidase (NA) in the virus envelope (Cross et al. 2001. EMBO J., 20: 4432-4442.

The HA protein is expressed as a membrane glycoprotein as one polypeptide (precursor HA0), which is then divided into HA1 and HA2 by proteolytic cleavage, and in nature, a disulfide bond (the 30th amino acid residue of HA1, cysteine and HA2). Th amino acid, between cysteines) (Swelley et al. 2004. Biochemistry, 43: 5902-5911) (see FIG. 1).

For influenza virus to invade host cells, a membrane fusion must occur between the viral envelope membrane and the host cell membrane. This process involves HA2, a membrane protein with a transmembrane domain (TMD) at the C-terminus, which is composed of a fusion peptide consisting of hydrophobic amino acid residues at the N-terminus of HA2. The two membrane systems are known to fuse by acting to partially stir the cell membrane of the target cell, and so the HA2 protein is called a membrane fusion protein (Cross et al. 2001. EMBO J., 20: 4432- 4442).

After the invading virus enters the endosome, the pH decreases, and the mechanism by which HA2 on the surface of the virus becomes fused is called the "spring-roaded mechanism." This is a three-stranded α-helical coiled-coil made of three HA2 protein molecules after the loop portion in the HA2 protein (Fig. 2) is converted to a fusion phase by pH shift in the incubation period. What happens (Epand et al. 1999. J. Mol. Biol., 286: 489-503).

The site where the α-helical coiled-coil of HA2 is formed is reported to span amino acid residues 38-175 of HA2. The interface of the coiled-coil HA2 trimer is composed of amino acid residues corresponding to a and d positions in a heptad method in which the α-helix helix structure is circularly analyzed for the arrangement of amino acid residues (FIG. 3). In particular, the hydrophobic interaction between amino acid residues at the d position of this site appears to be a major factor providing the forces between the protein molecules that form the coiled-coil HA2 trimer.

Vaccines against influenza viruses have traditionally been using inactivated viruses or HA and NA proteins extracted from virus particles, but contain viral lipids that have not been completely removed during purification. It is still a problem for the elderly in terms of safety. In addition, IgA responses are not induced in nasal secretions that induce high serum IgG responses but become viral penetration pathways. Recently, studies have been conducted to use live attenuated viruses (eg, temperature-sensitive) as vaccines, but high dosages due to the possibility of being converted into active viruses and inducing low antibody production It has been reported that there is a problem that should be administered or inactivated virus together, and despite the many possibilities it is not yet practical.

Korean Patent Registration No. 10-0703571 discloses a peptide-based vaccine against influenza, and Korean Patent Publication No. 2008-0093382 discloses a vaccine composition for preventing influenza, but the antigenic epitope for influenza virus vaccine of the present invention. It is different from recombinant HA (hemagglutinin) protein as an antigenic epitope.

The present invention has been made in accordance with the above requirements, and in the present invention, in order to develop an antigenic epitope for influenza virus vaccine with excellent biosafety even in young infants and the elderly, hemagglutinin protein ( HA1 and HA2) were each expressed in E. coli and purified. When preparing vaccines, mutant HA2 and wild-type HA1 proteins lacking infectivity should be used together as antigenic epitopes. In other words, separately expressed and purified wild-type HA1 protein should also be put together.

In order to increase biosafety, the membrane fusion function of HA2 protein should be removed.

First, by substituting alanine for the amino acid residue corresponding to the d position at the interface of the coiled-coil HA2 trimer, it inhibits the hydrophobic interaction between HA2 protein molecules and does not destroy the α-helix helix itself, but rather the coiled-coil HA2 trimer. A mutant HA2 protein can be prepared that inhibits only the formation of. Second, G1E HA2 and G1V HA2 mutant proteins can be prepared in which the membrane fusion function of the fusion peptide itself present at the N-terminus of HA2 protein is reduced. Third, a HA2 protein fragment from which the fusion peptide itself is removed can be prepared.

In order to express recombinant HA1 and HA2 proteins derived from influenza virus in E. coli , host cell strains such as E. coli strain Rosetta (DE3) pLysS (Novagen) should be used. In order to improve the expression yield, it is preferable to replace rare codons, such as R123, R124 and R127, of the HA2 protein with codons suitable for expression in E. coli. In addition, to prevent inclusion body formation, cysteine, an amino acid residue capable of forming an intramolecular or intermolecular disulfide bond, needs to be substituted with serine. In the case of the HA1 protein, the N-terminal signal sequence region must be expressed in E. coli.

Purification of protein expression conditions such as cell culture conditions, timing of induction, induction intensity (addition amount of IPTG), expression time after induction, cell disruption solution, strength of affinity chromatography (His tag), washing solution and method, and elution method Conditions need to be optimized.

In order to solve the above problems, the present invention is a recombinant HA (hemagglutinin) protein as an antigenic epitope for influenza virus vaccine, amino acid residues 1 to 16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1 is deleted The 30th amino acid residue is substituted for serine in cysteine; In the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2, the 137th amino acid residue is substituted with serine at cysteine, the AGG codon corresponding to arginine at 123th, 124th and 127th amino acid residues is substituted with CGT, respectively, and the recombinant HA2 protein Provides a recombinant HA (hemagglutinin) protein characterized by a lack or reduced membrane fusion function.

According to the present invention, (1) the production of a mutant HA2 protein as an antigenic epitope with excellent biosafety is possible, and (2) the development of an influenza virus vaccine having no toxicity and improved vaccine efficacy required for infants and the elderly. And (3) using protein engineering techniques to develop new forms of antigenic epitopes for influenza virus vaccines that can replace existing patented technologies, and (4) avian influenza virus, swine Flu, and HIV virus gp41 proteins. It can be used to develop related vaccines.

In order to achieve the object of the present invention, the present invention is a recombinant HA (hemagglutinin) protein as an antigenic epitope for influenza virus vaccine, amino acid residues 1 to 16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1 Are deleted and the 30th amino acid residue is substituted for cysteine in serine; The 137th amino acid residue of the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with serine in cysteine, and the codons of arginine corresponding to the 123rd, 124th and 127th amino acid residues are substituted with AGT to CGT, respectively. To provide a recombinant HA (hemagglutinin) protein.

In a recombinant HA protein according to one embodiment of the invention, the HA2 protein is T59A, I66A, V73A, L80A, T87A, V73A, I108A, M115A, T122A, T59A / I66A, V73A / L80A, T87A / W94A, M115A / T122A, One or more amino acid residues selected from the group consisting of I66A / V73A, L80A / T87A and I108A / M115A may be substituted. For example, T59A refers to a single mutant in which threonine, the 59th amino acid of HA2 protein, is substituted with alanine, and T59A / I66A refers to threonine, the 59th amino acid of HA2 protein, replaced with alanine, Refers to a double mutant substituted with alanine.

In a recombinant HA protein according to an embodiment of the present invention, the first amino acid residue of the HA2 protein may be substituted with glutamic acid or valine in glycine.

In a recombinant HA protein according to an embodiment of the present invention, amino acid residues 1 to 22 corresponding to the fusion peptide of the HA2 protein may be deleted, and at the same time, correspond to the TMD (transmembrane domain) of the HA2 protein. 186 th to 221 th amino acid residues may be deleted.

In the recombinant HA protein according to an embodiment of the present invention, His7-tag and His6-tag may be attached to the C-terminus of the recombinant HA1 and HA2 proteins, respectively.

Hereinafter, the present invention will be described in more detail.

In the case of HA2 protein, three methods were used as follows to remove membrane fusion function.

First, among the amino acid residues 38-175 of the site where the coiled-coil of HA2 is formed, an interface that forms a HA2 trimer of coiled-coil structure induced by conformational change of HA2 in fusogenic state by pH shift The study focused on amino acid residues corresponding to and d position, especially amino acid residues at d position. By replacing the amino acid residue corresponding to d position at the interface of the coiled-coil HA2 trimer with alanine, the normal HA2 trimer is formed while inhibiting hydrophobic interaction between HA2 protein molecules without destroying the α-helix helix itself. Inhibition produced 16 mutant HA2 proteins lacking membrane fusion activity.

Second, G1E HA2 and G1V HA2 mutant proteins were substituted with the first amino acid residues of which the membrane fusion function of the fusion peptide itself, which is present at the N-terminus of HA2 protein, was reduced, and the membrane-fusion was maintained while maintaining the coiled-coil HA2 trimer. To prevent it. The G1E HA2 and G1V HA2 mutant proteins mean that the first amino acid residue of the HA2 protein is substituted with glutamic acid and valine in glycine, respectively.

Third, HA2 (23-185) and HA2 (23-221) protein fragments were prepared by removing the fusion peptide itself consisting of 22 hydrophobic amino acid residues present at the N-terminus of the HA2 protein, thereby eliminating membrane fusion activity. Three rare arginine codons contained in the HA2 protein were replaced with codons suitable for expression in E. coli (R123, R124, R127) and HA2, which can form an intermolecular disulfide bond with cysteine, the 30th amino acid residue of the HA1 protein Cysteine, the 137th amino acid residue of, was substituted with serine (C137S).

In the case of the HA1 protein, the N-terminal signal sequence was removed (HA1 (17-344)) and cysteine, the 30th amino acid residue of the HA1 protein, was substituted with serine to prevent inclusion body formation by intramolecular or intermolecular disulfide bonds. (C30S).

For the expression of recombinant HA1 and HA2 proteins in E. coli, the host cell strain was used E. coli strain Rosetta (DE3) pLysS (Novagen) and 18-20 ° C, 110 rpm after induction with 0.5 mM IPTG at OD ₆₀₀ = 0.8. 6-8 hours expression at. Purification conditions were established using Ni affinity chromatography by attaching His7-tag and His6-tag to the C-terminus of the recombinant HA1 and HA2 proteins, respectively. The proteins bound to the beads were sufficiently washed with a washing buffer to which 20 mM and 50 mM imidazole were added, followed by step-wise elution. In the case of HA1 protein, cells were disrupted without adding EDTA, DTT, and β-mercaptoethanol.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Reagents and Instruments

The HA gene used in the present invention is derived from influenza virus type A X31 strain and is contained in plasmid pHA. It was expressed in E. coli strain Rosetta (DE3) pLysS (Novagen), which was inserted into the pET24b (+) vector to solve the rare codon problem of E. coli. The DNA amplification apparatus used for the preparation of mutant DNA was a T-GRADIENT 48 model of Biometra.

Example 1: Preparation of d position mutant present at interface of coiled-coil HA2 trimer

All HA2 constructs used in the present invention were used by substituting three rare (R123, R124, R127) rare arginine codons (AGG) with codons (CGT) suitable for expression in E. coli.

HA-3R-F

ACAAGCTGTTTGAAAAAACACGTCGTCAACTGCGTGAAAATGCTGAAGA G AT (SEQ ID NO: 3)

HA-3R-R

ATCTCTTCAGCATTTTCACGCAGTTGACGACGTGTTTTTTCAAACAGCTTGT (SEQ ID NO: 4)

Among the amino acid residues that make up the interface of the coiled-coil sites (38-175) of HA2 using the HA2 (1-185) plasmid DNA construct (FIG. 4B), the amino acid residues are first located at d positions between 55 and 126. Mutant HA2 (9 single mutants, 7 double mutants) in which the corresponding amino acid residues were substituted with alanine was obtained and summarized in the table (FIGS. 5 and 6).

방법을 변형하여 PCR (Biometra Tgradient Thermocycler)을 이용하여 수행하였다 (도 7). 돌연변이를 일으키고자 하는 자리를 가운데에 포함하고 있는 동일한 위치를 포함하는 30 ~ 35 bp 길이의 정방향 및 역방향 mutagenic 프라이머 (Bioneer, Korea)를 사용하였다. 플라스미드 DNA 전체를 복제해야 하기 때문에 fidelity가 우수하면서도 합성속도가 빠른 (1kb/min) Pfu Turbo

DNA polymerase 를 사용하여 일반적으로 다음의 조건으로 PCR 반응을 수행하였다; 25 cycle (95℃ 45 sec; 55℃ 1 min; 68℃ 8 min).All site-directed mutagenesis performed in the present invention are QuickChange of Stratagene (USA)

The method was modified and performed using PCR (Biometra Tgradient Thermocycler) (FIG. 7). Forward and reverse mutagenic primers (Bioneer, Korea) of 30 to 35 bp in length containing the same position including the site to be mutated were used. Excellent fidelity and fast synthesis rate (1kb / min) Pfu because the entire plasmid DNA must be replicated Turbo

PCR reactions were generally performed using DNA polymerase under the following conditions; 25 cycles (95 ° C. 45 sec; 55 ° C. 1 min; 68 ° C. 8 min).

After the PCR reaction was terminated, agarose gel electrophoresis was performed to confirm that the DNA band of the linear plasmid size was amplified (Fig. 8), and then treated with Dpn I restriction enzyme for about 3 hours in E. coli DH5α. The extracted parental DNA template was removed as much as possible. After transformation into E. coli DH5α, plasmid DNA miniprep was carried out from 2 or 3 colonies to confirm that the desired position was modified through DNA sequencing (Solgent, Korea).

Example 2: Preparation of N-terminal amino acid mutant HA2

G1E HA2 mutant and G1V HA2 mutant, which are considered to have excellent biosafety due to lack of infectivity, were prepared through site-directed mutagenesis for use as antigenic epitopes. The two types of HA2 mutants have been reported to retain the α-helix propensity and form a coiled-coil HA2 trimer, but have little membrane fusion activity. At this time, the plasmid DNA construct used as a template was HA2 (1-185) (FIG. 4B).

Example 3: Preparation of Mutant HA2 with Removed Fusion Peptides

HA2 genes (1 to 221) from the influenza virus type A X31 strain used in the present invention are located after the HA1 gene on the plasmid pHA. For intact HA2 proteins produced by natural viruses, the C-terminal TMD site is located in the virus envelope and the N-terminal fusion peptide site attacks the target cell membrane. This type of structure may cause structural problems in which two sites are simultaneously placed on one membrane on the micelle structure or artificial membrane (vesicle, liposome) formed by using detergent during separation and purification. Intact HA2 protein expressed for the same reason is difficult to induce normal protein expression due to cytotoxicity caused by unstable cell membrane of the expression host cell.

Therefore, such problems as HA2 (1-185), HA2 (23-221), or HA2 (23-185) from which the N-terminal fusion peptide site or the C-terminal TMD site are removed among the HA2 gene (1 to 221) sites are avoided. A modified construct was prepared and inserted into pET24b (+) vector, an expression vector that can be purified using His-tag affinity chromatography.

DNA polymerase를 사용하여 다음과 같은 PCR 반응을 통하여, HA2(23-221) 부위만을 증폭하였다; 30 cycle (95℃ 45 sec; 53℃ 1 min; 68℃ 2 min).First, a plasmid DNA having a HA2 (23-221) DNA fragment from which a fusion peptide (up to 1st to 22nd amino acids), which is a membrane fusion active site of HA2, was removed (FIG. 4C) was prepared. By using the plasmid pHA with the total HA gene of influenza virus type A strain X31 derived as a template using two primers below, Pfu Turbo

DNA polymerase was used to amplify only the HA2 (23-221) site through the following PCR reaction; 30 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min).

HA2 (-FP) _NdeI_F: CACTTCGTCATATGGGTTTCAGGCATCAAAATTCTG (SEQ ID NO: 5)

HA2_221_SalI_R: CACTTCGTGTCGACAATGCAAATGTTGCACCTAATGT (SEQ ID NO: 6)

Each of the HA2 (23-221) DNA fragment obtained above with the Nde I and Sal I double digestion and ligated to pET-24b (+) vector with Nde I and Sal I cut sewn were transformed in DH5α. Mini-prep was performed to screen colonies that were ligated in the desired form, followed by double digestion with Nde I and Sal I or colony PCR. The plasmid DNA thus selected was again confirmed through DNA sequencing (FIG. 9).

When the HA2 (23-221) plasmid DNA construct obtained by the above method is expressed in recombinant E. coli, intramolecular or intermolecular disulfide bonds are formed, which is likely to precipitate in the form of inclusion bodies in aggregated form. So we performed site-directed mutagenesis to replace the 137th cysteine with serine; 25 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min). As a result, the HA2 (23-221) / C137S plasmid DNA construct was finally obtained (FIG. 10).

However, the HA2 (23-221) plasmid DNA construct still retains the transmembrane domain (TMD), which has a hydrophobic nature at the C-terminus. Thus, micelle structure using a detergent such as Triton X-100 was used during the separation and purification process. Must be formed. Therefore, first, it was decided to prepare and use a plasmid DNA construct having only HA2 (23-185) DNA fragments in which TMD sites were removed together with fusion peptide sites (FIG. 4D).

DNA polymerase를 사용하여 다음과 같은 PCR 반응을 통하여, HA2(23-185)/C137S 부위만을 증폭하였다; 30 cycle (95℃ 45 sec; 53℃ 1 min; 68℃ 2 min).Using the HA2 (1-185) / C137S construct in the pET24b (+) vector directly as a template, using the following two primers, the HA2 (23-221) plasmid DNA construct was obtained under the same conditions as below. Using two primers, Pfu Turbo

DNA polymerase was used to amplify only the HA2 (23-185) / C137S site through the following PCR reaction; 30 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min).

HA2 (-FP) _NdeI_F: CACTTCGTCATATGGGTTTCAGGCATCAAAATTCTG (SEQ ID NO: 7)

HA2_185_SalI_R: CACTTCGTGTCGACCCAGTCTTTGTATCCAGACTTCA (SEQ ID NO: 8)

The HA2 (23-185) / C137S DNA fragment was inserted into Nde I and Sal I sites of the pET-24b (+) vector in the same manner as when obtaining a plasmid DNA construct to obtain a desired form (FIG. 11).

Example 4: Preparation of recombinant HA1 from which the N-terminal signal sequence was removed

PCR was used to detect the remaining regions of the HA1 gene region, located in front of the HA2 gene on the plasmid pHA containing the HA gene from the influenza virus type A X31 strain, except for the signal sequence consisting of 16 amino acid residues located at the N-terminus. After replication, it was inserted into pET24b (+) vector, an expression vector that can be purified using His-tag affinity chromatography (FIG. 8).

First, the following two primers (without modification of amino acids) were used to remove Nde I sites present in the HA1 gene DNA at the plasmid pHA containing the entire HA gene from the influenza virus type A X31 strain. -directed mutagenesis was performed.

HA1_NdeIX-F: GTAAACAAGATCACATA C GGAGCATGCCCCAAG (SEQ ID NO: 9)

HA1_NdeIX-R: CTTGGGGCATGCTCCGTATGTGATCTTGTTTAC (SEQ ID NO: 10)

DNA polymerase를 사용하여 다음과 같은 PCR 반응을 수행하여, HA1(17-344) 부위만을 증폭하였다; 30 cycle (95℃ 45 sec; 53℃ 1 min; 68℃ 2 min). HA2 DNA construct를 얻을 때와 같은 방법으로 pET-24b(+) 벡터의 Nde I과 Xho I 자리에 삽입하여 원하는 형태를 확보하였다.Using the pHA from which the Nde I site in the HA1 gene DNA was removed as a template, the following two primers were used, Pfu Turbo

PCR amplification using the DNA polymerase was performed to amplify only the HA1 (17-344) site; 30 cycles (95 ° C. 45 sec; 53 ° C. 1 min; 68 ° C. 2 min). The desired shape was obtained by inserting into the Nde I and Xho I sites of the pET-24b (+) vector in the same manner as when obtaining the HA2 DNA construct.

HA1_NdeI-F: CGCTACTAGCATATGAAGACCATCATTGCTTTGA (SEQ ID NO: 11)

HA1_XhoI-R: CGCGTGGTCTCGAGAGTTTGTTTCTCTGGTACATT (SEQ ID NO: 12)

After DNA sequencing of the obtained HA1 (17-344) plasmid DNA construct, it was confirmed that the 173rd amino acid residue was changed from serine to leucine as compared with the HA1 gene from the influenza virus type A X31 strain reported in the literature. Could. In addition, cysteine, the 30th amino acid residue, forms an intermolecular disulfide bond with C137 of HA2 protein in its native state (see FIG. 1). However, when only the recombinant HA1 gene was expressed in E. coli, intramolecular or intermolecular disulfide bonds could be formed at this C30 site. Finally, in order to introduce double mutations of C30S and L173S into HA1 (17-344) plasmid DNA construct, site-directed mutagenesis was performed sequentially under the following conditions, and finally HA1 (17-344) / C30S plasmid DNA construct was constructed. Prepared.

C30S mutation: 30 cycles (95 ° C 45 sec; 55 ° C 1 min; 68 ° C 10 min) / 2% DMSO

L173S mutation: 25 cycles (95 ° C 45 sec; 55 ° C 1 min; 68 ° C 10 min)

Example 5: Expression and Purification in Recombinant E. Coli

For the expression of recombinant HA1 and HA2 proteins in E. coli, E. coli strain Rosetta (DE3) pLysS (Novagen) was used as a host cell strain to solve the codon usage problem.

end. HA2 protein

Optimal conditions for protein expression of HA2 (23-185) / C137S plasmid DNA construct (His6-tag) were determined as follows. After induction with 0.5 mM IPTG at an OD ₆₀₀ value of 0.7, expression conditions were performed at 20 ° C. and 110 rpm for 6 hours, and purification conditions were established using Ni affinity chromatography. The proteins bound to the beads were washed sufficiently with a washing buffer containing 20 mM imidazole, followed by step-wise elution.

As can be seen in SDS-PAGE (FIG. 12), HA2 was expressed in large amounts and had little impurity.

I. HA1 protein

Attempted expression and purification of the HA1 (17-344) / C30S plasmid DNA construct (His6-tag) in E. coli under the same conditions as the HA2 protein, but the expression amount was small and many impurity bands remained after purification. In order to solve the problem of expression and purification of recombinant HA1, first, the expression in E. coli under the same conditions as in the case of HA2 protein, and then purified HA1 protein by disrupting the cells without the addition of EDTA, DTT and β-mercaptoethanol As a result of confirming by SDS-PAGE (FIG. 13), it was confirmed that the expression level of the protein was improved. Cells were disrupted with 1 mM DTT to reduce intramolecular or intermolecular disulfide bonds that may have been formed during the previous purification conditions. However, HA1 (17-344) / C30S (His6) with added DTT was expressed. It was determined that the protein interfered with binding to Ni-NTA agarose beads, resulting in only a small amount of protein.

In order to improve the purity, His-tag was added to increase the binding strength of the beads, and more than twice the cleaning was performed to remove impurities. PET-24b (+) plasmid DNA with His6-attached HA1 (17-344) / C30S DNA construct was used as a template. As a result, it was confirmed that the cloned DNA band was visible in the sample without DMSO. By the DNA sequencing and the plasmid mini-prep DNA with the identified DNA Dpn I after rough processing from four of the colonies were obtained by performing the transformation in E. coli DH5α result, the construct Incidentally substituted with His7 and each His8 Got.

HA1 constructs substituted with His7 and His8, respectively, were modified in E. coli strain Rosetta (DE3) pLysS by changing various conditions such as cell culture conditions, timing of induction, and expression time after induction. there was. The His7 construct was used to induce 0.5 mM IPTG at 0.8 OD ₆₀₀ and then incubated at 18 ° C. and 110 rpm for 8 hours. In the purification process, the cells were disrupted without adding EDTA, DTT, and β-mercaptoethanol. After washing the beads sufficiently with the washing buffer containing 20 mM imidazole, 50 mM imidazole was added. Also washed twice with a washing buffer, and eluted sequentially with 1 mL of 100 mM, 150 mM, and 200 mM imidazole buffer, respectively, and confirmed by SDS-PAGE (FIG. 14). As shown in FIGS. 13 and 14, the HA1 protein expression problem is greatly improved, but it is determined that an additional purification process is required to increase purity.

1 is a schematic diagram of HA (hemagglutinin).

It is a schematic diagram of HA2 structural unit in a natural state.

3 is 28 residues of the fusion peptide with high α-helix propensity.

Figure 4 is a kind of plasmid DNA construct containing a HA2 gene used in the present invention.

5 is a mutant HA2 (1-185).

6 shows amino acid residues corresponding to a- and d-position of the coiled-coil region of HA2.

site-directed mutagenesis (Stratagene, USA) 방법의 개요를 나타낸다.7 QuickChange

An overview of the site-directed mutagenesis (Stratagene, USA) method is given.

site-directed mutagenesis 방법을 통해서 생성된 positive PCR 밴드이다.8 is a modified QuickChange

Positive PCR bands generated by site-directed mutagenesis.

9 is a vector construct for the expression of recombinant HA1 and HA2 proteins.

10 shows HA2 (-FP) 23-221.

11 shows HA2 (-FP) 23-185.

12 shows SDS-PAGE results of HA1 and HA2 proteins expressed in recombinant E. coli.

Figure 13 shows the SDS-PAGE (1) results of the HA1 protein expressed in recombinant E. coli.

14 shows the results of SDS-PAGE (2) of HA1 protein expressed in recombinant E. coli.

<110> Hanbat National University Industry-Academic Cooperation Foundation <120> Recombinant influenza virus hemagglutinin protein as antigenic          epitope for vaccination with enhanced biosafety <130> PN09119 <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 344 <212> PRT <213> Influenza virus type A X31 strain <220> <221> PEPTIDE (222) (1) .. (344) <223> HA1 <400> 1 Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile Phe Cys Leu Ala Leu Gly   1 5 10 15 Gln Asp Leu Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly              20 25 30 His His Ala Val Pro Asn Gly Thr Leu Val Lys Thr Ile Thr Asp Asp          35 40 45 Gln Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Ser Ser Ser Thr      50 55 60 Gly Lys Ile Cys Asn Asn Pro His Arg Ile Leu Asp Gly Ile Asp Cys  65 70 75 80 Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro His Cys Asp Val Phe Gln                  85 90 95 Asn Glu Thr Trp Asp Leu Phe Val Glu Arg Ser Lys Ala Phe Ser Asn             100 105 110 Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val         115 120 125 Ala Ser Ser Gly Thr Leu Glu Phe Ile Thr Glu Gly Phe Thr Trp Thr     130 135 140 Gly Val Thr Gln Asn Gly Gly Ser Asn Ala Cys Lys Arg Gly Pro Gly 145 150 155 160 Ser Gly Phe Phe Ser Arg Leu Asn Trp Leu Thr Lys Ser Gly Ser Thr                 165 170 175 Tyr Pro Val Leu Asn Val Thr Met Pro Asn Asn Asp Asn Phe Asp Lys             180 185 190 Leu Tyr Ile Trp Gly Ile His His Pro Ser Thr Asn Gln Glu Gln Thr         195 200 205 Ser Leu Tyr Val Gln Ala Ser Gly Arg Val Thr Val Ser Thr Arg Arg     210 215 220 Ser Gln Gln Thr Ile Ile Pro Asn Ile Gly Ser Arg Pro Trp Val Arg 225 230 235 240 Gly Leu Ser Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly                 245 250 255 Asp Val Leu Val Ile Asn Ser Asn Gly Asn Leu Ile Ala Pro Arg Gly             260 265 270 Tyr Phe Lys Met Arg Thr Gly Lys Ser Ser Ile Met Arg Ser Asp Ala         275 280 285 Pro Ile Asp Thr Cys Ile Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile     290 295 300 Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Lys Ile Thr Tyr Gly Ala 305 310 315 320 Cys Pro Lys Tyr Val Lys Gln Asn Thr Leu Lys Leu Ala Thr Gly Met                 325 330 335 Arg Asn Val Pro Glu Lys Gln Thr             340 <210> 2 <211> 221 <212> PRT <213> Influenza virus type A X31 strain <220> <221> PEPTIDE (222) (1) .. (221) <223> HA2 <400> 2 Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly   1 5 10 15 Met Ile Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly Thr              20 25 30 Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asp Gln Ile          35 40 45 Asn Gly Lys Leu Asn Arg Val Ile Glu Lys Thr Asn Glu Lys Phe His      50 55 60 Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp Leu  65 70 75 80 Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn Ala                  85 90 95 Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr Asp             100 105 110 Ser Glu Met Asn Lys Leu Phe Glu Lys Thr Arg Arg Gln Leu Arg Glu         115 120 125 Asn Ala Glu Glu Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys Cys     130 135 140 Asp Asn Ala Cys Ile Glu Ser Ile Arg Asn Gly Thr Tyr Asp His Asp 145 150 155 160 Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gln Ile Lys Gly Val                 165 170 175 Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe Ala             180 185 190 Ile Ser Cys Phe Leu Leu Cys Val Val Leu Leu Gly Phe Ile Met Trp         195 200 205 Ala Cys Gln Arg Gly Asn Ile Arg Cys Asn Ile Cys Ile     210 215 220 <210> 3 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HA-3R-F primer <400> 3 acaagctgtt tgaaaaaaca cgtcgtcaac tgcgtgaaaa tgctgaagag at 52 <210> 4 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HA-3R-R primer <400> 4 atctcttcag cattttcacg cagttgacga cgtgtttttt caaacagctt gt 52 <210> 5 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> HA2 (-FP) _NdeI_F primer <400> 5 cacttcgtca tatgggtttc aggcatcaaa attctg 36 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> HA2_221_SalI_R primer <400> 6 cacttcgtgt cgacaatgca aatgttgcac ctaatgt 37 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> HA2 (-FP) _NdeI_F primer <400> 7 cacttcgtca tatgggtttc aggcatcaaa attctg 36 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> HA2_185_SalI_R primer <400> 8 cacttcgtgt cgacccagtc tttgtatcca gacttca 37 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> HA1_NdeIX-F primer <400> 9 gtaaacaaga tcacatacgg agcatgcccc aag 33 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> HA1_NdeIX-R primer <400> 10 cttggggcat gctccgtatg tgatcttgtt tac 33 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> HA1_NdeI-F primer <400> 11 cgctactagc atatgaagac catcattgct ttga 34 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> HA1_XhoI-R primer <400> 12 cgcgtggtct cgagagtttg tttctctggt acatt 35  

Claims (6)

In a recombinant hemagglutinin (HA) protein as an antigenic epitope for influenza virus vaccines, amino acid residues 1-16 of the HA1 protein consisting of the amino acid sequence of SEQ ID NO: 1 are deleted, and the 30th amino acid residue is a serine from cysteine. Substituted with; The 137th amino acid residue of the HA2 protein consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with serine in cysteine, and the codons of arginine corresponding to the 123rd, 124th and 127th amino acid residues are substituted with AGT to CGT, respectively. Recombinant HA (hemagglutinin) protein. The method of claim 1, wherein T59A, I66A, V73A, L80A, T87A, V73A, I108A, M115A, T122A, T59A / I66A, V73A / L80A, T87A / W94A, M115A / T122A, I66A / V73A, L80A / T87A and I108A / A recombinant HA protein, wherein at least one amino acid residue of the HA2 protein is selected from the group consisting of M115A. The recombinant HA protein of claim 1, wherein the first amino acid residue of the HA2 protein is substituted with glutamic acid or valine in glycine. The recombinant HA protein according to claim 1, wherein the 1st to 22nd amino acid residues corresponding to the fusion peptide of the HA2 protein are deleted. The recombinant HA protein according to claim 4, wherein the 186-221 amino acid residues corresponding to the transmembrane domain (TMD) of the HA2 protein are deleted. The recombinant HA (hemagglutinin) protein according to claim 1, wherein His7-tag and His6-tag are attached to the C-terminus of the recombinant HA1 and HA2 proteins, respectively.

Images