WO2010140464A1 - Procédé d'induction de la différenciation cellulaire - Google Patents

Procédé d'induction de la différenciation cellulaire Download PDF

Info

Publication number
WO2010140464A1
WO2010140464A1 PCT/JP2010/058284 JP2010058284W WO2010140464A1 WO 2010140464 A1 WO2010140464 A1 WO 2010140464A1 JP 2010058284 W JP2010058284 W JP 2010058284W WO 2010140464 A1 WO2010140464 A1 WO 2010140464A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
differentiation
basement membrane
ips
Prior art date
Application number
PCT/JP2010/058284
Other languages
English (en)
Japanese (ja)
Inventor
昭苑 粂
伸明 白木
裕一朗 樋口
香穂子 梅田
和彦 粂
恵太郎 山根
克身 持立
Original Assignee
国立大学法人 熊本大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人 熊本大学 filed Critical 国立大学法人 熊本大学
Publication of WO2010140464A1 publication Critical patent/WO2010140464A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/067—Hepatocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/90—Substrates of biological origin, e.g. extracellular matrix, decellularised tissue

Definitions

  • the present invention relates to a method for inducing differentiation of ES cells and iPS cells. More specifically, the present invention relates to a method for inducing differentiation of ES cells or iPS cells into endoderm using a biosynthetic basement membrane culture substrate without using supporting cells.
  • Embryonic stem (ES) cells are pluripotent stem cells derived from the inner cell mass of blastocysts.
  • ES Embryonic stem
  • in vitro methods embryoid bodies are formed to mimic the inducible microenvironment necessary for liver regeneration (Non-Patent Documents 1 and 2), or treatment with specific growth factors and cytokines essential for hepatocyte differentiation is performed. (Non-Patent Document 3). It has been shown that when ES cells are cultured together with embryonic mesenchymal cells, ES cells go to the liver lineage (Non-Patent Documents 4 to 6). Production of ES cell-derived hepatocytes in vitro has been reported using BMP4 (Non-patent Document 7).
  • the present inventors have developed a method using feeder cells, and established a high-efficiency differentiation induction technique from ES cells to embryonic endoderm respiratory and digestive organs by planar culture (Patent Documents 1 and 2, and Non-patent document 8).
  • ES cells are transformed into mesendoderm, definitive endoderm, and final region-specific definitive endoderm-derived organs in vitro in a manner similar to early embryonic induction in vivo. They are guided in order (Non-Patent Document 9).
  • the M15 feeder is also a useful tool for creating strain-specific cell types derived from ES cells belonging to three germ layers (ie, neuroectodermal, mesoderm, and definitive endoderm) (Non-patent Document 10).
  • Differentiated ES cells undergo FGF stimulation of the ERK signaling cascade and switch from self-renewal to lineage restriction.
  • Activin and / or p38pMAPK then induce branching into the mesendoderm lineage. Later, activin induces mesendoderm branching into the definitive endoderm.
  • region specification to hepatocytes or pancreatic cells can be manipulated by modifying the culture conditions.
  • Non-patent Document 9 It has also been shown in culture transfilter assays that only this final stage of differentiation into region-specific definitive endoderm requires direct contact with M15 cells (Non-patent Document 9). Even the M15 cell layer fixed with aldehyde has been shown to retain the ability to induce pancreatic differentiation (Non-Patent Document 9), so the role of the extracellular matrix (basement membrane component) deposited around the M15 cell layer was thought to play a role in guiding the differentiation of definitive endoderm into region-specific strains.
  • these methods are methods using living support cells, and it is desirable to develop a method using a cell-free system in consideration of future application to humans.
  • sBM substratum synthesized basement Membrane substratum
  • BMP-4 is required for hepatic specification of mouse embryonic stem cell-derived definitive endoderm. Nat Biotechnol. 2006; 24: 1402-1411 Shiraki N, Umeda K, Sakashita N, et al. Differentiation of mouse and human embryonic stem cells into hepatic lineages. Genes Cells. 2008; 13: 731-746 Shiraki N, Yoshida T, Araki K, et al. Guided differentiation of embryonic stem cells into Pdx1-expressing regional-specific definitive endoderm. Stem Cells. 2008; 26: 874-885 Shiraki N, Higuchi Y, Harada S, et al. Differentiation and characterization of embryonic stem cells into three germ layers.
  • the present invention solves the problem of providing a novel ES cell or iPS cell differentiation induction method that enables differentiation induction of ES cells or iPS cells into an endoderm system without using feeder cells. It was a problem to be solved.
  • the present inventors have cultured ES cells or iPS cells on a biosynthetic basement membrane culture substrate to differentiate into an endoderm system without using supporting cells. I found that it can be guided. That is, in the present invention, the ES cells are induced to differentiate efficiently and selectively into the liver system or pancreatic system by modifying the medium using a biosynthetic basement membrane culture substrate (sBM (culture) substrate). I was able to. Similarly, iPS cells could also be induced into pancreatic cells using the same plutocol as ES cells by culturing on sBM substrate. The present invention has been completed based on these findings.
  • sBM biosynthetic basement membrane culture substrate
  • the following inventions are provided.
  • (1) Inducing differentiation from ES cells or iPS cells into pancreatic or liver cells, including culturing mammalian-derived ES cells or iPS cells in the presence of growth factors on a biosynthetic basement membrane culture substrate Method.
  • (2) The method according to (1), wherein the biosynthetic basement membrane culture substrate is a biosynthetic basement membrane culture substrate prepared by culturing cells having a basement membrane-forming ability on a support.
  • (3) The biosynthetic basement membrane culture substrate is a biosynthetic basement membrane culture substrate prepared by culturing cells having the ability to form a basement membrane on a support provided with a sugar chain (1) or (2 ) Method.
  • the biosynthetic basement membrane culture substrate comprises a human laminin-511 isoform basement membrane dense layer structure (lamina densa).
  • lamina densa basement membrane dense layer structure
  • a mouse-derived ES cell or iPS cell is cultured on a biosynthetic basement membrane culture substrate in the presence of ITS (insulin, transferrin, and sodium selenite), fetal bovine albumin, activin A, and bFGF.
  • ITS insulin, transferrin, and sodium selenite
  • fetal bovine albumin activin A
  • bFGF fetal bovine albumin
  • differentiation is induced into hepatic cells by culturing in the presence of ITS (insulin, transferrin, and sodium selenite), HGF (hepatocyte growth factor), dexamethasone, and oncostatin M.
  • ITS insulin, transferrin, and sodium selenite
  • HGF hepatocyte growth factor
  • dexamethasone dexamethasone
  • ES cells or iPS cells on biosynthetic basement membrane culture substrates ITS (insulin, transferrin, and sodium selenite), fetal bovine albumin, activin A and bFGF (basic fibroblast growth factor / basic fibroblasts) Cultured in the presence of cell growth factor), then in the presence of retinoic acid, and then in the presence of ITS (insulin, transferrin and sodium selenite), nicotinamide, glucagon-like peptide-1 (GLP1)
  • ITS insulin, transferrin and sodium selenite
  • GLP1 glucagon-like peptide-1
  • ES cells or iPS cells are performed in the presence of a test substance.
  • the degree of differentiation induction into pancreatic or liver cells and when the ES cells or iPS cells are cultured in the presence of the test substance A method for screening a substance that promotes or inhibits differentiation induction from ES cells or iPS cells into pancreatic or liver cells, comprising comparing the degree of differentiation induction into pancreatic or liver cells.
  • the degree of differentiation induction into pancreatic or liver cells is measured using the expression level of a marker expressed in pancreatic or liver cells as an index.
  • ES cells and iPS cells are characterized in that they can proliferate indefinitely and have pluripotency capable of differentiating into any cell tissue.
  • the development of differentiation from ES cells into hepatocytes and pancreatic cells has been developed worldwide, no cell that has sufficient function and can be recognized as a mature hepatic pancreatic cell has yet to be obtained.
  • a technique for controlling differentiation induction into liver cells and pancreatic cells was successfully established by a method not using feeder cells (supporting cells).
  • the method of the present invention is useful for the creation of model cells that can be applied to basic research of drug discovery such as safety evaluation of new drugs, and the creation of transplanted cell sources for regenerative medicine, and in particular, ES cells and iPS cells by the method of the present invention.
  • the method of inducing differentiation into mature hepatocytes and mature pancreatic cells is useful in the fields of drug discovery and regenerative medicine.
  • FIG. 1 is a schematic diagram of differentiation of ES cells into liver or pancreatic lineages on the M15 feeder cell layer.
  • M15 cells have the ability to differentiate ES cells into both pancreas and liver depending on the culture conditions.
  • FIG. 2 shows that ES cells cultured with human laminin-511 (hLN-511) isoform-sBM substrate can differentiate into definitive endoderm cells without a feeder.
  • Definitive endoderm cells (E-cadherin + / Cxcr4 +) expressing the differentiation markers E-cadherin and Cxcr4 were 27% in the culture on the sBM substrate, 50.9% in the culture on the ESM15 feeder cell layer, ES Appeared on day 8 of cell culture.
  • FIG. 3 shows that Afp and Alb1 expression is induced in 24 day ES cells cultured on sBM substrate.
  • ES cells grown in sBM were differentiated under culture conditions for liver differentiation, and expression of Afp and Alb1 was measured by real-time RT-PCR. Gene expression was normalized using ⁇ -actin.
  • ES cells cultured on SBM substrate had higher Afp expression but lower Alb1 expression than ES cells grown on the M15 feeder cell layer.
  • FIG. 4 shows the differentiation of khES-1 and khES-3 cells into liver lineages on sBM substrate.
  • FIG. 5 shows SK7 ES cells differentiated into Pdx1 / GFP expressing cells on the sBM substrate. SK7 ES cell line was seeded directly on sBM substrate. Pdx1 / GFP expression became detectable on day 10 and then gradually increased and reached a maximum on day 15.
  • FIG. 6 shows the expression of a mature pancreatic marker gene in differentiating ES cells that form cell clusters (having clusters).
  • d28 Total ES cells differentiated on day 28.
  • sBM ES cells differentiated on sBM substrate
  • d10, d15 and d28 total ES cells in the indicated number of days during differentiation culture.
  • the amount of cDNA was normalized using the expression level of ⁇ -actin.
  • Results showed that insulin 1 transcripts were detected on day 28 in ES cells cultured on sBM but not on ES cells on M15 feeder.
  • Pdx Pancreatic duodenum homeodomein 1; Ins1, insulin1; Gcg, glucagon; Sst, somatostatin; Ptf1a, pancreas specific transcription factor 1a; Amy, amylase.B)
  • Pdx1 Pancreatic duodenum homeodomein 1
  • Ins1, insulin1; Gcg glucagon
  • Sst somatostatin
  • Ptf1a pancreas specific transcription factor 1a
  • Amy amylase.B
  • FIG. 8 shows the progression of in vivo differentiation of mouse iPS cells differentiated on sBM substrate.
  • Mouse iPS cells were passaged twice on sBM substrate for 25 days to induce differentiation into the pancreatic lineage, and then collected and transplanted into the kidney capsule of SCID mice. After in vivo differentiation in transplanted tissues, transplants collected from iPS cell-derived cells cultured on sBM were analyzed. Frozen sections of the implants were stained with antibodies against mature pancreatic markers (magenta) and counterstained with DAPI (blue).
  • FIG. 9 shows the differentiation of human iPS cells using sBM substrate. Using sBM, human iPS cells cultured for 8 days (d8), 20 days (d20) and 30 days (d30) were subjected to gene expression analysis by RT-PCR.
  • FIG. 10 shows differentiation induction of human ES cells into hepatocytes on the sBM substrate. The khES3 strain was seeded on sBM, and the endoderm differentiation was started by switching to the differentiation medium from the next day.
  • differentiation of embryonic endoderm, albumin-positive hepatocytes, Pdx1-positive pancreatic progenitor cells, or insulin-positive pancreatic ⁇ cells can be induced from ES cells or iPS cells. It can.
  • differentiation from ES cells to the liver or pancreas has been induced by a method using M15 cells, which are feeder cells.
  • M15 cells which are feeder cells.
  • differentiation can be induced without using feeder cells (support cells). It became possible.
  • the method of the present invention was useful for maturation of pancreatic progenitor cells.
  • the cells When cells are cultured on a collagen matrix, the cells secrete “extracellular matrix” extracellularly.
  • the secreted extracellular matrix varies depending on the cell type, and various growth growth factors are captured by these extracellular matrixes, creating a solid phase environment that is very suitable for cell differentiation.
  • the biosynthetic basement membrane culture substrate is obtained by treating cells with a surfactant and an alkaline solution, and then excluding cell debris and exposing the basement membrane.
  • the present invention is a method for inducing differentiation of ES cells or iPS cells into pancreatic or liver cells, wherein the mammal-derived ES cells or iPS cells are cultured on a biosynthetic basement membrane culture substrate in the presence of a growth factor. It is a method characterized by culturing.
  • the differentiation induction method of the present invention it is possible to induce differentiation of digestive organ cells derived from endoderm such as liver or pancreas from ES cells or iPS cells on a biosynthetic basement membrane culture substrate without using supporting cells. . Inducing differentiation of hepatocytes or pancreatic cells without using feeder cells has never been reported so far and has been achieved for the first time by the present invention.
  • ES cells or iPS cells are easily induced to differentiate by being cultured on a biosynthetic basement membrane culture substrate. Therefore, when a specific growth growth factor is added, differentiation induction is further promoted. Therefore, the method of the present invention can also be used as a screening for unknown differentiation-inducing factors.
  • the ES sputum cell used in the present invention is not particularly limited as long as it is a mammal-derived ES cell, and for example, mouse, monkey or human-derived ES cells can be used.
  • a cell having a reporter gene introduced in the vicinity of the Pdx1 gene can be used in order to facilitate confirmation of the degree of differentiation.
  • a 129 / Sv-derived ES cell line R1, J1 incorporating the lacZ gene at the Pdx1 locus, or an ES cell SK7 line having a GFP reporter transgene under the control of the Pdx1 promoter can be used.
  • an ES cell PH3 strain having an mRFP1 reporter transgene under the control of a Hnf3 ⁇ endoderm-specific enhancer fragment and a GFP reporter transgene under the control of a Pdx1 promoter can also be used.
  • Mammal-derived ES cells can be cultured by conventional methods. For example, in the presence of mitomycin C-treated mouse embryo fibroblasts (MEF) as feeder cells, leukemia inhibitory factor (LIF, ESGRO 1000 Dulbecco's modified Eagle's medium (DMEM, Sigma) supplemented with differentiation medium (10% fetal bovine serum (FBS), 0.1 mM 2-mercaptoethanol, 100 ⁇ M non-essential amino acids, 2 mM L-glutamine, unit / ml, Chemicon) ))
  • LIF leukemia inhibitory factor
  • FBS fetal bovine serum
  • 2-mercaptoethanol 100 ⁇ M non-essential amino acids
  • 2 mM L-glutamine unit / ml, Chemicon
  • IPS cells induced pluripotent stem cells
  • Artificial pluripotent stem cells are pluripotent cells obtained by reprogramming somatic cells. Artificial pluripotent stem cells are produced by a group of Professor Shinya Yamanaka at Kyoto University, a group of RudolfudoJaenisch et al. At Massachusetts Institute of Technology, a group of James Thomson et al. At University of Wisconsin, Harvard University Several groups have been successful, including the group by Konrad Hochedlinger et al. Artificial pluripotent stem cells are highly expected as ideal pluripotent cells without rejection and ethical problems. For example, International Publication No.
  • WO2007 / 069666 discloses somatic cell nuclear reprogramming factors including Oct family gene, Klf family gene, and Myc family gene gene product, as well as Oct family gene, Klf family gene, Sox family gene and A somatic cell nuclear reprogramming factor containing a gene product of a Myc family gene is described, and further, a pluripotent stem cell induced by somatic cell nuclear reprogramming, comprising a step of contacting the nuclear reprogramming factor with the somatic cell. A method of manufacturing is described.
  • IPS cells used in the present invention can be produced by reprogramming somatic cells.
  • the type of somatic cell used here is not particularly limited, and any somatic cell can be used. That is, the somatic cell referred to in the present invention includes all cells other than the internal germ cells of the cells constituting the living body, and may be a differentiated somatic cell or an undifferentiated stem cell.
  • the origin of the somatic cell may be any of mammals, birds, fishes, reptiles and amphibians, but is not particularly limited, but is preferably a mammal (for example, a rodent such as a mouse or a primate such as a human). A mouse or a human is preferable.
  • human somatic cells any fetal, neonatal or adult somatic cells may be used.
  • the iPS cells referred to in the present invention have a self-replicating ability over a long period of time under predetermined culture conditions (for example, conditions under which ES cells are cultured), and are also ectoderm, mesoderm and endoderm under predetermined differentiation-inducing conditions.
  • the induced pluripotent stem cell in the present invention may be a stem cell capable of forming a teratoma when transplanted to a test animal such as a mouse.
  • the reprogramming gene is a gene encoding a reprogramming factor that has the action of reprogramming somatic cells into iPS cells.
  • Specific examples of the combination of reprogramming genes include the following combinations, but are not limited thereto.
  • (I) Oct gene, Klf gene, Sox gene, Myc gene ii) Oct gene, Sox gene, NANOG gene, LIN28 gene (iii) Oct gene, Klf gene, Sox gene, Myc gene, hTERT gene, SV40 large T gene
  • Iv Oct gene, Klf gene, Sox gene
  • ES cells or iPS cells are cultured on a biosynthetic basement membrane (sBM) substrate.
  • the biosynthetic basement membrane (sBM) substrate used in the present invention is not particularly limited as long as it can induce differentiation of ES cells or iPS cells into endoderm cells.
  • biosynthetic basement membrane (sBM) substrates Patent No. 37553532 (basement membrane preparation method), Patent No. 3829193 (basement membrane preparation or artificial tissue), Patent No. 4023597 (basement membrane preparation) And remanufactured artificial tissue used and its production method), and those produced by the method described in JP-A-2003-093053 (method for producing a basement membrane preparation). All the contents described in the above patent publications are incorporated herein by reference.
  • Japanese Patent No. 3785532 discloses a ⁇ -D-glucopyranose non-reducing end or a ⁇ -D-glucopyranose non-reducing end capable of localizing a receptor having an action of accumulating basement membrane components on the basal plane of a cell having basement membrane-forming ability.
  • a method for preparing a basement membrane comprising culturing cells having a basement membrane-forming ability on a support having a sugar chain having a 2-acetamido-2-deoxy- ⁇ -D-glucopyranose non-reducing end
  • the basement membrane described and produced by the preparation method can be used in the present invention.
  • the method of culturing mammalian-derived ES cells or iPS cells on a biosynthetic basement membrane (sBM) substrate is not particularly limited.
  • undifferentiated ES cells or iPS cells are dissociated with trypsin, seeded on a biosynthetic basement membrane (sBM) substrate, and grown in a differentiation medium.
  • sBM biosynthetic basement membrane
  • differentiation can be induced into endoderm cells such as liver cells and pancreatic cells.
  • ITS insulin, transferrin, and sodium selenite
  • cochlear fetal albumin activin A and bFGF
  • ITS insulin, transferrin, and Differentiation into hepatic cells can be induced by culturing in the presence of sodium selenite
  • HGF dexamethasone
  • Oncostatin M Oncostatin M.
  • human-derived ES cells or iPS cells are cultured in a medium containing activin A, LY294002, sodium butyrate, HGF, dexamethasone, sputum, and oncostatin M, and then cultured in a medium excluding the above-mentioned reagents. Differentiation into cells can be performed.
  • ES cells or iPS cells were cultured in the presence of ITS (insulin, transferrin, and sodium selenite), fetal bovine albumin, activin A and bFGF, then in the presence of retinoic acid, By incubating in the presence of ITS (insulin, transferrin, and sodium selenite), cochlear fetal albumin, nicotinamide, and glucagon-like peptide-1 (GLP1), differentiation into pancreatic cells can be induced.
  • ITS insulin, transferrin, and sodium selenite
  • GLP1 glucagon-like peptide-1
  • ES cells or iPS cells on a biosynthetic basement membrane (sBM) substrate according to the present invention, from ES cells or iPS cells, progenitor cells of undifferentiated endoderm, immature endoderm-derived organs. Differentiation can be induced into cells or mature cells of endoderm-derived organs. Examples of endoderm-derived organs include, but are not limited to, pancreas and liver.
  • the differentiation from ES cells to endoderm cells can be confirmed by measuring the expression level of a marker specific to endoderm.
  • the presence of a test substance is induced when differentiation is induced from ES cells or iPS cells to endoderm cells by culturing ES cells derived from mammals on a biosynthetic basement membrane (sBM) substrate.
  • ES cells or iPS cells were cultured under the condition, and when ES cells or iPS cells were cultured in the absence of the test substance, the degree of differentiation induction into endoderm cells and the ES cells were cultured in the presence of the test substance
  • a method of screening a substance that promotes or inhibits differentiation induction from ES cells or iPS cells to endoderm cells, comprising comparing the degree of differentiation induction into endoderm cells in some cases is provided.
  • a growth factor or a low molecular weight compound can be used. At this time, it is possible to measure the degree of differentiation induction into endoderm cells using the expression level of the marker expressed in the endoderm as an index.
  • Example 1 (experimental method) (1) ES cell line A mouse ES cell line SK7 having a Pdx1 promoter-inducible GFP reporter transgene was established by culturing blastocysts obtained from transgenic mice homozygous for the Pdx1 / GFP gene (Shiraki N, Yoshida T, Araki K, et al. Guided differentiation of embryonic stem cells into Pdx1-expressing regional-specific definitive endoderm. Stem Cells. 2008; 26: 874-885).
  • SK7 ES cell line is 1000 units / ml leukemia inhibitory factor (LIF; Chemicon), 15% knockout serum replacement (KSR; Gibco), 1% fetal bovine serum (FBS; Hyclone), 100 ⁇ M non-essential amino acids (NEAA; Invitrogen) , 2 mM L-glutamine (L-Gln; Invitrogen), 1 mM sodium pyruvate (Invitrogen), 50 units / ml penicillin and 50 ⁇ g / ml streptomycin (PS; Invitrogen) and 100 ⁇ M ⁇ -mercaptoethanol ( ⁇ -ME; Sigma ) Supplemented in Glasgow minimal essential medium (Invitrogen) on mouse embryo fibroblast (MEF) feeders.
  • LIF leukemia inhibitory factor
  • KSR knockout serum replacement
  • FBS Hyclone
  • NEAA non-essential amino acids
  • L-Gln L-glutamine
  • PS 50 ⁇ g / m
  • Human ES cells (KhES-1 and KhES-3) (Suemori H, Yasuchika K, Hasegawa K, et al. Efficient establishment of human embryonic stem cell lines and long-term maintenance with stable karyotype by clinical bulk passage.Biochem Biophys Res Commun 2006; 345: 926-932) was provided by Dr. N. Nakatsuji and Dr. H. Suemori (Kyoto University) and used according to the Japanese government's guidelines for human ES cells. Undifferentiated human ES cells were maintained under 3% CO 2 on the MEF feeder layer in DMEM / F12 (Sigma) supplemented with 20% KSR, L-Gln, NEAA and ⁇ -ME.
  • feeder cells were treated by treating human ES cell colonies with 0.25% trypsin and 0.1 mg / ml collagenase IV in PBS containing 20% KSR and 1 mM CaCl 2 for 5 minutes at 37 ° C.
  • the ES cell mass was dissociated into small pieces (5-20 cells) by detaching from the layers, adding medium and gently pipetting several times.
  • Recombinant human activin-A (R & D Systems), 20 ng / ml; Recombinant human bFGF (Peprotech), 50 ng / ml; Recombinant human hepatocyte growth factor (HGF, Peprotech), 10 ng / ml; Dexamethasone (Dex, Sigma), 1 ⁇ M; Recombinant human oncostatin M (OsM, Sigma), 10 ng / ml; Sodium butyrate (Na-Bu, Sigma-Aldrich), 1 mM; Y-27632 (Rock inhibitor, Wako), 10 ⁇ M; Nicotinamide (NA, Sigma-Aldrich), 10 mM; Glucagon-like peptide 1 (GLP-1, Sigma-Aldrich), 10 nM.
  • Recombinant human activin-A (R & D Systems), 20 ng / ml; Recombinant human bFGF (Peprotech), 50 ng /
  • sBM Biosynthetic Basement Membrane Culture Substrate
  • the sBM substrate was prepared on a 6-well culture insert having a PET porous membrane having a pore diameter of 3 ⁇ m (BD, # 3091).
  • Fibrous collagen matrix designated “fib” (a stiff matrix of type I collagen fibers) was first prepared on a porous membrane (Hosokawa T, Betsuyaku T, Nishimura M, et al. Differentiation of tracheal basal cells to ciliated). cells and tissue reconstruction on the synthesized basement membrane substratum in vitro. Connect Tissue Res. 2007; 48: 9-18).
  • the fibrous collagen matrix (fib) is then treated with oligo-N-acetylglucosamine (oligo-GlcNAc) ligand covalently linked to styrene-maleic anhydride hydrophobic copolymer (MAST) in DMEM medium for at least 1 day. It was applied at a concentration of 10-20 ⁇ g / ml (Mochitate, K .: Method of preparing basement membrane, method of constructing basement membrane specimen, reconstituted artificial tissue using the basement membrane specimen and process for producing the same. US Patent No. 7,399,634).
  • MAST-GlcNAc excess MAST-GlcNAc ligand (molecules temporarily adsorbed to collagen fibers or still free) was rinsed with fresh DMEM for several hours.
  • rLN-10 cells were seeded on a collagen fiber matrix (fib) coated with MAST-GlcNAc at a cell volume of 9.6 ⁇ 10 6 cells per 6-well type fib, and 1% FBS and 0.2 mM ascorbic acid- The cells were cultured in DMEM containing 2-phosphate for 2 weeks.
  • the rLN-10 cell layer was removed by treatment with D-PBS (-) solution containing 50 mM NH 4 OH, 0.1% Triton X-100, and protease inhibitor cocktail (Hosokawa T, Betsuyaku T, Nishimura M, et al. Differentiation of tracheal basal cells to ciliated cells and tissue reconstruction on the synthesized basement membrane substratum in vitro. Connect Tissue Res. 2007; 48: 9-18), reconstituted dense layer structure of human laminin-511 isoform ( lamina densa) was exposed without hurting.
  • the de novo synthesized basement membrane (sBM) culture substrate was stored frozen at ⁇ 75 ° C. until use in a state of being immersed in a storage solution.
  • ES cells were seeded in advance with M15 cells.
  • a 24-well or 6-well culture plate (Nunc) was seeded at a count of 5,000 or 20,000 cells per well, and the cells consisted of activin A (20 ng / ml) and bFGF (50 ng / ml), 10% FBS and The cells were cultured in a differentiation medium supplemented with 4,500 mg / L glucose.
  • activin A and bFGF were removed from ES cells, and HGF (10 ng / ml), Dex was removed from day 4 to day 24.
  • ES cells were treated with Activin A (20 ng / ml by day 13).
  • bFGF 50 ng / ml supplemented with medium containing 10% FBS, then cut into ITS medium, 1,000 mg / L glucose, 10 mM NA, and 10 nM GLP-1. It was replaced.
  • KhES-1 or KhES-3 cells are seeded at a cell number of 20,000 or 80,000 per well in a 24-well or 6-well culture plate previously seeded with M15 cells to form a cell layer.
  • ES cells were cultured in differentiation medium (10% KSR, 4,500 mg / L glucose, NEAA, L-Gln, penicillin and DMEM supplemented with streptomycin and 2-ME) until day 20.
  • Activin A (20 ng / ml) and LY294002 (10 ⁇ M) ⁇ were added from day 0 to day 10 of differentiation.
  • Na-Bu (1 mM), HGF (10 ng / ml), Dex (1 ⁇ M) and OsM (1 ⁇ M) were added from day 0 to day 10. The medium was changed every 2 days with fresh differentiation medium supplemented with growth factors.
  • ES cells grown on MEF were dissociated and seeded at a cell volume of 10,000 per sBM substrate.
  • ES cells were treated with ITS, fetal bovine albumin (Albumax II, 2.5 mg / ml), activin A (20 ng / ml) and bFGF (50 ng / ml) and 4,500 mg / L glucose.
  • ES cells Culture from 0 to 8 days in differentiation medium supplemented with ITS, HGF (10 ng / ml), Dex (1 ⁇ M), OsM (10 ng / ml), 10% KSR and 2,000 The medium was switched to a medium supplemented with mg / L glucose and cultured until day 24.
  • KhES-1 or KhES-3 cells were pretreated with Y-27632 (a powerful Rock inhibitor) for 12 hours. Thereafter, ES cells were dissociated using 0.25% trypsin-EDTA and seeded at a cell volume of 100,000 per sBM substrate.
  • ES cells were cultured in differentiation medium (DMEM supplemented with 10% KSR, 4,500 mg / L glucose, NEAA, L-Gln, penicillin and streptomycin and 2-ME) until day 40.
  • differentiation medium DMEM supplemented with 10% KSR, 4,500 mg / L glucose, NEAA, L-Gln, penicillin and streptomycin and 2-ME
  • Activin A (20 ng / ml) and LY294002 (10 ⁇ M) were added from day 0 to day 10 of differentiation.
  • HGF (10 ng / ml)
  • Dex (1 ⁇ M) and OsM (1 ⁇ M) were added from day 0 to day 10.
  • the medium was changed every 2 days with fresh differentiation medium supplemented with growth factors.
  • ES cells were treated with ITS, fetal bovine albumin, activin A (20 ng / ml) from day 0 to day 10.
  • bFGF 50 ng / ml
  • 1 ⁇ M retinoic acid was added from day 10 to day 13, and from day 13 to day 28, ITS,
  • the medium was switched to a medium supplemented with 10 mM NA, 10 nM GLP1, and 1,000 mg / L glucose.
  • differentiation-inducing cells on the sBM substrate up to day 15 were dissociated with 0.25% trypsin, and two-thirds of the dissociated cells were replated on fresh sBM substrate. After the subculture, the same medium as that from day 13 to day 28 was used. Ten days after passage (that is, day 25), the cultured cells were collected with 0.25% trypsin and used for analysis of differentiation.
  • Biotin-conjugated anti-E-cadherin monoclonal antibody (mAb) ECCD2 (Shirayoshi Y, Nose A, Iwasaki K, et al. N-linked oligosaccharides are not involved in the function of a cell-cell binding glycoprotein E-cadherin. Cell Struct Funct. 1986; 11: 245-252) or phycoerythrin (PE) -conjugated anti-Cxcr4 monoclonal antibody (mAb) 2B11 (BD Biosciences Pharmingen). Stained cells were analyzed with FACS Canto (BD) or collected with FACS Aria (BD). Data was recorded with the BD FACS Diva Software program (BD) and analyzed using the Flowjo program (Tree Star).
  • PCR conditions for each cycle Denaturation at 96 ° C. for 30 seconds; annealing at 60 ° C. for 2 seconds; and extension at 72 ° C. for 45 seconds;
  • RT-PCR products were separated by 5% native polyacrylamide gel electrophoresis, stained with SYBR Green I (Molecular Probes), and visualized with Gel Logic 200 I Imaging System (Kodak).
  • Real-time PCR conditions are as follows. Denaturation at 95 ° C. for 15 seconds, 60 ° C. for 60 seconds annealing and extension up to 40 cycles. The amount of each target mRNA displayed in arbitrary units was measured by the standard curve method.
  • Kidney capsule transplantation On the 25th day, the differentiated cells on the sBM substrate were lysed with 0.25% trypsin, and the collected cells were further cultured in an MPC-coated 24-well plate (Nunc) for another day. The cell concentration was 5 ⁇ 10 5 cells / well. The next day, floating cells were collected by centrifugation and suspended in a 2.1 mg / ml collagen solution at a concentration of 5 ⁇ 10 5 cells / 10 ⁇ l.
  • the collagen solution was prepared from Cellmatrix (registered trademark) Type IA collagen kit (Nitta Gelatin, Japan) according to the protocol.
  • mice 5 ⁇ 10 5 cells suspended in 10 ⁇ l of gel were injected under the kidney capsule of CB-17 / Icr-scid / scid Jcl mice (CLEA-Japan, Japan) using an insulin syringe (29G, BD). .
  • the transplanted mice were killed. Transplants were collected from kidneys, fixed with 4% PFA, and subjected to immunohistochemical analysis.
  • ES cells grown on rLN10-sBM substrate were suitable for definitive endoderm differentiation.
  • the present inventors established a co-culture method that induces mouse and human ES cells to the liver lineage using the mesoderm-derived cell line M15.
  • FIG. 1 is a schematic diagram showing that ES cells cultured on the M15 feeder cell layer can be directed to the liver and pancreas lineage depending on the culture conditions, as already reported (Non-Patent Documents 8 and 9).
  • FIG. 2A shows a schematic diagram of the experimental design.
  • the substrate was placed in a 6-well culture plate, and ES cells were seeded on the substrate.
  • M15 cells were also seeded on another culture plate and ES cells were seeded directly on M15 monolayers as previously reported.
  • activin A and bFGF were also added to ES cell cultures on rLN10-sBM substrate. Differentiation of ES cells into E-cadherin + / Cxcr4 + definitive endoderm cells was quantified by flow cytometry. When assayed on day 8, 27.6% of all ES cell cultures grown on sBM substrate were E-cadherin + / Cxcr4 + definitive endoderm cells. On the other hand, 50.9% of all ES cell cultures grown on the M15 feeder layer were definitive endoderm cells (FIG. 2B).
  • FIG. 4A The effect of the addition of sodium butyrate (FIGS. 4A, B) (FIGS. 4A, B) was tested on human ES cell lines khES-1 and khES-3 cultured on M15.
  • the expression of Alb1 transcripts detected by real-time PCR was increased by adding sodium butyrate to khES-1 and khES-3 cells (FIG. 4A).
  • the ability of sodium butyrate to differentiate into the liver was similarly detected when cultured on an rLN10-sBM substrate, and increases in the expression levels of Afp and Alb1 were confirmed by RT-PCR (FIG. 4B).
  • the ability of the sBM substrate to differentiate ES cells into the liver lineage suggests that it plays a role as a solid environment of extracellular matrix structure suitable for differentiation into definitive endoderm lineage.
  • Pdx1 / GFP expressing cells After 15 days of induction, Pdx1 / GFP expressing cells began to aggregate as a three-dimensional cell mass. On day 28, Pdx1 / GFP expression was still observed in the cell mass of differentiated cells. Pdx1 / GFP positive cells were analyzed by flow cytometry. The cell ratio was 8.12% of all ES cells on day 15 (FIG. 7). Expression of the mature pancreatic marker gene was analyzed using RT-PCR cultures (FIG. 6A). Ins1 (insulin 1) transcript expression became detectable on day 28 in ES cells cultured on sBM substrate, but not in cells grown on M15 feeders (FIG. 6A).
  • the rLN10-sBM substrate was found to help ES cells differentiate into the endocrine lineage of the pancreas containing insulin-expressing ⁇ cells. Differentiated ES cells still expressed some markers of immature endocrine pancreas.
  • Mouse iPS cells grown on the sBM culture substrate were also able to differentiate into pancreas.
  • Mouse iPS cells into which four factors (Klf4, Sox2, Oct3 / 4 and c-myc) have been introduced (Okita K, Ichisaka T, Yamanaka S. Generation of germline-competent induced pluripotent stem cells. Nature. 2007; 448: 313-317 ) was also tested to see if the sBM substrate was effective in inducing cells into the pancreatic lineage (FIG. 6C).
  • Pdx1-expressing cells could be derived from mouse iPS cells cultured on sBM substrate by day 16 and insulin-expressing cells could be induced by day 28.
  • the similar phenomenon of appearance of cells expressing Pdx1 and Ins1 from differentiating iPS cells suggests that the properties of mouse iPS cells and SK7ES cells on rLN10-sBM substrate are similar.
  • Differentiated ES cells grown for 15 days on rLN10-sBM substrate were dissociated with 0.25% trypsin, seeded again on fresh sBM substrate, and cultured until day 25.
  • the percentage of Pdx1 / GFP expressing cells increased from 8.12% on the 15th day to 13.5% on the 25th day.
  • the sBM substrate has been found to be useful for amplifying the proportion of Pdx1-expressing cells derived from mouse ES cells and iPS cells.
  • Mouse iPS cell-derived definitive endoderm cells grown on the sBM substrate were able to advance differentiation into the pancreatic lineage under the mouse kidney capsule.
  • transplantation of SCID mice under the renal capsule induces maturation of immature pancreatic primitive cells (FIG. 8).
  • FIG. 8 In order to confirm whether iPS cells differentiated on the sBM substrate were capable of differentiating into pancreatic lineages, further transplantation experiments were performed on the cells in vivo.
  • mouse iPS cells differentiated on sBM substrate for 15 days were collected, seeded again on fresh sBM substrate, and cultured for another 10 days.
  • FIG. 8 shows that insulin (Ins)-or somatostatin (SS) -positive endocrine cells, or DBA-positive duct cells are frequently found. Although amylase (Amy) positive cells were also observed, the frequency was low.
  • the sBM substrate used in the present invention is an excess of human laminin-511 secreted by recombinant human laminin-511 (laminin ⁇ 5, ⁇ 1 and ⁇ 1) in HEK293 cells and other major basement membrane components on fib coated with MAST-GlcNAc. It is constructed by accumulating in In this example, rLN10 cells were used. Using this rLN10-sBM, ES cells or iPS could be induced in the liver and pancreas strains. The efficiency of differentiation was high, and the obtained differentiated cells could be further differentiated into mature cells (endocrine, exocrine and ductal cells of the pancreas).
  • the primers are as follows.
  • hGAPDH-U CGAGATCCCTCCAAAATCAA;
  • SEQ ID NO: 45 hGAPDH-D, CATGAGTCCTTCCACGATACCAA;
  • SEQ ID NO: 46 hOct3 / 4-U, AGGTGTGGGGGATTCCCCCAT;
  • SEQ ID NO: 47 hOct3 / 4-D, GCGATGTGGCTGATCTGCTGC;
  • SEQ ID NO: 48 hFoxa2-U, GCAGATACCTCCTACTACCA;
  • SEQ ID NO: 49 hFoxa2-D, GAAGCAGGAGTCTACACAGT;
  • SEQ ID NO: 50 hPdx1-U, GGATGAAGTCTACCAAAGCTCACGC;
  • SEQ ID NO: 51 hPdx1-D, CCAGATCTTGATGTGTCTCTCGGTC;
  • SEQ ID NO: 52
  • Example 3 Induction of differentiation of human ES cells into hepatocytes on sBM The khES3 strain was seeded on sBM, and the endoderm differentiation was started by switching to the differentiation medium from the next day. The results are shown in FIG. Differentiation of Sox17-positive endoderm cells was induced by culturing in RPMI1640 medium containing Activin 100ng / ml and B27 for 10 days. From the 10th day of culture, the cells were cultured in a serum-free medium containing Dex, HGF, DMSO, and OsM, and the medium was changed every other day.
  • AFP1-positive immature hepatocytes were induced to differentiate, and on day 30, ALBUMIN-positive hepatocytes were induced. Furthermore, in an indocyanine green uptake experiment to evaluate liver function, hepatocytes that took up ICG were confirmed after 30 minutes of treatment. Moreover, the induction effect of the drug metabolizing enzyme CYP3A4 was confirmed by adding rifampicin for 2 days.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention porte sur un nouveau procédé pour induire la différenciation d'une cellule ES ou une cellule iPS, qui peut induire la différenciation d'une cellule ES ou d'une cellule iPS dans un système d'endoderme sans nécessiter l'utilisation d'une quelconque cellule de support. L'invention porte spécifiquement sur un procédé d'induction de la différenciation d'une cellule ES ou d'une cellule iPS dans une cellule pancréatique ou hépatique, qui comprend la culture d'une cellule ES ou une cellule iPS issue de mammifère sur un substrat de culture de membrane basale biosynthétique en présence d'un facteur de croissance.
PCT/JP2010/058284 2009-06-05 2010-05-17 Procédé d'induction de la différenciation cellulaire WO2010140464A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2009136520 2009-06-05
JP2009-136520 2009-06-05

Publications (1)

Publication Number Publication Date
WO2010140464A1 true WO2010140464A1 (fr) 2010-12-09

Family

ID=43297601

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/058284 WO2010140464A1 (fr) 2009-06-05 2010-05-17 Procédé d'induction de la différenciation cellulaire

Country Status (2)

Country Link
JP (1) JP2011010653A (fr)
WO (1) WO2010140464A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012105505A1 (fr) * 2011-01-31 2012-08-09 独立行政法人国立国際医療研究センター Cellules hépatiques hautement fonctionnelles issues de cellules souches pluripotentes, leur procédé de production et procédé de test du métabolisme/de la toxicité d'un médicament
WO2015080297A1 (fr) 2013-11-27 2015-06-04 Kyoto Prefectural Public University Corporation Application de laminine à une culture de cellules endothéliales de la cornée
US9617517B2 (en) 2011-05-02 2017-04-11 National University Corporation Kumamoto University Small chemical compound which promotes induction of differentiation of stem cells into insulin-producing cells and method for inducing differentiation of stem cells into insulin-producing cells using said small chemical compound
EP3147354A4 (fr) * 2014-05-23 2017-11-22 The University of Tokyo Procede pour la production de cellule mesotheliale, et feuille cellulaire pour la prevention de concrescence
US11959103B2 (en) 2016-11-11 2024-04-16 Osaka University Method for inducing pluripotent stem cells to differentiate into somatic cells

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9404086B2 (en) * 2014-03-26 2016-08-02 Ge Healthcare Uk Limited Method for cell differentiation
SI3059307T2 (sl) * 2015-02-20 2022-08-31 Inserm(Institut National De La Sante Et De La Recherche Medicale) Uporaba laminina za diferenciacijo pluripotentnih celic v hepatocite

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002064748A2 (fr) * 2001-02-14 2002-08-22 Furcht Leo T Cellules souches adultes totipotentes, sources de ces cellules, procedes d'obtention et de maintien de ces dernieres, procedes de differentiation de ces cellules, procedes d'utilisation correspondants et cellules derivees des cellules susmentionnees
JP2003093050A (ja) * 2001-09-25 2003-04-02 Japan Science & Technology Corp 基底膜の調製方法
WO2006020919A2 (fr) * 2004-08-13 2006-02-23 University Of Georgia Research Foundation, Inc. Compositions et procedes d'auto-renouvellement et de differentiation dans des cellules souches embryonnaires humaines
WO2006108361A1 (fr) * 2005-04-15 2006-10-19 Peking University Procede d'induction de cellules souches embryonnaires en cellules pancreatiques
WO2006126574A1 (fr) * 2005-05-24 2006-11-30 Kumamoto University Procede d’induction de differenciation de cellule es
WO2007103282A2 (fr) * 2006-03-02 2007-09-13 Cythera, Inc. Cellules precurseurs endocrines, cellules exprimant des hormones pancreatiques et procedes de productions associes

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002064748A2 (fr) * 2001-02-14 2002-08-22 Furcht Leo T Cellules souches adultes totipotentes, sources de ces cellules, procedes d'obtention et de maintien de ces dernieres, procedes de differentiation de ces cellules, procedes d'utilisation correspondants et cellules derivees des cellules susmentionnees
JP2003093050A (ja) * 2001-09-25 2003-04-02 Japan Science & Technology Corp 基底膜の調製方法
WO2006020919A2 (fr) * 2004-08-13 2006-02-23 University Of Georgia Research Foundation, Inc. Compositions et procedes d'auto-renouvellement et de differentiation dans des cellules souches embryonnaires humaines
WO2006108361A1 (fr) * 2005-04-15 2006-10-19 Peking University Procede d'induction de cellules souches embryonnaires en cellules pancreatiques
WO2006126574A1 (fr) * 2005-05-24 2006-11-30 Kumamoto University Procede d’induction de differenciation de cellule es
WO2007103282A2 (fr) * 2006-03-02 2007-09-13 Cythera, Inc. Cellules precurseurs endocrines, cellules exprimant des hormones pancreatiques et procedes de productions associes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
EIHACHIRO KAWASE ET AL.: "Heisei 20 Nendo Chukan Nenpo Model Saibo o Mochiita Idenshi Kino To Kaiseki Gijutsu Kaihatsu (Kenkyu-yo Model Saibo no Sosei Gijutsu Kaihatsu) Kenkyu-yo Model Saibo no Sosei Gijutsu Kaihatsu", NEW ENERGY AND INDUSTRIAL TECHNOLOGY DEVELOPMENT ORGANIZATION (NEDO), KANAGAWA-KEN KAWASAKI-SHI, JAPAN, 15 May 2009 (2009-05-15), pages 6 - 8, Retrieved from the Internet <URL:https://app5.infoc.nedo.go.jp/disclosure/Search> [retrieved on 20100720] *
KATSUMI MOCHITATE: "Heisei 20 Nendo Chukan Nenpo Model Saibo o Mochiita Idenshi Kino To Kaiseki Gijutsu Kaihatsu (Kenkyu-yo Model Saibo no Sosei Gijutsu Kaihatsu) Giji Kiteimaku o Riyo shita ES Saibo no Bunka Yudo Seigyo Gijutsu no Kaihatsu", NEDO SEIKA HOKOKUSHO DATABASE. NEW ENERGY AND INDUSTRIAL TECHNOLOGY DEVELOPMENT ORGANIZATION (NEDO), 15 May 2009 (2009-05-15), pages 1, Retrieved from the Internet <URL:https://app5.infoc.nedo.go.jp/disclosure/Search> [retrieved on 20100720] *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012105505A1 (fr) * 2011-01-31 2012-08-09 独立行政法人国立国際医療研究センター Cellules hépatiques hautement fonctionnelles issues de cellules souches pluripotentes, leur procédé de production et procédé de test du métabolisme/de la toxicité d'un médicament
US9617517B2 (en) 2011-05-02 2017-04-11 National University Corporation Kumamoto University Small chemical compound which promotes induction of differentiation of stem cells into insulin-producing cells and method for inducing differentiation of stem cells into insulin-producing cells using said small chemical compound
WO2015080297A1 (fr) 2013-11-27 2015-06-04 Kyoto Prefectural Public University Corporation Application de laminine à une culture de cellules endothéliales de la cornée
EP3147354A4 (fr) * 2014-05-23 2017-11-22 The University of Tokyo Procede pour la production de cellule mesotheliale, et feuille cellulaire pour la prevention de concrescence
US11959103B2 (en) 2016-11-11 2024-04-16 Osaka University Method for inducing pluripotent stem cells to differentiate into somatic cells

Also Published As

Publication number Publication date
JP2011010653A (ja) 2011-01-20

Similar Documents

Publication Publication Date Title
AU2014248167B2 (en) Methods and compositions for culturing endoderm progenitor cells in suspension
Higuchi et al. Synthesized basement membranes direct the differentiation of mouse embryonic stem cells into pancreatic lineages
Bajpai et al. Functional vascular smooth muscle cells derived from human induced pluripotent stem cells via mesenchymal stem cell intermediates
JP5938726B2 (ja) 多能性幹細胞の分化誘導効率を改善するための方法及び培地
WO2010140464A1 (fr) Procédé d&#39;induction de la différenciation cellulaire
JP2018198620A (ja) 膵臓前駆細胞及び機能的β細胞をｈＰＳＣから生成するための方法及び組成物
EP3239294A1 (fr) Cellules primitives d&#39;endoderme d&#39;intestin et leur procédé de production
US20230227788A1 (en) Isolation of bona fide pancreatic progenitor cells
KR20170031254A (ko) 췌장 전구 세포의 증식 방법
WO2011009294A1 (fr) Procédés pour obtenir des cellules hépatiques, des cellules d’endoderme hépatiques et des cellules précurseurs hépatiques en induisant la différenciation
US9796962B2 (en) Method for generating pancreatic hormone-producing cells
CN111394298A (zh) 使用hb9调节子使人胚胎干细胞分化为胰腺内分泌细胞的方法
JP2008514214A (ja) ヒト胚盤胞由来幹細胞（ｈＢＳ）から肝細胞様細胞を発生させる方法
EP2737057B1 (fr) Nouveaux marqueurs pour des cellules progénitrices de neurone dopaminergique
JPWO2008149807A1 (ja) Ｅｓ細胞の分化誘導方法
AU2017205801A1 (en) Method for producing hepatic stem/precursor cells from mature hepatic cells using low-molecular-weight compound
EP3801577A1 (fr) Procédés et compositions comprenant des inhibiteurs de tankyrase pour produire des cellules produisant de l&#39;insuline
JP2011115161A (ja) 細胞の分化誘導方法
JP2020115771A (ja) 多能性幹細胞から軟骨組織を製造する方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10783248

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10783248

Country of ref document: EP

Kind code of ref document: A1