WO2010140464A1 - Method for induction of cell differentiation - Google Patents

Abstract

Disclosed is a novel method for inducing the differentiation of an ES cell or an iPS cell, which can induce the differentiation of an ES cell or an iPS cell into an endoderm system without requiring the use of any supporting cell. Specifically disclosed is a method for inducing the differentiation of an ES cell or an iPS cell into a pancreatic or hepatic cell, which comprises culturing a mammal-derived ES cell or iPS cell on a biosynthetic basal membrane culture substrate in the presence of a growth factor.

Description

Cell differentiation induction method

The present invention relates to a method for inducing differentiation of ES cells and iPS cells. More specifically, the present invention relates to a method for inducing differentiation of ES cells or iPS cells into endoderm using a biosynthetic basement membrane culture substrate without using supporting cells.

Embryonic stem (ES) cells are pluripotent stem cells derived from the inner cell mass of blastocysts. In in vitro methods, embryoid bodies are formed to mimic the inducible microenvironment necessary for liver regeneration (Non-Patent Documents 1 and 2), or treatment with specific growth factors and cytokines essential for hepatocyte differentiation is performed. (Non-Patent Document 3). It has been shown that when ES cells are cultured together with embryonic mesenchymal cells, ES cells go to the liver lineage (Non-Patent Documents 4 to 6). Production of ES cell-derived hepatocytes in vitro has been reported using BMP4 (Non-patent Document 7).

The present inventors have developed a method using feeder cells, and established a high-efficiency differentiation induction technique from ES cells to embryonic endoderm respiratory and digestive organs by planar culture ( Patent Documents 1 and 2, and Non-patent document 8). By using the M15 cell protocol, ES cells are transformed into mesendoderm, definitive endoderm, and final region-specific definitive endoderm-derived organs in vitro in a manner similar to early embryonic induction in vivo. They are guided in order (Non-Patent Document 9). The M15 feeder is also a useful tool for creating strain-specific cell types derived from ES cells belonging to three germ layers (ie, neuroectodermal, mesoderm, and definitive endoderm) (Non-patent Document 10). . Differentiated ES cells undergo FGF stimulation of the ERK signaling cascade and switch from self-renewal to lineage restriction. Activin and / or p38pMAPK then induce branching into the mesendoderm lineage. Later, activin induces mesendoderm branching into the definitive endoderm. After establishment of definitive endoderm, region specification to hepatocytes or pancreatic cells can be manipulated by modifying the culture conditions.

It has also been shown in culture transfilter assays that only this final stage of differentiation into region-specific definitive endoderm requires direct contact with M15 cells (Non-patent Document 9). Even the M15 cell layer fixed with aldehyde has been shown to retain the ability to induce pancreatic differentiation (Non-Patent Document 9), so the role of the extracellular matrix (basement membrane component) deposited around the M15 cell layer Was thought to play a role in guiding the differentiation of definitive endoderm into region-specific strains. However, these methods are methods using living support cells, and it is desirable to develop a method using a cell-free system in consideration of future application to humans.

On the other hand, establishing an alternative culture model that does not use feeder cells is very useful for molecular analysis of liver differentiation. Previously, the present inventors have formed a basement membrane structure directly under a cell by co-culturing immortalized type 2 alveolar epithelial (SV40-T2) cells together with Matrigel in vitro (Non-Patent Document). 11) And after that, only the SV40-T2 cells are removed by mild treatment with a surfactant and an alkaline solution, and the basement membrane structure formed immediately under the cells is exposed without damaging it. A method for preparing a culture substrate (sBM substratum: synthesized Basement Membrane substratum) has been reported, and further, when tracheal epithelial basal cells are cultured on this basement membrane culture substrate, terminal differentiation into ciliated cells has been reported (non-patent literature). 12).

WO2006 / 126574, WO2008 / 149807

The present invention solves the problem of providing a novel ES cell or iPS cell differentiation induction method that enables differentiation induction of ES cells or iPS cells into an endoderm system without using feeder cells. It was a problem to be solved.

As a result of intensive studies to solve the above problems, the present inventors have cultured ES cells or iPS cells on a biosynthetic basement membrane culture substrate to differentiate into an endoderm system without using supporting cells. I found that it can be guided. That is, in the present invention, the ES cells are induced to differentiate efficiently and selectively into the liver system or pancreatic system by modifying the medium using a biosynthetic basement membrane culture substrate (sBM (culture) substrate). I was able to. Similarly, iPS cells could also be induced into pancreatic cells using the same plutocol as ES cells by culturing on sBM substrate. The present invention has been completed based on these findings.

That is, according to the present invention, the following inventions are provided.
(1) Inducing differentiation from ES cells or iPS cells into pancreatic or liver cells, including culturing mammalian-derived ES cells or iPS cells in the presence of growth factors on a biosynthetic basement membrane culture substrate Method.
(2) The method according to (1), wherein the biosynthetic basement membrane culture substrate is a biosynthetic basement membrane culture substrate prepared by culturing cells having a basement membrane-forming ability on a support.
(3) The biosynthetic basement membrane culture substrate is a biosynthetic basement membrane culture substrate prepared by culturing cells having the ability to form a basement membrane on a support provided with a sugar chain (1) or (2 ) Method.
(4) Any one of (1) to (3), wherein the sugar chain is a sugar chain having a β-D-glucopyranose non-reducing end or a 2-acetamido-2-deoxy-β-D-glucopyranose non-reducing end The method described in 1.

(5) The method according to any one of (1) to (4), wherein the biosynthetic basement membrane culture substrate comprises a human laminin-511 isoform basement membrane dense layer structure (lamina densa).
(6) Applying a sugar chain covalently bonded to a hydrophobic copolymer to a collagen support, and then seeding and culturing cells having the ability to form a basement membrane to culture a basement membrane that is biosynthesized The method according to any one of (1) to (5), wherein the method is used as a quality.
(7) The method according to any one of (2) to (6), wherein the cell having the ability to form a basement membrane is a cell overexpressing recombinant laminin-511 (laminin α5, β1 and γ1).
(8) The method according to any one of (1) to (7), wherein the mammal-derived ES cell or iPS cell is a mouse or human-derived ES cell or iPS cell.

(9) A mouse-derived ES cell or iPS cell is cultured on a biosynthetic basement membrane culture substrate in the presence of ITS (insulin, transferrin, and sodium selenite), fetal bovine albumin, activin A, and bFGF. Next, differentiation is induced into hepatic cells by culturing in the presence of ITS (insulin, transferrin, and sodium selenite), HGF (hepatocyte growth factor), dexamethasone, and oncostatin M. The method according to any one of (1) to (8).
(10) Human-derived ES cells or iPS cells on a biosynthetic basement membrane culture substrate, activin A, LY294002 (phosphatidylinositol 3 kinase (PI 3-kinase) inhibitor), sodium butyrate, HGF, dexamethasone, and onco The method according to any one of (1) to (9), wherein the differentiation induction into liver cells is performed by culturing in a medium containing statin M and then culturing in a medium excluding the reagent.

(11) ES cells or iPS cells on biosynthetic basement membrane culture substrates, ITS (insulin, transferrin, and sodium selenite), fetal bovine albumin, activin A and bFGF (basic fibroblast growth factor / basic fibroblasts) Cultured in the presence of cell growth factor), then in the presence of retinoic acid, and then in the presence of ITS (insulin, transferrin and sodium selenite), nicotinamide, glucagon-like peptide-1 (GLP1) The method according to any one of (1) to (10), wherein differentiation induction into pancreatic cells is performed by culturing the cells.
(12) Inducing differentiation from an ES cell or iPS cell into an undifferentiated progenitor cell of the pancreas or liver system, an immature cell of the pancreas or liver system, or a mature cell of the pancreas or liver system, The method according to any one of (1) to (11).

(13) A pancreatic or liver cell obtained by differentiation from ES cells or iPS cells, obtained by the method according to any one of (1) to (12).
(14) When differentiation induction from ES cells or iPS cells into pancreatic or liver cells by the method according to any one of (1) to (12), ES cells or iPS cells are performed in the presence of a test substance. When the ES cells or iPS cells are cultured in the absence of the test substance, the degree of differentiation induction into pancreatic or liver cells and when the ES cells or iPS cells are cultured in the presence of the test substance A method for screening a substance that promotes or inhibits differentiation induction from ES cells or iPS cells into pancreatic or liver cells, comprising comparing the degree of differentiation induction into pancreatic or liver cells.
(15) The screening method according to (14), wherein the test substance is a growth factor or a low molecular compound.
(16) The screening method according to (14) or (15), wherein the degree of differentiation induction into pancreatic or liver cells is measured using the expression level of a marker expressed in pancreatic or liver cells as an index.

ES cells and iPS cells are characterized in that they can proliferate indefinitely and have pluripotency capable of differentiating into any cell tissue. Although the development of differentiation from ES cells into hepatocytes and pancreatic cells has been developed worldwide, no cell that has sufficient function and can be recognized as a mature hepatic pancreatic cell has yet to be obtained. In the present invention, a technique for controlling differentiation induction into liver cells and pancreatic cells was successfully established by a method not using feeder cells (supporting cells). The method of the present invention is useful for the creation of model cells that can be applied to basic research of drug discovery such as safety evaluation of new drugs, and the creation of transplanted cell sources for regenerative medicine, and in particular, ES cells and iPS cells by the method of the present invention. The method of inducing differentiation into mature hepatocytes and mature pancreatic cells is useful in the fields of drug discovery and regenerative medicine.

FIG. 1 is a schematic diagram of differentiation of ES cells into liver or pancreatic lineages on the M15 feeder cell layer. M15 cells have the ability to differentiate ES cells into both pancreas and liver depending on the culture conditions. FIG. 2 shows that ES cells cultured with human laminin-511 (hLN-511) isoform-sBM substrate can differentiate into definitive endoderm cells without a feeder. A) Schematic diagram of differentiation experiment. B) ES cells differentiated with sBM substrate or M15 feeder layer were analyzed by flow cytometry. Definitive endoderm cells (E-cadherin + / Cxcr4 +) expressing the differentiation markers E-cadherin and Cxcr4 were 27% in the culture on the sBM substrate, 50.9% in the culture on the ＥＳM15 feeder cell layer, ES Appeared on day 8 of cell culture. C) Real-time PCR analysis confirmed that Foxa2 (definitive endoderm marker) expression was induced in ES cells grown on the sBM substrate and M15 feeder layer. ES cells differentiated with sBM substrate for 14 days showed almost the same expression level of Foxa2 as cells grown on M15 for 8 days. Foxa2 expression was normalized using β-actin. ES cells were differentiated under the culture conditions for pancreatic differentiation described in the experimental method. FIG. 3 shows that Afp and Alb1 expression is induced in 24 day ES cells cultured on sBM substrate. ES cells grown in sBM were differentiated under culture conditions for liver differentiation, and expression of Afp and Alb1 was measured by real-time RT-PCR. Gene expression was normalized using β-actin. ES cells cultured on SBM substrate had higher Afp expression but lower Alb1 expression than ES cells grown on the M15 feeder cell layer. FIG. 4 shows the differentiation of khES-1 and khES-3 cells into liver lineages on sBM substrate. A) Differentiation of khES-1 and khES-3 cells into the liver lineage in the M15 cell layer was promoted with sodium butyrate. The addition of sodium butyrate increased the expression level of the Alb1 transcript on the 20th day. B) Differentiation on sBM was similarly promoted by sodium butyrate. With the addition of sodium butyrate, the expression level of Afp and Alb1 transcripts increased on the 40th day. FIG. 5 shows SK7 ES cells differentiated into Pdx1 / GFP expressing cells on the sBM substrate. SK7 ES cell line was seeded directly on sBM substrate. Pdx1 / GFP expression became detectable on day 10 and then gradually increased and reached a maximum on day 15. From day 15 onwards, Pdx1 / GFP-expressing cells started to form densely clustered three-dimensionally. On day 28, strong Pdx1 / GFP expression was observed in the differentiated cell mass (cluster). FIG. 6 shows the expression of a mature pancreatic marker gene in differentiating ES cells that form cell clusters (having clusters). A) Expression of mature pancreatic endocrine and exocrine markers. Lane: RNA extracted from E13.5 fetal placental tissue was used as a positive control. M15: ES cells differentiated on the M15 feeder. DE d8: Definitive endoderm cells expressing E-cadherin / CXCR4 on day 8 d28: Total ES cells differentiated on day 28. sBM: ES cells differentiated on sBM substrate; d10, d15 and d28: total ES cells in the indicated number of days during differentiation culture. The amount of cDNA was normalized using the expression level of β-actin. Results showed that insulin 1 transcripts were detected on day 28 in ES cells cultured on sBM but not on ES cells on M15 feeder. Pdx1, Pancreatic duodenum homeodomein 1; Ins1, insulin1; Gcg, glucagon; Sst, somatostatin; Ptf1a, pancreas specific transcription factor 1a; Amy, amylase.B) ) And expression of mature (Isl1, Glut2, IAPP) β cell markers. NeuroD1, neurogenic differentiation 1; Nkx2-2, NK2 transcription factor related locus 2; Nkx6-1, NK6 homeobox 1; Pax4, paired box gene 4; Pax6, paired box gene 6; Isl1, ISL1 Porter type 2; IAPP, islet amyloid polypeptide.C) The expression of Pdx1 and insulin 1 transcripts was analyzed by RT-PCR. Un iPS, undifferentiated iPS cells; 培養 d16, d20 and d28, 培養 sBM substrate differentiation period. FIG. 7 shows an increase in pancreatic primitive cells expressing Pdx1. A) Images of Pdx1 / GFP expressing cells before and after passage are shown. B) The cell ratio of Pdx1 / GFP expressing cells before and after passage is shown. The percentage of differentiated cells from 4 separate samples in each culture was measured by flow cytometry. FIG. 8 shows the progression of in vivo differentiation of mouse iPS cells differentiated on sBM substrate. Mouse iPS cells were passaged twice on sBM substrate for 25 days to induce differentiation into the pancreatic lineage, and then collected and transplanted into the kidney capsule of SCID mice. After in vivo differentiation in transplanted tissues, transplants collected from iPS cell-derived cells cultured on sBM were analyzed. Frozen sections of the implants were stained with antibodies against mature pancreatic markers (magenta) and counterstained with DAPI (blue). Ins, anti-insulin staining; SS, anti-somatostatin; Amy, anti-amylase staining, DBA, Dolichos biflorus agglutinin. FIG. 9 shows the differentiation of human iPS cells using sBM substrate. Using sBM, human iPS cells cultured for 8 days (d8), 20 days (d20) and 30 days (d30) were subjected to gene expression analysis by RT-PCR. FIG. 10 shows differentiation induction of human ES cells into hepatocytes on the sBM substrate. The khES3 strain was seeded on sBM, and the endoderm differentiation was started by switching to the differentiation medium from the next day.

Hereinafter, embodiments of the present invention will be described in more detail.
In the present invention, by using a biosynthetic basement membrane culture substrate, differentiation of embryonic endoderm, albumin-positive hepatocytes, Pdx1-positive pancreatic progenitor cells, or insulin-positive pancreatic β cells can be induced from ES cells or iPS cells. it can. In the conventional method, differentiation from ES cells to the liver or pancreas has been induced by a method using M15 cells, which are feeder cells. However, according to the present invention, differentiation can be induced without using feeder cells (support cells). It became possible. Furthermore, the method of the present invention was useful for maturation of pancreatic progenitor cells. When cells are cultured on a collagen matrix, the cells secrete “extracellular matrix” extracellularly. The secreted extracellular matrix varies depending on the cell type, and various growth growth factors are captured by these extracellular matrixes, creating a solid phase environment that is very suitable for cell differentiation. After creating such an environment, the biosynthetic basement membrane culture substrate is obtained by treating cells with a surfactant and an alkaline solution, and then excluding cell debris and exposing the basement membrane.

The present invention is a method for inducing differentiation of ES cells or iPS cells into pancreatic or liver cells, wherein the mammal-derived ES cells or iPS cells are cultured on a biosynthetic basement membrane culture substrate in the presence of a growth factor. It is a method characterized by culturing.

In the differentiation induction method of the present invention, it is possible to induce differentiation of digestive organ cells derived from endoderm such as liver or pancreas from ES cells or iPS cells on a biosynthetic basement membrane culture substrate without using supporting cells. . Inducing differentiation of hepatocytes or pancreatic cells without using feeder cells has never been reported so far and has been achieved for the first time by the present invention. In the present invention, ES cells or iPS cells are easily induced to differentiate by being cultured on a biosynthetic basement membrane culture substrate. Therefore, when a specific growth growth factor is added, differentiation induction is further promoted. Therefore, the method of the present invention can also be used as a screening for unknown differentiation-inducing factors.

The ES sputum cell used in the present invention is not particularly limited as long as it is a mammal-derived ES cell, and for example, mouse, monkey or human-derived ES cells can be used. As the ES cell, for example, a cell having a reporter gene introduced in the vicinity of the Pdx1 gene can be used in order to facilitate confirmation of the degree of differentiation. For example, a 129 / Sv-derived ES cell line R1, J1 incorporating the lacZ gene at the Pdx1 locus, or an ES cell SK7 line having a GFP reporter transgene under the control of the Pdx1 promoter can be used. Alternatively, an ES cell PH3 strain having an mRFP1 reporter transgene under the control of a Hnf3β endoderm-specific enhancer fragment and a GFP reporter transgene under the control of a Pdx1 promoter can also be used.

Mammal-derived ES cells can be cultured by conventional methods. For example, in the presence of mitomycin C-treated mouse embryo fibroblasts (MEF) as feeder cells, leukemia inhibitory factor (LIF, ESGRO 1000 Dulbecco's modified Eagle's medium (DMEM, Sigma) supplemented with differentiation medium (10% fetal bovine serum (FBS), 0.1 mM 2-mercaptoethanol, 100 μM non-essential amino acids, 2 mM L-glutamine, unit / ml, Chemicon) )) Can be maintained.

IPS cells (induced pluripotent stem cells) are pluripotent cells obtained by reprogramming somatic cells. Artificial pluripotent stem cells are produced by a group of Professor Shinya Yamanaka at Kyoto University, a group of RudolfudoJaenisch et al. At Massachusetts Institute of Technology, a group of James Thomson et al. At University of Wisconsin, Harvard University Several groups have been successful, including the group by Konrad Hochedlinger et al. Artificial pluripotent stem cells are highly expected as ideal pluripotent cells without rejection and ethical problems. For example, International Publication No. WO2007 / 069666 discloses somatic cell nuclear reprogramming factors including Oct family gene, Klf family gene, and Myc family gene gene product, as well as Oct family gene, Klf family gene, Sox family gene and A somatic cell nuclear reprogramming factor containing a gene product of a Myc family gene is described, and further, a pluripotent stem cell induced by somatic cell nuclear reprogramming, comprising a step of contacting the nuclear reprogramming factor with the somatic cell. A method of manufacturing is described.

IPS cells used in the present invention can be produced by reprogramming somatic cells. The type of somatic cell used here is not particularly limited, and any somatic cell can be used. That is, the somatic cell referred to in the present invention includes all cells other than the internal germ cells of the cells constituting the living body, and may be a differentiated somatic cell or an undifferentiated stem cell. The origin of the somatic cell may be any of mammals, birds, fishes, reptiles and amphibians, but is not particularly limited, but is preferably a mammal (for example, a rodent such as a mouse or a primate such as a human). A mouse or a human is preferable. In addition, when human somatic cells are used, any fetal, neonatal or adult somatic cells may be used.

The iPS cells referred to in the present invention have a self-replicating ability over a long period of time under predetermined culture conditions (for example, conditions under which ES cells are cultured), and are also ectoderm, mesoderm and endoderm under predetermined differentiation-inducing conditions. This refers to stem cells that have pluripotency. The induced pluripotent stem cell in the present invention may be a stem cell capable of forming a teratoma when transplanted to a test animal such as a mouse.

In order to produce iPS cells from somatic cells, first, at least one reprogramming gene is introduced into the somatic cells. The reprogramming gene is a gene encoding a reprogramming factor that has the action of reprogramming somatic cells into iPS cells. Specific examples of the combination of reprogramming genes include the following combinations, but are not limited thereto.
(I) Oct gene, Klf gene, Sox gene, Myc gene (ii) Oct gene, Sox gene, NANOG gene, LIN28 gene (iii) Oct gene, Klf gene, Sox gene, Myc gene, hTERT gene, SV40 large T gene (Iv) Oct gene, Klf gene, Sox gene

In the present invention, ES cells or iPS cells are cultured on a biosynthetic basement membrane (sBM) substrate. The biosynthetic basement membrane (sBM) substrate used in the present invention is not particularly limited as long as it can induce differentiation of ES cells or iPS cells into endoderm cells. As specific examples of biosynthetic basement membrane (sBM) substrates, Patent No. 37553532 (basement membrane preparation method), Patent No. 3829193 (basement membrane preparation or artificial tissue), Patent No. 4023597 (basement membrane preparation) And remanufactured artificial tissue used and its production method), and those produced by the method described in JP-A-2003-093053 (method for producing a basement membrane preparation). All the contents described in the above patent publications are incorporated herein by reference.

For example, Japanese Patent No. 3785532 discloses a β-D-glucopyranose non-reducing end or a β-D-glucopyranose non-reducing end capable of localizing a receptor having an action of accumulating basement membrane components on the basal plane of a cell having basement membrane-forming ability. A method for preparing a basement membrane comprising culturing cells having a basement membrane-forming ability on a support having a sugar chain having a 2-acetamido-2-deoxy-β-D-glucopyranose non-reducing end The basement membrane described and produced by the preparation method can be used in the present invention.

The method of culturing mammalian-derived ES cells or iPS cells on a biosynthetic basement membrane (sBM) substrate is not particularly limited. For example, undifferentiated ES cells or iPS cells are dissociated with trypsin, seeded on a biosynthetic basement membrane (sBM) substrate, and grown in a differentiation medium. Hereinafter, by culturing for several days, differentiation can be induced into endoderm cells such as liver cells and pancreatic cells.

In the differentiation induction method of the present invention, when culturing ES cells or iPS cells on a biosynthetic basement membrane (sBM) substrate, growth factors are added and cultured. For example, mouse-derived ES cells or iPS cells are cultured in the presence of ITS (insulin, transferrin, and sodium selenite), cochlear fetal albumin, activin A and bFGF, and then ITS (insulin, transferrin, and Differentiation into hepatic cells can be induced by culturing in the presence of sodium selenite), HGF, dexamethasone,, and Oncostatin M. Alternatively, human-derived ES cells or iPS cells are cultured in a medium containing activin A, LY294002, sodium butyrate, HGF, dexamethasone, sputum, and oncostatin M, and then cultured in a medium excluding the above-mentioned reagents. Differentiation into cells can be performed. Also, ES cells or iPS cells were cultured in the presence of ITS (insulin, transferrin, and sodium selenite), fetal bovine albumin, activin A and bFGF, then in the presence of retinoic acid, By incubating in the presence of ITS (insulin, transferrin, and sodium selenite), cochlear fetal albumin, nicotinamide, and glucagon-like peptide-1 (GLP1), differentiation into pancreatic cells can be induced.

According to the method for inducing differentiation of ES cells or iPS cells on a biosynthetic basement membrane (sBM) substrate according to the present invention, from ES cells or iPS cells, progenitor cells of undifferentiated endoderm, immature endoderm-derived organs. Differentiation can be induced into cells or mature cells of endoderm-derived organs. Examples of endoderm-derived organs include, but are not limited to, pancreas and liver. The differentiation from ES cells to endoderm cells can be confirmed by measuring the expression level of a marker specific to endoderm.

Furthermore, according to the present invention, the presence of a test substance is induced when differentiation is induced from ES cells or iPS cells to endoderm cells by culturing ES cells derived from mammals on a biosynthetic basement membrane (sBM) substrate. ES cells or iPS cells were cultured under the condition, and when ES cells or iPS cells were cultured in the absence of the test substance, the degree of differentiation induction into endoderm cells and the ES cells were cultured in the presence of the test substance A method of screening a substance that promotes or inhibits differentiation induction from ES cells or iPS cells to endoderm cells, comprising comparing the degree of differentiation induction into endoderm cells in some cases is provided. As a test substance, a growth factor or a low molecular weight compound can be used. At this time, it is possible to measure the degree of differentiation induction into endoderm cells using the expression level of the marker expressed in the endoderm as an index.

The following examples further illustrate the present invention, but the present invention is not limited to the examples.

Example 1
(experimental method)
(1) ES cell line A mouse ES cell line SK7 having a Pdx1 promoter-inducible GFP reporter transgene was established by culturing blastocysts obtained from transgenic mice homozygous for the Pdx1 / GFP gene (Shiraki N, Yoshida T, Araki K, et al. Guided differentiation of embryonic stem cells into Pdx1-expressing regional-specific definitive endoderm. Stem Cells. 2008; 26: 874-885). SK7 ES cell line is 1000 units / ml leukemia inhibitory factor (LIF; Chemicon), 15% knockout serum replacement (KSR; Gibco), 1% fetal bovine serum (FBS; Hyclone), 100 μM non-essential amino acids (NEAA; Invitrogen) , 2 mM L-glutamine (L-Gln; Invitrogen), 1 mM sodium pyruvate (Invitrogen), 50 units / ml penicillin and 50 μg / ml streptomycin (PS; Invitrogen) and 100 μM β-mercaptoethanol (β-ME; Sigma ) Supplemented in Glasgow minimal essential medium (Invitrogen) on mouse embryo fibroblast (MEF) feeders.

Human ES cells (KhES-1 and KhES-3) (Suemori H, Yasuchika K, Hasegawa K, et al. Efficient establishment of human embryonic stem cell lines and long-term maintenance with stable karyotype by clinical bulk passage.Biochem Biophys Res Commun 2006; 345: 926-932) was provided by Dr. N. Nakatsuji and Dr. H. Suemori (Kyoto University) and used according to the Japanese government's guidelines for human ES cells. Undifferentiated human ES cells were maintained under 3% CO ₂ on the MEF feeder layer in DMEM / F12 (Sigma) supplemented with 20% KSR, L-Gln, NEAA and β-ME. To pass human ES cells, feeder cells were treated by treating human ES cell colonies with 0.25% trypsin and 0.1 mg / ml collagenase IV in PBS containing 20% KSR and 1 mM CaCl ₂ for 5 minutes at 37 ° C. The ES cell mass was dissociated into small pieces (5-20 cells) by detaching from the layers, adding medium and gently pipetting several times.

293 cell-derived recombinant human laminin-511 (rLN-10) was provided by Masayuki Doi and Karl Tryggvason of Karolinska Institute (Sweden) (Doi M, Thyboll J, Kortesmaa J, et al. Recombinant 1α ): Production, purification, ificationand migration-promoting activity on vascular endothelial cells. J. Biol. Chem. 2002; 277: 12741-12748).

(2) Supporting cells Midrenal cell line M15 (Larsson SH, Charlieu JP, Miyagawa K, et al. Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell. 1995; 81: 391-401) , Dr. T. Nose (Mitsubishi Chemical Life Science Institute, Tokyo, Japan) and Dr. M. Rassoulzadegan (University of Nice-Sophia Antipolis, Antipolis, France), and 10 μg / ml mitomycin C before use. And cultured for 2.5 hours (Non-Patent Documents 8 to 10). M15 was seeded in gelatin-coated 6-well or 24-well plates at a concentration of 8 × 10 ⁵ cells or 2 × 10 ⁵ cells per well.

(3) Growth factors and inhibitors Reagents were purchased and used at the following concentrations.
Recombinant human activin-A (R & D Systems), 20 ng / ml;
Recombinant human bFGF (Peprotech), 50 ng / ml;
Recombinant human hepatocyte growth factor (HGF, Peprotech), 10 ng / ml;
Dexamethasone (Dex, Sigma), 1 μM;
Recombinant human oncostatin M (OsM, Sigma), 10 ng / ml;
Sodium butyrate (Na-Bu, Sigma-Aldrich), 1 mM;
Y-27632 (Rock inhibitor, Wako), 10μM;
Nicotinamide (NA, Sigma-Aldrich), 10 mM;
Glucagon-like peptide 1 (GLP-1, Sigma-Aldrich), 10 nM.

(4) Preparation of Biosynthetic Basement Membrane (sBM) Culture Substrate The sBM substrate was prepared on a 6-well culture insert having a PET porous membrane having a pore diameter of 3 μm (BD, # 3091). Fibrous collagen matrix (designated “fib”) (a stiff matrix of type I collagen fibers) was first prepared on a porous membrane (Hosokawa T, Betsuyaku T, Nishimura M, et al. Differentiation of tracheal basal cells to ciliated). cells and tissue reconstruction on the synthesized basement membrane substratum in vitro. Connect Tissue Res. 2007; 48: 9-18). The fibrous collagen matrix (fib) is then treated with oligo-N-acetylglucosamine (oligo-GlcNAc) ligand covalently linked to styrene-maleic anhydride hydrophobic copolymer (MAST) in DMEM medium for at least 1 day. It was applied at a concentration of 10-20 μg / ml (Mochitate, K .: Method of preparing basement membrane, method of constructing basement membrane specimen, reconstituted artificial tissue using the basement membrane specimen and process for producing the same. US Patent No. 7,399,634). After applying MAST-GlcNAc to the fib, excess MAST-GlcNAc ligand (molecules temporarily adsorbed to collagen fibers or still free) was rinsed with fresh DMEM for several hours. Next, rLN-10 cells were seeded on a collagen fiber matrix (fib) coated with MAST-GlcNAc at a cell volume of 9.6 × 10 ⁶ cells per 6-well type fib, and 1% FBS and 0.2 mM ascorbic acid- The cells were cultured in DMEM containing 2-phosphate for 2 weeks. After culturing, the rLN-10 cell layer was removed by treatment with D-PBS (-) solution containing 50 mM NH ₄ OH, 0.1% Triton X-100, and protease inhibitor cocktail (Hosokawa T, Betsuyaku T, Nishimura M, et al. Differentiation of tracheal basal cells to ciliated cells and tissue reconstruction on the synthesized basement membrane substratum in vitro. Connect Tissue Res. 2007; 48: 9-18), reconstituted dense layer structure of human laminin-511 isoform ( lamina densa) was exposed without hurting. The de novo synthesized basement membrane (sBM) culture substrate was stored frozen at −75 ° C. until use in a state of being immersed in a storage solution.

(5) Differentiation of ES cells on M15 Differentiation experiments into liver or pancreatic lineages on M15 were performed as previously reported (Non-Patent Documents 8 and 9. That is, ES cells were seeded in advance with M15 cells. A 24-well or 6-well culture plate (Nunc) was seeded at a count of 5,000 or 20,000 cells per well, and the cells consisted of activin A (20 ng / ml) and bFGF (50 ng / ml), 10% FBS and The cells were cultured in a differentiation medium supplemented with 4,500 mg / L glucose.For differentiation into liver, activin A and bFGF were removed from ES cells, and HGF (10 ng / ml), Dex was removed from day 4 to day 24. (1 μM), OsM (10 ng / ml), 10% KSR and 2,000 mg / L glucose were switched in. For differentiation into pancreas, ES cells were treated with Activin A (20 ng / ml by day 13). ) And bFGF (50 ng / ml) supplemented with medium containing 10% FBS, then cut into ITS medium, 1,000 mg / L glucose, 10 mM NA, and 10 nM GLP-1. It was replaced.

In the case of human ES cells, KhES-1 or KhES-3 cells are seeded at a cell number of 20,000 or 80,000 per well in a 24-well or 6-well culture plate previously seeded with M15 cells to form a cell layer. did. ES cells were cultured in differentiation medium (10% KSR, 4,500 mg / L glucose, NEAA, L-Gln, penicillin and DMEM supplemented with streptomycin and 2-ME) until day 20. Activin A (20 ng / ml) and LY294002 (10 μM) μ were added from day 0 to day 10 of differentiation. Na-Bu (1 mM), HGF (10 ng / ml), Dex (1 μM) and OsM (1 μM) were added from day 0 to day 10. The medium was changed every 2 days with fresh differentiation medium supplemented with growth factors.

(6) Differentiation of ES cells into liver lineage on sBM culture substrate The sBM substrate stored at -75 ° C was slowly thawed in the refrigerator the day before use. ES cells grown on MEF were dissociated and seeded at a cell volume of 10,000 per sBM substrate. For hepatic differentiation, ES cells were treated with ITS, fetal bovine albumin (Albumax II, 2.5 mg / ml), activin A (20 ng / ml) and bFGF (50 ng / ml) and 4,500 mg / L glucose. Culture from 0 to 8 days in differentiation medium supplemented with ITS, HGF (10 ng / ml), Dex (1 μM), OsM (10 ng / ml), 10% KSR and 2,000 The medium was switched to a medium supplemented with mg / L glucose and cultured until day 24. In the case of human ES cells, KhES-1 or KhES-3 cells were pretreated with Y-27632 (a powerful Rock inhibitor) for 12 hours. Thereafter, ES cells were dissociated using 0.25% trypsin-EDTA and seeded at a cell volume of 100,000 per sBM substrate. ES cells were cultured in differentiation medium (DMEM supplemented with 10% KSR, 4,500 mg / L glucose, NEAA, L-Gln, penicillin and streptomycin and 2-ME) until day 40. Activin A (20 ng / ml) and LY294002 (10 μM) were added from day 0 to day 10 of differentiation. Na-Bu (1 mM), HGF (10 ng / ml), Dex (1 μM) and OsM (1 μM) were added from day 0 to day 10. The medium was changed every 2 days with fresh differentiation medium supplemented with growth factors.

(7) Differentiation of ES cells into pancreatic lineages on sBM culture substrate For pancreatic differentiation, ES cells were treated with ITS, fetal bovine albumin, activin A (20 ng / ml) from day 0 to day 10. And bFGF (50 ng / ml) and 4,500 mg / L glucose supplemented culture medium, and 1 μM retinoic acid was added from day 10 to day 13, and from day 13 to day 28, ITS, The medium was switched to a medium supplemented with 10 mM NA, 10 nM GLP1, and 1,000 mg / L glucose. In subculture, differentiation-inducing cells on the sBM substrate up to day 15 were dissociated with 0.25% trypsin, and two-thirds of the dissociated cells were replated on fresh sBM substrate. After the subculture, the same medium as that from day 13 to day 28 was used. Ten days after passage (that is, day 25), the cultured cells were collected with 0.25% trypsin and used for analysis of differentiation.

(8) Flow cytometry analysis Any of the following antibodies was used. Biotin-conjugated anti-E-cadherin monoclonal antibody (mAb) ECCD2 (Shirayoshi Y, Nose A, Iwasaki K, et al. N-linked oligosaccharides are not involved in the function of a cell-cell binding glycoprotein E-cadherin. Cell Struct Funct. 1986; 11: 245-252) or phycoerythrin (PE) -conjugated anti-Cxcr4 monoclonal antibody (mAb) 2B11 (BD Biosciences Pharmingen). Stained cells were analyzed with FACS Canto (BD) or collected with FACS Aria (BD). Data was recorded with the BD FACS Diva Software program (BD) and analyzed using the Flowjo program (Tree Star).

(9) RT-PCR analysis RNA extraction, reverse transcription reaction, PCR analysis, and real-time PCR analysis were performed as previously reported (Non-Patent Documents 8 to 10). The primer sequences of each primer set are shown below.
Primer sequence:
Mouse Foxa2-F: TGGTCACTGGGGACAAGGGAA (SEQ ID NO: 1)
Mouse Foxa2-R: GCAACAACAGCAATAGAGAAC (SEQ ID NO: 2)
Mouse Afp-F: TCGTATTCCAACAGGAGG (SEQ ID NO: 3)
Mouse Afp-R: AGGCTTTTGCTTCACCAG (SEQ ID NO: 4)
Mouse Alb1-F: CTTAAACCGATGGGCGATCTCACT (SEQ ID NO: 5)
Mouse Alb1-R: CCCCACTAGCCTCTGGCAAAAT (SEQ ID NO: 6)
Human beta-actin-F: GTGATGGTGGGAATGGGTCA (SEQ ID NO: 7)
Human beta-actin-R: TTTGATGTCACGCACGATTTCC (SEQ ID NO: 8)
Human Afp-F: TGCCAACTCAGTGAGGACAA (SEQ ID NO: 9)
Human Afp-R: TCCAACAGGCCTGAGAAATC (SEQ ID NO: 10)
Human Alb1-F: GATGTCTTCCTGGGCATGTT (SEQ ID NO: 11)
Human Alb1-R: ACATTTGCTGCCCACTTTTC (SEQ ID NO: 12)
Human Gapdh-F: CGAGATCCCTCCAAAATCAA (SEQ ID NO: 13)
Human Gapdh-R: CATGAGTCCTTCCACGATACCAA (SEQ ID NO: 14)
Mouse Pdx1-F: CCAAAACCGTCGCATGAAGTG (SEQ ID NO: 15)
Mouse Pdx1-R: CTCTCGTGCCCTCAAGAATTTTC (SEQ ID NO: 16)
Mouse Ins1-F: CAGCCCTTAGTGACCAGCTA (SEQ ID NO: 17)
Mouse Ins1-R: ATGCTGGTGCAGCACTGATC (SEQ ID NO: 18)
Mouse Gcg-F: ACTCACAGGGCACATTCACC (SEQ ID NO: 19)
Mouse Gcg-R: CCAGTTGATGAAGTCCCTGG (SEQ ID NO: 20)
Mouse Sst-F: CCGTCAGTTTCTGCAGAAGT (SEQ ID NO: 21)
Mouse Sst-R: CAGGGTCAAGTTGAGCATCG (SEQ ID NO: 22)
Mouse Ptf1a-F: TGCAGTCCATCAACGACGC (SEQ ID NO: 23)
Mouse Ptf1a-R: GGACAGAGTTCTTCCAGTTC (SEQ ID NO: 24)
Mouse Amy-F: CAGGCAATCCTGCAGGAACAA (SEQ ID NO: 25)
Mouse Amy-R: CACTTGCGGATAACTGTGCCA (SEQ ID NO: 26)
Mouse NeuroD1-F: GGAGTAGGGATGCACCGGGAA (SEQ ID NO: 27)
Mouse NeuroD1-R: CTTGGCCAAGAACTACATCTGG (SEQ ID NO: 28)
Mouse Nkx2-2-F: AACCGTGCCACGCGCTCAAA (SEQ ID NO: 29)
Mouse Nkx2-2-R: AGGGCCTAAGGCCTCCAGTCT (SEQ ID NO: 30)
Mouse Nkx6-1-F: TACTTGGCAGGACCAGAGAG (SEQ ID NO: 31)
Mouse Nkx6-1-R: CGCTGGATTTGTGCTTTTTC (SEQ ID NO: 32)
Mouse Pax4-F: AACAGAAGAGCCAAATGGCG (SEQ ID NO: 33)
Mouse Pax4-R: TGAGCAATGGGTTGATGGCA (SEQ ID NO: 34)
Mouse Pax6-F: CAGTCACAGCGGAGTGAATC (SEQ ID NO: 35)
Mouse Pax6-R: CGCTTCAGCTGAAGTCGCAT (SEQ ID NO: 36)
Mouse Isl1-F: GACTGAGAGGGTCTCCAGCTC (SEQ ID NO: 37)
Mouse Isl1-R: AGCAAGAACGACTTCGTGATG (SEQ ID NO: 38)
Mouse Glut2-F: ACAGAGCTACAATGCAACGTGG (SEQ ID NO: 39)
Mouse Glut2-R: CAACCAGAATGCCAATGACGAT (SEQ ID NO: 40)
Mouse IAPP-F: GATTCCCTATTTGGATCCCC (SEQ ID NO: 41)
Mouse IAPP-R: CTCTCTGTGGCACTGAACCA (SEQ ID NO: 42)
Mouse b-actin-F: GTGATGGTGGGAATGGGTCA (SEQ ID NO: 43)
Mouse b-actin-R: TTTGATGTCACGCACGATTTCC (SEQ ID NO: 44)

PCR conditions for each cycle:
Denaturation at 96 ° C. for 30 seconds; annealing at 60 ° C. for 2 seconds; and extension at 72 ° C. for 45 seconds;

RT-PCR products were separated by 5% native polyacrylamide gel electrophoresis, stained with SYBR Green I (Molecular Probes), and visualized with Gel Logic 200 I Imaging System (Kodak). Real-time PCR conditions are as follows. Denaturation at 95 ° C. for 15 seconds, 60 ° C. for 60 seconds annealing and extension up to 40 cycles. The amount of each target mRNA displayed in arbitrary units was measured by the standard curve method.

(10) Kidney capsule transplantation On the 25th day, the differentiated cells on the sBM substrate were lysed with 0.25% trypsin, and the collected cells were further cultured in an MPC-coated 24-well plate (Nunc) for another day. The cell concentration was 5 × 10 ⁵ cells / well. The next day, floating cells were collected by centrifugation and suspended in a 2.1 mg / ml collagen solution at a concentration of 5 × 10 ⁵ cells / 10 μl. The collagen solution was prepared from Cellmatrix (registered trademark) Type IA collagen kit (Nitta Gelatin, Japan) according to the protocol. Next, 5 × 10 ⁵ cells suspended in 10 μl of gel were injected under the kidney capsule of CB-17 / Icr-scid / scid Jcl mice (CLEA-Japan, Japan) using an insulin syringe (29G, BD). . Four weeks after injection, the transplanted mice were killed. Transplants were collected from kidneys, fixed with 4% PFA, and subjected to immunohistochemical analysis.

(11) Immunohistochemistry The following antibodies were purchased. Goat anti-amylase (Santa Cruz Biotechnology; SCB), biotin-conjugated Dolichos biflorus agglutinin (DBA) lectin (Sigma), mouse anti-insulin (Sigma), goat anti-somatostatin (SCB). As a secondary antibody, Alexa 568-conjugated antibody (Molecular Probes) was used. Cells were counterstained with DAPI (Roche).

(result)
(1) ES cells grown on rLN10-sBM substrate were suitable for definitive endoderm differentiation.
The present inventors established a co-culture method that induces mouse and human ES cells to the liver lineage using the mesoderm-derived cell line M15.

FIG. 1 is a schematic diagram showing that ES cells cultured on the M15 feeder cell layer can be directed to the liver and pancreas lineage depending on the culture conditions, as already reported (Non-Patent Documents 8 and 9).

Previously, we have co-cultured SV40-T2 cells with Matrigel® on a fibrillar collagen matrix (fib) to provide a basement membrane dense layer with a mouse laminin-111 isoform derived from Matrigel. Reported the use of a novel culture substrate (named “Biosynthetic Basement Membrane Culture Substrate (sBM)”) (Furuyama A and Mochitate K. Assembly of the exogenous extracellular matrix during basement membrane formation by alveolar epithelial cells in vitro . J. Cell Sci. 2000; 113: 859-868; and Hosokawa T, Betsuyaku T, Nishimura M, et al. Differentiation of tracheal basal cells to ciliated cells and tissue reconstruction tro . 2007; 48: 9-18). In this example, the ability of initiating differentiation of ES cells into definitive endoderm (DE) was tested using a laminin-511 isoform human sBM substrate (rLN10-sBM) composed of rLN-10 cells.

FIG. 2A shows a schematic diagram of the experimental design. The substrate was placed in a 6-well culture plate, and ES cells were seeded on the substrate. In parallel, M15 cells were also seeded on another culture plate and ES cells were seeded directly on M15 monolayers as previously reported.

It has been reported that the addition of activin A and bFGF promotes definitive endoderm differentiation. Therefore, activin A and bFGF were also added to ES cell cultures on rLN10-sBM substrate. Differentiation of ES cells into E-cadherin + / Cxcr4 + definitive endoderm cells was quantified by flow cytometry. When assayed on day 8, 27.6% of all ES cell cultures grown on sBM substrate were E-cadherin + / Cxcr4 + definitive endoderm cells. On the other hand, 50.9% of all ES cell cultures grown on the M15 feeder layer were definitive endoderm cells (FIG. 2B). Real-time PCR analysis confirmed the expression of Foxa2 (definitive endoderm marker) in ES cells differentiated with sBM substrate or M15 feeder layer. The expression level of Foxa2 in ES cells induced to differentiate into endoderm for 8 days on the sBM substrate was about 1/5 of the maximum expression level in ES cells grown on the M15 feeder layer. However, the expression gradually increased and finally reached the same expression level as that grown on M15 on day 14 (FIG. 2C). The rLN10-sBM substrate was also shown to be a better substrate for differentiating ES cells into definitive endoderm in the sense that it was not necessary to use M15 cells.

(2) ES cells grown on hLN-511 isoform-sBM substrate were able to differentiate into liver.
Expression of Afp (α-feto-protein) and Alb1 (albumin 1) was detected in ES cells cultured on rLN10-sBM on day 24 by real-time RT-PCR (FIG. 3). Cells cultured on the substrate expressed about twice as much Afp and about one-third of Alb1 compared to cells grown on M15 cells. These results indicate that ES cells differentiated into liver lineages on sBM, but the degree of maturation is lower than cells grown on M15 cells.

In order to achieve a high degree of maturity, the operation was further optimized. The effect of the addition of sodium butyrate (FIGS. 4A, B) (FIGS. 4A, B) was tested on human ES cell lines khES-1 and khES-3 cultured on M15. The expression of Alb1 transcripts detected by real-time PCR was increased by adding sodium butyrate to khES-1 and khES-3 cells (FIG. 4A). The ability of sodium butyrate to differentiate into the liver was similarly detected when cultured on an rLN10-sBM substrate, and increases in the expression levels of Afp and Alb1 were confirmed by RT-PCR (FIG. 4B). The ability of the sBM substrate to differentiate ES cells into the liver lineage suggests that it plays a role as a solid environment of extracellular matrix structure suitable for differentiation into definitive endoderm lineage.

(3) Mouse ES cells grown on the sBM culture substrate were able to differentiate into pancreas.
The differentiation from definitive endoderm to pancreatic lineage was also examined. SK7 ES cell line, in which GFP expression is induced under the Pdx1 promoter, was seeded directly on rLN10-sBM substrate and cultured under other differentiation conditions (Shiraki N, Yoshida T, Araki K, et al. Guided differentiation of embryonic stem cells into Pdx1-expressing regional-specific definitive endoderm. Stem Cells. 2008; 26: 874-885). Pdx1 / GFP expression became detectable in SK 7 ES cells by day 10 and reached a maximum on day 15 (FIG. 5). After 15 days of induction, Pdx1 / GFP expressing cells began to aggregate as a three-dimensional cell mass. On day 28, Pdx1 / GFP expression was still observed in the cell mass of differentiated cells. Pdx1 / GFP positive cells were analyzed by flow cytometry. The cell ratio was 8.12% of all ES cells on day 15 (FIG. 7). Expression of the mature pancreatic marker gene was analyzed using RT-PCR cultures (FIG. 6A). Ins1 (insulin 1) transcript expression became detectable on day 28 in ES cells cultured on sBM substrate, but not in cells grown on M15 feeders (FIG. 6A). On the other hand, other endocrine markers (Gcg: glucagon, Sst: somatostatin) and exocrine markers (Amy: amylase, pancreas specific transcription factor 1a: Ptf1a) differentiated on sBM substrate and M15 feeder It was detected in ES cells (FIG. 6A). Immature (Neurod1, Nkx2-2, Nkx6-1, Pax6) and mature (Isl1, Glut2, IAPP) β cell markers were also expressed in ES cells differentiated under both conditions. However, the expression level of the maturation marker was lower than that of the fetal pancreas (FIG. 6B). The rLN10-sBM substrate was found to help ES cells differentiate into the endocrine lineage of the pancreas containing insulin-expressing β cells. Differentiated ES cells still expressed some markers of immature endocrine pancreas.

(4) Mouse iPS cells grown on the sBM culture substrate were also able to differentiate into pancreas.
Mouse iPS cells into which four factors (Klf4, Sox2, Oct3 / 4 and c-myc) have been introduced (Okita K, Ichisaka T, Yamanaka S. Generation of germline-competent induced pluripotent stem cells. Nature. 2007; 448: 313-317 ) Was also tested to see if the sBM substrate was effective in inducing cells into the pancreatic lineage (FIG. 6C). Pdx1-expressing cells could be derived from mouse iPS cells cultured on sBM substrate by day 16 and insulin-expressing cells could be induced by day 28. The similar phenomenon of appearance of cells expressing Pdx1 and Ins1 from differentiating iPS cells suggests that the properties of mouse iPS cells and SK7ES cells on rLN10-sBM substrate are similar.

Differentiated ES cells grown for 15 days on rLN10-sBM substrate were dissociated with 0.25% trypsin, seeded again on fresh sBM substrate, and cultured until day 25. The percentage of Pdx1 / GFP expressing cells increased from 8.12% on the 15th day to 13.5% on the 25th day. The sBM substrate has been found to be useful for amplifying the proportion of Pdx1-expressing cells derived from mouse ES cells and iPS cells.

(5) Mouse iPS cell-derived definitive endoderm cells grown on the sBM substrate were able to advance differentiation into the pancreatic lineage under the mouse kidney capsule.
Previously, the present inventors have reported that transplantation of SCID mice under the renal capsule induces maturation of immature pancreatic primitive cells (FIG. 8). In order to confirm whether iPS cells differentiated on the sBM substrate were capable of differentiating into pancreatic lineages, further transplantation experiments were performed on the cells in vivo. In order to increase pancreatic primitive cells, mouse iPS cells differentiated on sBM substrate for 15 days were collected, seeded again on fresh sBM substrate, and cultured for another 10 days. On day 25, differentiated iPS cells were collected and transplanted under the kidney capsule of SCID mice. Four weeks after transplantation, the transplants were collected and analyzed for pancreatic endocrine, exocrine, and positive cells as ductal cells. FIG. 8 shows that insulin (Ins)-or somatostatin (SS) -positive endocrine cells, or DBA-positive duct cells are frequently found. Although amylase (Amy) positive cells were also observed, the frequency was low. These results indicate that iPS cell-derived definitive endoderm cells differentiated on rLN10-sBM substrate can differentiate into pancreatic lineages.

(Summary of Examples)
The sBM substrate used in the present invention is an excess of human laminin-511 secreted by recombinant human laminin-511 (laminin α5, β1 and γ1) in HEK293 cells and other major basement membrane components on fib coated with MAST-GlcNAc. It is constructed by accumulating in In this example, rLN10 cells were used. Using this rLN10-sBM, ES cells or iPS could be induced in the liver and pancreas strains. The efficiency of differentiation was high, and the obtained differentiated cells could be further differentiated into mature cells (endocrine, exocrine and ductal cells of the pancreas).

Example 2: Induction of differentiation of human iPS cells into pancreatic progenitor cells on sBM (method)
RNA was extracted from the samples on the 8th, 20th, and 30th days according to the protocol of RNeasy ^R Micro / Mini Kit (Qiagen), and 20 μl using Oligo dT primers (Toyobo) and ReverTra Ace (Toyobo). CDNA was synthesized in the system. The obtained cDNA was diluted 10 times, and 1 μl thereof was used as a template for PCR reaction. The primers are as follows.
hGAPDH-U, CGAGATCCCTCCAAAATCAA; (SEQ ID NO: 45)
hGAPDH-D, CATGAGTCCTTCCACGATACCAA; (SEQ ID NO: 46)
hOct3 / 4-U, AGGTGTGGGGGATTCCCCCAT; (SEQ ID NO: 47)
hOct3 / 4-D, GCGATGTGGCTGATCTGCTGC; (SEQ ID NO: 48)
hFoxa2-U, GCAGATACCTCCTACTACCA; (SEQ ID NO: 49)
hFoxa2-D, GAAGCAGGAGTCTACACAGT; (SEQ ID NO: 50)
hPdx1-U, GGATGAAGTCTACCAAAGCTCACGC; (SEQ ID NO: 51)
hPdx1-D, CCAGATCTTGATGTGTCTCTCGGTC; (SEQ ID NO: 52)

(result)
Gene expression analysis by RT-PCR of human iPS cells (201B7 strain distributed by Kyoto University Research Institute) cultured for 8 days (d8), 20 days (d20) and 30 days (d30) using sBM Went. Undifferentiated human ES cells (khES-3) (negative control), human adult pancreas cDNA (reversely transcribed from Clontech Human pancreas total RNA) (positive control). The results are shown in FIG. The expression of Oct3 / 4, an undifferentiated cell marker, decreases as the culture progresses, and the expression of Foxa2, an endoderm marker, is observed from d8 and decreases toward d20-30. Expression of Pdx1 (a marker gene for pancreatic progenitor cells) is increased from d20. The amount of cDNA in each sample excluding Adult panc. Is corrected by the amount of GAPDH expression.

Example 3: Induction of differentiation of human ES cells into hepatocytes on sBM The khES3 strain was seeded on sBM, and the endoderm differentiation was started by switching to the differentiation medium from the next day. The results are shown in FIG. Differentiation of Sox17-positive endoderm cells was induced by culturing in RPMI1640 medium containing Activin 100ng / ml and B27 for 10 days. From the 10th day of culture, the cells were cultured in a serum-free medium containing Dex, HGF, DMSO, and OsM, and the medium was changed every other day. On day 20 of culture, AFP1-positive immature hepatocytes were induced to differentiate, and on day 30, ALBUMIN-positive hepatocytes were induced. Furthermore, in an indocyanine green uptake experiment to evaluate liver function, hepatocytes that took up ICG were confirmed after 30 minutes of treatment. Moreover, the induction effect of the drug metabolizing enzyme CYP3A4 was confirmed by adding rifampicin for 2 days.

Claims (16)

1. A method for inducing differentiation of an ES cell or iPS cell from a ES cell or iPS cell into a pancreatic or liver cell, comprising culturing a mammal-derived ES cell or iPS cell in the presence of a growth factor on a biosynthetic basement membrane culture substrate.
2. The method according to claim 1, wherein the biosynthetic basement membrane culture substrate is a biosynthetic basement membrane culture substrate prepared by culturing cells having the ability to form a basement membrane on a support.
3. The method according to claim 1 or 2, wherein the biosynthetic basement membrane culture substrate is a biosynthetic basement membrane culture substrate prepared by culturing cells having the ability to form a basement membrane on a support provided with a sugar chain. .
4. The method according to any one of claims 1 to 3, wherein the sugar chain is a sugar chain having a β-D-glucopyranose non-reducing end or a 2-acetamido-2-deoxy-β-D-glucopyranose non-reducing end.
5. The method according to any one of claims 1 to 4, wherein the biosynthetic basement membrane culture substrate comprises a basement membrane dense layer structure (laminalamdensa) of human laminin-511 isoform.
6. A basement membrane synthesized by applying a collagen support with a sugar chain covalently bonded to a hydrophobic copolymer and then seeding and culturing cells having the ability to form a basement membrane is used as a biosynthetic basement membrane culture substrate. The method according to claim 1.
7. The method according to any one of claims 2 to 6, wherein the cell having the ability to form a basement membrane is a cell overexpressing recombinant laminin-511 (laminin α5, β1 and γ1).
8. The method according to any one of claims 1 to 7, wherein the mammal-derived ES cell or iPS cell is a mouse or human-derived ES cell or iPS cell.
9. Mouse-derived ES cells or iPS cells are cultured in the presence of ITS (insulin, transferrin and sodium selenite), activin A and bFGF on a biosynthetic basement membrane culture substrate, and then ITS (insulin, transferrin) , And sodium selenite), 肝 臓 HGF, dexamethasone, and oncostatin M are cultured in the presence of differentiation to induce differentiation into hepatic cells.
10. After culturing human-derived ES cells or iPS cells on a biosynthetic basement membrane culture substrate in a medium containing activin A, LY294002, sodium butyrate, HGF, dexamethasone, sputum and oncostatin M, in a medium excluding the above reagents The method according to any one of claims 1 to 9, wherein differentiation induction into liver cells is performed by culturing.
11. ES cells or iPS cells are cultured on biosynthetic basement membrane substrate in the presence of ITS (insulin, transferrin and sodium selenite), cochlear fetal albumin, activin A and bFGF, then in the presence of retinoic acid And then in the presence of ITS (insulin, transferrin, and sodium selenite), cochlear fetal albumin, nicotinamide, and glucagon-like peptide-1 (GLP1), induction of differentiation into pancreatic cells The method according to claim 1, wherein:
12. 2. Differentiation induction from ES cells or iPS cells into any of undifferentiated progenitor cells of the pancreatic system or liver system, immature cells of the pancreatic system or liver system, or mature cells of the pancreatic system or liver system. To 11. The method according to any one of 11 to 11.
13. A pancreatic or liver cell obtained by the method according to any one of claims 1 to 12 and induced to differentiate from an ES cell or an iPS cell.
14. 13. Inducing differentiation from ES cells or iPS cells into pancreatic or liver cells by the method according to any one of claims 1 to 12, the ES cells or iPS cells are cultured in the presence of the test substance, and the test substance Degree of differentiation induction into pancreatic or hepatic cells when ES cells or iPS cells are cultured in the absence, and pancreatic or liver systems when ES cells or iPS cells are cultured in the presence of the test substance A method for screening a substance that promotes or inhibits differentiation induction from ES cells or iPS cells into pancreatic or liver cells, comprising comparing the degree of differentiation induction into cells.
15. The screening method according to claim 14, wherein the test substance is a growth factor or a low molecular weight compound.
16. The screening method according to claim 14 or 15, wherein the degree of differentiation induction into pancreatic or liver cells is measured using the expression level of a marker expressed in pancreatic or liver cells as an index.

Images