WO2010131946A1 - Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance - Google Patents

Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance Download PDF

Info

Publication number
WO2010131946A1
WO2010131946A1 PCT/NL2009/050250 NL2009050250W WO2010131946A1 WO 2010131946 A1 WO2010131946 A1 WO 2010131946A1 NL 2009050250 W NL2009050250 W NL 2009050250W WO 2010131946 A1 WO2010131946 A1 WO 2010131946A1
Authority
WO
WIPO (PCT)
Prior art keywords
ecp6
plant
broad
protein
fgi
Prior art date
Application number
PCT/NL2009/050250
Other languages
English (en)
Inventor
Bart Pierre Hélène Joseph THOMMA
Ronnie De Jonge
Hendrikus Pieter Van Esse
Original Assignee
Wageningen Universiteit
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wageningen Universiteit filed Critical Wageningen Universiteit
Priority to PCT/NL2009/050250 priority Critical patent/WO2010131946A1/fr
Priority to PCT/NL2010/050275 priority patent/WO2010131960A2/fr
Publication of WO2010131946A1 publication Critical patent/WO2010131946A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi

Definitions

  • the present invention is in the field of plant biotechnology. More in particular, the present invention relates to fungal resistance in plants, especially the interaction between the fungus and the plant. The invention further relates to fungal elicitor molecules, and their use as a marker to determine fungal resistance in plants.
  • Cladosporium ful ⁇ um is a biotrophic pathogen that causes leaf mold of tomato (Lycopersicon esculentum) . After germination of conidia, the fungus produces runner hyphae that penetrate stomata predominantly on the lower side of the leaf. Once inside the apoplast, C. ful ⁇ um does not penetrate host cells or develop haustoria but remains confined to the intercellular space between plant mesophyll cells. Despite much research on the C. fulvum-tomato interaction, the molecular components that C. ful ⁇ um utilizes for infection and colonization are largely unknown (Thomma, B. P. H. J. et al., 2005, MoI. Plant Pathol. 6:379-393).
  • HR acquired resistance
  • elicitor also called effector
  • the pathogen resistance is elicited by response to elicitor (also called effector) compounds, which are frequently found to be of proteinaceous nature (Arlat, M., et al, EMBO J., 13, 543-553, 1994; Baker, CJ. et al, Plant Physiol. 102, 1341-1344, 1993; Staskawicz, B.J. et al, Proc. Natl. Acad. Sci. USA 81, 6024-6028, 1984; Vivian, A. et al, Physiol. MoI. Plant Pathol. 35, 335-344, 1989; Keen, N.T., Ann. Rev. Gen. 24, 447-463, 1990; Ronald, P.C.
  • the elicitor proteins are characterized by that they are race- specific and only are able to elicit the response with a cognate (also called corresponding or specific) resistance protein.
  • a cognate also called corresponding or specific
  • the concept of avirulence- gene based resistance is also known under the name of the gene-for-gene response.
  • Avirulence genes have been cloned from bacterial and viral pathogens (such as TMV, Pseudomonas and Xanthomonas) and from fungal pathogens (such as Cladosporium fulvum, Rhynchosporium secalis and Phytophthora parasitica).
  • plant genes coding for some of the corresponding resistance genes have been cloned (such as the tomato gene Cf9 corresponding to the avirulence gene avr9 from Cladosporium fulvum, RPMl from Arabidopsis corresponding to the avirulence gene avrRPMl from Pseudomonas syringae pv. Maculicola, Pi-ta from Oryza sativa corresponding to AvrPita from Magnaporthe grisea and the N-gene from Nicotiana tabacum which corresponds with TMV-helica from Tobacco Mosaic Virus).
  • the invention now comprises a fungal effector protein comprising at least one LysM domain according to the sequence of SEQ ID NO: 4 or a sequence which is 95% or more identical thereto.
  • a fungal effector comprises the amino acid sequence as depicted in SEQ ID NO:3 or a protein that is more than 95% identical thereto.
  • said effector is an ortholog of Ecp6, selected from the orthologs of Fig. 11 or a protein that is more than 95% identical thereto.
  • the invention further comprises a method for detecting resistance in a plant comprising introducing a fungal effector protein according to the invention to a plant or a plant part; and etecting whether a resistance reaction in said plant or plant part occurs.
  • Said resistance preferably is fungal resistance.
  • the introduction of said fungal effector protein is established by infecting the plant or plant part with a fungus capable of expressing said protein, preferably wherein introduction of said fungal effector protein is established by application of said protein to the plant or a plant, more preferably wherein said application is application into the apoplastic space.
  • the introduction of said fungal effector protein is by transformation of a plant with a construct encoding said protein, more preferably wherein said effector protein is transiently expressed.
  • a method wherein introduction of said fungal effector protein is achieved by transient Agrobacterium transformation (ATTA) or through a viral construct, preferably a potatoviral construct.
  • Agrobacterium transformation Agrobacterium transformation
  • a viral construct preferably a potatoviral construct.
  • an effector protein according to the invention for assaying pathogen resistance in plants.
  • a method for providing pathogen resistant plants comprising: a. Selecting a plant having pathogen resistance and containing a resistance gene cognate for an effector protein according to the invention; b. Crossing said plant with a plant that needs to be provided with pathogen resistance; c. Assaying offspring of said crossing by testing for the presence of the resistance gene cognate for an effector protein according to the invention; d. Selecting those plants that contain said resistance gene.
  • step (c) is performed with a method according to the invention.
  • Fig. 1 Disease progression of Cladosporium ful ⁇ um on tomato.
  • the fungus is not visible at early stages of infection (3 dpi) but develops white patches of conidiophores (6 dpi) that expand and cover almost the whole leaf (9 dpi). Subsequently, the conidiophores start to produce conidia (13 dpi) which give the leaf a green-brownish velvet-like appearance (16 dpi).
  • B Quantitative real-time reverse transcription PCR to measure C. ful ⁇ um growth on resistant MM-Cf-4 tomato plants (white) and on susceptible MM-Cf- 0 tomato plants (grey) at 3, 6, 9, 13 and 16 dpi.
  • the extent of colonization is determined by the relative quantification (RQ) of transcript levels of the constitutively expressed C. ful ⁇ um actin gene (measure for fungal biomass) to the constitutively expressed tomato glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (measure for plant biomass) shown on a logarithmic scale. Bars represent mean values and standard errors of three leaflets taken from two plants at each time point analysed. The experiment was repeated twice with similar results.
  • Fig. 2 The apoplast proteome of Cladosporium fulvum-infected tomato analysed with two-dimensional polyacrylamide gel electrophoresis (2D-PAGE). Coomassie brilliant blue-stained 2D-PAGE gels obtained after electrophoresis of soluble proteins present in apoplastic fluid collected from a compatible (A; race 5 C. fulvum strain inoculated onto MM-Cf-O plants) and an incompatible (B; race 5 C. fulvum strain inoculated onto MM-Cf-4 plants) interaction at 14 days post inoculation. The proteins were focused over a non-linear gradient of pH 4—7. Molecular weight markers for the second dimension are indicated on the left. The part of the gel containing the C. fulvum- derived differentially accumulated proteins is shown. Protein spots for which identification was pursued are numbered.
  • Fig. 3 Expression analysis of the newly identified Cladosporium fulvum extracellular proteins.
  • the expression of CfPhiA, Ecp6, Ecp 7 and Avr9 genes was monitored during the interaction of C. fulvum with MM-Cf-4 tomato (incompatible; white bars) and MM-Cf-O tomato (compatible; grey bars) at 3, 6, 9, 13 and 16 days post inoculation.
  • Real-time reverse transcription PCR was used for the relative quantification (RQ) of transcript levels of the C. fulvum CfPhiA, Ecp6 and Ecp 7 genes relative to the constitutively expressed C. fulvum actin gene as an endogenous control.
  • the RQ of the Avr9 gene is shown as an example of the expression profile of a typical C. fulvum effector gene.
  • Fig. 4 Symptoms caused by wild-type Fusarium oxysporum f. sp. lycopersici and heterologous Ecp6 overexpression transformants on susceptible tomato.
  • a and B Side view (A) and top view (B) of the disease phenotype caused by F. oxysporum f. sp. lycopersici wild-type (WT) and four independent heterologous Ecp6 overexpression transformants (Ecp6-1 to Ecp6-4) on susceptible tomato MoneyMaker plants when compared with mock-inoculated tomato (mock) at 14 days post inoculation.
  • Ecp 6 is monitored during a compatible interaction between C. fulvum and MM-Cf-O tomato involving the wild- type (WT) C. fulvum and RNAi transformants at 10 days post inoculation.
  • Real-time PCR was used to measure the relative quantification (RQ) of transcript levels of the Ecp6 genes, as compared with the constitutively expressed C. fulvum actin gene as an endogenous control. Bars represent mean values and standard error of the results obtained from three leaflets taken from two infected plants.
  • Fig. 6 Typical symptoms caused by C. ful ⁇ um wild-type (WT) and RNAi transformants silenced for Ecp6 at 10 days post inoculation onto susceptible tomato plants (MM-Cf-O).
  • Fig. 7 Allelic variation of the Cladosporium ful ⁇ um Ecp6 gene. Open reading frames are shown as light grey boxes and introns as black boxes. The predicted signal peptide is indicated as dark grey box. The white flag indicates a single- nucleotide polymorphism (SNP) that leads to an amino acid substitution in the Ecp6 protein. Silent mutations are indicated by a T. The figure is drawn to scale.
  • SNP single- nucleotide polymorphism
  • Fig. 8 Homologues of Ecp6 in other fungal species. Neighbour-joining tree of 17 Ecp6-like sequences from different fungal species. The evolutionary history of Ecp6-like protein sequences was inferred by neighbour- joining analysis and bootstrap values (%) are indicated at the nodes. The tree is drawn to scale, with branch lengths representing evolutionary distances. The positions containing alignment gaps were eliminated in pair-wise sequence comparisons. A total of 220 positions were calculated in the final data set.
  • Fig. 9 Homology models for the LysM domains of Cladosporium ful ⁇ um Ecp6.
  • PrChi-A Identical amino acid residues are shaded in black and similar residues (75% threshold according to Blosum62 score) are shaded in grey.
  • Panels 1, 2 and 3 display the three-dimensional ribbon structures of the Ecp6 LysM domains 1, 2 and 3 respectively.
  • Panel 4 shows the computed molecular surface of Ecp6 Ly sM domain 1.
  • the arrow indicated in panel 1 indicates the direction of looking to obtain the view in panel 4.
  • the arrow in panel 4 indicates the shallow groove described as the site of interaction of PrChi-A with chitin oligomers.
  • Fig. 10 Recognition of Cladosporium ful ⁇ um Ecp6 in various wild tomato varieties.
  • a strong response in the tomato varieties L. cheesmanii v.typ. PI266375 Gl.1615 (A) and L. pimpinellifolium Gl.1914 (B) results in a hypersensitive response including tissue collapse.
  • a less strong response in L. pimpinellifolium Gl.1310 (C) and L. pimpinellifolium PI344102 Gl.1594 (D) results in clear chlorosis.
  • No phenotypic responses are observed upon injection of Ecp6 in MoneyMaker (E) and Motelle (F) plants.
  • Fig. 11 Nucleotide and amino acid sequences of Ecp6 orthologs.
  • Fig. 12 Nucleotide and amino acid sequences of CfPhiA and Ecp7.
  • genes include coding sequences and/or the regulatory sequences required for their expression.
  • gene refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
  • the term “native” or wild type” gene refers to a gene that is present in the genome of an untransformed cell, i. e., a cell not having a known mutation. The term “native” or wild type” is intended to encompass allelic variants of the gene.
  • a "marker gene” encodes a selectable or screenable trait. The term
  • selectable marker refers to a polynucleotide sequence encoding a metabolic trait which allows for the separation of transgenic and non-transgenic organisms and mostly refers to the provision of antibiotic resistance.
  • a selectable marker is for example the aphhl encoded kanamycin resistance marker, the nptll gene, the gene coding for hygromycin resistance.
  • Other selection markers are for instance reporter genes such as chloramphenicol acetyl transferase, ⁇ -galactosidase, lucif erase and green fluorescence protein. Identification methods for the products of reporter genes include, but are not limited to, enzymatic assays and fluorimetric assays.
  • Reporter genes and assays to detect their products are well known in the art and are described, for example in Current Protocols in Molecular Biology, eds. Ausubel et al., Greene Publishing and Wiley-Interscience: New York (1987) and periodic updates.
  • chimeric gene refers to any gene that contains 1) DNA sequences, including regulatory and coding sequences that are not found together in nature, or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
  • transgene refers to a gene that has been introduced into the genome by transformation. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed.
  • endogenous gene refers to a native gene in its natural location in the genome of an organism.
  • foreign gene refers to a gene not normally found in the host organism but that is introduced by gene transfer.
  • oligonucleotide e. g., for use in probing or amplification reactions, may be about 30 or fewer nucleotides in length (e. g., 9, 12, 15, 18, 20, 21 or 24, or any number between 9 and 30).
  • primers are upwards of 14 nucleotides in length.
  • primers 16 to 24 nucleotides in length may be preferred.
  • probing can be done with entire restriction fragments of the gene disclosed herein which may be 100's or even 1000's of nucleotides in length.
  • Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i. e., lacking an intron, such as in a cDNA or it may include one or more introns bound by appropriate splice junctions.
  • An "intron” is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein.
  • regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences. As is noted above, the term “suitable regulatory sequences” is not limited to promoters.
  • Promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
  • Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
  • Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • an "enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence- specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • Constant expression refers to expression using a constitutive promoter.
  • Transient expression is expression as a result of a transient transformation event. Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
  • Constutive promoter refers to a promoter that is able to express the open reading frame (ORF) that it controls in all or nearly all of the plant tissues during all or nearly all developmental stages of the plant.
  • open reading frame and “ORF” refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
  • initiation codon and “termination codon” refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
  • “Operably-linked” refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other.
  • a regulatory DNA sequence is said to be "operably linked to” or “associated with” a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i. e., that the coding sequence or functional RNA is under the transcriptional control of the promoter).
  • Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
  • “Expression” refers to the transcription and/or translation of an endogenous gene, ORF or portion thereof, or a transgene in plants. Expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein.
  • heterologous DNA sequence each refer to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form.
  • a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling.
  • the terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence.
  • the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.
  • a "homologous" DNA sequence is a DNA sequence that is naturally associated with a host cell into which it is introduced.
  • “Homologous to” in the context of nucleotide or amino acid sequence identity refers to the similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules. Estimates of such homology are provided by either DNA-DNA or DNA-RNA hybridization under conditions of stringency as is well understood by those skilled in the art (as described in Haines and Higgins (eds.), Nucleic Acid Hybridization, IRL Press, Oxford, U. K.), or by the comparison of sequence similarity between two nucleic acids or proteins. Two nucleotide or amino acid sequences are homologous when their sequences have a sequence similarity of more than 60%, preferably more than 70%, 80%, 85%, 90%, 95%, or even 98%.
  • substantially similar refers to nucleotide and amino acid sequences that represent functional and/or structural equivalents of sequences disclosed herein. For example, altered nucleotide sequences which simply reflect the degeneracy of the genetic code but nonetheless encode amino acid sequences that are identical to a particular amino acid sequence are substantially similar to the particular sequences. In addition, amino acid sequences that are substantially similar to a particular sequence are those wherein overall amino acid identity is at least 65% or greater to the instant sequences. Modifications that result in equivalent nucleotide or amino acid sequences are well within the routine skill in the art.
  • nucleotide sequences encompassed by this invention can also be defined by their ability to hybridize, under low, moderate and/or stringent conditions (e. g., 0. IX SSC, 0.1% SDS, 65°C), with the nucleotide sequences that are within the literal scope of the instant claims.
  • transformation refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance.
  • Host cells containing the transformed nucleic acid fragments are referred to as "transgenic” cells, and organisms comprising transgenic cells are referred to as "transgenic organisms”.
  • Examples of methods of transformation of plants and plant cells include Agrobacterium-mediated transformation (De Blaere et al., 1987) particle bombardment technology (Klein et al. 1987; U.S. Patent No. 4,945,050), microinjection, CaPO4 precipitation, lipofection (liposome fusion), use of a gene gun and DNA vector transporter (Wu et al., 1992).
  • Whole plants may be regenerated from transgenic cells by methods well known to the skilled artisan (see, for example, Fromm et al., 1990).
  • Transformed refers to a host organism such as a bacterium or a plant into which a heterologous nucleic acid molecule has been introduced.
  • the heterologous nucleic acid molecule can be stably integrated into the genome generally known in the art and are disclosed in Sambrook et al., 1989. See also Innis et al., 1995 and Gelfand, 1995; and Innis and Gelfand, 1999.
  • “transformed”, “transformant”, and “transgenic” plants or calli have been through the transformation process and contain a foreign gene integrated into their chromosome.
  • the term “untransformed” refers to normal plants that have not been through the transformation process.
  • Transiently transformed refers to cells in which transgenes and foreign DNA have been introduced (for example, by such methods as Agrobacterium-mediated transformation or biolistic bombardment), but not selected for stable maintenance.
  • “Stably transformed” refers to cells that have been selected and regenerated on a selection media following transformation.
  • Genetically stable and “heritable” refer to chromosomally- integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations. "Chromosomally-integrated” refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. Where genes are not “chromosomally integrated” they may be “transiently expressed”.
  • Gene refers to the complete genetic material of an organism.
  • nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-or double- stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrimidine.
  • the term encompasses nucleic acids containing known analogs of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
  • a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., 1991; Ohtsuka et al., 1985; Rossolini et al. 1994).
  • a "nucleic acid fragment” is a fraction of a given nucleic acid molecule.
  • deoxyribonucleic acid DNA
  • RNA ribonucleic acid
  • nucleotide sequence refers to a polymer of DNA or RNA which can be single-or double- stranded, optionally containing synthetic, non- natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
  • nucleic acid or “nucleic acid sequence” may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
  • nucleotide sequences used in aspects of the invention include both the naturally occurring sequences as well as mutant (variant) forms. Such variants will continue to possess the desired activity, i. e., either promoter activity or the activity of the product encoded by the open reading frame of the non-variant nucleotide sequence.
  • variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein.
  • Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques.
  • variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site- directed mutagenesis and for open reading frames, encode the native protein, as well as those that encode a polypeptide having amino acid substitutions relative to the native protein.
  • nucleotide sequence variants of the invention will have at least 40,50,60, to 70%, e. g., preferably 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e. g., 81%-84%, at least 85%, e. g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98% and 99% nucleotide sequence identity to the native (wild type or endogenous) nucleotide sequence.
  • nucleotide sequence identity or "nucleotide sequence homology” as used herein denotes the level of similarity, respectively the level of homology, between two polynucleotides.
  • Polynucleotides have “identical” sequences if the sequence of nucleotides in the two sequences is the same.
  • Polynucleotides have “homologous” sequences if the sequence of nucleotides in the two sequences is the same when aligned for maximum correspondence.
  • Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity.
  • the comparison window is generally from about 20 to 200 contiguous nucleotides.
  • the "percentage of sequence identity " or "percentage of sequence homology" for polynucleotides, such as 50, 60, 70, 80, 90, 95, 98, 99 or 100 percent sequence identity or homology may be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e. gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100 to yield the percentage of sequence homology.
  • Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms, or by visual inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1990; Altschul et al., 1997) and ClustalW programs, both available on the internet.
  • BLAST Basic Local Alignment Search Tool
  • nucleic acid sequences of the invention can be "optimized" for enhanced expression in plants of interest. See, for example, EP 0359472 or WO 91/16432. In this manner, the open reading frames in genes or gene fragments can be synthesized utilizing plant-preferred codons. Thus, the nucleotide sequences can be optimized for expression in any plant.
  • variant polypeptide is intended a polypeptide derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein.
  • variants may result from, for example, genetic polymorphism or from human manipulation. Methods for such manipulations are generally known in the art.
  • polypeptides may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. Conservative substitutions, such as exchanging one amino acid with another having similar properties, are preferred. Individual substitutions deletions or additions that alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an encoded sequence are "conservatively modified variations", where the alterations result in the substitution of an amino acid with a chemically similar amino acid.
  • variants have a degree of homology (or identity) of preferably more than 90%, more preferably more than 95%, more preferably more than 97% and most preferably more than 98% or 99%.
  • a "homologous" gene is a gene related to a second gene by descent from a common ancestral DNA sequence. The term, homolog, may apply to the relationship between genes separated by the event of speciation (ortholog) or to the relationship between genes separated by the event of genetic duplication (paralog).
  • orthologs are genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same function in the course of evolution. Identification of orthologs is critical for reliable prediction of gene function in newly sequenced genomes.
  • "Paralogs” are genes related by duplication within a genome. Orthologs retain the same function in the course of evolution, whereas paralogs evolve new functions, even if these are related to the original one.
  • “Expression cassette” as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
  • the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction.
  • the expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
  • the expression cassette may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus.
  • the promoter can also be specific to a particular tissue or organ or stage of development.
  • vector refers to a construction comprised of genetic material designed to direct transformation of a targeted cell.
  • a vector contains multiple genetic elements positionally and sequentially oriented, i.e., operatively linked with other necessary elements such that the nucleic acid in a nucleic acid cassette can be transcribed and when necessary, translated in the transformed cells.
  • Vector is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e. g.
  • shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e. g. higher plant, mammalian, yeast or fungal cells).
  • the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e. g. bacterial, or plant cell.
  • the vector may be a bi- functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
  • Codoning vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector.
  • a “transgenic plant” is a plant having one or more plant cells that contain an expression vector.
  • “Significant increase” is an increase that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 10%-50%, or even 2-fold or greater.
  • “Significantly less” means that the decrease is larger than the margin of error inherent in the measurement technique, preferably a decrease by about 2-fold or greater.
  • Virtually any DNA composition may be used for delivery to recipient plant cells.
  • DNA segments in the form of vectors and plasmids, or linear DNA fragments, in some instances containing only the DNA element to be expressed in the plant, and the like may be employed.
  • the construction of vectors which may be employed in conjunction with the present invention will be known to those of skill of the art in light of the present disclosure (see, e. g., Sambrook et al., 1989; Gelvin et al., 1990).
  • Vectors including plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) and DNA segments for use in transforming cells, according to the present invention will, of course, comprise the cDNA, gene or genes necessary for production of the desired protein in the transformant.
  • the vector of the invention can be introduced into any plant.
  • the genes and sequences to be introduced can be conveniently used in expression cassettes for introduction and expression in any plant of interest.
  • the transcriptional cassette will include in the 5'-to-3' direction of transcription, transcriptional and translational initiation regions, a DNA sequence of interest, and transcriptional and translational termination regions functional in plants.
  • the termination region may be native with the transcriptional initiation region, may be native with the DNA sequence of interest, or may be derived from another source.
  • Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau et al. (1991) MoI. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64: 671- 674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 151-158; Ballas et al. (1989) Nucleic Acids Res. 17: 7891-7903; Joshi et al. (1987) Nucleic Acid Res. 15: 9627-9639.
  • Suitable methods of transforming plant cells include, but are not limited to, microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrobacterium-mediated transformation (Hinchee et al., 1988), direct gene transfer (Paszkowski et al., 1984), and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wis. And BioRad, Hercules, Calif, (see, for example, Sanford et al., U. S. Pat. No. 4,945,050; and McCabe et al., 1988).
  • Ti-derived vectors transform a wide variety of higher plants, including monocotyledonous and dicotyledonous plants, such as soybean, cotton, rape, tobacco, and rice (Pacciotti et al., 1985 : Byrne et al., 1987 ; Sukhapinda et al., 1987; Park et al., 1985: Hiei et al., 1994).
  • the use of T-DNA to transform plant cells has received extensive study and is amply described (EP 120516; Hoekema, 1985 ; Knauf, et al., 1983; and An et al.,
  • chimeric genes of the invention can be inserted into binary vectors as described in the examples.
  • transformation methods are available to those skilled in the art, such as direct uptake of foreign DNA constructs (see EP 0295959), techniques of electroporation (Fromm et al., 1986) or high velocity ballistic bombardment with metal particles coated with the nucleic acid constructs (Kline et al., 1987, and U. S. Patent No. 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art.
  • rapeseed (De Block et al., 1989), sunflower (Everett et al., 1987), soybean (McCabe et al., 1988; Hinchee et al., 1988 ; Chee et al., 1989; Christou et al., 1989 ; EP 301749), rice (Hiei et al., 1994), and corn (Gordon Kamm et al., 1990; Fromm et al., 1990).
  • Agrobacterium tumefaciens cells containing a vector comprising an expression cassette of the present invention, wherein the vector comprises a Ti plasmid are useful in methods of making transformed plants. Plant cells are infected with an Agrobacterium tumefaciens as described above to produce a transformed plant cell, and then a plant is regenerated from the transformed plant cell. Numerous Agrobacterium vector systems useful in carrying out the present invention are known. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, 1984).
  • Methods using either a form of direct gene transfer or Agrobacterium-mediated transfer usually, but not necessarily, are undertaken with a selectable marker which may provide resistance to an antibiotic (e. g., kanamycin, hygromycin or methotrexate) or a herbicide (e. g., phosphinothricin).
  • a selectable marker which may provide resistance to an antibiotic (e. g., kanamycin, hygromycin or methotrexate) or a herbicide (e. g., phosphinothricin).
  • the nucleotide sequence coding for an effector protein is placed under control of the CaMV 35S promoter and introduced into an Agrobacterium strain which is also used in protocols for stable transformation. After incubation of the bacteria with acetosyringon or any other phenolic compound which is known to enhance Agrobacterium T-DNA transfer, 1 ml of the Agrobacterium culture is infiltrated into an in situ plant by injection after which the plants are placed in a greenhouse. After 2-5 days the leaves can be scored for occurrence of HR symptoms.
  • the invention now comprises a new effector protein that has been identified in the interaction between tomato plants and Cladosporium fulvum.
  • Said effector molecule, Ecp-6 of which both the amino acid sequence and the nucleotide sequence encoding said polypeptide are given below, is clearly different from known effector molecules, like Avr's and other Ecp effector proteins.
  • Ecp6_Genomic DNA start and stop codons bold underlined and intron sequences in italics and underlined
  • the mature Ecp6 protein contains 199 amino acids and has an estimated molecular mass of 21 kDa, making it the largest of the abundantly secreted effector proteins of C. ful ⁇ um identified so far.
  • Previous studies on the genes encoding secreted C. ful ⁇ um effectors have shown that A ⁇ r genes accumulated considerably more polymorphisms than Ecp genes (Stergiopoulos et al., 2007). This was suggested to be due to the lack of selection pressure imposed on the pathogen to overcome resistance mediated by resistance genes that recognize Ecps, as these have not been deployed yet in commercial tomato lines. In line with these findings, polymorphisms in Ecp6 were only rarely observed. Of the 50 C.
  • Allelic variant 1 (G > A at 128 bp downstream of the putative start codon in intron, shown in gray shading)
  • Allelic variant 2 (G > A at 494 bp downstream of the putative start codon in intron, C >T at 335 bp downstream of the putative start codon, silent mutation, G > A at 662 bp downstream of the putative start codon, silent mutation, and O A at 142 bp downstream of the putative start codon, amino acid substitution Thr25 > Asn, all shown in gray shading).
  • Ecp6 protein contains three lysin motifs (LysM domains) that were originally found in a variety of enzymes that bind to and hydrolyse peptidoglycans present in bacterial cell walls, of which lysozyme is the best- known example.
  • cysteine residues are found at positions 32 and 34 in the fungal LysM consensus sequence. It has been shown for several C. ful ⁇ um effectors that the formation of disulphide bridges between cysteine residues is required for stability upon secretion in the host, which might be true also for fungal LysM effectors.
  • the consensus sequence that can be defined for the common LysM domain(s) in Ecp6 orthologs has the following sequence: ( SEQ ID NO : 4 )
  • part of the invention are effector proteins that have at least a domain comprising the amino acid sequence of SEQ ID N0:4 or a domain that is at least 95% or more identical to the sequence as shown in SEQ ID N0:4. It will be clear to the skilled person that - in general - the effector proteins of the present invention lack a further functional domain. This is in contrast with other Lysm containing proteins (not being effector proteins) that are found in fungi, wherein the LysM domain(s) is/are coupled with other functional domains, such as domains having an enzymatic function.
  • the LysM domains are thought to be involved in chitin binding, and thus protecting the chitin structure of the fungus against any chitinase activity produced by the plant.
  • the hypothesis is that, in its turn, the plant has used this protection mechanism of the fungus as a signal that a fungal infection is taken place. Accordingly, the plant has developed a recognition system, which puts in motion a signaling cascade that eventually results in a hypersensitive response.
  • the hypothetical receptor or resistance gene product that recognizes Epc6 (or one of its orthologs) is denominated c/Epc6 (i.e. the cognate counterpart of C. ful ⁇ um Epc6).
  • the invention also comprises a method for the testing of the presence of fungal resistance in a plant by using an effector protein according to the invention.
  • a plant is tested for the presence of c/Epc6 (or perhaps an ortholog of c/Epc6) by providing a plant with an effector protein of the invention and checking for a hypersensitive response.
  • Providing the effector protein to the plant(s) in such an assay can be achieved in many ways, which will be clear to the person of skill in the art.
  • a first method to provide a plant with an effector protein is by injecting the protein into a part of the plant, e.g. a leaf or a stem segment.
  • the injection of the protein will have no clear visible result.
  • the c/Epc6 will recognize the effector protein and the cascade leading to the hypersensitive reaction will be started. As discussed before, and as is shown in Fig. 10, this will lead to a local necrosis of the plant tissue, or, in a less strong reaction, to chlorosis of the injected site, which effect can be visually observed.
  • nucleotide construct encoding said protein.
  • ATTA Agrobacterium Transient Transformation Assay
  • nucleotide sequences encoding the effector proteins are disclosed in this description or can be derived from the amino acid sequences that are also provided in the present description, any person of skill will be able to clone a coding sequence into an expression vector that is suitable for Agrobacterium transformation.
  • a viral vector can be used.
  • a sequence encoding an effector protein of the invention can be cloned into a viral vector (such as potatovirus X) after which the viral particles are used to infect the plant or plant part and to express the protein.
  • a viral vector harbouring the sequence encoding the effector protein is constructed after which this viral vector is introduced into A. tumefaciens.
  • Using a viral vector in which the virus stills maintains its infectious properties has a further advantage.
  • the absence of the resistance gene will also be visible, because in such plants the disease that is caused by the virus will develop.
  • a lack of disease progress will indicate the presence of a resistance mechanism.
  • such a system will only be feasible with plants that are normally susceptible for the virus that is used as a viral vector.
  • the effector protein is excreted to the apoplastic space, because this is the location where the effector protein in nature is found.
  • the protein automatically will be present in the apoplastic space.
  • expression into the apoplastic space can be achieved by providing the nucleotide sequence with a signal sequence for extracellular targeting.
  • signal sequences are available for a person skilled in the art and one example is the signal sequence of the tobacco PR- Ia gene.
  • Alternative sequences can be obtained from the Avr4 peptide, the carrot extension gene or from studies on N-terminal signal sequences (Small, I. et al., 2004, Proteomics 4:1581-1590).
  • the assay system as described above will be of use when breeding or constructing plants with a fungal resistance based on the presence of the Ecp6-c/Epc6 resistance mechanism.
  • the breeder normally will depart from a plant that contains c/Epc6 or an ortholog thereof.
  • This plant line will then be used as a parent line and crossed with another plant to generate offspring.
  • This offspring can be tested on the presence of the resistance mechanism in an assay as described above. This process then will be repeated until the desired end product is obtained.
  • CocheC5_172945 207 251 257 307 330 365 428 484 517 561 CocheC ⁇ 18916 161 206
  • Podospora anserina Pa_3_3275 7 49 86 133 Podospora anserina Pa_3_780 131 176 Podospora anserina Pa_4_1460 35 80 160 205 Podospora anserina Pa_4_5520 51 97 172 217 250 295 332 377 410 455 Podospora anserina Pa_5_1130 12 57 93 149 170 204 Podospora anserina Pa 5 1560 51 95 151 196 229 274 311 356 389 434 Podospora anserina Pa 5 2020 397 444
  • Phanerochaete 2 1 JGI - DOE PHYCH7732 31 76 86 131 crysosporium
  • Ustilago maydis 1 Broad - FGI UM02090 33 79 89 132
  • Ustilago maydis 1 Broad - FGI UM05087 219 262
  • the wild-type race 5 strain of C. ful ⁇ um was stored in 50% glycerol at -80°C until revitalized on potato dextrose agar (PDA; Oxoid, Hampshire, England) and was grown at room temperature in the dark.
  • PDA potato dextrose agar
  • Two-week-old C. ful ⁇ um PDA plate cultures were used to harvest conidia by adding sterile water to the plates and rubbing the surface with a sterile glass rod to release the conidia.
  • Conidial suspensions were filtered through Miracloth (Calbiochem-Behring, La Jolla, CA), centrifuged at 4000 r.p.m. and washed twice with sterile water after which the conidial concentration was determined. Subsequently, the conidia were used for plant inoculations or Agrobacterium tumefaciens- mediated transformation.
  • Leaves were harvested from C. ful ⁇ um-infected MM-Cf-O and MM- Cf-4 lines at 14 dpi and apoplastic fluid (AF) was isolated by vacuum infiltration (van Esse, H.P. et al., 2006, MoI. Plant Microbe Interact. 20:1092-1101) using demineralized water followed by centrifugation for 5 min and stored at -20°C until further analysis. AF from both interactions was freeze dried and the residue was resuspended in 3.5 ml of water. After centrifugation (10 min at 4000 g) samples were desalted using a PD-IO desalting column (GE Healthcare, UK), freeze-dried again and stored at -20°C.
  • a PD-IO desalting column GE Healthcare, UK
  • Freeze-dried protein samples were dissolved in 340 ml of Rehydration Buffer [7 M urea, 2 M thiourea, 4% CHAPS, 60 mM DTT, 0.002% (w/v) bromophenol blue] along with 3.4 ml of IPG buffer pH 4-7 (GE Healthcare). The samples were vortexed briefly and centrifuged (10 min at 4000 g). The protein samples were applied to Immobiline DryStrips of 18 cm with a non-linear pH 4-7 gradient (GE Healthcare), covered with paraffin oil and allowed to rehydrate overnight at room temperature. Isoelectric focusing was performed using the Ettan IPGphor electrophoresis apparatus (GE Healthcare) at 20°C maintaining 50 mA per strip.
  • a total focusing of 70 k Vh was achieved by following a running protocol using a step-n-hold gradient (1.5 h 0—3500 V, 6 h 3500 V). After first dimensional isoelectric focusing, the strips were stored at -20°C. Subsequently, strips were placed in equilibration buffer [EB; 50 mM Tris, pH 8.8, 6 M urea, 30% (v/v) glycerol and 2% (w/v) SDS] supplemented with 65 mM DTT. After 15 min, the buffer was replaced by EB supplemented with 135 mM iodoacetamide, and the strips were incubated for another 15 min.
  • EB equilibration buffer
  • the proteins were subsequently separated on 12.5% polyacrylamide gels; the gels were run at 70 V for the first 30 min and subsequently at 200 V until the bromophenol blue reached the bottom of the gels. Gels were stained with Coomassie brilliant blue overnight and de-stained with 10% ethanol and 7.5% HAc in water.
  • Protein spots were excised from the gel and digested with trypsin with an in- gel method (Shevchenko A. et al., 1996, Anal. Chem. 69:850-858). The collected extracts of the resulting tryptic peptides were freeze dried and stored at -20°C. The peptides were redissolved in 8 ml of 50% acetonitrile, 5% formic acid. MS and MS/MS information was acquired with a Q-Tofl (Waters, Manchester, UK) coupled with a nano-LC Ultimate system (LC Packings Dionex, Sunnyvale, CA).
  • peptides were separated on a nano-analytical column (75 mm inside diameter x 15 cm C18 PepMap, LC Packings, Dionex) using a gradient of 2-50% acetonitrile, 0.1% formic acid in 20 min.
  • the forward degenerate primer Deg-PhiA along with an oligo-(dT) primer (Table S2) was used to isolate the CfPhiA coding sequence.
  • degenerate forward primers (Table S2) were designed matching the ETKATDCG and QITTQDFG sequences from the N-terminal sequences of Ecp6 and Ecp7 respectively.
  • Using the degenerate primers and a poly T primer PCR products were amplified from a cDNA library derived from a compatible interaction between C. fulvum and tomato using the high fidelity polymerase ExTaq (Takara, Shiga, Japan). Products were cloned into the pGEM-T Easy vector (Promega, Madison, WI) and sequenced.
  • RNAi constructs for overexpression of inverted-repeat constructs for RNAi based on two different parts of the Ecp6 coding sequence were generated.
  • 218 bp of Ecp6 was PCR-amplified from cDNA using a forward primer that added an Ncol restriction site to the 5' end (Ecp6i-F) and a reverse primer that added EcoRI and Notl restriction sites to the 3' end (Ecp6i-R; Table S2).
  • PCR reactions were carried out under the following conditions: an initial denaturation step for 2 min followed by denaturation for 15 s at 94°C, annealing for 30 s at 55°C and extension for 1 min at 72°C for 30 cycles, followed by a final elongation step at 72°C for 5 min.
  • PCR products were separated on 1% agarose gels and were purified using the DNeasy kit (Qiagen, Valencia, CA). Subsequently, PCR products were cloned into the pGemT-Easy vector. Vectors were digested with Ncol and Notl or with Ncol and EcoRI.
  • Both digested inserts were cleaned from gel using the QIAquick gel extraction kit (Qiagen) and subsequently ligated with a Notl- and EcoRI- digested 129 bp spacer segment from the Pichia pastor is Aox-1 gene into the Ncol- digested plasmid pFBB302 (Dr Brandwagt, Wageningen University).
  • the plasmid pFBB302 is constructed in the backbone of the pGreen II binary vector (Hellens R. P. et al., 2000, Plant MoI. Biol. 42:819-832) and contains a nourseothricin resistance cassette (Malonek S. et al., 2004, J. Biol. Chem.
  • RNAid pFBT004 is a modified version of pFBB302, in which the nourseothricin resistance cassette is replaced by a hygromycin resistance cassette (Punt et al., supra).
  • RNAi plasmids were transformed into A. tumefaciens strain LBAlIOO [containing the binary vector pSoup (Hellens et al., supra] by electroporation.
  • a 3 ml culture of A. tumefaciens was grown overnight in Ix YT (Sambrook and Russell, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 2001) supplemented with kanamycin (25 mg ml-1).
  • MM fresh minimal medium
  • the culture was centrifuged and resuspended in 10 ml of fresh MM.
  • One millilitre of resuspended bacteria was used to inoculate 50 ml of induction medium [IM; MM salts plus 40 mM 2-(Nmorpholino) methanesulphonic acid (MES), pH 5.3, 10 mM glucose and 0.5% (w/v) glycerol] supplemented with 200 mM acetosyringone (AS) and was grown for an additional 4—5 h until the culture reached an optical density (OD600) of 0.25. At that point, the A. tumefaciens culture was centrifuged and resuspended in 10 ml of sterile water.
  • IM induction medium
  • AS mM acetosyringone
  • the filter was transferred to PDA supplemented with 50 mg ml 1 nourseothricin (Werner BioAgents, Jena, Germany) or with 100 mg ml-1 hygromycin B (Duchefa Biochemie BV, Haarlem, the Netherlands) as a selection agent for transformants and 200 mg ml 1 cefotaxime (Duchefa Biochemie BV, Haarlem, the Netherlands) to kill A. tumefaciens cells. Individual transformants were transferred to new selection plates and incubated until conidiogenesis under normal growth conditions. Conidia from these plates were stored in 50% glycerol at -80°C until further analysis.
  • Leaf samples were composed of three leaflets from the second, third and fourth tomato leaves of two tomato plants taken at each time point, immediately frozen in liquid nitrogen and stored at -80°C until used for RNA analysis. A similar procedure was used for RNAi transformant analysis.
  • Ecp ⁇ RNAi transformants Ecp6i-1 and Ecp6i-4 along with Ecp7 RNAi transformants Ecp7i-1, Ecp7i-3 and Ecp7i-7 were randomly chosen for inoculation and analysis with the progenitor race 5 wild-type strain inoculated on MM-Cf-O plants.
  • Leaf samples were taken at 10 dpi, immediately frozen in liquid nitrogen and stored at -80°C until used for RNA analysis.
  • Quantitative real-time PCR was conducted using an ABI7300 PCR machine (Applied Biosystems, Foster City, CA) with the GoldStar SYBR green PCR kit (Eurogentec, Seraing, Belgium). All primer sequences are shown in Table S2.
  • RNAi constructs were designed so that the reverse primer was not included in the RNAi construct to prevent detection of the constitutively expressed RNAi construct.
  • primer pair Ecp6-RNAi-RQ-F and Ecp6-RNAi-RQ-R was used, and for the second RNAi construct primer pair Ecp6-RNAi2-RQ-F and Ecp6-RNAi2-RQ-R.
  • Real-time PCR conditions were as follows: an initial 95°C denaturation step for 10 min followed by denaturation for 15 s at 95°C, annealing for 30 s at 60°C and extension for 30 s at 72°C for 40 cycles, and analysed on the 7300 System SDS software (Applied Biosystems, Foster City, CA). To ensure no genomic DNA contaminated RNA samples, real-time PCR was also carried out on RNA without the addition of reverse transcriptase. All experiments, including leaf inoculations, were repeated twice.
  • C. fulvum Ecp6 the cDNA corresponding to the mature protein was amplified using primer Ecp6OE-F that also contained the sequence encoding the C. fulvum Avr4 signal peptide for extracellular targeting (Table S2).
  • C. fulvum Ecp7 the cDNA corresponding to the mature protein was amplified in two steps. As the 5' coding sequence was lacking from our cDNA clone, a primer was designed to add a 5' codon-optimized sequence stretch based on the N-terminal protein sequence (Ecp7NtermF) and used in combination with the reverse primer Ecp70E-R (Table S2).
  • the resulting PCR product was used as template for a second PCR with primer Ecp70E-F that also contained the sequence encoding the C. fulvum Avr4 signal peptide for extracellular targeting and a HindIII restriction site in combination with the reverse primer Ecp7OE-R that contained a Xmal restriction site (Table S2). All PCR reactions were carried out under the following conditions: an initial denaturation step for 2 min followed by denaturation for 15 s at 94°C, annealing for 30 s at 56°C and extension for 1 min at 72°C for 30 cycles, followed by a final elongation step at 72°C for 5 min.
  • PCR products were separated on 1% agarose gels and purified using the DNeasy kit (Qiagen, Valencia, CA). Subsequently, PCR products were cloned into the pGemT-Easy vector and sequenced. A correct clone was digested with EcoRI (for Ecp6) or HindIII and Xmal (for Ecp7), cleaned from gel, and ligated into the EcoRI- (for Ecp6) or HindIII- and Xmal- (for Ecp7) digested plasmid pFBT004. The constructs were transformed into A.
  • TSPl Three primers designed on the region encoding the mature Ecp6 protein (TSPl, TSP2 and TSP3; Table S2) were used to amplify the genomic DNA sequence upstream of the region that encodes the mature Ecp6 protein using the DNA Walking SpeedUpTM Premix Kit (Seegene, Rockville, MD) according to the manufacturer's instructions. Amplified products were cloned in the pGEM-T Easy vector (Promega, Madison, WI) and sequenced. Putative open reading frames (ORFs) were predicted using the FGENESH program (Salamov, A.A. and Solovyev, V. V., 2000, Genome Res.
  • the generated cDNA was used as template for the primers Ecp6_ChrWal_Fl and Ecp6_R (Table S2) to amplify the predicted Ecp6 ORF.
  • the primers Ecp6_F3, Ecp6_F2, Ecp6_R3, Ecp6_R2 (Table S2) that hybridized outside the predicted Ecp6 ORF were used as negative controls.
  • the 50 ml PCR reaction mixes contained 5.0 ml of 1Ox SuperTaq PCR reaction buffer, 10 niM of each dNTP (Promega Benelux bv, Leiden, the Netherlands), 20 niM of each primer, 1 unit of SuperTaq DNA polymerase (HT Biotechnology, Cambridge, UK) and approximately 100 ng of cDNA as template.
  • the PCR programme consisted of an initial 5 min denaturation step at 94°C, followed by 35 cycles of denaturation at 94°C (30 s), annealing at 55°C (30 s) and extension at 72°C (60 s). A final extension step at 72°C (7 min) concluded the reaction. Amplified products were cloned in the pGEM-T Easy vector (Promega, Madison, WI) and sequenced.
  • the 50 ml PCR reaction mixes contained 5.0 ml of 10 ⁇ SuperTaq PCR reaction buffer, 10 mM of each dNTP (Promega Benelux bv, Leiden, the Netherlands), 20 mM of each primer, 1 unit of SuperTaq DNA polymerase (HT).
  • the PCR programme consisted of an initial 5 min denaturation step at 94°C, followed by 35 cycles of denaturation at 94°C (30 s), annealing at 55°C (30 s) and extension at 72°C (60 s). A final extension step at 72°C (7 min) concluded the reaction.
  • Amplified PCR products were excised from 0.8% agarose gels, purified using the GFXTM PCR DNA and Gel Band Purification Kit (Amersham Biosciences UK limited, Buckinghamshire, England), and sequenced using the forward primers Ecp6_F2 and Ecp6_F in combination with the reverse primer Ecp6_R3 (Table S2).
  • Hmmpfam analysis of each identified candidate was performed by running a customized Perl script for Pfam HMM detection, available at ftp://ftp.sanger.ac.uk/pub/databases/Pfam, using Bioperl version 1.4 (http://bioperl.org) and HMMER version 2.3.2 (http://hmmer.janelia.org), which was loaded with the current Pfam Is and fs models (02.10.2007), for whole domain and fragment models respectively. An ⁇ J-value of 0.001 was used as cut-off. The retained sequences were analysed in BioEdit version 7.0.5.3 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).
  • Fig. 1 Proteins present in 2 ml of apoplastic fluid isolated from the two different interactions were analysed with 2D-PAGE. Separation of the proteins in the first dimension was carried out on Immobiline DryStrips (pH 4-7) and for the second dimension 12.5% polyacrylamide gels were used.
  • CfPhiA This is a protein that typically occurs on phialides, which are sporogenous cells that release conidia from their apex by budding (Melin, P. et al, 2003, Fungal Genet. Biol. 40:234-241).
  • N- terminal sequencing of spot 12 resulted in a 26-amino-acid sequence harbouring the identified MS/MS sequence tags and the corresponding protein was designated Ecp6.
  • the 25-amino-acid sequence that was obtained matched the corresponding MS/MS sequence tags and the protein was designated Ecp7.
  • sequence information based on MS/MS was available for protein spot 15, this protein was not considered for further study because N-terminal sequence failed repeatedly.
  • CfPhiA a 720 bp fragment encoding the mature protein and part of the 3'UTR was cloned (Fig. Sl).
  • the predicted mature CfPhiA protein contains 175 amino acids and has a predicted molecular mass of about 19 kDa and an isoelectric point (pi) of 5.0.
  • pi isoelectric point
  • BLASTP analysis of the amino acid sequence showed that this protein shares similarity to putative proteins of several fungal species including A. nidulans, A. fumigatus and Neurospora crassa. Of these orthologues, the PhiA protein from A.
  • nidulans has been functionally characterized (Melin et al., supra), and was found to be essential for growth and sporulation of the fungus as phiA mutants were found to be impaired in phialide development. Therefore, it is likely that the C. fulvum putative orthologue CfPhiA has a similar function.
  • a 742 bp fragment with the coding region for the mature Ecp6 protein and the 3'UTR was cloned.
  • Ecp6 encodes a mature protein of 199 amino acids, including eight cysteines, and has a predicted molecular mass of 21 kDa and a pi of 4.6.
  • Ecp6 contains five predicted N-glycosylation sites, explaining the location of the Ecp6 protein spots on the 2D-gel. Based on BLASTP analysis, Ecp6 was found to share significant homology to the glycoprotein CIHl identified in the plant pathogenic fungus Colletotrichum lindemuthianum (Perfect, S. E. et ⁇ Z.,1998, Plant J. 15:273-279). Although the contribution of CIHl to pathogenicity is unknown, it has been shown in this reference to accumulate during infection on bean in the walls of intracellular hyphae and the interfacial matrix which separates the hyphae from the invaginated host plasma membrane.
  • Ecp 7 a 464 bp cDNA fragment was cloned containing the coding region for 84 amino acids of the mature Ecp7 protein. N-terminal sequencing of Ecp7 revealed that a stretch of 16 amino acids precedes the peptide that was identified as an MS tag, and based on which the degenerate primer for cloning the cDNA was designed. Therefore it should be concluded that Ecp 7 encodes a mature protein of 100 amino acids which includes six cysteines and has a predicted molecular mass of 11 kDa and a pi of 6.0. BLASTP analysis of the amino acid sequence revealed no significant homology of Ecp7 to other protein sequences deposited in public databases.
  • CfPhiA expression is induced already early in the compatible interaction, at 6 dpi, and maintains this level of expression for all time points analysed.
  • CfPhiA is also induced, although its expression level is approximately half of that found in the compatible interaction (Fig. 3).
  • Ecp6 and Ecp7 show a low but steady level of expression in the incompatible interaction when compared with that of the C. ful ⁇ um actin gene, while the genes are clearly induced in the compatible interaction. While Ecp 7 peaks at 9 dpi (Fig. 3), Ecp6 is maximally expressed at 13 dpi (Fig. 3).
  • the patterns of Ecp 6 and Ecp 7 typically resemble those of other genes encoding secreted C. ful ⁇ um effectors.
  • C. ful ⁇ um A ⁇ r9 is highly expressed throughout the compatible interaction, with maximum expression at 9 dpi, whereas its expression in the incompatible interaction remains low (Fig. 3). Nevertheless, the expression level of the Avr9 gene is much higher than those of Ecp 6 and Ecp 7 (Fig. 3).
  • RNAi-mediated silencing ofEcp ⁇ compromises C. ful ⁇ um virulence on tomato.
  • RNAi has been successfully employed for gene functional analysis in filamentous fungi (Nakayashiki, H. et al., 2005, Fungal Genet. Biol. 42:275- 283). This is particularly relevant for fungi like C. ful ⁇ um for which homologous recombination is not straightforward.
  • Recent evidence has shown that PEG-mediated transformation may generate somaclonal variation that may be circumvented by Agrobacterium-mediated transformation which is, however, significantly less efficient (van Esse et al., supra). Therefore, RNAi was recently successfully implemented to silence the expression of C. ful ⁇ um effector genes (van Esse et al., supra). Based on the results obtained with heterologous expression of C. ful ⁇ um Ecp6 in F.
  • RNAi-mediated silencing for functional analysis of the C. ful ⁇ um Ecp6 gene using Agrobacterium-mediated transformation with constructs aimed at generating double- stranded RNA that targets these genes (RNAi).
  • T-DNA transfer DNA
  • ToxA promoter To target the expression of the Ecp6 gene, two RNAi constructs were generated based on different sections of the Ecp6 coding region.
  • RNAi constructs generated several antibiotic-resistant transformants for each construct. Analysis of the transformants indicated that their growth in ⁇ itro was indistinguishable from that of the progenitor race 5 isolate (data not shown).
  • C. ful ⁇ um effector genes show variable expression when cultured in ⁇ itro (Thomma et ⁇ l., 2006), 4-week-old MM-Cf-O tomato plants were inoculated with three transgenic C. fulvum strains to determine whether the introduc- tion of the inverted-repeat construct resulted in Ecp6 silencing.
  • RNAi transformants To measure the extent of fungal growth of RNAi transformants compared with the parental wild-type strain, the constitutively expressed C. fulvum actin gene was used as a marker in real-time PCR analyses (Fig. 5B).
  • the constitutively expressed tomato chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as a reference for the ratio of fungal biomass to plant biomass to determine the degree of colonization.
  • GPDH tomato chloroplast glyceraldehyde-3-phosphate dehydrogenase
  • Ecp6 is a virulence factor of C. fulvum
  • sequence variation of Ecp6 in a worldwide collection of strains We first obtained 691 bp of genomic sequence upstream of the region that encodes the mature Ecp6 protein by gene walking. Sequence analysis using the gene prediction algorithm FGENESH identified a putative start codon and predicted intron/exon boundaries using the genetic codes of several fungi present as models in the database. These were confirmed by cloning the Ecp6 cDNA from infected plant material, showing that the Ecp6 ORF is 669 bp, interrupted by two introns of 68 and 111 bp, respectively, and encodes a protein of 222 amino acids (Fig. 7).
  • the full-length sequence of Ecp6 was obtained from a collection of 50 C. fulvum strains (Table Sl). Analysis of the sequence 62 bp upstream of the start codon to 91 bp downstream of the stop codon revealed that variation within Ecp6 was very limited, resulting in a total of five single- nucleotide polymorphisms (SNPs) within these strains (Fig. 7).
  • SNPs single- nucleotide polymorphisms
  • One SNP (G > A at 494 bp downstream of the putative start codon) occurred inside the second intron o ⁇ Ecp ⁇ , and was only detected in one Canadian strain (#34; Table Sl). The other four SNPs all occurred in seven strains originating from North America (#31, #34, #40, #41; Table Sl), and Japan (#67, #71, #74; Table Sl).
  • Fig. S2 a multiple sequence alignment analysis was performed (Fig. S2). In addition to the LysM domains, the positions of the cysteine residues that flank the LysM domains, and the high abundance of proline, serine and threonine residues in the LysM linker regions appear to be conserved (Fig. S2). Subsequently a neighbour- joining tree) was constructed to reveal evolutionary relationships (Fig. 8).
  • the 16 Ecp6-like proteins can be divided into three groups.
  • the second group of Ecp6-like proteins encompasses the two M. grisea Ecp6-like proteins and CIHl from C. lindemuthianum that are shorter than other Ecp6-like proteins and have only two LysM domains (Group 2, Fig. 8).
  • LysM domains have been identified in over 1500 proteins, the three- dimensional (3D) structure of only three LysM domains has been reported. Two of these are of bacterial origin, the 3D structure of a LysM domain of the Escherichia coli membrane-bound lytic murein transglycosylase D (MItD; PDB code: IEOG; Bateman, A. and Bycroft M., 2000, J. MoI. Biol. 299:1113-1119) and the LysM domain of the Bacillus subtilis spore protein ykuD of unknown function (PDB code: 1Y7M; Bielnicki, J. et al., 2006, Proteins 62:144-151).
  • MItD Escherichia coli membrane-bound lytic murein transglycosylase D
  • PDB code IEOG
  • Bateman A. and Bycroft M.
  • LysM domain of the Bacillus subtilis spore protein ykuD of unknown function PB code: 1Y7M
  • the 3D structure of the LysM domain of the human hypothetical protein SB145 was determined using nuclear magnetic reso- nance (NMR) imaging (PDB code: 2DJP).
  • NMR nuclear magnetic reso- nance
  • the structural organization of the three LysM domains from these different proteins is highly similar, and characterized by a ⁇ fold, with the two helices stacking on one side of the plate generated by a double- stranded antiparallel ⁇ - sheet.
  • the first characterization of an interaction of a LysM domain with its ligand was reported (Ohnuma, T. et al., 2008, J. Biol. Chem. 283:5178-5187).
  • ligand binding can be modelled according to the interaction between chitin oligomers and PrChi-A LysM domains.
  • the molecular surface of the first LysM domain of Ecp6 (Fig. 9B, panel 1) was computed and is shown in panel 4 of Fig. 9B.
  • a cavity is observed that fulfils the requirements to act as binding site of chitin oligomers, based on the structural homology with PrChi- A.
  • Ecp6 was fused to the Avr4 signal peptide and a His6-FLAG-tag by overlap extension PCR, and transformed into Pichia pastoris. Subsequently, Ecp6 was produced and purified using a Ni-NTA column. Finally the fractions containing Ecp6 were isolated and dialyzed against ddH20. The protein concentration was measured using BCA, and determined to be approximately 5.5 mg/ml.
  • the binary PVX vector pGrlO ⁇ (Jones, L. et al., 1999, Plant Cell 11:2291-2301) was used as a backbone for all PVX expression constructs.
  • the coding sequences of the Ecp6 orthologs were fused to the tobacco PR- Ia signal sequence, for extracellular targeting, using overlap extension PCR and directionally cloned into the Clal-Notl restriction sites of pGrlO ⁇ .
  • the resulting plasmids were transformed into Agrobacterium tumefaciens strain GV3101 by electroporation. The A.
  • tumefaciens strains were cultured on plates containing modified LB medium (10 g 1/1 bacto-peptone; 5 g 1/1 yeast extract; 2.5 g 1/1 NaCl; 10 g 1/1 mannitol) for 48 h at 28 degrees Celcius. Subsequently, colonies were selected and inoculated on 2-week-old tomato plants by toothpick inoculation.
  • modified LB medium 10 g 1/1 bacto-peptone; 5 g 1/1 yeast extract; 2.5 g 1/1 NaCl; 10 g 1/1 mannitol
  • Ecp6 was purified from the culture medium and used to screen a collection of 28 tomato lines for the occurrence of a hypersensitive response upon injection with Ecp6 (Table S3). Ecp6 injection triggered the development of strong chlorotic and necrotic lesions in the center of the injected area within 5 days in leaves of 7 lines ( Figure 10; Table S3). In another 6 lines a less strong response was observed. Inoculation of these lines with a similar concentration of Avr4 caused no symptoms. The remaining 15 lines and the control cultivars MoneyMaker and Motelle, that both lack functional C. fulvum resistance genes, exhibited no symptoms upon injection of Ecp6.
  • Cf-Ecp6 a single dominant gene, designated Cf-Ecp6
  • Ecp6-responsive plants were crossed with MoneyMaker Cf-O plants that lack functional Cf resistance genes.
  • the progeny of the cross (Fl) was tested for Ecp6 responsiveness by injection of P. pastoris produced Ecp6 and tested for C. ful ⁇ um resistance by challenge inoculation with various strains of C. ful ⁇ um that all possess Ecp6. All Fl plants obtained in the diverse crosses showed Ecp6-responsiveness as well as resistance against all C. ful ⁇ um strains that were tested.
  • F2 progenies were generated to study the heritability of HR upon exposure to Ecp6.
  • the three F2 populations exhibited a 3:1 ratio for Ecp6- responsiveness as well as for C. ful ⁇ um resistance, showing that both traits are conferred by a single dominant gene, designated Cf-Ecp6, in the three wild tomato species.
  • Cf-Ecp6-responsiveness a single dominant gene, designated Cf-Ecp6, in the three wild tomato species.
  • pairwise crosses were made and F2 progeny was obtained. Since all individuals of the diverse F2 populations exhibited Ecp6-responsiveness, it is concluded that Ecp6 responsiveness in the three wild tomato species is conferred by different alleles of the same gene.
  • Cf-Ecp6 recognizes Ecp6 orthologs of multiple fungal species
  • responsiveness towards various Ecp6 orthologs was tested. Screenings were carried out by using Potato Virus X (PVX) for systemic production of the Ecp6 orthologs that were targeted to the apoplast of virus- infected plants.
  • PVX Potato Virus X
  • the Ecp6 orthologs were cloned from Mycosphaerella fijiensis, M. graminicola, Cercospora beticola and Septoria lycopersici that, similar to C.
  • Ecp6 orthologs were cloned from the distantly related tomato pathogens Botrytis cinerea, Fusarium oxysporum, Fusarium solani and Verticillium dahliae.
  • Cf-Ecp6 plants are resistant to multiple, Ecp6 expressing, 2 fungal pathogens
  • Deg-Ecp7 CARATHACNACNCARGAYTTYGG Degenerate primer for Ecpl cloning oligo-dT TTGGATCCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
  • Ecp6i-F CCATGGAGATCGAGAACCCAGATGCC
  • Ecp6 RNAi forward with Ncol bold
  • Ecp6i-R GAATTCGCGGCCGCCCCGACCATCTTCAC Ecp6 RNAi reverse with ACCTG EcoRl (bold) and JVofI (underlined)
  • AATTGCCTTCATTTCTTCTTGTCTCTA coding sequence for C is a sequence for C .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention porte sur une nouvelle protéine effectrice fongique Ecp6 et ses orthologues et sur l'utilisation de ces protéines effectrices dans un essai pour la détection d'une résistance fongique dans des plantes.
PCT/NL2009/050250 2009-05-12 2009-05-12 Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance WO2010131946A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/NL2009/050250 WO2010131946A1 (fr) 2009-05-12 2009-05-12 Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance
PCT/NL2010/050275 WO2010131960A2 (fr) 2009-05-12 2010-05-12 Protéine fongique élicitrice inédite et son utilisation en tant que marqueur de résistance

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/NL2009/050250 WO2010131946A1 (fr) 2009-05-12 2009-05-12 Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance

Publications (1)

Publication Number Publication Date
WO2010131946A1 true WO2010131946A1 (fr) 2010-11-18

Family

ID=41429439

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/NL2009/050250 WO2010131946A1 (fr) 2009-05-12 2009-05-12 Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance
PCT/NL2010/050275 WO2010131960A2 (fr) 2009-05-12 2010-05-12 Protéine fongique élicitrice inédite et son utilisation en tant que marqueur de résistance

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/NL2010/050275 WO2010131960A2 (fr) 2009-05-12 2010-05-12 Protéine fongique élicitrice inédite et son utilisation en tant que marqueur de résistance

Country Status (1)

Country Link
WO (2) WO2010131946A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002002787A1 (fr) * 2000-07-03 2002-01-10 Syngenta Limited Eliciteur de cladosporium

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002002787A1 (fr) * 2000-07-03 2002-01-10 Syngenta Limited Eliciteur de cladosporium

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BOLTON MELVIN D ET AL: "The novel Cladosporium fulvum lysin motif effector Ecp6 is a virulence factor with orthologues in other fungal species", MOLECULAR MICROBIOLOGY, vol. 69, no. 1, July 2008 (2008-07-01), pages 119 - 136, XP002561934, ISSN: 0950-382X *

Also Published As

Publication number Publication date
WO2010131960A2 (fr) 2010-11-18
WO2010131960A3 (fr) 2011-02-03

Similar Documents

Publication Publication Date Title
Westerink et al. Cladosporium fulvum circumvents the second functional resistance gene homologue at the Cf‐4 locus (Hcr9‐4E) by secretion of a stable avr4E isoform
Wang et al. A novel wheat NAC transcription factor, TaNAC30, negatively regulates resistance of wheat to stripe rust
Franco‐Orozco et al. A new proteinaceous pathogen‐associated molecular pattern (PAMP) identified in Ascomycete fungi induces cell death in Solanaceae
AU2016206158B2 (en) Protein associated with disease resistance and encoding gene thereof, and use thereof in regulation of plant disease resistance
DK1472281T3 (en) GENES RESISTING TO PHYTOPHTHERA INFESTANS (POTATO FARM)
EP2861058B1 (fr) Récepteur de reconnaissance de motifs végétal et chimères pour l'utilisation contre des infections bactériennes
WO2006042145A2 (fr) Gene de resistance a la brulure bacterienne du riz
US5920000A (en) Plant pathogen resistance genes and uses thereof
Westerink et al. The AVR4 elicitor protein of Cladosporium fulvum binds to fungal components with high affinity
US20160319301A1 (en) Methods for Increasing Resistance to Soybean Cyst Nematode in Soybean Plants
CN117430678A (zh) 一种来自小麦条锈菌的免疫诱抗蛋白质及其相关生物材料与应用
AU2006339460A1 (en) Disease resistant plants
EP2911517B1 (fr) Nouvel extrait fongique immunogène et récepteur à reconnaissance de motif dans des plantes
WO2010131946A1 (fr) Nouvelle protéine élicitrice fongique et son utilisation comme marqueur de résistance
AU2001270611B2 (en) Elicitor from cladosporium
WO2006068481A2 (fr) Nouvelles proteines induisant la necrose et l'ethylene provenant de botrytis
EP3656784A1 (fr) Kinases réceptrices de reconnaissance de motifs chimériques
WO2005080421A1 (fr) Proteine inhibitrice de la polygalacturonase et son utilisation
KR101028113B1 (ko) 생장 증진, 내염성 및 노화 조절에 관여하는 고추의 ＣａＨＢ1 유전자 및 그의 용도
EP2451830B1 (fr) Procédé pour augmenter la résistance d'une plante ou une pièce associée à un pathogène, procédé de criblage de la résistance d'une plante ou pièce associée à un pathogène, et utilisation associée
AU709028B2 (en) Plant pathogen resistance genes and uses thereof
CN116064463B (zh) 番茄基因SlPKG及其编码蛋白在抗病中的应用
WO2008100112A1 (fr) Plantes transgéniques présentant une résistance accrue aux stress biotique et abiotique ou une période de floraison accélérée et procédés de production desdites plantes transgéniques
WO2013095125A1 (fr) Procédé de production d'une plante ayant une résistance accrue aux maladies vis-à-vis des nématodes
KR101568342B1 (ko) 원형질연락사를 통해 이동 가능한 복합체 및 그를 이용하여 식물 세포 간 목적 물질을 이동시키는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09788183

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09788183

Country of ref document: EP

Kind code of ref document: A1