WO2010121298A1 - Détection de staphylococcus aureus - Google Patents

Détection de staphylococcus aureus Download PDF

Info

Publication number
WO2010121298A1
WO2010121298A1 PCT/AU2010/000442 AU2010000442W WO2010121298A1 WO 2010121298 A1 WO2010121298 A1 WO 2010121298A1 AU 2010000442 W AU2010000442 W AU 2010000442W WO 2010121298 A1 WO2010121298 A1 WO 2010121298A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
nucleic acid
primer
aureus
sample
Prior art date
Application number
PCT/AU2010/000442
Other languages
English (en)
Inventor
Douglas Spencer Millar
John Robert Melki
Claire Kate Inman
Original Assignee
Human Genetic Signatures Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genetic Signatures Pty Ltd filed Critical Human Genetic Signatures Pty Ltd
Publication of WO2010121298A1 publication Critical patent/WO2010121298A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates generally to methods of bacterial pathogen detection.
  • the present invention relates to methods of detecting methicillin- sensitive (MSSA) and/or methicillin-resistant Staphylococcus aureus (MRSA) in a sample.
  • MSSA methicillin- sensitive
  • MRSA methicillin-resistant Staphylococcus aureus
  • Staphylococcus aureus is a cause of a variety of conditions in humans, including skin infections (e.g. folliculitis, styes, cellulitis, impetigo, and furunculosis), pneumonia, mastitis, phlebitis, meningitis, scalded skin syndrome, osteomyelitis, urinary tract infections, and food poisoning.
  • S. aureus is also a major cause of hospital-acquired (HA or nosocomial) infection of surgical wounds. Therefore, it is desirable to have a diagnostic assay to detect S. aureus. Additionally, methicillin- resistant S.
  • MRSA methicillin-sensitive strains of S. aureus
  • MRSA is one of the two "most out of control" antibiotic resistant pathogens; vancomycin-resistant enterococcus is the other (Society for Healthcare and Epidemiology, SHEA guidelines 2003). Over 50% of nosocomial infections in intensive care units are due to MRSA (National Nosocomial Infections Surveillance System, NNIS report, January 1992- June 2004). Accordingly, MRSA represents a significant threat to public health.
  • CA-MRSA MRSA acquired in persons with no known risk factors for MRSA infection (e.g. recent hospitalization, contact with infected patient). In clinical activities, the quick and reliable identification of MRSA has become important for the diagnosis and treatment of infected patients as well as for implementation and management of hospital infection control procedures.
  • Methicillin resistance is caused by the acquisition of an exogenous gene mecA that encodes penicillin-binding protein (PBP2a or PBP2 1 ).
  • mecA is carried on a mobile genetic element called Staphylococcal cassette chromosome mec (SCCmec) which also contains the ccr gene complex encoding the recombinases necessary for the element's mobility.
  • SCCmec cassette is a large element that can move in and out of the S. aureus genome.
  • SCCmec integrates at a specific site (attBscc) near the chromosomal origin of replication of S. aureus within the 3' end of the orfx gene, which has no known function.
  • attBscc a specific site
  • There are a variety of different types of SCCmec defined by variability in length (approximately 20 - 60 kb), gene content and other factors such as ccr gene complex type.
  • the mecA gene is also present in coagulase-negative Staphylococcus (CNS) strains that are less pathogenic than S. aureus. These strains include S. epidermidis, S. haemolyticus, S. saprophyticus, S. capitis, S. warneri, S. sciuri and S. caprae. Some of these other strains of Staphyloccus inhabit the same environments as S. aureus such as the anterior nares and the skin. It follows that clinical samples such as nasal swabs or wound swabs could potentially contain a mixture of more than one Staphylococcal species. Therefore, detection of mecA alone is not sufficient to identify MRSA directly from clinical sample. Because identification of MRSA is of greater clinical significance than the other Staphylococcus species due to its increased pathogenicity and toxicity, it is desirable that a diagnostic assay distinguish MRSA from the other staphylococcal strains containing the mecA gene.
  • CNS coagulase-negative St
  • the present invention provides methods for detecting methicillin resistant Staphylococcus aureus (MRSA) or methicillin sensitive
  • the present methods relate to the positive identification of MRSA or MSSA using detection of two gene markers.
  • the present methods also relate to converting the nucleic acids in a sample so that unmethylated cytosine residues are replaced by uracil or thymine residues and then to detecting sequence-modified MRSA and/or MSSA genetic markers in the converted sample.
  • the present invention provides methods of detecting nucleic acids from S. aureus in a sample, comprising bringing the sample suspected of containing S. aureus in contact with one primer pair that may detect MRSA and/or MSSA from other Staphylococcal strains.
  • the present inventors have found that there is a unique nucleic acid sequence common to both the orfx gene of S. aureus and the staphylococcal cassette chromosome mec (SCCmec) of S. aureus.
  • SCCmec staphylococcal cassette chromosome mec
  • the present inventors have been able to invent a test for MRSA and MSSA that can use one primer pair, where one of the primers can bind to both a region of the orfx gene and a region of SCCmec.
  • MSSA which only contains the orfx gene, if present there will be one amplification product produced. If, however, MRSA, which contains both the orfx gene and SCCmec, is present, two amplification products will be produced.
  • the one primer pair may be selected from: (i) a first primer which is complementary to a sequence in S. aureus nucleic acid of the orfx gene; and (ii) a second primer which is complementary to a sequence in S. aureus nucleic acid of the orfx gene and complementary to a sequence in S. aureus nucleic acid of the SCCmec under conditions wherein the primers specifically hybridize and one or more amplification products of the S. aureus nucleic acid is produced.
  • the present invention provides methods of detecting sequence- modified nucleic acids from S. aureus in a biological sample, comprising converting the unmethylated cytosines present in the nucleic acids contained in the biological sample to uracils to produce sequence modified nucleic acids, and then bringing the biological sample containing the sequence modified nucleic acids in contact with one or more primer pairs that may detect MRSA from other Staphylococcal strains.
  • the one primer pair may be selected from: (i) a first primer which is complementary to a sequence in the modified nucleic acid corresponding to a segment of the orfx gene; and (ii) a second primer which is complementary to a sequence in the modified nucleic acid corresponding to a segment of the orfx gene and complementary to a sequence in the modified nucleic acid corresponding to segment of SCCmec under conditions wherein the primers specifically hybridize and one or more amplification products of the S. aureus nucleic acid is produced
  • two primer pairs may be selected from: (a) a first primer pair which is complementary to a sequence in the modified nucleic acid corresponding to a segment of the mecA gene; and (b) a second primer pair, one primer of which is complementary to a sequence in the modified nucleic acid corresponding to a segment of SCCmec and the other primer of which is complementary to a sequence in the modified nucleic acid corresponding to a segment of the orfx gene under conditions wherein the primers specifically hybridize and an amplification product of the sequence- modified nucleic acids is produced.
  • the two primer pairs may be combined in a single reaction vessel for multiplex detection of multiple sequence-modified MRSA markers.
  • the methods may further comprise detecting an amplification product produced by the two primer pairs, thereby detecting MRSA and/or MSSA, if present, in the sample of converted nucleic acids.
  • the present invention provides a method for determining if a sample contains methicillin resistant Staphylococcus aureus (MRSA) or methicillin sensitive Staphylococcus aureus (MSSA) comprising:
  • the first primer can be complementary to any sequence on the orfX gene located 5 1 from the region on the orfX gene that the second primer binds.
  • a working example of the first primer is ⁇ '-ACGGCCTGCACAAGGACGTCT-S'
  • the second primer is complementary or binds under stringent conditions to sequence AGAAGCATATCATAAATGATG (SEQ ID NO: 1) that is common to both the orfx gene of S. aureus and the staphylococcal cassette chromosome mec (SCCmec) of S. aureus.
  • the second primer includes the sequence
  • CATYAYTTATGATAWGCTTCT (SEQ ID NO: 2). More preferably, the second primer is CATYAYTTATGATAWGCTTCT (SEQ ID NO: 2) or
  • the method may further comprising providing a second primer pair where the primers are complementary to a sequence of a segment of the mecA gene.
  • amplifying both primer pairs further assists that true MRSA and not "empty cassette" MSSA is detected in wild type S. aureus.
  • the present invention provides a method for determining if a sample contains methicillin resistant Staphylococcus aureus (MRSA) or methicillin sensitive Staphylococcus aureus (MSSA) comprising:
  • the sequence modified nucleic acids are produced by treating the sample with an agent that modifies cytosine to uracil.
  • the agent is preferably a bisulphite reagent. More preferably, agent is sodium bisulphite or sodium metabisulphite.
  • the second primer is complementary to or binds under stringent conditions to the sequence in the modified nucleic acid being AGAAGTATATTAT AAATGATG (SEQ ID NO: 4) that is common to the corresponding sequence in the modified nucleic acid of both the orfx gene of S. aureus and the staphylococcal cassette chromosome mec ⁇ SCCmec) of S. aureus.
  • the second primer includes the sequence
  • CATYAYTTATAATAHACTTCT SEQ ID NO: 5
  • the second primer is CATYAYTTATAATAHACTTCT (SEQ I D NO: 5) or
  • the method may further comprise providing a second primer pair where the primers are complementary to a sequence in the modified nucleic acid corresponding to a segment of the mecA gene.
  • amplifying both primer pairs further assists that true MRSA and not "empty cassette" MSSA is detected.
  • the present invention provides a method for determining if a sample contains methicillin resistant Staphylococcus aureus (MRSA) comprising:
  • sequence modified nucleic acids do not exist naturally and do not form part of a cellular genome but can be used for diagnostic purposes as they correspond to native nucleic acids present in the sample before the converting step.
  • the invention may further include the use of a primer set for a marker gene specific for Staphylococcus aureus.
  • the marker gene specific for S. aureus may be selected from the group consisting of: spa, agr, ssp protease, sir, sodM, cap, coa, alpha hemolysin, gamma hemolysin, femA, Tuf, sortase, fibrinogen binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthetase, sar, sbi, rpoB, gyrase A, and orfX.
  • the marker gene specific for S. aureus is spa.
  • the step of converting the non-methylated cytosines present in the nucleic acids contained in the biological sample to uracils is accomplished by contacting the nucleic acids with an agent (e.g. sodium bisulphite) capable of converting non-methylated cytosines to uracil.
  • an agent e.g. sodium bisulphite
  • the present invention provides a method of identifying methicillin resistant Staphylococcus aureus (MRSA), if present, in a sample, comprising:
  • the present invention provides a method of identifying methicillin resistant Staphylococcus aureus (MRSA) or methicillin sensitive Staphylococcus aureus (MSSA), if present, in a sample, comprising:
  • a first primer pair which is complementary to a sequence in the modified nucleic acid corresponding to a segment of the mecA gene
  • a second primer pair one primer of which is complementary to a sequence in the modified nucleic acid of the first stand corresponding to a segment of SCCmec and the other primer of which is complementary to a sequence in the modified nucleic acid of the first stand corresponding to a segment of the orfx gene
  • a third primer pair which is complementary to a sequence in the modified nucleic acid of the second stand corresponding to a segment of the orfx gene, under conditions wherein the primers specifically hybridize and amplify the segments of the mecA gene, SCCmec and orfx gene
  • the primer pairs and probes suitable for detection of MRSA or MSSA are selected from sequences set out in Table 1 , Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9 (SEQ ID NO: 7 to SEQ ID NO: 105).
  • the present invention provides primers for methicillin resistant
  • MRSA methicillin sensitive Staphylococcus aureus
  • MSSA methicillin sensitive Staphylococcus aureus
  • the present invention provides use of primers according to the sixth aspect of the present invention for detection of methicillin resistant Staphylococcus aureus (MRSA) or methicillin sensitive Staphylococcus aureus (MSSA).
  • MRSA methicillin resistant Staphylococcus aureus
  • MSSA methicillin sensitive Staphylococcus aureus
  • the present invention provides use of primer pairs and probes set out in Table 1 , Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9 (SEQ ID NO: 7 to SEQ ID NO: 105) for the detection of methicillin resistant Staphylococcus aureus (MRSA) or methicillin sensitive Staphylococcus aureus (MSSA) using bisulphite pre-treatment of microbial nucleic acid.
  • MRSA methicillin resistant Staphylococcus aureus
  • MSSA methicillin sensitive Staphylococcus aureus
  • any of the primers or probes may be degenerate, i.e. a mixture of primers or probes is provided that have a variable sequence at one or more nucleotide residues.
  • the primers may be degenerate at 1 nucleotide position, 1-2 nucleotide positions, 1-3 nucleotide positions, and at 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide positions.
  • the biological sample may be brought into contact with one or more of the primer pairs separately or simultaneously. Where the contact occurs simultaneously (i.e. multiplexing), one or more of the first primer pair, the second primer pair, and the third primer pair are brought into contact with the biological sample and with each other to amplify the target sequences.
  • a internal positive control nucleic acid and a fourth primer pair complementary to the internal positive control nucleic acid may be added to the amplification mixture.
  • the present methods use real time PCR to detect the amplification products.
  • the detecting may be accomplished using a labeled oligonucleotide probe for each amplification product.
  • a quencher may further be associated with the detectable label which prevents detection of the label prior to amplification of the probe's target.
  • TaqMan® probes, molecular beacons, MGB eclipse, lux, sunrise and INA beacon probes are examples of such probes, any of which may but not limited to may be used in amplification mixture.
  • the probe and one of the primers of the primer pair may comprise part of the same molecule (e.g. a ScorpionTM primer/probe).
  • a ScorpionTM contains a fluorophore associated with a quencher to reduce background fluorescence. Following PCR extension, the synthesized target region is attached to the same strand as the probe. Upon denaturation, product, the probe portion of the ScorpionTM specifically hybridizes to a part of the newly produced PCR product, physically separating the fluorophore from the quencher, thereby producing a detectable signal.
  • At least one primer of each primer pair in the amplification reaction is labeled with a detectable moiety.
  • a specific probe molecule labeled with a detectable moiety may be added to the amplification mixture.
  • the detectable moiety may be a fluorescent dye.
  • different pairs of primers or probes in a multiplex PCR may be labeled with different distinguishable detectable moieties.
  • HEX, FAM and Texas Red fluorescent dyes may be present on different primers or probes in multiplex PCR and associated with the resulting amplicons.
  • the forward primer is be labeled with one detectable moiety
  • the reverse primer is labeled with a different detectable moiety, e.g. FAM dye for a forward primer and HEX dye for a reverse primer.
  • FAM dye for a forward primer
  • HEX dye for a reverse primer.
  • Use of different detectable moieties is useful for discriminating between amplified products which are of the same length or are very similar in length.
  • at least two different fluorescent dyes are used to label different primers used in a single amplification.
  • Analysis of amplified products from amplification reactions can be performed using an automated DNA analyzer such as an automated DNA sequencer (e.g. ABI PRISM 3100 Genetic Analyzer) which can evaluate the amplified products based on size (determined by electrophoretic mobility) and/or respective fluorescent label. Detection of amplification products can also be by melting curve analysis.
  • an automated DNA analyzer such as an automated DNA sequencer (e.g. ABI PRISM 3100 Genetic Analyzer) which can evaluate the amplified products based on size (determined by electrophoretic mobility) and/or respective fluorescent label. Detection of amplification products can also be by melting curve analysis.
  • the methods further comprise a nucleic acid extraction step.
  • nucleic acid extraction methods are known in the art which can be employed with the methods and compositions provided herein such as lysis methods (such as alkaline lysis), phenol: chloroform and isopropanol precipitation. Nucleic acid extraction kits can also be used. In suitable embodiments, the extraction method is according to QIAampTM mini blood kit, Agencourt GenfindTM, Roche Cobas®, Roche MagnaPur®, IDI lysis method or phenol: chloroform extraction using Eppendorf Phase Lock Gels®. Oligonucleotides or combinations of oligonucleotides that are useful as primers or probes in the methods are also provided. These oligonucleotides are provided as substantially purified material.
  • Kits comprising oligonucleotides which may be primers for performing amplifications as described herein also are provided. Kits may further include oligonucleotides that may be used as probes to detect amplified nucleic acid. Kits may also include restriction enzymes, specific nucleases or glycosylases for digesting non- target nucleic acid to increase detection of target nucleic acid by the oligonucleotide primers. Throughout this specification, unless the context requires otherwise, the word
  • Figure 1 shows results of detection of native MRSA DNA using one primer pair.
  • FIG. 1 shows results of detection of MRSA DNA following bisulphite treatment using one primer pair.
  • Figure 3 shows results of specificity of the MRSA/MSSA primer set.
  • Figure 4 shows results of specificity of the MRSA/MSSA primer set.
  • Figure 5 shows results of MSSA/MRSA primer using clinical MSSA isolates.
  • MRSA methicillin-resistant S. aureus
  • MSSA methicillin-sensitive S. aureus
  • the present invention provides methods of identifying S. aureus (MRSA and/or MSSA) in biological samples that may contain nucleic acids from both S. aureus and coagulase-negative Staphylococcal species such as S. epidermidis and S. haemolyticus.
  • Coagulase-negative Staphylococcal species are less pathogenic than S. aureus but share the same habitats and permanently or transiently colonize the anterior nares and regions of skin and mucous membranes that are sources of infection. While not wishing to be limited by theory, a single gene marker may be insufficient to distinguish MRSA from these other less pathogenic strains.
  • mecA is distributed widely among Staphylococcal strains, while the SCCmec cassette carrying mecA is known to integrate into the genomes of S. aureus, S. epidermidis, S. haemolyticus and S. hominis. Species other than S. aureus such as S. epidermidis lack additional pathogenic factors, making its identification less clinically significant. Hanssen & Sollid. Antimicrob Agents & Chemother 51 : 1671 (2007). Moreover, the integrated SCCmec cassette can undergo genetic rearrangement, which leaves the SCCmec/orfX ]unc ⁇ on intact, but deletes the mecA gene from the genome. Thus, clinical isolates of methicillin-sensitive S.
  • MSSA myelosus aureus
  • a diagnostic assay detects not only the presence of the SCCmec cassette integrated into the S. aureus genome, but also detects the presence of the mecA gene. Accordingly, the present inventors have surprisingly discovered that a positive identification of MRSA and/or MSSA can be made by detecting two marker nucleic acids in a biological sample without the need for a primer pair directed to S. aureus specific gene.
  • the biological sample containing converted nucleic acids is contacted with primer pairs corresponding to mecA, and integrated SCCmec.
  • the amplification preferably occurs in a multiplex format, but individual reactions for each marker may also be used. Amplification from both sequence-modified markers indicates a high likelihood of MRSA in the sample. Amplification from only one of mecA or integrated SCCmec indicates that MSSA is likely present in the sample.
  • methods which distinguish between MRSA and MSSA by detecting mecA, and integrated SCCmec may use converted (i.e. sequence-modified) nucleic acids or may use unconverted nucleic acids for any or all of the two genes.
  • a reference to “an oligonucleotide” includes a plurality of oligonucleotide molecules
  • a reference to “a nucleic acid” is a reference to one or more nucleic acids.
  • “about” means plus or minus 10%.
  • amplification or "amplify” as used herein includes methods for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear. A target nucleic acid may be either DNA or RNA. The sequences amplified in this manner form an "amplicon.” While the exemplary methods described hereinafter relate to amplification using the polymerase chain reaction (PCR), numerous other methods are known in the art for amplification of nucleic acids (e.g. isothermal methods, rolling circle methods, etc.). The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods. See, e.g.
  • nucleic acid sequence such that the 5' end of one sequence is paired with the 3 1 end of the other, is in "antiparallel association.”
  • sequence "5'-A-G-T-3"' is complementary to the sequence "3'-T-C-A-5 ⁇ "
  • bases not commonly found in natural nucleic acids may be included in the nucleic acids described herein; these include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), Peptide Nucleic Acids (PNA) and Intercalating Nucleic Acids (INA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases.
  • a complement sequence can also be a sequence of RNA complementary to the DNA sequence or its complement sequence, and can also be a cDNA.
  • substantially complementary means that two sequences specifically hybridize (defined below). The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length.
  • detecting used in context of detecting a signal from a detectable label to indicate the presence of a target nucleic acid in the sample does not require the method to provide 100% sensitivity and/or 100% specificity.
  • sensitivity is the probability that a test is positive, given that the person has a target nucleic acid sequence
  • specificity is the probability that a test is negative, given that the person does not have the target nucleic acid sequence.
  • a sensitivity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred.
  • a specificity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred.
  • Detecting also encompasses assays with false positives and false negatives. False negative rates may be 1%, 5%, 10%, 15%, 20% or even higher. False positive rates may be 1%, 5%, 10%, 15%, 20% or even higher.
  • a “fragment” in the context of a nucleic acid refers to a sequence of nucleotide residues which are at least about 5 nucleotides, at least about 7 nucleotides, at least about 9 nucleotides, at least about 11 nucleotides, or at least about 17 nucleotides.
  • the fragment is typically less than about 300 nucleotides, less than about 100 nucleotides, less than about 75 nucleotides, less than about 50 nucleotides, or less than 30 nucleotides.
  • the fragments can be used in polymerase chain reaction (PCR), various hybridization procedures or microarray procedures to identify or amplify identical or related parts of mRNA or DNA molecules.
  • Genomic nucleic acid or “genomic DNA” refers to some or all of the DNA from a chromosome. Genomic DNA may be intact or fragmented (e.g. digested with restriction endonucleases by methods known in the art). In some embodiments, genomic DNA may include sequence from all or a portion of a single gene or from multiple genes. In contrast, the term “total genomic nucleic acid” is used herein to refer to the full complement of DNA contained in the genome. Methods of purifying DNA and/or RNA from a variety of samples are well-known in the art.
  • multiplex PCR refers to simultaneous amplification of two or more products within the same reaction vessel. Each product is primed using a distinct primer pair. A multiplex reaction may further include specific probes for each product, that are detectably labeled with different detectable moieties.
  • oligonucleotide refers to a short polymer composed of deoxyribonucleotides, ribonucleotides or any combination thereof. Oligonucleotides are generally between about 10, 11 , 12, 13, 14 or 15 to about 150 nucleotides (nt) in length, more preferably about 10, 11, 12, 13, 14, or 15 to about 70 nt, and most preferably between about 18 to about 35 nt in length.
  • nt nucleotides
  • the single letter code for nucleotides is as described in the US Patent Office Manual of Patent Examining Procedure, section 2422, table 1.
  • nucleotide designation "R” means purine such as guanine or adenine
  • Y means pyrimidine such as cytosine or thymidine (uracil if RNA); and
  • M means adenine or cytosine.
  • An oligonucleotide may be used as a primer or as a probe.
  • a "primer” for amplification is an oligonucleotide that is complementary to a target nucleotide sequence and leads to addition of nucleotides to the 3' end of the primer in the presence of a DNA or RNA polymerase.
  • the 3' nucleotide of the primer should generally be identical to the target sequence at a corresponding nucleotide position for optimal expression and amplification.
  • primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, intercalating nucleic acid primers, and the like.
  • a "forward primer” is a primer that is complementary to the anti-sense strand of dsDNA.
  • a “reverse primer” is complementary to the sense-strand of dsDNA.
  • Primers are typically between about 10 and about 100 nucleotides in length, preferably between about 15 and about 60 nucleotides in length, and most preferably between about 25 and about 40 nucleotides in length. There is no standard length for optimal hybridization or polymerase chain reaction amplification. An optimal length for a particular primer application may be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989).
  • oligonucleotide e.g. a probe or a primer
  • hybridize to the target nucleic acid under suitable conditions.
  • hybridization or “hybridizing” refers to the process by which an oligonucleotide single strand anneals with a complementary strand through base pairing under defined hybridization conditions.
  • Specific hybridization is an indication that two nucleic acid sequences share a high degree of complementarity. Specific hybridization complexes form under permissive annealing conditions and remain hybridized after any subsequent washing steps. Permissive conditions for annealing of nucleic acid sequences are routinely determinable by one of ordinary skill in the art and may occur, for example, at 65 0 C in the presence of about 6 X SSC. Stringency of hybridization may be expressed, in part, with reference to the temperature under which the wash steps are carried out. Such temperatures are typically selected to be about 5 0 C to 2O 0 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm thermal melting point
  • the Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Equations for calculating Tm and conditions for nucleic acid hybridization are known in the art.
  • an oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity with a portion of the nucleic acid when the oligonucleotide and the nucleic acid are aligned.
  • An oligonucleotide that is specific for a nucleic acid is one that, under the appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest.
  • sequence identity can be determined using a commercially available computer program with a default setting that employs algorithms well known in the art.
  • sequences that have "high sequence identity" have identical nucleotides at least at about 50% of aligned nucleotide positions, preferably at least at about 60% of aligned nucleotide positions, and more preferably at least at about 75% of aligned nucleotide positions.
  • Oligonucleotides used as primers or probes for specifically amplifying (i.e. amplifying a particular target nucleic acid sequence) or specifically detecting (i.e. detecting a particular target nucleic acid sequence) a target nucleic acid generally are capable of specifically hybridizing to the target nucleic acid.
  • sample may comprise clinical samples, isolated nucleic acids, or isolated microorganisms.
  • a sample is obtained from a biological source (i.e. a "biological sample"), such as tissue, bodily fluid, or microorganisms collected from a subject.
  • Sample sources include, but are not limited to, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial wash (BW), blood, bodily fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g. biopsy material).
  • Preferred sample sources include nasopharyngeal swabs, wound swabs, and nasal washes.
  • patient sample refers to a sample obtained from a human seeking diagnosis and/or treatment of a disease.
  • ScorpionTM detection system refers to a method for real-time PCR. This method utilizes a bi-functional molecule (referred to herein as a "ScorpionTM”), which contains a PCR primer element covalently linked by a polymerase- blocking group to a probe element. Additionally, each ScorpionTM molecule contains a fluorophore that interacts with a quencher to reduce the background fluorescence.
  • ScorpionTM bi-functional molecule
  • target nucleic acid or "target sequence” as used herein refer to a sequence which includes a segment of nucleotides of interest to be amplified and detected. Copies of the target sequence which are generated during the amplification reaction are referred to as amplification products, amplimers, or amplicons.
  • Target nucleic acid may be composed of segments of a chromosome, a complete gene with or without intergenic sequence, segments or portions of a gene with or without intergenic sequence, or sequence of nucleic acids which probes or primers are designed.
  • Target nucleic acids may include a wild-type sequence(s), a mutation, deletion or duplication, tandem repeat regions, a gene of interest, a region of a gene of interest or any upstream or downstream region thereof.
  • Target nucleic acids may represent alternative sequences or alleles of a particular gene.
  • Target nucleic acids may be derived from genomic DNA, cDNA, or RNA.
  • target nucleic acid may be DNA or RNA extracted from a cell or a nucleic acid copied or amplified therefrom, or may include extracted nucleic acids further converted using a bisulphite reaction.
  • TaqMan® PCR detection system refers to a method for real time PCR. In this method, a TaqMan® probe which hybridizes to the nucleic acid segment amplified is included in the PCR reaction mix.
  • the TaqMan® probe comprises a donor and a quencher fluorophore on either end of the probe and in close enough proximity to each other so that the fluorescence of the donor is taken up by the quencher.
  • the 5'- exonuclease activity of the Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit fluorescence which can be detected.
  • Sample Preparation Specimens from which MRSA can be detected and quantified with the present invention are from sterile and/or non- sterile sites.
  • Sterile sites from which specimens can be taken are body fluids such as blood, urine, cerebrospinal fluid, synovial fluid, pleural fluid, pericardial fluid, intraocular fluid, tissue biopsies or endotracheal aspirates.
  • Non- sterile sites from which specimens can be taken are e.g. sputum, stool, swabs from e.g. skin, inguinal, nasal and/or throat.
  • specimens are from non-sterile sites, more preferably wound and/or nasal swabs are used in the present invention.
  • Specimens for MRSA detection may also comprise cultures of isolated bacteria grown on appropriate media to form colonies. Specimens may also include bacterial isolates.
  • Specimens may be processed prior to nucleic acid amplification.
  • bacteria isolated from clinical specimens may be cultured in media containing antibiotics (e.g. methicillin) to check for the presence of drug resistance.
  • antibiotics e.g. methicillin
  • immunocapture with an antibody specific for S. aureus is used to enrich the sample for this species.
  • the assay first detects a species-specific gene product, e.g. spa using an antibody, and then uses nucleic acid amplification to detect one or more target nucleic acids associated with MRSA (e.g. mecA and/or SCCmec) in the enriched sample.
  • capture of S e.g. mecA and/or SCCmec
  • aureus genomic DNA using a specific binding agent such as a nucleic acid probe or protein nucleic acid
  • a specific binding agent such as a nucleic acid probe or protein nucleic acid
  • the assay first detects a species-specific gene product e.g. spa using a nucleic acid probe, and then uses nucleic acid amplification to detect one or more target nucleic acids associated with MRSA (e.g. mecA and/or SCCmec) in the enriched sample.
  • the nucleic acid conversion step may be done before or after the genomic capture step.
  • the nucleic acid may be isolated from the sample according to any methods well known to those of skill in the art. If necessary the sample may be collected or concentrated by centrifugation and the like. The cells of the sample may be subjected to lysis, such as by treatments with enzymes, heat surfactants, ultrasonication, mechanical disruption or combination thereof. The lysis treatment is performed in order to obtain a sufficient amount of DNA derived from MRSA and/or MSSA, if present in the sample, to detect using polymerase chain reaction.
  • Suitable methods include phenol and chloroform extraction. See Maniatis et al., Molecular Cloning, A Laboratory Manual, 2d, Cold Spring Harbor Laboratory Press, page 16.54 (1989). Numerous commercial kits also yield suitable DNA including, but not limited to, QIAampTM mini blood kit, Agencourt GenfindTM, Roche Cobas® Roche MagNA Pure® IDI lysis or phenol: chloroform extraction using Eppendorf Phase Lock Gels®.
  • the nucleic acids present in the sample are converted to sequence-modified nucleic acids prior to amplification.
  • Conversion refers to the process whereby the non-methylated cytosines present in the nucleic acids are chemically deaminated and modified into uracils. Following amplification, thymidine residues are substituted for the deaminated cytosines. In some methods, the conversion is accomplished by contacting the nucleic acids with sodium bisulphite.
  • MethylEasyTM Human Genetic Signatures
  • EpiTect® Bisulphite Kit Qiagen/Epigenomics
  • Methyl AmpTM DNA Modification Kit Epigentek
  • Chemical conversion of cytosine to uracil or thymidine residues may be carried out as follows. First, the nucleic acid sample is denatured, if double stranded, to provide single-stranded nucleic acid. The denaturation step may be performed by contacting the nucleic acid with a NaOH solution, or other suitable alkaline reagent, or by heating.
  • the nucleic acid sample is reacted with a reagent and incubated so as to form a treated nucleic acid sample where any methylated nucleotides in the nucleic acid sample remain unchanged while unmethylated cytosine nucleotides are deaminated.
  • Suitable reagents include, but are not limited to, sodium bisulphite.
  • the treated nucleic acid sample is purified to substantially remove any unwanted reagents or diluents from the treated nucleic acid sample. This may be accomplished, for example, by using column purification and concentration, or diluting the sample so as to reduce salt concentration and then precipitating the nucleic acid.
  • a desulphonation step of the treated nucleic acid sample may be performed to remove sulphonate groups present on the treated nucleic acid so as to obtain a nucleic acid sample substantially free of sulphonate groups. Further detail regarding the conversion of non-methylated nucleotides can be found in U.S. Patent Application publications 2007/0020633, 2004/0219539, and 2004/0086944.
  • Non-methylated cytosine residues in both DNA strands are converted as a result of the process just described. Consequently, following conversion the two DNA strands are no longer fully complementary and will not specifically hybridize, but may hybridize under non- stringent conditions, depending on the number of non-methylated cytosines within the converted strands. If few non-methylated cytosines are present within the strand, then the strands will likely retain some complementarity after conversion. If many non-methylated cytosines are present within the strand, then the top strand and bottom strand will be less likely to hybridize even under non-stringent conditions.
  • strand refers to a single chain of sugar-phosphate linked nucleosides, i.e.
  • dsDNA double-stranded DNA
  • top strand refers to the sense strand of the polynucleotide read in the 5 1 to 3' direction, which is the strand of dsDNA that includes at least a portion of a coding sequence of a functional protein.
  • bottom strand refers to the anti-sense strand, which is the strand of dsDNA that is the reverse complement of the sense strand. It is understood that, while a sequence is referred to as bottom or top strand, such a designation is intended to distinguish complementary strands since, in solution, there is no orientation that fixes a strand as a top or bottom strand.
  • top strand will therefore have its own complementary strand following amplification and likewise the bottom strand will have its own complementary strand following amplification. While the original converted strands (top or bottom) will be simplified to only contain a 3 base pair sequence of A's, Ts and G 1 S; the complementary strands will necessarily only contain T's, A's and Cs. In some methods, the presence of converted nucleic acids is detected using PCR. For each target sequence, either the top strand, the bottom strand, or both may be detected using primers specific for the modified sequence of either strand.
  • the overlaying of mineral oil prevents evaporation and oxidation of the reagents but is not essential.
  • the sample was then incubated overnight at 55 0 C.
  • the samples can be cycled in a thermal cycler as follows: incubate for about 4 hours or overnight as follows: Step 1 , 55 0 C / 2 hr cycled in PCR machine; Step 2, 95 0 C / 2 min.
  • Step 1 can be performed at any temperature from about 37 0 C to about 9O 0 C and can vary in length from 5 minutes to 8 hours.
  • Step 2 can be performed at any temperature from about 7O 0 C to about 99 0 C and can vary in length from about 1 second to 60 minutes, or longer.
  • additives are optional and can be used to improve the yield of DNA obtained by co- precitpitating with the target DNA especially when the DNA is present at low concentrations.
  • the use of additives as carrier for more efficient precipitation of nucleic acids is generally desired when the amount of nucleic acid is ⁇ 0.5 ⁇ g.
  • An isopropanol cleanup treatment was performed as follows: 800 ⁇ l of water were added to the sample, mixed and then 1 ml isopropanol was added.
  • the water or buffer reduces the concentration of the bisulphite salt in the reaction vessel to a level at which the salt will not precipitate along with the target nucleic acid of interest.
  • the dilution is generally about 1/4 to 1/1000 so long as the salt concentration is diluted below a desired range, as disclosed herein.
  • the sample was mixed again and left at 4 0 C for a minimum of 5 minutes.
  • the sample was spun in a microfuge for 10-15 minutes and the pellet was washed 2x with 70% ETOH, vortexing each time. This washing treatment removes any residual salts that precipitated with the nucleic acids.
  • the pellet was allowed to dry and then resuspended in a suitable volume of T/E (10 mM Tris/0.1 mM EDTA) pH 7.0-12.5 such as 50 ⁇ l. Buffer at pH 10.5 has been found to be particularly effective.
  • the sample was incubated at 37 0 C to 95 0 C for 1 min to 96 hr, as needed to suspend the nucleic acids.
  • Nucleic acid samples or isolated nucleic acids may be amplified by various methods known to the skilled artisan.
  • PCR is used to amplify nucleic acids of interest.
  • two primer sequences are prepared that are complementary to regions on opposite complementary strands of the marker sequence.
  • An excess of deoxynucleotide triphosphates are added to a reaction mixture along with a DNA polymerase, e.g. Tag polymerase.
  • the amplification mixture preferably does not contain a UNG nuclease.
  • the primers will bind to the sequence and the polymerase will cause the primers to be extended along the target sequence by adding on nucleotides.
  • the extended primers will dissociate from the marker to form reaction products, excess primers will bind to the marker and to the reaction products and the process is repeated, thereby generating amplification products. Cycling parameters can be varied, depending on the length and sequence composition of the amplification products to be extended.
  • An internal positive amplification control (IPC) can be included in the sample, utilizing oligonucleotide primers and/or probes. The IPC can be used to monitor both the conversion process and any subsequent amplification.
  • oligonucleotide primers and probes are used in the methods described herein to amplify and detect target sequence- modified nucleic acids specific to MRSA and/or MSSA.
  • target nucleic acids may include sequence-modified fragments of the mecA gene, and integrated SCCmec.
  • target nucleic acids may include unmodified fragments of the mecA gene, and integrated SCCmec.
  • primers can also be used to amplify one or more control nucleic acid sequences.
  • the target nucleic acids described herein may be detected individually or in a multiplex format, utilizing individual labels for each target.
  • the skilled artisan is capable of designing and preparing primers that are appropriate for amplifying a target sequence in view of this disclosure.
  • the length of the amplification primers for use in the present invention depends on several factors including the nucleotide sequence identity and the temperature at which these nucleic acids are hybridized or used during in vitro nucleic acid amplification. The considerations necessary to determine a preferred length for an amplification primer of a particular sequence identity are well known to the person of ordinary skill in the art.
  • primers and probes to amplify and detect sequence-modified or unmodified nucleic acids corresponding to integrated SCCmec, and mecA are provided by the present invention.
  • Primers that amplify a nucleic acid molecule can be designed using, for example, a computer program such as OLIGO (Molecular Biology Insights, Inc., Cascade, CO).
  • OLIGO Molecular Biology Insights, Inc., Cascade, CO.
  • Important features when designing oligonucleotides to be used as amplification primers include, but are not limited to, an appropriate size amplification product to facilitate detection (e.g.
  • oligonucleotide primers are 15 to 35 nucleotides in length.
  • a further consideration for designing primers for sequence-modified nucleic acids is that the converted sequence comprises primarily A, T, and G residues or alternatively primarily T, A and C residues. Accordingly, the melting temperature of the primer directed to a sequence-modified target will typically be lower than a corresponding primer directed to the unmodified target. Therefore, it may be necessary for the length of sequence-modified primers to be adjusted compared to a corresponding unmodified target primer. Therefore, the oligonucleotide primers may be longer than typical oligonucleotide primers directed to sequences comprised of all four bases (e.g. longer than 15 to 35 nucleotides).
  • PCR template When the PCR template is sequence modified DNA 1 the majority of the DNA is effectively reduced to three bases (A, T, and G on one strand and T, A and C on the other strand). This decreases the complexity of DNA and can increase the incidence of primer-template interaction at "nonspecific" regions. Optionally, these non-specific interactions may be overcome by the use of a nested, semi-nested PCR or probe based detection approach. Designing oligonucleotides to be used as hybridization probes can be performed in a manner similar to the design of primers.
  • oligonucleotide probes usually have similar melting temperatures, and the length of each probe must be sufficient for sequence-specific hybridization to occur but not so long that fidelity is reduced during synthesis. Oligonucleotide probes are generally 15 to 60 nucleotides in length.
  • a mix of primers having degeneracy at one or more nucleotide positions.
  • Degenerate primers are used in PCR where variability exists in the target sequence, i.e. the sequence information is ambiguous.
  • degenerate primers will exhibit variability at no more than about 4, no more than about 3, preferably no more than about 2, and most preferably, no more than about 1 nucleotide position.
  • the target nucleic acids to identify MRSA may be selected according to a wide variety of methods.
  • Exemplary target nucleic acids are modified sequences corresponding to mecA, and integrated SCCmec.
  • the target may be amplified in full.
  • fragments or segments of the target sequences are amplified.
  • the fragment may be derived from any region of the full sequence, but fragment length in accordance with the present methods is typically at least 30, at least 50, at least 75, at least 100, at least 150, at least 200, at least 250 or at least 300 nucleotides.
  • the size and location of the particular target nucleic acid will control the selection of the amplification primers and vice versa.
  • Specific primers and probes can be selected to amplify and detect a modified fragment of a marker gene specific for S. aureus. This marker should be present in S. aureus, but absent from other Staphylococcus species.
  • specific marker genes include, but are not limited to spa, agr, ssp protease, sir, sodM, cap, coa, alpha hemolysin, gamma hemolysin, femA, Tuf, sortase, fibrinogen binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthetase, sar, sbi, rpoB, gyrase A, and orfX.
  • S. auret/s-specific gene can be optional and used to distinguish a sample containing S. aureus from one that may contain other less pathogenic species or strains, e.g. S. epidermidis.
  • One suitable marker gene is the 1.55 kb spa gene (see, for example, GenBank Accession No. NC_002952, range 125378-123828).
  • primers, probes, and ScorpionsTM may be used.
  • specific primers and probes are selected to amplify and detect a fragment of the 2.0 kb mecA gene (see, for example, GenBank Accession No. AB033763) or a fragment of the sequence-modfied mecA gene.
  • Exemplary primer/ScorpionTM sequences for amplifying and detecting sequence-modified mecA are set out in Table 5 and Table 9. The skilled artisan will understand that other primers, probes, and ScorpionsTM may be used.
  • primers and probes are selected to amplify and detect a fragment of the integrated SCCmec or sequence-modified integrated SCCmec cassette.
  • primers are designed so that the amplified fragment contains the junction between the SCCmec cassette and the surrounding genomic DNA.
  • the primers may be designed to amplify either the 5' or 3' junction of sequence-modified SCCmec integrated within the S. aureus genome.
  • the 3' junction of sequence-modified SCCmec is amplified.
  • a forward primer may be designed to specifically hybridize to the 3 1 end of sequence-modified SCCmec and a reverse primer designed to specifically hybridize to the sequence-modified orf gene in the chromosomal DNA surrounding the sequence-modified SCCmec.
  • exemplary primer/ScorpionTM sequences for amplifying and detecting sequence-modified integrated SCCmec are set out in Table 1 , Table 2, Table 3, Table 4, Table 7 ,and Table 8. The skilled artisan will understand that other primers, probes, and ScorpionsTM may be used. In a suitable embodiment, PCR is performed using a ScorpionTM primer/probe combination.
  • ScorpionTM probes as used in the present invention comprise a 3' primer with a 5' extended probe tail comprising a hairpin structure which possesses a fluorophore/quencher pair.
  • the polymerase is blocked from extending into the probe tail by the inclusion of hexethlyene glycol (HEG).
  • HOG hexethlyene glycol
  • the 3' target-specific primer anneals to the target and is extended such that the ScorpionTM is now incorporated into the newly synthesized strand, which possesses a newly synthesized target region for the 5' probe.
  • PCR is carried out using either but not limited to TaqMan, molecular beacon, MGB, sunrise, lux or INA beacon probes. Detection of Amplified Nucleic Acids
  • Amplification of nucleic acids can be detected by any of a number of methods well-known in the art such as gel electrophoresis, column chromatography, hybridization with a probe, sequencing, melting curve analysis, or "real-time” detection.
  • sequences from two or more fragments of interest are amplified in the same reaction vessel (i.e. "multiplex PCR”).
  • Detection can take place by measuring the end-point of the reaction or in "real time”.
  • primers and/or probes may be detectably labeled to allow differences in fluorescence when the primers become incorporated or when the probes are hybridized, for example, and amplified in an instrument capable of monitoring the change in fluorescence during the reaction.
  • Real-time detection methods for nucleic acid amplification include, for example, the TaqMan® system, molecular Beacon, MGB, Lux, sunrise, ScorpionTM primer system , INA beacon probes and use of intercalating dyes for double stranded nucleic acid.
  • the amplicon(s) could be detected by first size-separating the amplicons, then detecting the size-separated amplicons.
  • the separation of amplicons of different sizes can be accomplished by, for example, gel electrophoresis, column chromatography, or capillary electrophoresis. These and other separation methods are well known in the art.
  • amplicons of about 10 to about 150 base pairs whose sizes differ by 10 or more base pairs can be separated, for example, on a 4% to 5% agarose gel (a 2% to 3% agarose gel for about 150 to about 300 base pair amplicons), or a 6% to 10% polyacrylamide gel.
  • the separated nucleic acids can then be stained with a dye such as ethidium bromide and the size of the resulting stained band or bands can be compared to a standard DNA ladder.
  • InvaderTM may be used to detect specific nucleic acid sequences after linear or exponential amplification.
  • the DNA structure recognized by a thermostable flap endonuclease is formed by an InvaderTM probe that overlaps the signal probe by at least one base.
  • the unpaired single- stranded flap of the signal probe is released during the FEN reaction and can be detected by various methods such as measuring fluorescence after capturing and extending the released signal probe flap with fluorescein-labeled nucleotides (ELISA-format), mass-spectrometry, denaturing gel electrophoresis, etc.
  • FRET thermostable flap endonuclease
  • the released signal probe fragment of the initial FEN reaction subsequently serves as an Invader probe invading the stem fragment of the hairpin formed intramolecularly in the FRET probe.
  • This process induces a second FEN reaction during which the fluorophore in the FRET probe is separated from the nearby quenching dye in the FRET probe, resulting in the generation of fluorescence.
  • Both FEN reactions occur at isothermic conditions (near the melting temperature of the probes) which enables a linear signal amplification.
  • two or more fragments of interest are amplified in separate reaction vessels. If the amplification is specific, that is, one primer pair amplifies for one fragment of interest but not the other, detection of amplification is sufficient to distinguish between the two types - size separation would not be required.
  • amplified nucleic acids are detected by hybridization with a specific probe.
  • Probe oligonucleotides complementary to a portion of the amplified target sequence may be used to detect amplified fragments. Hybridization may be detected in real time or in non-real time.
  • Amplified nucleic acids for each of the target sequences may be detected simultaneously (i.e. in the same reaction vessel) or individually (i.e., in separate reaction vessels).
  • the amplified DNA is detected simultaneously, using two or more distinguishably-labeled, gene- specific oligonucleotide probes, one which hybridizes to the first target sequence and one which hybridizes to the second target sequence.
  • the target may be independently selected from the top strand or the bottom strand. Thus, all targets to be detected may comprise top strand, bottom strand, or a combination of top strand and bottom strand targets.
  • the probe may be detectably labeled by methods known in the art.
  • Useful labels include, e.g. fluorescent dyes (e.g. Cy5®, Cy3®, FITC, rhodamine, lanthamide phosphors, Texas red, FAM, JOE, HEX, CaI Fluor Red 610®, Quasar 670®), 32 P, 35 S, 3 H, 14 C, 125 1, 131 I, electron-dense reagents (e.g. gold), enzymes, e.g. as commonly used in an ELISA (e.g. horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase), colorimetric labels (e.g.
  • fluorescent dyes e.g. Cy5®, Cy3®, FITC, rhodamine, lanthamide phosphors, Texas red, FAM, JOE, HEX, CaI Fluor Red 610®, Qu
  • colloidal gold examples include magnetic labels (e.g. DynabeadsTM), biotin, dioxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available.
  • Other labels include ligands or oligonucleotides capable of forming a complex with the corresponding receptor or oligonucleotide complement, respectively.
  • the label can be directly incorporated into the nucleic acid to be detected, or it can be attached to a probe (e.g. an oligonucleotide) or antibody that hybridizes or binds to the nucleic acid to be detected.
  • a probe e.g. an oligonucleotide
  • One general method for real time PCR uses fluorescent probes such as the TaqMan® probes, molecular beacons, and Scorpions.
  • Real-time PCR quantitates the initial amount of the template with more specificity, sensitivity and reproducibility, than other forms of quantitative PCR, which detect the amount of final amplified product. Real-time PCR does not detect the size of the amplicon.
  • the probes employed in ScorpionTM and TaqMan® technologies are based on the principle of fluorescence quenching and involve a donor fluorophore and a quenching moiety.
  • the detectable label is a fluorophore.
  • fluorophore refers to a molecule that absorbs light at a particular wavelength (excitation frequency) and subsequently emits light of a longer wavelength (emission frequency).
  • donor fluorophore means a fluorophore that, when in close proximity to a quencher moiety, donates or transfers emission energy to the quencher. As a result of donating energy to the quencher moiety, the donor fluorophore will itself emit less light at a particular emission frequency ; that it would have in the absence of a closely positioned quencher moiety.
  • quencher moiety means a molecule that, in close proximity to a donor fluorophore, takes up emission energy generated by the donor and either dissipates the energy as heat or emits light of a longer wavelength than the emission wavelength of the donor. In the latter case, the quencher is considered to be an acceptor fluorophore.
  • the quenching moiety can act via proximal (i.e., collisional) quenching or by F ⁇ rster or fluorescence resonance energy transfer (“FRET"). Quenching by FRET is generally used in TaqMan® probes while proximal quenching is used in molecular beacon and ScorpionTM type probes.
  • proximal quenching In proximal quenching (a.k.a. "contact” or “collisional” quenching), the donor is in close proximity to the quencher moiety such that energy of the donor is transferred to the quencher, which dissipates the energy as heat as opposed to a fluorescence emission.
  • FRET quenching the donor fluorophore transfers its energy to a quencher which releases the energy as fluorescence at a higher wavelength.
  • Proximal quenching requires very close positioning of the donor and quencher moiety, while FRET quenching, also distance related, occurs over a greater distance (generally 1-10 nm, the energy transfer depending on R-6, where R is the distance between the donor and the acceptor).
  • the quenching moiety is an acceptor fluorophore that has an excitation frequency spectrum that overlaps with the donor emission frequency spectrum.
  • the assay may detect an increase in donor fluorophore fluorescence resulting from increased distance between the donor and the quencher (acceptor fluorophore) or a decrease in acceptor fluorophore emission resulting from decreased distance between the donor and the quencher (acceptor fluorophore).
  • Suitable fluorescent moieties include the following fluorophores known in the art:
  • Alexa Fluor® 350 Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes), 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS), 4- amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N- (4-anilino-l- naphthyl)maleimide, anthranilamide, Black Hole Quencher TM (BHQTM) dyes (biosearch Technologies), BODIPY® R-6G, BOPIPY® 530/550, BODIP
  • the detectable label can be incorporated into, associated with or conjugated to a nucleic acid.
  • Label can be attached by spacer arms of various lengths to reduce potential steric hindrance or impact on other useful or desired properties. See, e.g. Mansfield, 9 MoI. Cell. Probes 145-156 (1995).
  • Detectable labels can be incorporated into nucleic acids by covalent or non-covalent means, e.g. by transcription, such as by random-primer labeling using Klenow polymerase, or nick translation, or amplification, or equivalent as is known in the art.
  • a nucleotide base is conjugated to a detectable moiety, such as a fluorescent dye, and then incorporated into nucleic acids during nucleic acid synthesis or amplification.
  • a detectable moiety such as a fluorescent dye
  • sequence-specific priming and PCR product detection is achieved using a single molecule.
  • the ScorpionTM probe maintains a stem-loop configuration in the unhybridized state.
  • the fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end, although in suitable embodiments, this arrangement may be switched.
  • the 3" portion of the stem also contains sequence that is complementary to the extension product of the primer. This sequence is linked to the 5' end of a specific primer via a non-amplifiable monomer.
  • the specific probe sequence After extension of the ScorpionTM primer, the specific probe sequence is able to bind to its complement within the extended amplicon thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed.
  • a specific target is amplified by the reverse primer and the primer portion of the ScorpionTM, resulting in an extension product. A fluorescent signal is generated due to the separation of the fluorophore from the quencher resulting from the binding of the probe element of the ScorpionTM to the extension product.
  • TaqMan® probes (Heid, et al, Genome Res 6: 986-994, 1996) use the fluorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in cDNA samples.
  • TaqMan® probes are oligonucleotides that contain a donor fluorophore usually at or near the 5' base, and a quenching moiety typically at or near the 3' base.
  • the quencher moiety may be a dye such as TAMRA or may be a non- fluorescent molecule such as 4- (4 -dimethylaminophenylazo) benzoic acid (DABCYL). See Tyagi, et al., 16 Nature Biotechnology 49-53 (1998).
  • DABYL 4- (4 -dimethylaminophenylazo) benzoic acid
  • TaqMan® probes are designed to anneal to an internal region of a PCR product.
  • the polymerase e.g. reverse transcriptase
  • its 5' exonuclease activity cleaves the probe. This ends the activity of the quencher (no FRET) and the donor fluorophore starts to emit fluorescence which increases in each cycle proportional to the rate of probe cleavage. Accumulation of PCR product is detected by monitoring the increase in fluorescence of the reporter dye (note that primers are not labeled).
  • real time PCR is performed using any suitable instrument capable of detecting fluorescence from one or more fluorescent labels.
  • real time detection on the instrument e.g. a ABI Prism® 7900HT sequence detector
  • the threshold cycle, or Ct value is the cycle at which fluorescence intersects the threshold value.
  • the threshold value is determined by the sequence detection system software or manually.
  • melting curve analysis and high resolution melt analysis may be used to detect an amplification product.
  • Melting curve analysis involves determining the melting temperature of an nucleic acid amplicon by exposing the amplicon to a temperature gradient and observing a detectable signal from a fluorophore. Melting curve analysis is based on the fact that a nucleic acid sequence melts at a characteristic temperature called the melting temperature (Tm), which is defined as the temperature at which half of the DNA duplexes have separated into single strands.
  • Tm melting temperature
  • the melting temperature of a DNA depends primarily upon its nucleotide composition. Thus, DNA molecules rich in G and C nucleotides have a higher Tm than those having an abundance of A and T nucleotides.
  • the fluorescent dye may emit a signal that can be distinguished from a signal emitted by any other of the different fluorescent dyes that are used to label the oligonucleotides.
  • the fluorescent dye for determining the melting temperature of a nucleic acid may be excited by different wavelength energy than any other of the different fluorescent dyes that are used to label the oligonucleotides.
  • the second fluorescent dye for determining the melting temperature of the detected nucleic acid is an intercalating agent.
  • Suitable intercalating agents may include, but are not limited to SYBRTM GREEN idye, SYBR dyes, Pico Green, SYTO dyes, SYTOX dyes, ethidium bromide, ethidium homodimer-1 , ethidium homodimer-2, ethidium derivatives, acridine, acridine orange, acridine derivatives, ethidium-acridine heterodimer, ethidium monoazide, propidium iodide, cyanine monomers, 7-aminoactinomycin D, YOYO-I, TOTO-I, YOYO-3, TOTO-3,
  • the selected intercalating agent is SYBRTM GREEN idye. By detecting the temperature at which the fluorescence signal is lost, the melting temperature can be determined. In the disclosed methods, each of the amplified target nucleic acids may have different melting temperatures.
  • each of these amplified target nucleic acids may have a melting temperature that differs by at least about 1 0 C, more preferably by at least about 2 0 C, or even more preferably by at least about 4 0 C from the melting temperature of any of the other amplified target nucleic acids.
  • the melting temperature(s) of the MRSA targets from the respective amplification product can confirm the presence or absence of MRSA and/or MSSA in the sample.
  • DNA was extracted from a clinical isolate of SCCmec type Il using the IDI DNA extraction technique according to the manufacturers instructions. The purified DNA was then amplified using the following conditions.
  • Primer #1 ⁇ '-ACGGCCTGCACAAGGACGTCT-S' (SEQ ID NO: 106)
  • Primer #2 ⁇ '-YAACCMCATYAYTTATGATAWGCTTCT-S' (SEQ ID NO: 3)
  • the material was amplified in a Thermo Px2 cycler using the following conditions: 95 0 C 2 minutes 1 cycle
  • Figure 1 shows the amplification of both MRSA and MSSA from a clinical isolate of MRSA.
  • the upper band corresponds to the MRSA specific product while the lower band corresponds to the MSSA specific product that would be expected to be present in both MRSA and MSSA.
  • a real time PCR probe-based using the approach is used in the above experiment above that will result in only one probe, producing fluorescence (green highlight), will generate a signal if the sample is MSSA. If, however, the sample is MRSA then both probes (green and turquoise) will produce fluorescence as the turquoise probe will additionally bind to the MRSA specific region which is not present in the MSSA genome.
  • Real time PCR using intercalating dyes such as syber green and subsequent melt analysis can also be used as the two bands are of different size (as seen in Figure 1 and Figure 2) and will melt at different temperatures.
  • the products can be differentiated by colour detection without the need for gel electrophoresis separation of amplification products.
  • HGS-SCCmed CATYAYTTATAATAHACTTCT (SEQ ID NO: 4)
  • HGS-SCCmec2 TTTTATTTATAATACACTTCT (SEQ ID NO: 27)
  • Acrometrix MRSA (SCCmec type II) control 10,000 copies was added to an IDI lysis tube and centrifuged at high speed for 5 minutes. The pellet was then washed with 200 ⁇ l of IDI sample buffer, spun as above and the supernatant discarded. 50 ⁇ l of IDI sample buffer was added and the sample vortexed at full speed for 5 minutes.
  • the sample was then heated at 95 0 C for 10 minutes.
  • the samples were the purified as directed in the MethylEasyTM direction circular and finally eluted in 20 ⁇ l of reagent #5.
  • the purified sample was then desulphonated for 10 minutes at 95 0 C
  • Figure 2 shows the detection of both MRSA and MSSA using a single consensus primer sequence with bisulphite treatment. As can be seen from the Figure 2 distinct bands are visible after gel electrophoresis, the lower band corresponding to the MSSA sequence and the higher band representing the MRSA sequence.
  • Figure 3 shows the results obtained from testing a small panel of relevant bacteria.
  • the primer set is specific for only MRSA and MSSA as no amplification is observed using the closely related MRCoNS and MSCoNS bacteria.
  • all relevant types of SCCmec cassettes (I, II, III, IV and V) were detected using the single primer set assay.
  • Figure 4 shows the results of the single primer set on a larger panel of the closely related Methicilin Resistant Coagulase Negative Staphylococcus (MRCoNS) and Methicilin Sensitive Coagulase Negative Staphylococcus (MSCoNS).
  • MRCoNS Methicilin Resistant Coagulase Negative Staphylococcus
  • MSCoNS Methicilin Sensitive Coagulase Negative Staphylococcus
  • Figure 5 shows the specific detection of a larger panel of clinical MSSA isolates.
  • Table 12 below sets out the results graphed in Figure 5.

Abstract

L'invention porte sur un procédé permettant de déterminer si un échantillon contient du Staphylococcus aureus résistant à la méticilline (SARM) ou du Staphylococcus aureus sensible à la méticilline (SASM) comprenant : (a) la mise en contact de l'échantillon avec : (i) une première amorce qui est complémentaire à une séquence dans un acide nucléique de S. aureus du gène orfx ; et (ii) une seconde amorce qui est complémentaire à une séquence dans un acide nucléique de S. aureus du gène orfx et également complémentaire à une séquence dans un acide nucléique de S. aureus de la cassette SCCmec dans des conditions dans lesquelles les amorces s'hybrident spécifiquement et un ou plusieurs produits d'amplification de l'acide nucléique de S. aureus peuvent être produits ; (b) la mise en œuvre de l'amplification de l'échantillon ; et (c) la détection de tous produits d'amplification, un produit d'amplification indiquant la présence de SASM et deux produits d'amplification indiquant la présence de SARM.
PCT/AU2010/000442 2009-04-20 2010-04-20 Détection de staphylococcus aureus WO2010121298A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17079309P 2009-04-20 2009-04-20
US61/170,793 2009-04-20

Publications (1)

Publication Number Publication Date
WO2010121298A1 true WO2010121298A1 (fr) 2010-10-28

Family

ID=43010584

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2010/000442 WO2010121298A1 (fr) 2009-04-20 2010-04-20 Détection de staphylococcus aureus

Country Status (1)

Country Link
WO (1) WO2010121298A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014137906A1 (fr) * 2013-03-05 2014-09-12 Intelligent Medical Devices, Inc. Sondes et amorces optimisées et procédés d'utilisation de celles-ci pour la détection, le criblage, l'isolement et le séquençage de mrsa, mssa, des marqueurs de staphylococcus, et le gène meca de résistance à un antibiotique
CN105793436A (zh) * 2013-09-23 2016-07-20 奎斯特诊断投资股份有限公司 对生物样品中耐甲氧西林金黄色葡萄球菌的检测
CN110923344A (zh) * 2019-12-19 2020-03-27 武汉中帜生物科技股份有限公司 金黄色葡萄球菌及耐甲氧西林金黄色葡萄球菌耐药基因mecA检测试剂盒及其应用
CN112592993A (zh) * 2020-12-30 2021-04-02 广东省微生物研究所（广东省微生物分析检测中心） 含有特异性分子靶标的金黄色葡萄球菌标准菌株及其检测和应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002099034A2 (fr) * 2001-06-04 2002-12-12 Infectio Diagnostic (I.D.I.) Inc. Sequences de detection et d'identification de staphyloccocus aureus resistant a la methicilline
EP1529847B1 (fr) * 2003-11-07 2006-04-05 Federal Rep. of Germany repr. by the Ministry of Health & Soc. Security, the latter repr. by the Pres. of the Robert Koch Ins. Méthode pour la détection de Staphylococcus aureus résistant aux méthiciline (MRSA)
WO2009018000A1 (fr) * 2007-07-31 2009-02-05 Quest Diagnostics Investments Incorporated Détection de staphylococcus aureus résistant à la méthicilline et sensible à la méthicilline dans des échantillons biologiques
US20090263909A1 (en) * 2004-04-29 2009-10-22 Human Genetic Signatures Pty Ltd Treatment of nucleic acid

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002099034A2 (fr) * 2001-06-04 2002-12-12 Infectio Diagnostic (I.D.I.) Inc. Sequences de detection et d'identification de staphyloccocus aureus resistant a la methicilline
EP1529847B1 (fr) * 2003-11-07 2006-04-05 Federal Rep. of Germany repr. by the Ministry of Health & Soc. Security, the latter repr. by the Pres. of the Robert Koch Ins. Méthode pour la détection de Staphylococcus aureus résistant aux méthiciline (MRSA)
US20090263909A1 (en) * 2004-04-29 2009-10-22 Human Genetic Signatures Pty Ltd Treatment of nucleic acid
WO2009018000A1 (fr) * 2007-07-31 2009-02-05 Quest Diagnostics Investments Incorporated Détection de staphylococcus aureus résistant à la méthicilline et sensible à la méthicilline dans des échantillons biologiques

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CUNY, C ET AL.: "PCR for the identification of methicillin resistant Staphylococcus aureus (MRSA) strains using a single primer pair specific for SCCmec elements and the neighbouring chromosome-borne orfX", CLIN MICROBIOL INFECT, vol. 11, 2005, pages 834 - 837 *
KATAYAMA, Y. ET AL.: "A New Class of Genetic Element, Staphylococcus Cassette Chromosome mec, Encodes Methicillin Resistance in Staphylococcus aureus", ANTIMICROBIAL AGENTS CHEMOTHERAPY, vol. 44, 2000, pages 1549 - 1555 *
RUPP, J. ET AL.: "Be Aware of the Possibility of False-Positive Results in Single-Locus PCR Assays for Methicillin-Resistant Staphylococcus aureus", J CLIN MICROBIOL, vol. 44, 2006, pages 2317 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014137906A1 (fr) * 2013-03-05 2014-09-12 Intelligent Medical Devices, Inc. Sondes et amorces optimisées et procédés d'utilisation de celles-ci pour la détection, le criblage, l'isolement et le séquençage de mrsa, mssa, des marqueurs de staphylococcus, et le gène meca de résistance à un antibiotique
CN105793436A (zh) * 2013-09-23 2016-07-20 奎斯特诊断投资股份有限公司 对生物样品中耐甲氧西林金黄色葡萄球菌的检测
EP3049537A1 (fr) * 2013-09-23 2016-08-03 Quest Diagnostics Investments Incorporated Détection de staphylococcus aureus résistant à la méticilline dans des échantillons biologiques
EP3049537A4 (fr) * 2013-09-23 2017-05-10 Quest Diagnostics Investments Incorporated Détection de staphylococcus aureus résistant à la méticilline dans des échantillons biologiques
US10385408B2 (en) 2013-09-23 2019-08-20 Quest Diagnostics Investments Incorporated Detection of methicillin-resistant Staphylococcus aureus in biological samples
US10407739B2 (en) 2013-09-23 2019-09-10 Quest Diagnostics Investments Incorporated Detection of methicillin-resistant Staphylococcus aureus in biological samples
US11674189B2 (en) 2013-09-23 2023-06-13 Quest Diagnostics Investments Llc Detection of methicillin-resistant Staphylococcus aureus in biological samples
CN110923344A (zh) * 2019-12-19 2020-03-27 武汉中帜生物科技股份有限公司 金黄色葡萄球菌及耐甲氧西林金黄色葡萄球菌耐药基因mecA检测试剂盒及其应用
CN110923344B (zh) * 2019-12-19 2023-06-27 武汉中帜生物科技股份有限公司 金黄色葡萄球菌及耐甲氧西林金黄色葡萄球菌耐药基因mecA检测试剂盒及其应用
CN112592993A (zh) * 2020-12-30 2021-04-02 广东省微生物研究所（广东省微生物分析检测中心） 含有特异性分子靶标的金黄色葡萄球菌标准菌株及其检测和应用
CN112592993B (zh) * 2020-12-30 2022-05-20 广东省微生物研究所（广东省微生物分析检测中心） 含有特异性分子靶标的金黄色葡萄球菌标准菌株及其检测和应用

Similar Documents

Publication Publication Date Title
US7888075B2 (en) Detection of methicillin-resistant and methicillin-sensitive Staphylococcus aureus in biological samples
US11499199B2 (en) Bordetella detection assay
JP7086122B2 (ja) 生物学的試料中のメチシリン耐性黄色ブドウ球菌の検出
US20210222232A1 (en) Kits for detecting mycobacterium avium/intracellulare nucleic acid
EP3442984B1 (fr) Méthodes de détection debordetella
WO2012009813A1 (fr) Procédés de détection de polymorphismes génétiques à l'aide de la température de fusion de complexes sonde—amplicon
EP2198057B1 (fr) Détection d'une pneumonie atypique
WO2010121298A1 (fr) Détection de staphylococcus aureus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10766491

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10766491

Country of ref document: EP

Kind code of ref document: A1