WO2010106180A2 - Optimized fc variants - Google Patents
Optimized fc variants Download PDFInfo
- Publication number
- WO2010106180A2 WO2010106180A2 PCT/EP2010/053644 EP2010053644W WO2010106180A2 WO 2010106180 A2 WO2010106180 A2 WO 2010106180A2 EP 2010053644 W EP2010053644 W EP 2010053644W WO 2010106180 A2 WO2010106180 A2 WO 2010106180A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- variant
- amino acid
- variants
- region
- fcrn
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- the present invention relates to a variant of a parent polypeptide comprising an Fc region.
- the said variant exhibits increased binding to FcRn as compared to the parent polypeptide and comprises at least one amino acid modification in its Fc region.
- Monoclonal antibodies are used as therapeutics, to treat a variety of conditions including cancer, autoimmune diseases, chronic inflammatory diseases, transplant rejection, infectious diseases, and cardiovascular diseases.
- monoclonal antibodies or monoclonal antibody fragment products approved on the market, and more than four hundred in clinical development.
- One of the critical issues in the use of monoclonal antibodies in therapy is their persistence in the blood circulation.
- the rate of antibody clearance directly affects the efficacy of therapy, and consequently, the frequency and the quantity of drug administration that may cause adverse effects in the patient and also increase medical costs.
- IgG is the most prevalent immunoglobulin class in humans and also the most utilized in therapeutic.
- IgG homeostasis has been elucidated through studies related to the transfer of passive immunity from mother to fetus or neonate in rodents (Brambell, 1966, Lancet; 2(7473):1087-93.; Rodewald, 1976, J Cell Biol.;71 (2):666-9; Jones et aL, 1972, J Clin Invest., 51 (11 ):2916-27).
- FcRn neonatal Fc receptor
- the FcRn is a heterodimer that comprises a transmembrane ⁇ -chain with structural homology to the extracellular domains of the ⁇ -chain of major histocompatibility complex class I molecules, and a soluble light chain consisting of ⁇ 2 -microglobulin ( ⁇ 2 m) (Simister and Mostov, 1989, Cold Spring Harb Symp Quant Biol.:54 Pt 1 :571 -80).
- the FcRn is expressed in placental cells, in intestinal, kidney and bronchial epithelial cells, in endothelial cells and in hematopoetic cells such as small intestinal macrophages, monocytes and monocyte-derived dendritic cells (Zhu X et aL, 2001 , J Immunol.; 166:3266-76).
- FcRn binds its two major ligands, IgG and serum albumin, in a pH-dependent manner, with efficient binding at pH 6.0-6.5 and releasing at pH 7.0-7.5 (Raghavan et al., 1995, Biochemistry., 34:14649-57).
- IgGs are internalized by non-specific pinocytosis into the endosomes of the endothelial cells where the low pH promotes binding to FcRn (Ghetie and Ward, 1997, Nat. Biotechnol.,15 : 637- 40). Bound IgG-FcRn complexes are recycled back to the cell surface and dissociate at the neutral pH of the extracellular fluid, returning to circulation in the blood. IgGs that do not bind to FcRn traffic into the lysosomes where they are degraded by proteases.
- the receptor According to the concentration-dependent catabolism mechanism for the survival of IgG, at low serum IgG concentrations the receptor would bind all endocytosed IgG, and efficiently return it to the circulation, yielding a long IgG half-life. Conversely, at high IgG concentrations, the receptor is saturated by IgG and a major fraction of the IgG is unbound by the receptor and traffics to be degraded, yielding a more rapid catabolism of the unbound IgG.
- Dall'Acqua et al. (2002, J lmmunol.;169:5171 -80) described random mutagenesis and screening of human IgGI hinge-Fc fragment phage display libraries against mouse FcRn. They disclosed random mutagenesis of positions 251 , 252, 254-256, 308, 309, 31 1 , 312, 314, 385-387, 389, 428, 433, 434, and 436.
- the major improvements in IgGI -human FcRn complex stability occur in substituting residues located in a band across the Fc-FcRn interface (M252, S254, T256, H433, N434, and Y436) and to lesser extend substitutions of residues at the periphery like V308, L309, Q311 , G385, Q386, P387, and N389.
- the variant with the highest affinity to human FcRn was obtained by combining the M252Y/S254T/T256E and H433K/N434F/Y436H mutations and exhibited a 57-fold increase in affinity relative to the wild-type IgGI .
- Hinton et al. (2004, J Biol Chem. ;279:6213-6) described two mutations, T250Q and M428L, which increased the binding of human lgG2 to human FcRn by about 3 and 7-fold, respectively. In combination, these two mutations induced a 28-fold increased binding capacity of lgG2. Injected to rhesus monkeys for pharmacokinetics studies, both lgG2 mutants, M428L and T250Q/M428L, showed half-lives about 2-fold longer than the wild- type antibody
- Dall'Acqua et a/. 2006, J. Biol. Chem.;281 :23514-24
- a humanized anti- respiratory syncytial virus IgGI whose Fc region was mutated at position 252, 254 and 256 (M252Y/S254T/T256E).
- These mutations increase the binding to human FcRn by about 10-fold at pH 6.0 while allowing efficient release at pH 7.4 (Dall'Acqua et aL, 2002, J lmmunol.;169:5171 -80).
- U.S. Pat. No. 6,165,745 discloses a method of producing an antibody with a decreased biological half-life by introducing a mutation into the DNA segment encoding the antibody.
- the mutation includes an amino acid substitution at position 253, 310, 31 1 , 433, or 434 of the Fc-hinge domain.
- PCT Publication No. WO 00/42072 discloses a polypeptide comprising a variant Fc region with altered FcRn binding affinity, which polypeptide comprises an amino acid modification at any one or more of amino acid positions 238, 252, 253, 254, 255, 256, 265, 272, 286, 288, 303, 305, 307, 309, 31 1 , 312, 317, 340, 356, 360, 362, 376, 378, 380, 386, 388, 400, 413, 415, 424, 433, 434, 435, 436, 439, and 447 of the Fc region, wherein the numbering of the residues in the Fc region is that of the EU index (Kabat et al., op. cit.).
- PCT Publication No. WO 02/060919 A2 discloses a modified IgG comprising an IgG constant domain comprising one or more amino acid modifications relative to a wild-type IgG constant domain, wherein the modified IgG has an increased half-life compared to the half-life of an IgG having the wild-type IgG constant domain, and wherein the one or more amino acid modifications are at one or more of positions 251 , 253, 255, 285-290, 308-314, 385-389, and 428-435.
- the present invention provides a variant of a parent polypeptide with optimized properties.
- the optimized properties comprise higher binding property to FcRn than the corresponding parent polypeptide.
- the said variant of a parent polypeptide comprises a Fc region, exhibits increased binding to FcRn as compared to the said parent polypeptide, and comprises at least one amino acid modification in the Fc region of said parent polypeptide, wherein said modification is selected from the group consisting of 226, 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259,
- the invention provides a pharmaceutical composition comprising the variant of the invention.
- the invention provides an isolated nucleic acid encoding the variant of the invention.
- the invention provides a vector comprising the nucleic acid described above.
- the invention provides a host cell containing a vector described above. In another embodiment, the invention provides a method for producing a polypeptide variant comprising culturing the host cell described above so that the nucleic acid is expressed.
- the invention provides a medicament comprising a variant of the invention. In another embodiment, the invention provides the use of a variant of the invention for the manufacture of a medicament.
- the invention provides a method for identifying Fc optimized variants. Brief description of the drawings
- Figure 1 shows the phagemid vector pMG58 in wich human Fc gene encoding amino acid residues 226-447 (EU index as in Kabat) derived from a human IgGI heavy chain (Fc226, SEQ n°1 ) was cloned into.
- CVDE C-terminal part of the VMA1 -derived endonuclease
- VMA vacuolar ATPase subunit
- CPIII C-terminal part of the capsid protein pill (or p3) of the phage M13
- FIG. 2 shows the methods used for Fc variants selection in solid phase (2A) and in solution (2B).
- FcRn-biot refers to biotinylated FcRn
- FcRn-p3 refers to FcRn-p3 fusion protein.
- the Fc-phage is bacteriophage M13 which expresses an Fc variant on its capsid.
- the wells of immunoplates are coated with FcRn-p3 fusion protein (Fc-Rn-p3) or with neutravidin followed by FcRn-biot.
- FIG. 3 shows the principle of phage-ELISA assay performed on selected Fc variants.
- the Fc-phage is a bacteriophage M13 which expresses an Fc variant on its capsid.
- FcRn-p3 is FcRn-p3 fusion protein coated on wells of immunoplates.
- Anti-M13 refers to mouse anti-M13 antibody fused to Horseradish peroxidase (HRP) used for ELISA detection.
- HRP Horseradish peroxidase
- Figure 4 shows a histogram which represents for each amino acid position of Fc IgGI the percentage of mutants comprising a modification at said position.
- X-coordinate amino acid number according to EU index as in Kabat of the mutated position.
- Y- coordinate percentage of Fc variants containing the position mutated.
- Figure 5a shows the principle of ELISA assay dedicated to measure the binding affinity of Fc variants for FcRn.
- FcRn-p3 is an FcRn-p3 fusion protein coated on wells of immunoplates.
- Fc is an Fc variant comprising V5 tag for ELISA detection.
- Anti-V5 is an anti-V5 antibody fused to HRP. The antibody is used for ELISA detection.
- Figure 5b shows the dose-effect curve for wild-type Fc (rounds) and Fc-H variant
- Figure 5c shows the dose-effect curves for wild-type Fc (rounds) and S3A_07 variant (squares) obtained by ELISA assay performed as described in Example 1 in IV.I .a.
- X-coordinate Concentration of Fc polypeptide.
- Y-coordinate percentage of FcRn bound to Fc polypeptide.
- Figure 5d shows the dose-effect curves for wild-type Fc (rounds) and S5A_41 variant (squares) obtained by ELISA assay performed as described in Example 1 in IV.I .a.
- X-coordinate Concentration of Fc polypeptide.
- Y-coordinate percentage of FcRn bound to Fc polypeptide.
- Figure 6 shows alignments of native human IgGI sequences referring to positions 216-447 (according to EU index in Kabat) with the corresponding sequences of human lgG2 (SEQ ID NO:14), human lgG3 (SEQ ID NO:15) and human lgG4 (SEQ ID NO:16).
- the IgGI sequences refer to G1 m1 ,17 allotype (SEQ ID NO:12) and to G1 m3 allotype (SEQ ID NO:13).
- the "lower hinge-CH2-CH3" domain of IgGI begins at position 216 (see arrow).
- Figure 7 shows the results of ELISA assays which were performed to show the Fc- variant binding affinity to FcRn at distinct pHs (see for more details Example 2, part IV.2).
- OD 450n m correlates with the amount of immobilized FcRn bound to Fc variants.
- Figure 8a illustrates a schematic map of the expression vector that is sued for expressing recombinant IgGI antibodies bearing Fc variants as described herein.
- the resulting recombinant IgGI antibodies possess binding specificity for the CD20 antigen.
- the nucleic acid encoding the heavy chain constant region bearing the mutations described in the specification and in the examples are inserted between the Apa1 and the Ascl cloning sites present in the HKCD20-Opti-GA vector.
- Figures 8b and 8c show SDS-PAGE of IgG variants under non reducing conditions and reducing conditions, respectively.
- (1) refers to IgG comprising wild-type Fc;
- (2) refers to IgG comprising Fc-H variant ;
- Figure 9 shows the dose-effect curve for IgG variants of the invention ("1 ”) and wild- type IgG ("2") obtained by ELISA assay performed as described in Example 2, 111.1 for characterizing the binding of IgG variants to FcRn.
- X-coordinate Concentration of IgG.
- Y- coordinate percentage of FcRn bound to IgG.
- Figure 10 shows the dose-effect curves obtained by ELISA assay for IgG variants of the invention in order to characterize their affinity to Fc ⁇ Rllla.
- (1 ) refers to the curve obtained for C6A_66 variant
- (2) refers to the curve obtained for Rituximab
- (3) refers to curves obtained for C6A_69; C6A_78; T5A_74 ; C6A_74 ; C6A_60 variants, and wild-type IgG .
- the ELISA assay was performed as described in Example 2, in part IV.1.
- X- coordinate Concentration of IgG.
- Y-coordinate percentage of Fc ⁇ Rllla bound to IgG.
- Figure 11 illustrates the binding of various recombinant IgG to Jurkat FcRn.
- Figure 11 shows the binding or Ritixan and of various variants according to the invention to Jurkat FcRn has been determined as described in the Materials and Methods Section above and expressed as mean fluorescence intensity (MFI) values.
- Figure 12 shows the dose-effect curves obtained in ADCC assay for de IgG variants of the invention. (1) refers to the curve of C6A_66 variant, (2) refers to the curve of
- Rituximab and (3) refers to the curves of LFB-R603, WT-IgG, and IgG variants of the invention (namely C6A_69; C6A_78; T5A_74 ; C6A_74 ; C6A_60 variants).
- X-coordinate Concentration of IgG.
- Y-coordinate percentage of cell lysis.
- polypeptide or "protein” as used herein is meant at least two covalently attached amino acids, which includes proteins, polypeptides, oligopeptides and peptides.
- amino acid as used herein is meant one of the 20 naturally occurring amino acids or any non-natural analogues that may be present at a specific, defined position.
- the naturally occurring amino acids can be abbreviated with the three letter code, or with the one letter code:
- position as used herein is meant a location in the sequence of a protein. For Fc region, the positions are numbered according to the EU index as in Kabat.
- amino acid modification herein is meant a change in the amino acid sequence of a polypeptide.
- amino acid modifications which may be also termed “amino acid changes” herein include amino acid substitution, insertion, and/or deletion in a polypeptide sequence.
- amino acid substitution or “substitution” herein is meant the replacement of an amino acid at a particular position in a parent polypeptide sequence with another amino acid.
- substitution N434S refers to a variant polypeptide, in this case an Fc variant, in which the asparagine at position 434 is replaced with serine.
- amino acid insertion or “insertion” as used herein is meant the addition of an amino acid at a particular position in a parent polypeptide sequence.
- insert G>235-236 designates an insertion of glycine between positions 235 and 236.
- amino acid deletion or “deletion” as used herein is meant the removal of an amino acid at a particular position in a parent polypeptide sequence.
- E294del designates the deletion of glutamic acid at position 294.
- 434S or N434S, means that the parent amino acid in position 434, i.e. asparagine, is replaced by serine.
- the preferred format is the following:
- variable region as used herein is meant the region of an immunoglobulin that comprises one or more Ig domains substantially encoded by any of the VK, V ⁇ , and/or VH genes that make up the kappa, lambda, and heavy chain immunoglobulin genetic loci respectively.
- Variables regions comprise Complementarity-Determining Regions (CDRs) and Framework Regions (FR).
- Fc or “Fc region”, as used herein is meant the polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain.
- Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains.
- Fc may include the J chain.
- Fc comprises immunoglobulin domains Cgamma2 and Cgamma3 (C ⁇ 2 and C ⁇ 3 which are CH2 and CH3 domains, respectively for IgGs) and the lower hinge region between Cgammal (C ⁇ 1 ) and Cgamma2 (C ⁇ 2).
- the human IgGI heavy chain Fc region is defined herein to comprise residues C226 to its carboxyl-terminus, wherein the numbering is according to the EU index as in Kabat.
- the lower hinge refers to positions 226-236
- the CH2 domain refers to positions 237-340
- the CH3 domain refers to positions 341 -447 according to the EU index as in Kabat.
- the corresponding Fc region of other immunoglobulins can be identified by sequence alignments.
- Fc may refer to this region in isolation, or this region in the context of an Fc polypeptide, as described below.
- Fc polypeptide as used herein is meant a polypeptide that comprises all or part of an Fc region.
- Fc polypeptides include, but are not limited to, antibodies, Fc fusions, isolated Fes, Fc-conjugates and Fc fragments.
- antibody refers to any polypeptide which at least comprises (i) a Fc region and (ii) a binding polypeptide domain derived from a variable region of an immunoglobulin.
- the said binding polypeptide domain is able to bind specifically one given target antigen or a group of target antigens.
- a binding polypeptide domain which derives from a variable region of an immunoglobulin comprises one or more CDRs.
- Antibodies include, but are not limited to, full-length immunoglobulins, monoclonal antibodies, multi-specific antibodies, Fc-fusion protein comprising at least one variable region, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, fully human antibodies, antibody- fusion proteins, antibody conjugates and fragments of each respectively.
- full-length antibody or by “immunoglobulin” as used herein is meant the structure that constitutes the natural biological form of an antibody, including variable and constant regions.
- Full-length antibody covers monoclonal full-length antibodies, wild-type full-length antibodies, chimeric full-length antibodies, humanized full-length antibodies, the list not being limitative. In most mammals, including humans and mice, the structure of full-length antibodies is generally a tetramer. Said tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (typically having a molecular weight of about 25 kDa) and one "heavy” chain (typically having a molecular weight of about 50-70 kDa). In some mammals, for example in camels and llamas, full-length antibodies may consist of only two heavy chains, each heavy chain comprising a variable domain attached to the Fc region.
- each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
- variable region three loops are gathered for each of the V domains of the heavy chain and light chain to form an antigen-binding site.
- Each of the loops is referred to as a complementarity-determining region (hereinafter referred to as a "CDR"), in which the variation in the amino acid sequence is most significant.
- CDR complementarity-determining region
- each chain defines a constant region primarily responsible for effector function.
- Kabat et al. collected numerous primary sequences of the variable regions of heavy chains and light chains. Based on the degree of conservation of the sequences, they classified individual primary sequences into the CDR and the framework and made a list thereof (see Sequences of Immunological Interest, 5th edition, NIH publication, No. 91 -3242, E. A. Kabat et al., incorporated by reference herein in its entirety).
- light chains are classified as kappa and lambda light chains.
- Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
- IgG has several subclasses, including, but not limited to IgGI , lgG2, lgG3, and lgG4.
- IgM has subclasses, including, but not limited to, IgMI and lgM2.
- isotype as used herein is meant any of the subclasses of immunoglobulins defined by the chemical and antigenic characteristics of their constant regions.
- the known human immunoglobulin isotypes are IgGI , lgG2, lgG3, lgG4, IgAI , lgA2, IgMI , lgM2, IgD, and IgE.
- IgG as used herein is meant a polypeptide belonging to the class of antibodies that are substantially encoded by a recognized immunoglobulin gamma gene.
- IgG comprises the subclasses or isotypes IgGI , lgG2, lgG3, and lgG4.
- IgG comprises IgGI , lgG2a, lgG2b, lgG3.
- IgGs are tetramers and consist of two identical pairs of two immunoglobulin chains, each pair having one light and one heavy chain, each light chain comprising immunoglobulin domains VL and CL, and each heavy chain comprising immunoglobulin domains VH, C ⁇ 1 (also called CH1 ), C ⁇ 2 (also called CH2), and C ⁇ 3 (also called CH3).
- CH1 refers to positions 118-220
- CH2 domain refers to positions 237-340
- CH3 domain refers to positions 341 - 447 according to the EU index as in Kabat.
- IgG heavy chain also comprises a hinge domain which refers to positions 221 -236 in the case of IgGL
- parent polypeptide or "polypeptide parent” as used herein is meant an unmodified polypeptide that is subsequently modified to generate a variant.
- Said parent polypeptide may be a naturally occurring polypeptide, a variant of a naturally occurring polypeptide, engineered version of a naturally occurring polypeptide or a synthetic polypeptide.
- Parent polypeptide may refer to the polypeptide itself, or the amino acid sequence that encodes it.
- the parent polypeptide comprises an Fc region selected from the group of wild-type Fc regions, their fragments and their mutants. Accordingly, the parent polypeptide may optionally comprise pre-existing amino acid modifications in its Fc region (i.e. an Fc mutant) as compared to wild-type Fc regions.
- parent polypeptide is an antibody, an immunoglobulin, an Fc fusion polypeptide, an Fc conjugate, this list not being limitative.
- parent immunoglobulin as used herein is meant immunoglobulin polypeptide that is modified to generate a variant immunoglobulin
- parent antibody as used herein is meant antibody that is modified to generate a variant antibody.
- parent antibody includes, but are not limited to, known commercial, recombinantly produced antibodies.
- at least one is equal to "one or more”.
- variant polypeptide By “variant polypeptide”, “polypeptide variant” or “variant” as used herein is meant a polypeptide sequence that differs from that of a parent polypeptide sequence by virtue of at least one amino acid modification.
- Variant may refer to Fc variant, Fc polypeptide variant, protein variant, antibody variant, immunoglobulin variant, IgG variant, this list not being limitative.
- immunoglobulin variant or “variant immunoglobulin” as used herein is meant an immunoglobulin sequence that differs from that of a parent immunoglobulin sequence by virtue of at least one amino acid modification.
- the parent polypeptide may be a naturally occurring or wild-type (WT) polypeptide, or may be a modified version of a WT polypeptide.
- Parent polypeptides of interest are polypeptides which comprise an Fc region as defined above.
- the variant of the invention has a polypeptide sequence that differs from that of a parent polypeptide sequence by virtue of at least one amino acid modification in the Fc region. Consequently a variant of interest comprises an Fc variant.
- Fc variant or “variant Fc” as used herein is meant an Fc sequence that differs from that of a parent Fc sequence by virtue of at least one amino acid modification.
- An Fc variant may be an isolated Fc region and fragments thereof, or may exist in the context of an antibody, Fc fusion, and fragments therefore, the list not being limitative.
- protein variant or “variant protein” as used herein is meant a protein that differs from a parent protein by virtue of at least one amino acid modification.
- antibody variant or “variant antibody” as used herein is meant an antibody that differs from a parent antibody by virtue of at least one amino acid modification.
- IgG variant or “variant IgG” as used herein is meant an antibody that differs from a parent IgG by virtue of at least one amino acid modification.
- the variant has at least one amino acid modification compared to the parent polypeptide, e.g. from about 1 to about 45 amino acid modifications, preferably from about 1 to about 20 amino acid modifications, and more preferably from about 1 to about 10 amino acid modifications.
- the variant sequence herein will preferably possess at least about 80% identity with its parent polypeptide sequence, and most preferably at least about 90% identity.
- a determined polypeptide having at least about 90% amino acid identity with a reference polypeptide possesses at least about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% amino acid identity with the said reference polypeptide.
- the sequences are aligned for optimal comparison purposes. For example, gaps can be introduced in one or both of a first and a second amino acid sequence for optimal alignment and nonhomologous sequences can be disregarded for comparison purposes.
- wild type or WT herein is meant an amino acid sequence or a nucleotide sequence that is found in nature, including allelic variations.
- a WT protein, polypeptide, antibody, immunoglobulin, IgG, etc. have an amino acid sequence or a nucleotide sequence that has not been intentionally modified.
- FcRn or "neonatal Fc Receptor” as used herein is meant a protein that binds the IgG antibody Fc region and is encoded at least in part by an FCRN gene.
- the FcRn may be from any organism, including but not limited to humans, mice, rats, rabbits, and monkeys.
- the functional FcRn protein comprises two polypeptides, often referred to as the heavy chain and light chain.
- the light chain is beta-2-microglobulin and the heavy chain is encoded by the FCRN gene.
- FcRn or FcRn protein refers to the complex of ⁇ -chain with beta-2-microglobulin.
- the gene coding for FcRn is called FCGRT.
- “increased FcRn binding” is meant the increase in binding affinity, in vivo or in vitro, of the variant of the invention to FcRn, compared to the parent polypeptide.
- the ability of the polypeptide variant to bind an FcRn may be evaluated in vitro by ELISA (Example 1 part IV.1. a ) or SPR technology (Example 1 part IV.I .b. ).
- the variants which have an enhanced binding property for FcRn most often have an enhanced serum retention in vivo and, thus, an increased half-life.
- in vivo half-life refers to a biological half-life of a polypeptide of interest in the circulation of a given animal and is represented by the time required for half the quantity present in the circulation of the animal to be cleared from the circulation and/or other tissues in the animal.
- the present invention is based on the identification of amino acid modifications of Fc region which modifications increase the binding affinity of the Fc region for FcRn.
- the amino acid modifications of interest have been determined by generating two Fc variants libraries by random mutagenesis and by measuring the binding property of said variants for FcRn.
- the present invention relates to variants of parent polypeptides comprising an Fc region which display increased binding to FcRn as compared to said parent polypeptides.
- a parent polypeptide of the invention is a polypeptide comprising an Fc region. Said polypeptide may comprise one single polypeptide chain or several polypeptide chains which are not covalently linked together.
- Parent polypeptides include, but are not limited to, antibodies, Fc fusion proteins, Fc conjugates, Fc derivated polypeptides, isolated Fc and fragments thereof.
- said parent polypeptide may be a naturally occurring polypeptide, a variant of a naturally occurring polypeptide, an engineered version of a naturally occurring polypeptide, a synthetic polypeptide or a polypeptide comprising a non- proteinous fragment.
- An engineered version of a naturally occurring polypeptide is a polypeptide with is not encoded by a naturally occurring gene.
- the engineered polypeptide may be a chimeric antibody or a humanized antibody.
- the Fc region of the parent polypeptide is preferably selected from the group consisting of wild-type Fc regions of IgGs, fragments and mutants thereof.
- Fc region of IgG corresponds to the "lower hinge"-CH2-CH3 domain (For IgGs, CH2 and CH3 are also called C ⁇ 2 and C ⁇ 3 domains).
- the sequence of "lower hinge"-CH2-CH3 domain of the wild type human IgGI is the sequence of SEQ ID NO:1.
- the lower hinge refers to positions 226-236
- the CH2 domain refers to positions 237-340
- the CH3 domain refers to positions 341 -447 according to the EU index as in Kabat.
- the analogous domains for other IgG sub-classes can be determined from amino acid sequence alignment of heavy chains or heavy chain fragments of said IgG sub-classes with that of human IgGI .
- Fragments of Fc region are defined as polypeptides which comprise one or more polypeptides derived from a wild-type Fc region, preferably from the "lower hinge-CH2- CH3" domain of a wild-type IgG.
- the said fragments have a dissociation constant for FcRn lower than 1 microM according to the SPR assay described in Example 1 part IV.1.).
- the parent polypeptide can comprise a wild-type Fc mutant i.e a Fc region which already comprises pre-existing amino acid modifications such as additions, insertions and/or substitutions with proviso that the said Fc mutant has a dissociation constant for FcRn lower than 1 microM according to the SPR assay described in Example 1 part IV.1. and is not a wild-type Fc region.
- a wild-type Fc mutant i.e a Fc region which already comprises pre-existing amino acid modifications such as additions, insertions and/or substitutions with proviso that the said Fc mutant has a dissociation constant for FcRn lower than 1 microM according to the SPR assay described in Example 1 part IV.1. and is not a wild-type Fc region.
- variant polypeptide or “variant” as used herein is meant a polypeptide sequence which differs from that of a parent polypeptide in virtue of at least one amino acid modification.
- the variant polypeptide according to the present invention displays an increased binding to FcRn as compared to the corresponding parent polypeptide. In other words, the affinity of the variant for FcRn is higher than that of the parent polypeptide.
- Such variants are optimized variants according to the invention.
- the affinity of the said polypeptides for FcRn can be evaluated by well-known methods of the prior art. For example, the one skilled in the art may determine the dissociation constant (Kd) using Surface Plasmon Resonance (SPR) experiments as illustrated in the Example 1 part IV.I .b. of the present application. If the variant has a Kd 1.1 -fold lower than that of its corresponding parent then the said variant is an optimized variant according to the invention.
- Kd dissociation constant
- SPR Surface Plasmon Resonance
- an appropriate ELISA assay enables to compare the bond strength of the variant and that of the parent to FcRn as illustrated in Example 1.
- the specific signals detected for the variant and the parent polypeptide are compared.
- the variant is an optimized variant of the invention if its specific signal is at least 1.2-fold stronger, more preferably at least 3.2- fold stronger than that of the parent polypeptide (i.e. at least as good as the Fc variant having the double amino acid modification T250Q/M428L).
- Appropriate ELISA assays are illustrated in Example 1 of the present application.
- the binding affinity can be indifferently determined by evaluating the full-length polypeptides (see Example 2 part III) or by evaluating the isolated Fc regions thereof (see Example 1 part IV).
- polypeptide variants of interest comprise at least one amino acid modification in its Fc region as compared to the parent polypeptide.
- the amino acid modifications are selected from the group consisting of amino acid insertions, deletions and substitutions.
- the at least one amino acid modification should be introduced at an amino acid position selected from the group consisting of 226, 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 290, 291 , 292, 294, 297, 298, 299, 301 , 302, 303, 305, 307, 308, 309, 311 , 315,317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384,
- the analogous positions for other Fc regions can be determined from amino acid sequence alignment of the said Fc regions with human IgGI heavy chain fragment comprising the polypeptide of SEQ ID NO:1.
- Fig. 6 depicts the sequence alignment of human IgGI , lgG2, lgG3 and lgG4 heavy chain fragments comprising "lower hinge-CH2-CH3" domain.
- the polypeptide variant preferably has from 1 to 20 and more preferably from 1 to 10 amino acid modifications, at positions selected from the list cited above.
- 1 to 20 amino acid modifications encompasses 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 and 20 amino acid modifications.
- the said polypeptide variant sequence preferably possesses at least about 90% identity with its parent polypeptide sequence.
- a determined polypeptide having at least about 90 % amino acids with a reference polypeptide possesses at least about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% amino acids identity with said reference polypeptide.
- the Fc variants of the present invention which display the highest binding affinity for
- FcRn generally comprise more than one amino acid modifications.
- the results obtained from phage ELISA assay described in example Il shows that the optimized variants comprising more than one amino acid modification may have a specific signal from about 3.2-fold to 30-fold stronger (see table 2 and table 3) than the wild-type Fc whereas the variants with a single point amino acid modification (see table 1 ) may have a signal from about 1.2-fold to 3.5-fold stronger than the wild-type Fc.
- the signal of the optimized variant may be from about 1 -fold to about 10-fold stronger than that of Fc-
- the said variant comprises at least two amino acid modifications selected from the list consisting of 226, 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 290, 291 , 292, 294, 297, 298, 299, 301 , 302, 303, 305, 307, 308, 309, 311 , 315,317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396, 3
- Fc variants which display the highest binding affinity for FcRn may have 3 to 6 amino acid modifications.
- the variant polypeptides of the invention may comprise 3 to 6 amino acid modifications at amino acid positions selected from the group consisting of 226, 227, 228, 230, 231 , 233, 234, 239, 241 , 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 290, 291 , 292, 294, 297, 298, 299, 301 , 302, 303, 305, 307, 308, 309, 31 1 , 315,317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361 , 362, 369, 370, 371 , 375, 378, 380, 382, 383, 384, 385, 386, 387, 389, 390, 392, 39
- Some amino acid positions of the above list - namely 226, 230, 241 , 264, 307, 315, 330, 342, 362, 378, 382, 389, 396, 397, 421 and 434 - are key positions.
- the Fc variants which display high binding affinity for FcRn are likely to comprise at least one amino acid modification at the said amino acid positions.
- the polypeptide variant according to the invention comprises at least one amino acid modification at amino acid positions selected from the group consisting of 226, 230, 241 , 264, 307, 315, 330, 342, 362, 378, 382, 389, 396, 397,
- the sequencing of the Fc variants which display the strongest binding for FcRn have shown that the amino acid positions 230, 264, 307, 315, 330, 378 and 434 are the most often mutated positions.
- the at least one modification occurs at one position selected from the group consisting of 230, 264, 307, 315, 330, 378 and 434, more preferably from the group consisting of 264, 315, 378 and 434 of the Fc region as compared to the parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index as in Kabat.
- the introduction of at least two amino acid modifications can noticeably enhance the binding affinity of Fc variant for FcRn as compared to the Fc parent.
- the polypeptide variant comprises at least two amino acid modifications, said at least two amino acid modifications comprising:
- the at least one amino acid modification (ii) can occur at any position of the list cited in (ii) except on position 434.
- polypeptide variant comprises at least two amino acid modifications, said at least two amino acid modifications comprising:
- the said variant comprises at least two amino acid modifications, said at least two amino acid modifications comprising:
- the said variant comprises at least two amino acid modifications comprising:
- the polypeptide variant comprises at least three amino acid modifications in its Fc region. Accordingly, the said at least three amino acid modifications may comprise:
- the polypeptide variant comprises at least three amino acid modifications, said at least three amino acid modifications comprising:
- the polypeptide variant comprises at least three amino acid modifications, said at least three amino acid modifications comprising: (i) one modification at an amino acid position selected from the group consisting of 378 and 434;
- amino acid modifications are preferably selected from the group consisting of amino acid substitutions and deletions.
- a further object of the invention relates to a variant of a parent polypeptide comprising a Fc region which exhibits increased binding to FcRn as compared to said parent polypeptide and comprises at least one amino acid modification in the Fc region selected from the group consisting of 226G, 226Y, 227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231 T, 231 V, 233D, 234R, 239A, 241 L, 241 Y, 241 R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y, 288R, 289I, 290R, 290E, 291 S, 291 Q, 292W, 294del,
- the said polypeptide comprises at least one modification selected from the group consisting of 226G, 227L, 230S, 230T, 230L, 231 T, 241 L, 243L, 250A, 256N, 259I, 264E, 265G, 267R, 290E, 294del, 303A, 305A, 307P, 307A, 308I, 315D, 322R, 325S, 327V, 330V, 342R, 347R, 352S, 361 D, 362R, 362E, 370R, 378V, 378T, 382V, 383N, 386R, 386K, 387T, 389T, 389K, 392R, 395A, 396L, 397M, 403T, 404L, 415N, 416K 1 421 T, 426T, 428L, 433R, 434Y, 434S and 439R of the Fc region,
- the said variant has from 1 to 20, more preferably from 1 to 10 amino acid modifications selected from the above lists, as compared to the parent polypeptide.
- from 1 to 20 modifications is meant 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 and 20 modifications.
- the said variant comprises from 3 to 6 amino acid modifications selected from the group consisting of 226G, 226Y, 227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231T, 231V, 233D, 234R, 239A, 241 L, 241 Y, 241 R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y, 288R, 289I, 290R, 290E, 291 S, 291 Q, 292W, 294del, 297D, 298G, 298N, 299M, 299A, 299K, 301 C, 302A, 303A, 303I, 305A
- the said polypeptide comprises from 3 to 6 amino acid modifications selected from the group consisting of 226G, 227L, 230S, 230T, 230L, 231 T, 241 L, 243L, 250A, 256N, 259I, 264E, 265G, 267R, 290E, 294del, 303A, 305A, 307P, 307A, 308I, 315D, 322R, 325S, 327V, 330V, 342R, 347R, 352S, 361 D, 362R, 362E, 370R, 378V, 378T, 382V, 383N, 386R, 386K, 387T, 389T, 389K, 392R, 395A, 396L, 397M, 403T, 404L, 415N, 416K 1 421 T, 426T, 428L, 433R, 434Y, 434S and 439R of the F
- the Fc variants which display high binding affinity to FcRn are likely to comprise at least one amino acid modification selected from the said key modifications.
- the said polypeptide variant may comprise at least one modification selected from the group consisting of 226G, 230S, 230T, 230L, 241 L, 264E, 307P, 315D, 330V, 342R, 362R, 362E, 378V, 378T, 382V, 389T, 389K, 396L, 397M, 421 T, 434Y and 434S of the Fc region compared to said parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index as in Kabat.
- the said polypeptide variant comprises at least one amino acid modification selected from the group consisting of 264E, 315D, 378V, 378T, 434Y and 434S of the Fc region as compared to said parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index as in Kabat.
- the said polypeptide variant comprises at least one amino acid modification selected from the group consisting of 378V, 378T, 434Y and 434S of the Fc region as compared to said parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index as in Kabat.
- the introduction of at least two amino acid modifications can noticeably enhance the binding of Fc variants to FcRn as compared to the parents.
- At least one of said modifications may be selected from the key modifications i.e. from the group consisting of 226G, 230S, 230T, 230L, 241 L, 264E, 307P, 315D, 330V, 342R, 362R, 362E, 378V, 378T, 382V, 389T, 389K, 396L, 397M, 421 T, 434Y and 434S.
- the said polypeptide variant comprises at least two amino acid modifications, the said at least two modifications comprising
- the said variant comprises at least two amino acid modifications, the said at least two modifications comprising
- the said variant comprises at least two amino acid modifications, the said at least two modifications comprising:
- a further object of the invention relates to a variant of a parent polypeptide comprising an Fc region which exhibits increased binding to FcRn as compared to said parent polypeptide and comprises at least one combination of amino acid modifications in the Fc region.
- the at least one combination of modifications is selected from the group consisting of: 226G/330V, 230L/264E, 230L/378V, 230S/315D, 230S/434Y, 230T/378V,
- the said variant may further comprise at least one modification selected from the group of 226G, 226Y, 227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231 T, 231 V, 233D, 234R, 239A, 241 L, 241 Y, 241 R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y, 288R, 289I, 290R, 290E, 291 S, 291 Q, 292W, 294del, 297D, 298G, 298N, 299M, 299A, 299K, 301 C, 302A, 303A, 303I, 305A, 307P, 307
- a variant according to the present invention comprises: (i) at least one combination of amino acid modifications selected from the group consisting of : 226G/330V, 230L/264E, 230L/378V, 230S/315D, 230S/434Y, 230T/378V, 241 L/434S, 250A/434Y, 264E/378T, 305A/315D, 305A/330V, 305A/434Y, 307P/434Y, 315D/389T, 330V/382V, 330V/389T, 378V/421T, 389K/434Y, 389T/434Y, 396L/434S, 230T/264E, 230T/315D, 230T/434S, 230T/434Y, 241 L/307P, 264E/307P, 264E/396L, 315D/362R, 315D/382V, 362R/434Y,
- the said variant comprises at least one combination of amino acid modifications selected from the group consisting of 250A/434Y, 307P/434Y,
- the said variant may further comprise at least one amino acid modification selected from the group of 226G, 226Y, 227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q,
- 264A, 264E, 264M 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L,
- a variant according to the present invention comprises: (i) at least one combination of amino acid modifications selected from the group consisting of :
- the said variant comprises at least one amino acid combination of modifications selected from the group consisting of:
- the said variant may comprise at least one additional modification selected from the group consisting of 226G, 226Y, 227S, 227L, 228R, 228L, 230S, 230T, 230L, 230A, 230Q, 231T, 231 V, 233D, 234R, 239A, 241 L, 241 Y, 241 R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y, 288R, 289I, 290R, 290E, 291 S, 291 Q, 292W, 294del, 297D, 298G, 298N, 299M, 299A, 299K, 301 C, 302A, 303A, 303I, 305A, 307P,
- a variant according to the present invention comprises:
- the said variant comprises at least one amino acid combination of modifications selected from the group consisting of:
- the said variant may further comprise at least one additional modification selected from the group consisting of 226G 1 226Y 1 227S 1 227L 1 228R 1 228L 1 230S 1 230T 1 230L 1 230A, 230Q, 231 T, 231 V, 233D, 234R, 239A, 241 L, 241 Y, 241 R, 243L, 246R, 250A, 252L, 256N, 259I, 264A, 264E, 264M, 265G, 265N, 267N, 267R, 269D, 269G, 270N, 270E, 276S, 284L, 285Y, 288R, 289I, 290R, 290E, 291 S, 291 Q, 292W, 294de
- a variant according to the present invention comprises:
- the said variant preferably has from 1 to 20, more preferably from 1 to 10 amino acid modifications as compared to the parent polypeptide.
- the said variant comprises one combination of amino acid modifications selected from the group consisting of 307A/315D/330V/382V/389T/434Y, 307A/315D/382V/389T/434Y, 256N/378V/383N/434Y, 256N/378V/434Y, 315D/330V/361 D/378V/434Y, 315D/361 D/378V/434Y, 2591/315D/434Y, 230S/315D/428L/434Y, 241 L/264E/307P/378V/433R, 250A/389K/434Y,
- the said variant comprises one combination of amino acid modifications selected from the group consisting of 256N/378V/434Y, 307A/315D/330V/382V/389T/434Y, 256N/378V/383N/434Y, 315D/330V/361 D/378V/434Y, 259I/315D/434Y and 230S/315D/428L/434Y.
- a further object of the invention is to provide polypeptide variants with increased binding for FcRn as compared to their parent polypeptides and comprising a Fc variant selected from the group consisting of 307A/315D/330V/382V/389T/434Y, 307A/315D/382V/389T/434Y 256N/378V/383N/434Y, 315D/330V/361 D/378V/434Y, 315D/361 D/378V/434Y 2591/315D/434Y, 230S/315D/428L/434Y,
- the polypeptide variant with increased binding for FcRn as compared to its parent polypeptide comprises a Fc variant selected from the group consisting of 256N/378V/434Y, 307A/315D/330V/382V/389T/434Y, 256N/378V/383N/434Y, 315D/330V/361 D/378V/434Y, 259I/315D/434Y and 230S/315D/428L/434Y.
- the Fc region of their parent polypeptides may derive from the Fc regions of wild-type IgGs (e.g "lower hinge-CH2-CH3") and fragments thereof.
- the Fc region of parent polypeptides derives from the human IgG subclasses namely IgGI , lgG2, lgG3 and lgG4.
- the Fc region of the parent polypeptides is selected from the group consisting of the wild-type IgGI Fc region (SEQ ID:NO1), the wild- type lgG2 Fc region (SEQ ID:NO2), the wild-type lgG3 Fc region (SEQ ID:NO3) and the wild-type lgG4 Fc region (SEQ ID:NO4).
- another object of the invention is a polypeptide comprising a IgGI Fc variant wherein said IgGI Fc variant comprises at least one amino acid modification as compared to the wild-type sequence of IgGI Fc (SEQ ID NO:1 ) and displays an increased binding to FcRn as compared to the wild-type IgGI Fc with the proviso that the sequence of said IgGI Fc variant is not SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.
- Another object of the invention is a polypeptide comprising an lgG2 Fc variant wherein said lgG2 Fc variant comprises at least one amino acid modification as compared to the wild-type sequence of lgG2 Fc (SEQ ID NO:2) and displays an increased binding to FcRn as compared to the wild-type lgG2 Fc with the proviso that the sequence of said lgG2 Fc variant is not SEQ ID NO:1 , SEQ ID NO:3 and SEQ ID NO:4.
- An additional object of the invention is a polypeptide comprising an lgG3 Fc variant wherein said lgG3 Fc variant comprises at least one amino acid modification as compared to the wild-type sequence of lgG3 Fc (SEQ ID NO:3) and displays an increased binding to FcRn as compared to the wild-type lgG3 Fc with the proviso that the sequence of said lgG3 Fc variant is not SEQ ID NO:1 , SEQ ID NO:2 and SEQ ID NO:4.
- Another object of the invention is a polypeptide comprising an lgG4 Fc variant wherein said lgG4 Fc variant comprises at least one amino acid modification as compared to the wild-type sequence of lgG4 Fc (SEQ ID NO:4) and displays an increased binding to
- the at least one amino acid modification comprised in the IgGI , lgG2, lgG3 or lgG4 Fc variant polypeptides are selected from the group of amino acid modifications and combinations of amino acid modifications that are described above in the instant specification when generally defining the variant of a polypeptide comprising an Fc region and having an increased binding to FcRn as compared to the corresponding parent polypeptide.
- a variant according to the invention exhibits an increased binding to FcRn as compared to the corresponding parent polypeptide.
- the effector functions and the other binding properties of the said variant are similar to that of the corresponding parent.
- the said variant may particularly exhibit no significant change in binding to Fc-gamma receptors or C1q as compared to its parent polypeptide.
- the said variant has an increased binding to FcRn combined with one or more altered effector functions and/or binding to Fc ligands (other than FcRn).
- the variant of the invention may have an increased binding to FcRn combined with unaltered binding to a Fc ⁇ R, in particular to Fc ⁇ Rllla, ADCC (Antibody-Dependent Cell-mediated Cytotoxicity) activity and CDC (Complement- Dependent Cytotoxicity) activity as compared to the polypeptide variant.
- the variant of the invention may also have an increased binding to FcRn combined with ADCC and CDC activities which are at least similar to that of its polypeptide parent.
- the variant of the invention may have an increased binding to FcRn combined with at least one reduced effector activity selected from ADCC and CDC as compared to its polypeptide parent.
- ADCC and CDC activities may be assessed by well-known methods of the prior art such as those described in Example 2 parts IV.2 and IV.3 of the present specification.
- the binding to Fc ⁇ R may be assessed by conventional methods such as SPR or
- a further object of the invention is to provide variants which optionally comprise additional amino acid modifications which differ from those cited previously with the proviso that the resulting variants have an increased binding to FcRn as compared to the parent polypeptide.
- Fc modifications of the present invention may be combined with other Fc modifications which are known to increase the Fc affinity for FcRn (see for example the references cited in the part of the present application dedicated to the description of the related art).
- the Fc modifications may be combined with other Fc modifications including but not limited to modifications that alter effector function or interaction with one or more Fc ligands. As a consequence, such variants may display an increased binding to
- FcRn combined with an altered binding to one Fc ligand (other than FcRn) or/and an altered effector function as compared to the parent polypeptide.
- Fc ligands include but are not limited to Fc ⁇ Rs (Fcgamma. receptors), C1q, C3, mannan binding lectin, mannose receptor, staphylococcal protein A, streptococcal protein G, and viral Fc ⁇ Rs.
- Fc ligands also include Fc receptor homologs (FcRH), which are a family of Fc receptors that are homologous to the FcgammaRs (Davis et al., 2002,
- effector function as used herein is meant a biochemical or cellular event that results from the interaction of an antibody Fc region with an Fc receptor or ligand. Effector functions include but are not limited to ADCC (Antibody-Dependent Cell-mediated
- ADCP Antibody-Dependent Cell-mediated Phagocytosis
- CDC CDC
- the variants of the present invention encompass any polypeptide comprising an Fc region and displaying an increased binding affinity for FcRn as compared to its parent polypeptide with the proviso that the said polypeptide differs from its parent polypeptide in virtue of at least one amino acid modification or combination of amino acid modifications in the Fc region.
- the modifications and the combinations of amino acid modifications of interest are those described above when giving general features of the variants according to the invention.
- the variants include, but are not limited to, antibodies, Fc fusion proteins, Fc conjugates, isolated Fc and their fragments respectively.
- the variants can be an Fc-comprising binding protein.
- the variants comprising (i) an Fc variant and (ii) a binding polypeptide domain which is able to specifically bind to a given molecule.
- the polypeptide variants of the invention are selected from the group consisting of Fc-fusion protein variants and Fc-conjugate variants.
- Fc-fusion protein and Fc-conjugates consist of an Fc region linked to a partner. The Fc region can be linked to its partner with or without a spacer.
- an Fc fusion protein is a protein encoded by a single gene and comprises a protein, a polypeptide or a small peptide linked to an Fc region.
- Fc fusion protein optionally comprises a peptide spacer.
- Virtually any protein or small molecule may be linked to Fc regions to generate an Fc fusion.
- Protein fusion partners may include, but are not limited to, the variable region of any antibody, a polypeptide derived from a variable region of any antibody, the target-binding region of a receptor, an adhesion molecule, a ligand, an enzyme, a cytokine, a chemokine, or some other protein or protein domain.
- the Fc-fusion protein can be an immunoadhesin i.e antibody-like protein which combines the binding domain of a heterologous "adhesion" protein (i.e receptor, ligand or enzyme) with a fragment of immunoglobulin constant domain (i.e. an Fc region) (see for a review about immunoadhesins, Ashkenazi A, Chamow SM. 1997, Curr Opin Immunol. ;9(2):195-200).
- adhesin i.e antibody-like protein which combines the binding domain of a heterologous "adhesion" protein (i.e receptor, ligand or enzyme) with a fragment of immunoglobulin constant domain (i.e. an Fc region)
- Small peptide fusion partners may include, but are not limited to, any therapeutic agent that directs the Fc fusion to a therapeutic target.
- targets may be any molecule, preferably an extracellular receptor that is implicated in disease.
- an Fc conjugate results from the chemical coupling of a Fc region with a conjugate partner.
- the conjugate partner can be proteinaceous or non-proteinaceous.
- the coupling reaction generally uses functional groups on the Fc region and on the conjugate partner.
- Various linkers are known in the art to be appropriate for the synthesis of conjugate; for example, homo-or hetero-bifunctional linkers are well known (see, Pierce Chemical Company catalog, 2005-2006, technical section on cross-linkers, pages 321 -350, incorporated herein by reference.
- Suitable conjugate partners include, but are not limited to, therapeutic polypeptides, labels (for example of labels, see further below), drugs, cytotoxic agents, cytotoxic drugs (e.g., chemotherapeutic agents), toxins and active fragments of such toxins.
- Suitable toxins and their corresponding fragments include, but are not limited to, diptheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin and the like.
- a cytotoxic agent may be any radionuclide which can be directly conjugated to the Fc variant or sequestrated by a chelating agent which is covalently attached to the Fc variant.
- the conjugate partners can be selected from the group consisting of calicheamicin, auristatins, geldanamycin, maytansine, and duocarmycins and analogs; (for the latter, see U.S. 200310050331 , hereby incorporated by reference in its entirety).
- Such variants of interest may have an increased binding to FcRn at lowered pH (e.g at about pH 6), and substantially unmodified binding at higher pH (e.g. at about pH 7,4).
- Fc-fusion protein and Fc-conjugate variants which display increased in vivo half-lives as compared to parent polypeptides.
- the polypeptide variant of the present invention is a variant antibody of a parent antibody.
- antibody refers to any polypeptide which at least comprises (i) a Fc region and (ii) a binding polypeptide domain derived from a variable domain of an immunoglobulin.
- the said binding polypeptide domain is able to bind specifically one given target antigen or a group of target antigens.
- a binding polypeptide domain which derives from a variable region of an immunoglobulin comprises at least one or more CDRs.
- antibodies include, but are not limited to, full-length immunoglobulins, monoclonal antibodies, multi-specific antibodies, Fc-fusion protein comprising at least one variable region, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies and fully human antibodies.
- Antibodies also encompass antibody-fusion proteins, antibody conjugates and fragments of each respectively.
- a variant antibody of the invention comprises, in its Fc region, at least one amino acid modification or combination of modifications above- cited that increase its binding affinity for FcRn as compared to its parent antibody.
- antibody variants that display increased binding affinity to FcRn at lowered pH (e.g at about pH 6), and have substantially unmodified binding at higher pH (e.g. at about pH 7,4).
- antibody variants which have increased in vivo half-lives as compared to parent polypeptides.
- a variant antibody of the invention is selected from the group consisting of variants of parent full-length antibodies.
- full length antibody herein is meant the structure that constitutes the natural biological form of an antibody, including variable and constant regions.
- the parent polypeptide of a full-length antibody variant of the present invention can be a wild-type antibody, a mutant of a wild-type antibody (e.g. comprising pre-existing modifications), an engineered version of a wild-type antibody (e.g. for example a chimeric, a humanized antibody or a fully human antibody, see further below), this list not being limitative.
- the structure of a full-length antibody is generally a tetramer except for some mammals such as llamas and camels in which some immunoglobulins are dimers.
- Each tetramer is typically composed of two identical pairs of polypeptide chains, each pair having one "light” (typically having a molecular weight of about 25 kDa) and one "heavy” chain (typically having a molecular weight of about 50-70 kDa).
- full-length antibodies are human immunoglobulins which encompass IgM, IgD, IgG, IgA and IgE classes.
- the said full-length antibody variant is selected from the group consisting of variants of IgGs.
- the said full-length antibody variant is selected from the group consisting of variants of human IgGI , lgG2, lgG3 and lgG4 with the proviso that the said Fc region sequence of said variant is not SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.
- the said IgG variant comprises one or more amino acid modifications as compared to its parent IgG, said one or more modifications or combinations of amino acid modifications are those previously described in the present specification when generally defining the variants of a polypeptide comprising a Fc region and having an increased binding to FcRn as compared to the corresponding parent polypeptide.
- the said antibody variant is selected from the group consisting of Fc-fusion protein comprising a binding polypeptide domain derived from a variable domain of an immunoglobulin.
- Fc-fusion protein comprising a binding polypeptide domain derived from a variable domain of an immunoglobulin.
- antibodies that comprise (a) a Fc variant of the inventions, and (b) one of the following binding polypeptide domains derived from a variable region of an immunoglobulin (i.e.
- the antibody is a minibody. Minibodies are minimized antibody-like proteins comprising a scFv joined to a CH3 domain (Hu et al., 1996, Cancer Res. 56:3055-3061 , incorporated by reference herein in its entirety). In some cases, the scFv can be joined to a full-length Fc region (De Lorenzo et al., 2005, Carcinogenesis 26:1890-1895, incorporated by reference herein its entirety), and may also include the hinge region or fragment thereof. In one embodiment, the antibodies of the invention are selected from the group of multispecific antibodies, and notably from the group of bispecific antibodies which are sometimes referred to as "diabodies". These antibodies bind to two (or more) different antigens.
- Diabodies can be manufactured in a variety of ways known in the art (Holliger and Winter, 1993, Current Opinion Biotechnol. 4:446-449, incorporated by reference herein in its entirety), e.g., chemically prepared or derived from hybridomas.
- the scaffold components of the antibody variants can be a mixture from different species.
- Such antibody variant may be a chimeric antibody and/or a humanized antibody.
- both “chimeric antibodies” and “humanized antibodies” refer to antibodies that combine regions from more than one species.
- “chimeric antibodies” traditionally comprise variable region(s) from a non-human animal, generally the mouse (or rat, in some cases) and the constant region(s) from a human.
- humanized antibodies are chimeric antibodies that contain minimal sequence derived from non human immunoglobulin.
- a humanized antibody the entire antibody, except the CDRs, is encoded by a polynucleotide of human origin or is identical to a human antibody except within its CDRs.
- the CDRs some or all of which are encoded by nucleic acids originating in a non-human organism, are grafted into the beta- sheet framework of a human antibody variable region to create an antibody, the specificity of which is determined by the engrafted CDRs.
- the creation of such antibodies is described in, e.g., WO 92/11018 ; Jones, 1986, Nature 321 :522-525 ; Verhoeyen et al., 1988, Science 239:1534-1536, all incorporated by reference herein in their entirety.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region, typically that of a human immunoglobulin, and thus will typically comprise a human Fc region.
- Humanized antibodies can also be generated using mice with a genetically engineered immune system (Roque et al., 2004, Biotechnol. Prog. 20:639-654, incorporated by reference herein in its entirety).
- a variety of techniques and methods for humanizing and reshaping non-human antibodies are well known in the art (See Tsurushita & Vasquez, 2004, Humanization of Monoclonal Antibodies, Molecular Biology of B Cells, 533-545, Elsevier Science (USA), and references cited therein, all incorporated by reference in their entirety).
- Humanization methods include but are not limited to methods described in Jones et al., 1986, Nature 321 :522-525 ; Riechmann et al.,1988; Nature 332:323-329 ; Verhoeyen et al., 1988, Science, 239:1534-1536 ; Queen et al., 1989, Proc Natl Acad Sci, USA 86:10029-33 ; He et al., 1998, J. Immunol. 160: 1029-1035 ; Carter et al., 1992, Proc Natl Acad Sci USA 89:4285-9 ; Presta et al., 1997, Cancer Res.
- Humanization or other methods of reducing the immunogenicity of nonhuman antibody variable regions may include resurfacing methods, as described for example in Roguska et al., 1994, Proc. Natl. Acad. Sci. USA 91 :969-973, incorporated by reference herein in its entirety.
- the said antibody variant is a fully human antibody with at least one amino acid modification as outlined herein.
- Fully human antibody or “complete human antibody” refers to an antibody entirely comprising sequences originating from human genes. In some cases this may be human antibodies that have the gene sequence of an antibody derived from a human chromosome with the modifications outlined herein. Alternatively, the components of the antibody may be human but not be derived from a single gene.
- human CDRs from one antibody can be combined with sequences, such as scaffold sequences, from one or more human antibodies.
- a variety of germline sequences can be combined to form a human antibody or human scaffold (e.g. for use in humanized or chimeric sequences as outlined above), as well as U.S. patent application Ser. No. 11/022,289, incorporated herein by reference in its entirety.
- the antibody variant of the invention is selected from the group consisting of chimeric IgGs, humanized IgGs and fully-human IgGs.
- Covalent modifications of antibodies are also included within the scope of this invention, and are generally, but not always, done post-translationally. Such modifications include, but are not limited to, glycosylates, labelling and conjugation.
- the polypeptide variants disclosed herein can be modified to include one or more engineered glycoforms.
- engineered glycoform as used herein is meant a carbohydrate composition that is covalently attached to the polypeptide comprising the Fc variant, wherein said carbohydrate composition differs chemically from that of a polypeptide parent.
- Engineered glycoforms may be useful for a variety of purposes, including but not limited to enhancing or reducing effector function.
- the engineered glycoforms can be attached at any amino acid of the variant sequence.
- the said glycoforms are attached at amino acids of the Fc region.
- Engineered glycoforms may be generated by a variety of methods known in the art (Uma ⁇ a et al., 1999, Nat Biotechnol 17:176-180; Davies et al., 2001 , Biotechnol Bioeng 74:288-294; Shields et al., 2002, J Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol Chem 278:3466-3473; U.S. Pat. No. 6,602,684; U.S. Ser. Nos.
- engineered glycoform may refer to the antibody variant that comprises the different carbohydrate or oligosaccharide.
- glycosylation patterns can depend on both the sequence of the protein (e.g., the presence or absence of particular glycosylation amino acid residues, discussed below), or the host cell or organism in which the protein is produced. Particular expression systems are discussed below.
- N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue.
- the tri-peptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain.
- O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose, to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used.
- Addition of glycosylation sites to the antibody is conveniently accomplished by altering the amino acid sequence such that it contains one or more of the above-described tri-peptide sequences (for N-linked glycosylation sites).
- the alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the starting sequence (for O-linked glycosylation sites).
- the antibody amino acid sequence is preferably altered through changes at the DNA level, particularly by mutating the DNA encoding the target polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
- Another means of increasing the number of carbohydrate moieties on the antibody is by chemical or enzymatic coupling of glycosides to the protein. These procedures are advantageous in that they do not require production of the protein in a host cell that has glycosylation capabilities for N- and O-linked glycosylation.
- the sugar(s) may be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteine, (d) free hydroxyl groups such as those of serine, threonine, or hydroxyproline, (e) aromatic residues such as those of phenylalanine, tyrosine, or tryptophan, or (f) the amide group of glutamine.
- Removal of carbohydrate moieties present on the starting antibody may be accomplished chemically or enzymatically.
- Chemical deglycosylation requires exposure of the protein to the compound trifluoromethanesulfonic acid, or an equivalent compound. This treatment results in the cleavage of most or all sugars except the linking sugar (N- acetylglucosamine or N-acetylgalactosamine), while leaving the polypeptide intact.
- Chemical deglycosylation is described by Hakimuddin et al., 1987, Arch. Biochem. Biophys. 259:52 and by Edge et al., 1981 , Anal. Biochem. 118:131.
- Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al., 1987, Meth. Enzymol. 138:350. Glycosylation at potential glycosylation sites may be prevented by the use of the compound tunicamycin as described by Duskin et al., 1982, J. Biol. Chem. 257:3105. Tunicamycin blocks the formation of protein-N-glycoside linkages.
- the antibody variant of the invention is selected from the group consisting of chimeric IgGs, humanized IgGs and fully-human IgGs which comprise engineered glycoforms.
- the covalent modification of the antibody variants of the invention comprises the addition of one or more labels. In some cases, these are considered antibody fusions.
- labeling group means any detectable label. In some embodiments, the labeling group is coupled to the antibody via spacer arms of various lengths to reduce potential steric hindrance. Various methods for labeling proteins are known in the art and may be used in performing the present invention.
- labels fall into a variety of classes, depending on the assay or on the diagnostic procedure in which they are to be detected: a) isotopic labels, which may be radioactive or heavy isotopes; b) magnetic labels (e.g., magnetic particles); c) redox active moieties; d) optical dyes; enzymatic groups (e.g. horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase); e) biotinylated groups; and f) predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.).
- a secondary reporter e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.
- Specific labels include optical dyes, including, but not limited to, chromophores, phosphors and fluorophores, with the latter being specific in many instances.
- Fluorophores can be either fluorescent "small molecules" fluorescent, or fluorescent proteins.
- the antibody variants of the present invention may be fused to or conjugated to a protein or a small molecule which are not used as a labelling group as described above. Virtually any protein or small molecule may be linked to an antibody.
- Protein fusion partners may include, but are not limited to, the target-binding region of a receptor, an adhesion molecule, a ligand, an enzyme, a cytokine, a chemokine, or some other protein or protein domain.
- Small molecules include, but are not limited to drugs, cytotoxic agents (e.g., chemotherapeutic agents), toxins or active fragments of such toxins.
- target antigen as used herein is meant the molecule that is bound specifically by the variable region of a given antibody or immunoglobulin.
- a target antigen may be a protein, a carbohydrate, a lipid, or other chemical compound.
- any antigen may be targeted, for example membrane proteins comprising but not limited to the RhD antigen, CD3, CD4, CD19, CD20, CD22, CD25, CD28, CD32B, CD33, CD38, CD40, CD44, CD52, CD71 (transferrin receptor), CD80, CD86, CTLA-4, CD147, CD160, CD224, growth factor receptors like those belonging to the ErbB family of receptors ErbB1 , ErbB2, ErbB3, ErbB4 (EGFR, HER2/neu, HER3, HER4), VEGF-R1 , VEGF-R2, IGF-FM 1 PIGF-R, MHC class I and MHC class Il molecules, e.g.
- HLA-DR interleukin receptors like IL-1 R, IL- 2R alpha, IL-2R beta and IL-2R gamma, IL-6R, hormone receptors like M ⁇ llerian inhibitory substance type Il receptor, LDL receptor, NKp44L, chemokine receptors like CXCR4 and CCR5, integrins, adhesion molecules like CD2, ICAM, EpCAM.
- the membrane proteins also include tumour markers like GD2, GD3, CA125, MUC-1 , MUC-16, carcinoembrionic antigen (CEA), Tn, glycoprotein 72, PSMA, HMW-MAA.
- Antibodies of the invention can also target soluble proteins, including but not limited to cytokines (for instance IL-1 beta, IL- 2, IL-6, IL-12, IL-23, TGF beta, TNF alpha, IFN gamma), chemokines, growth factors like VEGF-A, EGF, PIGF, PDGF, IGF, hormones, bacterial toxins and toxins of other origin like botulinus toxin, ricin, B. anthracis protective antigen, B. anthracis lethal factor, B. anthacis edema factor, shigatoxins 1 and 2, viral antigens from different viruses, for example pathogenic viruses, an inhibitory antibody, including a FVIII inhibitory antibody.
- cytokines for instance IL-1 beta, IL- 2, IL-6, IL-12, IL-23, TGF beta, TNF alpha, IFN gamma
- chemokines for instance IL-1 beta, IL- 2, IL-6, IL-12,
- the variant of the present invention may target CD20.
- the parent polypeptide can be selected from: EMAB6 or EMAB603 (see WO2006064121 ), RITUXIMAB (Rituxan®, IDEC/Genentech/Roche) (see for example U.S. Pat. No. 5,736,137, incorporated by reference in its entirety), HUMAX ⁇ -CD20, described in U.S. Pat. No.
- the variant of the present invention may target RhD antigen.
- the parent polypeptide can be selected from EMAB2 (see FR 03 12 229), SymOOI (Symphogen A/S) or MonoRho (ZLB, Zurich).
- the parent polypeptide may also be Avastin® (anti-VEGF), Remicade® (anti-TNF- ⁇ ), Erbitux®, Vectibix® (anti-EGFR), Tysabri® (anti-alpha4 chain of integrine), Herceptin® (anti-HER2/neu), the list not being limitative.
- Avastin® anti-VEGF
- Remicade® anti-TNF- ⁇
- Erbitux® anti-EGFR
- Tysabri® anti-alpha4 chain of integrine
- Herceptin® anti-HER2/neu
- the present application also provides variants that display an increased binding to FcRn combined with another optimized property selected from a variety of well-known therapeutically relevant properties.
- the most preferred property that may be optimized is the in vivo half-life.
- the variant should exhibit increased binding affinity to FcRn at lower pH, such as the pH associated with endosomes, e.g. pH 6.0, while maintaining the reduced affinity at higher pH, such as 7.4., to allow increased binding to FcRn into endosomes but normal release rates (Dall'Acqua et al., 2002, J. Immunol. 169: 5171-5180 ; Gurbaxani et al., 2006, MoI Immunol. 43(9):1462-73).
- these variants with such modulated FcRn binding may optionally have other desirable properties, such as modulated Fc ⁇ R binding.
- the variants are optimized to possess enhanced affinity for a human activating Fc ⁇ R, preferably Fc ⁇ Rllla in addition to the FcRn binding profile.
- the variants are optimized to have increased affinity for FcRn and increased or decreased affinity for a human Fc ⁇ R, including but not limited to Fc ⁇ RI, Fc ⁇ Rlla, Fc ⁇ Rllb, Fc ⁇ Rllc, and Fc ⁇ Rlllb including their allelic variations.
- the variants of the present invention may optionally have increased (or decreased) effector functions as well as an increased serum half-life.
- a variant of the invention may have increased ADCC activity and/or increased binding to a Fc ⁇ R as well as increased serum half-life as compared to its polypeptide parent.
- the variant of the invention may further have an increased CDC activity as compared to its polypeptide parent.
- the variants may find use in a wide range of products.
- the variant is a therapeutic, a diagnostic, or a research reagent, preferably a therapeutic.
- the variant of the invention are anticipated to have longer in vivo half-lives, more precisely longer in vivo serum half-lives than their parent polypeptides.
- such variants have useful applications as parent polypeptide substitutes when the parent polypeptide is too rapidly cleared from the blood circulation or for use in the treatment of chronic or long-term diseases which requires long half-life active principles.
- the variants When the variants are selected from the group of antibodies, they may find use in an antibody composition that is monoclonal or polyclonal.
- the said antibody variants are used to kill target cells that bear the target antigen, for example cancer cells.
- the variants are used to block, antagonize or agonize the target antigen, for example for antagonizing a cytokine or cytokine receptor, for neutralizing an infectious agent like a bacterium or a virus or a toxin, for example, a bacterial toxin.
- the variants are used to block, antagonize or agonize the target antigen and kill the target cells that bear the target antigen.
- a variant antibody is administered to a patient to treat an antibody-related disorder.
- a "patient” for the purposes of the present invention includes humans and other animals, preferably mammals and most preferably humans.
- antibody related disorder or “antibody responsive disorder” or “condition” or “disease” herein are meant a disorder that may be ameliorated by the administration of a pharmaceutical composition comprising a variant of the present invention.
- Antibody related disorders include but are not limited to autoimmune diseases, immunological diseases, infectious diseases, inflammatory diseases, neurological diseases, pain, pulmonary diseases, hematological conditions, fibrotic conditions, and oncological and neoplastic diseases including cancer.
- cancer and “cancerous” herein refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth.
- examples of cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma), neuroendocrine tumors, mesothelioma, schwanoma, meningioma, adenocarcinoma, melanoma, and leukemia and lymphoid malignancies.
- rheumatoid arthritis juvenile rheumatoid arthritis, Crohn's disease, ulcerative colitis, Sjorgren's disease, multiple sclerosis, ankylosing spondylitis, asthma, allergies and allergenic conditions, graft versus host disease, and the like.
- a further object of the invention is to provide pharmaceutical compositions comprising the said variant.
- the said formulations are prepared by mixing the polypeptide variant having the desired degree of purity with optional physiologically acceptable pharmaceutically acceptable carrier, excipients or stabilizers in the form of lyophilised formulations or aqueous solutions. (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed., 1980, incorporated by reference herein in its entirety). Such pharmaceutical compositions are destined for treating a patient in need.
- a therapeutically effective dose of the variant may be administered.
- therapeutically effective dose herein is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. Dosages may range from 0.001 to 100 mg/kg of body weight or greater, for example 0.1 , 1.0, 10, or 50 mg/kg of body weight, with 1 to 10mg/kg being preferred.
- Administration of the pharmaceutical composition comprising a variant may be done in a variety of ways, including, but not limited to, orally, subcutaneously, intravenously, parenterally, intranasally, intraortically, intraocularly, rectally, vaginally, transdermal ⁇ , topically (e.g., gels, salves, lotions, creams, etc.), intraperitoneal ⁇ , intramuscularly, intrapulmonary.
- orally subcutaneously, intravenously, parenterally, intranasally, intraortically, intraocularly, rectally, vaginally, transdermal ⁇ , topically (e.g., gels, salves, lotions, creams, etc.), intraperitoneal ⁇ , intramuscularly, intrapulmonary.
- Therapeutic described herein may be administered with other therapeutics concomitantly, i.e., the therapeutics described herein may be co-administered with other therapies or therapeutics, including for example, small molecules, other biologicals, radiation therapy, surgery, etc.
- Another object of the present invention is to provide isolated nucleic acids encoding variants according to the invention. Most often, the DNA encoding the parent polypeptide is available or can be obtained. Consequently, the DNA encoding the variant of interest can be generated by altering the DNA encoding parent polypeptide thanks to a variety of methods known in the prior art. These methods include, but are not limited to site-directed mutagenesis, random mutagenesis, PCR mutagenesis and cassette mutagenesis.
- Amino acid substitutions are preferably made by site-directed mutagenesis (see, for example, Zoller and Smith, 1982, Nucl. Acids Res. 10:6487-6500; Kunkel, 1985, Proc. Natl. Acad. Sci USA 82:488, which are hereby incorporated by reference in their entireties).
- the desired amino acid sequence encoding a polypeptide variant can be determined and thus can be generated synthetically by well- known methods of the prior art.
- the variants of the present invention can be made by any method known in the art.
- the variant sequences e.g. IgG variant sequences
- the variant sequences are used to create nucleic acids that encode the member sequences, and that may then be cloned into host cells, expressed and assayed, if desired.
- the nucleic acids that encode the variants may be incorporated into an expression vector in order to express the protein.
- Expression vectors typically include a protein operably linked, that is, placed in a functional relationship, with control or regulatory sequences, selectable markers, any fusion partners, and/or additional elements.
- the variant (e.g. IgG variants) of the present invention may be produced by culturing a host cell transformed with nucleic acid, preferably an expression vector, containing nucleic acid encoding the variant, under the appropriate conditions to induce or cause expression of the protein.
- host cell lines may be used, including but not limited to mammalian cells, bacteria, insect cells, and yeast.
- mammalian cell lines that may find use are described in the ATCC cell line catalog, available from the American Type Culture Collection.
- Host cells may be, but not limited to, YB2/0 (YB2/3HL.P2.GII.IGAg.2O cell, deposit to the American Type Culture Collection, ATCC n°CRL-1662), SP2/0, YE2/0, 1 R983F, Namalwa, PERC6, CHO cell lines, particularly CHO-K-1 , CHO-LeclO, CHO-Lecl, CHO-Lecl3, CHO Pro-5, CHO dhfr-, Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, KGH6, NSO, SP2/0-Ag 14, P3X63Ag8.653, C127, JC, LA7, ZR-45-30, hTERT, NM2C5, UACC-812 and the like.
- YB2/0 YB2/3HL.P2.GII.IGAg.2O cell, deposit to the American Type Culture Collection, ATCC n°CRL-1662
- a variant according to the present invention may be produced by a transgenic non-human animal or transgenic plant.
- a transgenic non-human animal can be obtained by directly injecting a desired gene into a fertilized egg (Gordon et a/., 1980 Proc Natl Acad Sci U S A.;77:7380-4).
- the transgenic non-human animals include mouse, rabbit, rat, goat, cow, cattle or fowl, and the like.
- a transgenic non-human animal having a desired gene can be obtained by introducing the desired gene into an embryonic stem cell and preparing the animal by an aggregation chimera method or injection chimera method (Manipulating the Mouse Embryo, A Laboratory Manual, Second edition, Cold Spring Harbor Laboratory Press (1994); Gene Targeting, A Practical Approach, IRL Press at Oxford University Press (1993)).
- Examples of the embryonic stem cell include embryonic stem cells of mouse (Evans and Kaufman, 1981 , Nature; 292:154-156), rat, goat, rabbit, monkey, fowl, cattle and the like.
- a transgenic non-human animal can also be prepared using a clonal technique in which a nucleus into which a desired gene is introduced is transplanted into an enucleated egg (Ryan et aL, 1997 Science; 278: 873 - 876 ; Cibelli et_a/., 1998 Science, 280 : 1256-1258).
- the polypeptide variant can be produced by introducing DNA encoding the variant molecule into an animal prepared by the above method to thereby form and accumulate the variant molecule in the animal, and then collecting the polypeptide variant from the animal.
- the polypeptide variant may be made to be formed and accumulated in the milk, egg or the like of the animal.
- Another object of the invention is to provide a method for identifying Fc variants which are optimized variants i.e. which have an increased binding for an Fc ligand as compared to a corresponding wild-type Fc region. Said method comprising the steps of:
- step (iii) selecting among the Fc variants produced in step (ii), those which are able to bind to the Fc ligand
- the nucleic acid sequences comprised in the said nucleic acid library may be RNA or DNA.
- the said library comprises DNA sequences encoding Fc variants.
- the Fc control is selected from the group consisting of wild-type Fc regions and known Fc variants which have binding property for the Fc ligand equal or higher than that of wild-type Fc.
- the Fc ligand can be selected from FcRn and Fc.gamma.receptors, the list not being limitative.
- the nucleic acids of the library which encode Fc variants can be generated by altering the DNA sequence encoding for the wild-type Fc.
- alter the nucleic acid sequence is meant the introduction of mutations such as insertions, deletions or substitutions of nucleotides in a given nucleic acid sequence. Such mutations can be performed by well-known methods of the prior art. These methods include, but are not limited to, random mutagenesis, site-directed mutagenesis, PCR mutagenesis and cassette mutagenesis.
- the library is generated by random mutagenesis based on the use of one or more low fidelity DNA polymerases.
- random mutagenesis is described in the PCT application WO0238756 incorporated by reference in its entirety.
- the library may be generated by the mixing of sub-libraries generated with one single polymerase or a specified combination of polymerases as described in the material and methods part of the example of the present application.
- the said nucleic acid library is generated by altering the DNA sequences encoding for a pool of pre-optimized Fc variants using one of the above- mentioned methods. Random mutagenesis is preferably used.
- Pre-optimized Fc variants are Fc variants which comprise at least one amino acid modification and display an increased binding for the Fc ligand as compared to the wild-type Fc.
- Pre-optimized Fc variants have preferably 1 to 4 amino acid modifications as compared to the wild-type Fc.
- Such pre-optimized Fc variants can be obtained from the screening of a library generated by mutation of a wild-type Fc.
- the pool of pre-optimized Fc variants comprises several polypeptides, more preferably from about 2 to about 100 pre-optimized variants.
- the libraries generated from pre-optimized variants enable to select more optimized
- Step (ii) i.e the expression of Fc variants can be performed by well-known methods using host cells as described previously.
- the Fc library is expressed on the surface of bacteriophages (phage display) using standard procedures (see Smith, Science, 1985, 228: 1315).
- Step (iii) can be performed by generating Fc variants-Fc ligand complexes and then separating the bound Fc variants from the unbound Fc variants.
- the Fc ligand may be advantageously immobilized on a solid support or should be able to be immobilized on a solid support during the process of step (iii). Examples of such procedures are described in Example 1 of the present application.
- the step (iii) preferably comprises several rounds of selection which enable to identify the most effective Fc ligands (for illustration see Example 2).
- step (iv) the binding properties of Fc variants for Fc ligand can be evaluated by well-known methods of the prior art.
- the one skilled in the art may perform an appropriate ELISA.
- the variant is selected if its specific signal is at least 1.2-fold stronger than that of the Fc parent.
- Appropriate ELISA assays can be performed on isolated Fc or on Fc displayed on phage as illustrated in example Il and in example IV of the present application.
- the one skilled in the art may determine the dissociation constant using Surface Plasmon Resonance (SPR) experiments as illustrated in the example IV of the present application. If the variant has a dissociation constant 3-fold lower then that of the Fc parent then the said variant is selected in step (v).
- SPR Surface Plasmon Resonance
- EXAMPLE 1 Identification of Fc variants with increased binding to FcRn as compared to Fc-WiId- type and binding characterization of said variants
- soluble human FcRn using the baculovirus system was performed by GTP Technology (Labege, France) as previously described (Popov et al., MoI. Immunol. 33:521 -530 (1996)).
- the derivative ⁇ -chain and the ⁇ 2 microglobulin chain were cloned into pFastBacDual under the P10 and polyhedrine promoters, respectively.
- FcRn- biot A biotinylated version of FcRn (FcRn- biot) was prepared by chemical coupling with the FluoReporter® Biotin-XX Protein Labeling Kit, F2610 (Molecular Probes) according to the manufacturer's protocol.
- a fusion protein was also produced containing the ⁇ 2 microglobulin chain and the ⁇ -chain fused to the amino terminal part of the bacteriophage p3 protein and the CVDE protein (FcRn-p3). More than 90% pure proteins were obtained after IgG-Sepharose and IMAC purification steps.
- Fc polypeptide derived from a human IgGI heavy chain (SEQ n°1 ), (Poul MA et al., Eur. J. Immunol. 25(7): 2005-2009 (1995) was cloned into the phagemid vector pMG58 (pMG58_Fc226, Fig. 1 ) as a BamHI/EcoRI fragment using standard PCR protocols.
- the said vector is depicted in Figure 1.
- Several fully randomised libraries were generated using the MUTAGENTM procedure (WO0238756) that uses low fidelity human DNA polymerases (mutases) to introduce random mutations homogeneously over the whole target sequence.
- the human Fc gene was double replicated with mutases using the 5' primer MG_619 : ⁇ '-AGTACTGACTCTACCTAGGATCCTGCCCACCGTGCS' (SEQ ID N°5) and the 3' primer MG_621 5'-ACTGCTCGATGTCCGTACTATGCGGCCGCGAATTC- 3' (SEQ ID N°6) ⁇ BamHI and EcoRI restriction sites are underlined and italic characters correspond to the non-specific tails).
- replication buffer was 5OmM Tris HCI pH 8.8, 1 OmM MgCI 2 , 1OmM KCI, 1 mM DTT and 1 % (v/v) glycerol.
- Replication buffer for pol ⁇ was 25mM Tris HCI pH 7.2, 5mM MgCI 2 , 1 OmM KCI, 1 mM DTT and 2.5% (v/v) glycerol.
- mutagenic replications were performed by adding 50 ⁇ M dATP/dCTP, 100 ⁇ M dTTP/dGTP and 1 ⁇ g of pol ⁇ or 100 ⁇ M dNTPs and 1 ⁇ g of pol ⁇ (or pol ⁇ and pol ⁇ , 1 ⁇ g of each mutase). The replication reaction was carried out at 37° C for two hours. The replication products were then desalted and concentrated on microcon columns (Millipore).
- the replication products previously obtained were amplified through a selective PCR with tail primers.
- the primers (MG_619 and MG_621 ) were designed with a tail that is non- complementary to the template allowing specific amplification of the DNA fragments synthesised by the mutases.
- a fraction of the replication products was added to a mixture containing the PCR buffer (2OmM Tris-HCI pH 8.4, 5OmM KCI), 1.5mM MgCI 2 , I Opmol of the 5' and 3' primers, 200 ⁇ M dNTPs and 1.25 U Platinum Taq DNA polymerase (InvitroGen).
- the PCR cycles were as follow, first cycle: 2 min. at 94° C, 10 sec. at 64° C, 30 sec. at 75°C, 1 min. at 94 0 C and then 30 selective cycles: 20 sec. at 94 0 C and 30 sec. at 75° C.
- the amplified replication products were purified on 1 % (w/v) agarose gels, digested with BamHI and EcoRI restriction enzymes and cloned into the pMG58 vector.
- the ligation mixtures were transformed in electrocompetent E. coll XL1 -Blue cells and subsequently plated on solid 2YT medium (16g/l peptones, 10g/l yeast extract, 5g/l NaCl, 15g/l agar) supplemented with 100 ⁇ g/ml ampicillin and 1 % (w/v) glucose. After growth, the number of colonies was determined to estimate the size of the libraries and 96 clones per library were randomly subjected to PCR and high throughput DNA sequencing. Cells were scrapped in
- Mut1 analysis the frequency of mutations of Mut1 library is of 6.3 mutations per kilo bases (kb), which means 4.2 mutations per gene (666 nt). Amongst these mutations,
- the mutation frequency is of 4.0 mutations per kb, i. e. 2.7 mutations per gene (1 to 6 mutated nucleotides per gene).
- the mutation analysis was also performed at the protein level to determine the active part of the library.
- the Mut1 library contains 28.6% of clones expressing the wild type fragment (non mutated or with silent mutations), 40.0% of clones containing a sequence out of frame or with a stop codon (not expressed) and 31.4% of clones with a mutated sequence (Fc variants). These last clones represent the active part of the library, comprising 3.5x10 6 different clones with on average 2.3 mutated amino acids per molecule.
- Mut2 analysis the frequency of mutations of Mut2 library is of 4.5 mutations per kilo bases (kb), which means 3.0 mutations per gene. Amongst these mutations, 96.3% are substitutions, 3.2% are deletions and 0.5% additions. When considering only the sequences in frame, the mutation frequency is of 4.3 mutations per kb, i. e. 2.9 mutations per gene (1 to 7 mutated nucleotides per gene).
- the Mut2 library contains 17.4% of clones expressing the wild type fragment (non mutated or with silent mutations), 9.3% of clones containing a sequence out of frame or with a stop codon (not expressed) and 73.3% of clones with a mutated sequence (Fc variants). These last clones represent the active part of the library, comprising 1.5x10 7 different clones with on average 1.9 mutated aa per molecule.
- the Fc library was expressed at the surface of the bacteriophage M13 using standard procedures (Smith GP, Science 228: 1315 (1985)).
- phages were precipitated with PEG6000 using standard protocols, resuspended in 1 ml phosphate buffer pH6 (sodium phosphate 10OmM, sodium chloride 5OmM pH6.0, called P6) and titrated by infecting XL1 -Blue cells.
- Three selection strategies were applied using different conditions (Fig. 2) and 3 to 8 rounds of selection were performed per strategy (see below). 11.1. Selections on solid phase (strategies 1 and 2) (see figure 2A):
- phages were first incubated with 25OnM or 10OnM biotinylated FcRn in 1 ml P6/5% skimmed milk/0.1 %Tween 20 for 1 hour at room temperature under low agitation. Streptavidin coated magnetic beads (Dynal), previously blocked with 5% skimmed milk in P6 were then added to the phages for 30 minutes at room temperature. Phage-bead complexes were washed 15 times with P6/0.1 % Tween 20 using a magnet (magnetic particle concentrator, Dynal). Phages were eluted by incubation in 500 ⁇ l phosphate buffer pH7.4 (sodium phosphate 10OmM, sodium chloride 5OmM, pH
- 2YT medium/ampicillin/glucose The following day, cells were scrapped in 2YT medium with 15% glycerol, frozen and kept at -80 0 C until the next round of selection.
- Fc Variants were named according to the round of selection from which they were isolated (for Mut1 screening: B3A to B6A for strategy 1 , S3A to S6A for strategy 2 and L3A/B to L6A-F for strategy 3, for Mut2 screening: C3A to C8A for strategy 1 , T3A to T8A for strategy 2 and M3A/B for strategy 3).
- phage-Fc variants were produced as isolated clones on a 96-well plate in 800 ⁇ l cultures in 2YT/ampicillin/glucose infected with helper phage M13K07 (as described in paragraph 3). Phages produced overnight at 26°C were recovered in the supernatants after 30 minutes centrifugation at 300Og.
- Fc-H variant is the double mutant T250Q/M428L and was described as having an improved affinity for FcRn (x28, Hinton PR et al., J. Biol. Chem. 279(8): 6213-6216 (2004)).
- This variant was generated by standard PCR protocols with two long oligonucleotides comprising the mutated codons and the restriction sites: 5' primer 5'- CGGGATCCTGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTC CTCTTCCCCCCAAAACCCAAGGACCAACTCATGATCTCCCGGAC -3' (SEQ ID NO:10) and 3' primer 5'-GCGAATTCTTTACCCGGAGACAGGGAGAGGCTCTTCTGCGTGTAGTG GTTGTGCAGAGCCTCATGCAGCACGGAGCATGAGAAG -3' (SEQ ID NO:1 1) (BamHI and EcoRI restriction sites are underlined and the characters in grey correspond to the mutated codons).
- the Fc-H variant had a specific signal on average 3.2-fold stronger than the wild type Fc, i.e. Fc-WT (ratio variant/Fc-WT) and amongst the 227 Fc-variants tested, 73 variants had a ratio/Fc-WT>3.2, which means that they had a better binding to FcRn than the Fc-H variant (table 2).
- Positive variants from MS1 and having a single point amino acid modification have a specific signal from about 1.2-fold to 3.5-fold stronger than the wild-type Fc (see table 1 ).
- Table 1 Variants having a single amino acid modification identified during MS1 or obtained by directed mutagenesis
- the 223 variants selected during MS2 were tested using the same ELISA protocol but in comparison with the Fc-H variant and the best Fc variant isolated during MS1 (S5A_41 ), because the difference between the Fc-WT signal and the signal of the Fc variants was too great to be compared on the same ELISA plate.
- 209 Fc variants were better than the Fc-H (ratio/Fc-H>1.1 ) and 39 Fc variant were better than the best Fc variant isolated during MS1.
- 16 positions are preferentially mutated and are considered as key positions: C226, P230, F241 , V264, T307, N315, A330, Q342, Q362, A378, E382, N389, P396, V397, N421 and N434.
- 4 positions are more preferably mutated and are considered as most preferred key positions: V264, N315, A378 and N434 ( Figure 4).
- the Fc-WT sequence as well as the Fc-H variant and Fc variants isolated during MS1 and MS2 were subcloned from the pMG58 phagemid vector into the pMG62 vector, using BamHI and EcoRI restriction sites, permitting soluble periplasmic expression with a C-terminal 6xHis tag for purification and a V5 tag for detection in ELISA assays.
- Production of recombinant Fc polypeptides was performed in HB2151 E. coli strain (induction with 0.5mM IPTG for 16 hours at 20 0 C). Purification was performed on Ni-NTA using standard protocols and around 200-500 ⁇ g of each polypeptide were obtained.
- the binding characteristics of the Fc variants produced in a soluble format were determined in comparison with the Fc-WT using an ELISA test at pH6.0 with FcRn-p3 coated on wells.
- Purified Fc variants (as described in III) serially diluted in P6/5% skimmed milk/0.1%Tween-20 were tested on Maxisorp immunoplates previously coated with 0.25 ⁇ g
- BIAcore X100 instrument using a CM5 sensor chip (Biacore, GE Healthcare). The methodology was similar to that previously described for analyzing Fc-FcRn interactions (Popov S. et al., MoI Immunol. 33(6):521 -530 (1996)). Recombinant soluble FcRn was coupled to flow cell 2 of the sensor chip using amine-coupling chemistry. The flow cells were activated for 3 min with a 1 :1 mixture of 0.1 M ⁇ /-hydroxysuccinimide and 0.1 M 3- ( ⁇ /, ⁇ /-dimethylamino)propyl- ⁇ /-ethylcarbodiimide at a flow rate of 30 ⁇ l/min.
- Recombinant human FcRn (5 ⁇ g/ml in 10 mM sodium acetate, pH 5.0) was injected over flow cell 2 for 8 min at 10 ⁇ l/min, which resulted in a surface density of 1200 to 1300 response units (RU). Surfaces were blocked with a 3-min injection of 1 M ethanolamine-HCI, pH 8.5. Flow cell 1 was used as a control surface without FcRn and was prepared similarly to sample flow cell. The data from this blank flow cell were subtracted from the sample data.
- Fc fragments were diluted in PBS/Tween-20 (50 mM phosphate buffer, pH 6.0, 150 mM NaCI, 0.02% NaN 3 , 0.01 % Tween-20) which is used as running buffer in equilibrium binding experiments. All measurements were performed at 25 0 C with Fc fragment concentrations typically ranging from 1 to 200 nM at a flow rate of 10 ⁇ l/min.
- the table 6 hereunder shows FcRn binding characterization of variants S5A 41 , S3A 07 and Fc-H as compared to Fc WT by (i) phage ELISA. (ii) ELISA and (iii) SPR. In all cases, variant S5A 41 displayed a significantly higher capacity to bind FcRn than Fc WT.
- Table 6 FcRn binding characterisation of the Fc variants using ELISA and Surface Plasmon Resonance (SPR).
- SPR Surface Plasmon Resonance
- Table 7 hereunder shows the results obtained for each MS2 variant tested by (i) SPR and (ii) ELISA. The previous results obtained by ELISA-phage are also indicated.
- Table 7 FcRn binding characterization of the Fc variants using ELISA and Surface Plasmon Resonance (SPR).
- SPR Surface Plasmon Resonance
- the capacity of the Fc variants to bind FcRn at different pHs was also assessed by ELISA assay.
- ELISA assays were performed at a concentration providing an OD450 nm ranging from 0.8 and 1.0 when performing the
- Figure 7 shows the results of ELISA assays obtained for each variant.
- OD 450 nm correlates with the amount of Fc variants bound to immobilized FcRn (detection of bound Fc variants with HRP anti-V5 antibody). The higher the specific signal at OD 450 nm was, the higher the binding of the Fc-variant to FcRn was.
- Figure 7 clearly shows that the binding of Fc variants with FcRn varies upon pH. As expected, the binding of Fc variants to FcRn at pH 7,4 is insignificant as compared to the binding at pH 6.0.
- the amino acid modifications introduced to obtain Fc variants of the present invention may significantly increase the binding to FcRn at pH 6.0 as compared to that of Fc-WT but may not significantly modify the binding at pH 7.4 which remains very low.
- IgG variants Production of IgG variants based on Fc variants and biological characterization of said IgG.
- the Fc variants C6A_69; C6A_78; T5A_74 ; C6A_74 ; C6A_60 and C6-A66 were prepared in a IgG format with an anti-CD20 specificity in YB2/0 cell line.
- IgG based on wild-type Fc IgG-WT
- the full length heavy and light chains cDNA as well as Fc fragment coding the variants were neo-synthetized with codon optimisation for Rattus norvegicus. Unwanted features such as cryptic splicing sites or restriction sites were removed. Only a restriction site (Apal) was present at the junction variable/constant region.
- wild-type heavy chain was cloned between Nhel and Ascl in the expression vector CHK622-08, optimized for expression in YB2/0, resulting in the intermediate construct HCD20-Opti-GA.
- the optimized light chain was then cloned between Spel and Xbal restriction sites resulting in the final construct HKCD20-Opti-GA for expression of the wild-type anti-CD20 antibody (named IgG-WT hereunder).
- Fc variants were prepared by replacing the wild IgGI Fc fragment present in HKCD20-Opti-GA by its appropriated version. This was cloned between Apal and Ascl restriction sites ( Figure 8a).
- the concentrated culture supernatants were injected into a HiTrap protein A FF column (GE Healthcare). Bound antibodies were eluted with sodium citrate buffer 0,1 M, pH 3.0 and fractions were neutralized using 100 ⁇ l of 1 M Tris pH 7.5 per ml of elution buffer. Fractions containing the antibodies were pooled and dialyzed into PBS pH 6.0, and the samples were sterile-filtered (0.22nm) and stored at 4 0 C.
- the purified IgGs were characterised by SDS-PAGE under non- reducing and reducing conditions. Coomassie Blue-stained gels indicated that the IgGs, whatever the mutations, were purified to greater than 95% homogeneity and displayed the characteristic heavy and light chain bands for each IgG ( Figure 8b and Figure 8c).
- the binding properties of IgG variants to FcRn were determined by three distinct tests : (i) by ELISA assay, (ii) by SPR and (iii) by a competition binding assay performed on Jurkat-cell line expressing a truncated FcRn in the presence of fluorescent-labelled Rituximab (an anti-CD20 IgG)
- the binding properties of the IgG variants produced in Y2B/O were determined using an ELISA test at pH6.0 with FcRn-p3 coated on wells. For comparative purpose,
- the percentage of bound FcRn was plotted versus the log of the concentration of IgG-variant.
- the measurement of the IgG concentration related to 50% saturation of the curve (EC50) was determined and compared to the EC50 of WT-IgG. .
- the ELISA tests showed that the produced IgG variants had an increased binding to FcRn as compared to that of WT-IgG. This fact is clearly illustrated by binding curves (see figure 9) and by EC50 values. As illustrated in table 9 hereunder, the EC50 of IgG-variants are at least 5.8-fold lower than that of wild-type IgG. The best EC50 is obtained for C6A_69 variant.
- Table 9 Concentration at 50% saturation (EC50) obtained from the ELISA binding curve of each IgG variant. The ratio refers to WT EC50 divided by variant EC50.
- FcRn was monitored by surface plasmon resonance (SPR) detection using a BIAcore X100 instrument (GE Healthcare).
- SPR surface plasmon resonance
- BIAcore X100 instrument GE Healthcare
- the experimental protocol was similar to that used for determining the affinity of Fc variants (see paragraph IV.2. b. above).
- the equilibrium RU observed for each injection was plotted against the concentration of Fc.
- the equilibrium Kd values were derived by analysis of the plots by using the steady-state affinity model included in the BIAevaluation software.
- Kinetic parameters were determined by global fitting of association and dissociation phase data with a model 1 : 2. lll.2.b. SPR results
- the binding affinity (Kd values) of the IgG-WT for human FcRn was 78,3 nM. As illustrated in table 10, The Kd values of the 6 IgG variants were ranged from 10.5 to 18.8 nM which showed an increase in affinity for FcRn at pH 6.0 of 4 to 7 fold as compared to that of IgG-WT.
- Table 10 Kd values obtained by SPR. The ratio refers to WT-Kd divided by variant Kd.
- Table 10 Kd values obtained by SPR. The ratio refers to WT-Kd divided by variant Kd.
- datasets for the interaction of the IgG WT and variants with human FcRn were fit with 1 :2 model included in the BIAevaluation software.
- the curves obtained with IgG WT didn't fit with the 1 :2 model whereas the curves obtained with the IgG variant C6A 66 and all other variants fit well with the model 1 :2 (data not shown).
- the enhanced affinity of the IgG variants for human FcRn relative to the WT were predominantly driven by increased association kinetics (kon values).
- the ratio that refer to variants kon divided by WT-kon ranged from 13 to 23, indicating a significant increase in affinity of variants to FcRn.
- the increased values of Koffof the IgG variants relative to WT were ranged from 2 to 4, displaying a faint impact of the dissociation as compared to the association.
- Table 11 Rates of dissociation (koff) and association (kon) determined by SPR III.3. Binding to Jurkat-FcRn lll.3.a. Material and method
- IgG WT and variants were diluted in PBS pH6 at a final concentration ranging from 0,06 to 2mg/ml and incubated with Jurkat FcRn (150000 cell) in the presence of Alexa-conjugated Rituximab (labelled Rituximab) at a concentration of 50 ⁇ g/ml. After 20 minutes, the cells were analyzed by flow cytometry in order to quantify Alexa-Rituximab binding. The results were expressed as a percentage of the mean fluorescence intensity
- MFI mean fluorescence intensity
- Controls comprise the incubation of (i) unlabelled Rituximab or (ii) IgG-WT.
- the MFI was plotted versus the log of IgG concentration.
- concentration (IC50) of each tested IgG which provides an inhibition of 50% of the MFI signal was determined.
- the IC50 obtained for the variants of the invention are significantly lower than that obtained for WT-IgG.
- the decrease in IC50 for IgG variants of the invention was from 40 to 60-fold except for C6A 66.
- Table 12 IC50 obtained for binding competition assay performed on Jurkat cells expressing FcRn in the presence of fluorescent-labelled Rituximab.
- IgG variants of the invention displayed a significant increased binding to FcRn as compared to that of IgG wild type.
- IgG variants The ability of IgG variants to bind Fc ⁇ receptors and their ADCC and CDC activities were assessed in order to fully-characterize their biological functions.
- the human recombinant Fc ⁇ RIIIA (F158 allotype) was biotinylated with EZ-link NHS-PEO kit (Pierce), diluted at 1 ⁇ g/ml in assay buffer (Tris 25 mM, NaCI 150 mM, pH 7.35, 0.05% Tween-20, 0.1 % BSA) and coated onto react-bindTM streptavidin ELISA plates (Pierce) for 2 h at room temperature.
- lgG-F(ab')2 anti-F(ab')2 complexes were prepared in assay buffer by mixing 5 ⁇ g/ml of IgG and 2 ⁇ g/ml F(ab')2 anti-human F(ab')2 labelled with horseradish peroxidase (Jackson ImmunoResearch) for 2 h at room temperature. Serial dilutions of complexes were added to plates and incubated for 2 h at room temperature under gentle shaking. After washing plates with assay buffer, bound complexes to hFc ⁇ RIIIA were detected with TMB (Pierce). Absorbance at 450 nm was read using a plate reader (Tecan).
- the percentage of bound Fc ⁇ RIIIA (which is obtained from OD450nm) was plotted versus the concentration of IgG-variant.
- the binding of IgG variants to hFc ⁇ RIIIA is similar to that of the IgG WT, except for variant C6A_66 which fails to bind hFc ⁇ RIIIA.
- ADCC activity The natural killer (NK cells) cells were purified from the peripheral blood of healthy donors by the negative depletion technique developed by the company Miltenyi.
- the ADCC test comprises incubating the NK cells with the target cells of the Raji line that express the CD20 receptor, in the presence of different concentrations of anti-CD20 antibodies. After 16 hours of incubation, the cytotoxicity induced by the anti-CD20 antibodies is chromogenically measured by quantifying in cell supernatants the level of an intracellular enzyme called lactate dehydrogenase (LDH) which is released by the lysed target cells. The results are shown in Figure 12.
- LDH lactate dehydrogenase
- lysis results are expressed as the percent lysis as a function of antibody concentration.
- EC50 quantitative of antibody that induces 50% of maximum lysis
- Control experiments were performed with (i) Rituximab, (ii) WT-IgG produced in Y2/0 cells and LFB-R603 which is an anti-CD20 antibody known to have ADDC function that has been described by de Romeuf et al.
- Table 13 hereunder shows the EC50 for each variant and compares the ADCC function of IgG variants with that of LFB-R603 and WT-IgG. All IgG variants display ADCC activity except C6A_66 variant. This variant has no
- C6A_69, C6A_60 and C6A_74 have an increased ADCC activity as compared to IgG-WT.
- the other variants namely C6A 78 and T5A 75
- EC50 quantitative of antibody that induces 50% of maximum lysis obtained from ADCC assay. The ratio refers variant EC50 divided by LFB-R603 EC50.
- the target CD20+ cells of the Raji line were incubated with different concentrations of anti-CD20 antibodies (0 to 5000 ng/ml) in the presence of baby rabbit serum as a source of complement (Cedarlane ref.: CL3441 , dilution to 1/10). After 1 hour of incubation at 37°C, the quantity of LDH released in the supernatant by the lysed target cells is measured chromogenically (Roche Applied Sciences Cytotoxicity Detection Kit) and is used to quantity the complement-dependent cytotoxicity mediated by the antibodies. The results are expressed as a percentage of lysis. EC50 (quantity of antibody that induces 50% of maximum lysis) and Emax (percentage of maximum lysis) were calculated using PRISM software.
- Table 14 hereunder shows the Emax and EC50 obtained for each variant.
- the level of CDC activity varies upon IgG variants.
- C6A_78 and C6A_60 have a CDC activity significantly higher that of IgG-WT whereas C6A_69, T5_74 and C6A_66 display low CDC activity.
- C6A_74 variant The CDC activity of C6A_74 variant is similar to that of IgG-WT.
- Table 14 EC50 (quantity of antibody that induces 50% of maximum lysis) obtained from CDC assay.
- the six IgG variants of the invention recombinantly produced in Y2B/0 cell line have an increased binding to FcRn receptor as compared to the IgG-WT (produced in the same host cell and in the same condition).
- IgG variants of the invention have at least the same binding affinity to FcgRIII and the at least the same ADCC activity than IgG-WT, except C6AA_66 which shows poor affinity for FcgRIII.
- the IgG variants display distinct CDC activities.
- amino acid modifications according to the invention enable to obtain IgG variants which have an increased binding for FcRn combined with one or more Fc effector activities which are at least similar to that of the corresponding parent IgG (i.e IgG-WT).
- amino acid modifications according to the invention enable to obtain IgG variants which have an increased binding for FcRn combined with at least one decreased Fc effector activity such as CDC or ADCC.
- Table 15 Main results obtained for the IgG variants of the invention as compared to IgG- WT ; ++: Increased binding to FcRn as compared to WT-IgG ; 71: Increased activity as compared to WT-IgG ; il: Decreased activity as compared to WT-IgG ; S ⁇ Activity similar to that of WT-IgG
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- Physical Education & Sports Medicine (AREA)
- Rheumatology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Neurology (AREA)
- Diabetes (AREA)
- Communicable Diseases (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Pain & Pain Management (AREA)
- Neurosurgery (AREA)
- Transplantation (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (19)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2012500274A JP5770710B2 (en) | 2009-03-20 | 2010-03-19 | Optimized Fc variant |
AU2010224800A AU2010224800B2 (en) | 2009-03-20 | 2010-03-19 | Optimized Fc variants |
US14/993,277 USRE46585E1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
KR1020117021990A KR101797248B1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
EP20151751.3A EP3674318A1 (en) | 2009-03-20 | 2010-03-19 | Optimized fc variants |
EP14163605.0A EP2805969B1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
BR122021019353-3A BR122021019353B1 (en) | 2009-03-20 | 2010-03-19 | VARIANT OF A PRECURSOR POLYPEPTIDE, PHARMACEUTICAL COMPOSITION, ISOLATED NUCLEIC ACID, VECTOR, HOST CELL, METHOD FOR PRODUCING A VARIANT, DRUG, AND, USE OF A VARIANT |
PL14163605T PL2805969T3 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
KR1020167034673A KR101781318B1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
CA2755905A CA2755905C (en) | 2009-03-20 | 2010-03-19 | Optimized fc variants |
US13/257,502 US8742074B2 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
KR1020167023815A KR101757136B1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
CN201080017521.8A CN102405231B (en) | 2009-03-20 | 2010-03-19 | The Fc variant optimized |
EP18175587.7A EP3395831B1 (en) | 2009-03-20 | 2010-03-19 | Optimized fc variants |
EP10709546A EP2408813A2 (en) | 2009-03-20 | 2010-03-19 | Optimized fc variants |
US14/338,413 USRE45992E1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
BRPI1014525-7A BRPI1014525B1 (en) | 2009-03-20 | 2010-03-19 | VARIANT OF A PRECURSOR POLYPEPTIDE, PHARMACEUTICAL COMPOSITION AND USE OF A VARIANT |
IL215041A IL215041A (en) | 2009-03-20 | 2011-09-08 | Optimized fc variants, pharmaceutical compositions and medicaments comprising the same and methods for their production |
IL245050A IL245050A0 (en) | 2009-03-20 | 2016-04-11 | Optimized fc variants, pharmaceutical compositions and medicaments comprising the same, and methods for their production |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP09305250A EP2233500A1 (en) | 2009-03-20 | 2009-03-20 | Optimized Fc variants |
EP09305250.4 | 2009-03-20 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP14163605.0A Previously-Filed-Application EP2805969B1 (en) | 2009-03-20 | 2010-03-19 | Optimized FC variants |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2010106180A2 true WO2010106180A2 (en) | 2010-09-23 |
WO2010106180A3 WO2010106180A3 (en) | 2010-12-09 |
Family
ID=40578514
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2010/053644 WO2010106180A2 (en) | 2009-03-20 | 2010-03-19 | Optimized fc variants |
Country Status (14)
Country | Link |
---|---|
US (3) | US8742074B2 (en) |
EP (5) | EP2233500A1 (en) |
JP (2) | JP5770710B2 (en) |
KR (3) | KR101797248B1 (en) |
CN (2) | CN102405231B (en) |
AU (1) | AU2010224800B2 (en) |
BR (2) | BRPI1014525B1 (en) |
CA (3) | CA2995516C (en) |
DK (1) | DK2805969T3 (en) |
ES (1) | ES2726625T3 (en) |
IL (2) | IL215041A (en) |
PL (1) | PL2805969T3 (en) |
TR (1) | TR201904385T4 (en) |
WO (1) | WO2010106180A2 (en) |
Cited By (125)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012132067A1 (en) * | 2011-03-30 | 2012-10-04 | 中外製薬株式会社 | Retention of antigen-binding molecules in blood plasma and method for modifying immunogenicity |
WO2012156309A1 (en) | 2011-05-13 | 2012-11-22 | Millegen | Antibodies against her3 |
EP2537864A1 (en) * | 2011-06-24 | 2012-12-26 | LFB Biotechnologies | Fc variants with reduced effector functions |
WO2012175692A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2012175691A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2013004842A3 (en) * | 2011-07-06 | 2013-04-04 | Genmab A/S | Antibody variants and uses thereof |
WO2013047748A1 (en) | 2011-09-30 | 2013-04-04 | 中外製薬株式会社 | Antigen-binding molecule promoting disappearance of antigens having plurality of biological activities |
WO2013047752A1 (en) | 2011-09-30 | 2013-04-04 | 中外製薬株式会社 | Antigen-binding molecule for promoting loss of antigens |
JP2013528357A (en) * | 2010-03-29 | 2013-07-11 | ザイムワークス,インコーポレイテッド | Antibody with enhanced or suppressed effector function |
WO2013125667A1 (en) | 2012-02-24 | 2013-08-29 | 中外製薬株式会社 | ANTIGEN-BINDING MOLECULE FOR PROMOTING DISAPPEARANCE OF ANTIGEN VIA FcγRIIB |
WO2014006217A1 (en) * | 2012-07-06 | 2014-01-09 | Genmab B.V. | Dimeric protein with triple mutations |
WO2014030728A1 (en) | 2012-08-24 | 2014-02-27 | 中外製薬株式会社 | Fcγriib-specific fc region variant |
EP2733153A1 (en) | 2012-11-15 | 2014-05-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the preparation of immunoconjugates and uses thereof |
WO2014108198A1 (en) | 2013-01-10 | 2014-07-17 | Genmab B.V. | Human igg1 fc region variants and uses thereof |
WO2014163101A1 (en) | 2013-04-02 | 2014-10-09 | 中外製薬株式会社 | Fc region variant |
JP2014528906A (en) * | 2011-09-30 | 2014-10-30 | 中外製薬株式会社 | Therapeutic antigen binding molecules with FcRn binding domains that promote antigen clearance |
FR3012453A1 (en) * | 2013-10-31 | 2015-05-01 | Lab Francais Du Fractionnement | CHIMERIC PROTEIN FOR THE TREATMENT OF AMYLOSIS |
WO2015067986A1 (en) | 2013-11-07 | 2015-05-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuregulin allosteric anti-her3 antibody |
WO2015100299A1 (en) * | 2013-12-24 | 2015-07-02 | Argen-X N.V. | Fcrn antagonists and methods of use |
EP2767548A3 (en) * | 2013-02-19 | 2015-07-15 | Argen-X B.V. | Modified IgG molecules |
US9187552B2 (en) | 2010-05-27 | 2015-11-17 | Merck Sharp & Dohme Corp. | Method for preparing antibodies having improved properties |
CN105377877A (en) * | 2013-05-31 | 2016-03-02 | 韩美药品株式会社 | Igg4 fc fragment comprising modified hinge region |
US9328170B2 (en) | 2011-05-25 | 2016-05-03 | Merck Sharp & Dohme Corp. | Method for preparing Fc containing polypeptides having improved properties |
WO2016091891A1 (en) | 2014-12-09 | 2016-06-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies against axl |
WO2016135066A1 (en) | 2015-02-26 | 2016-09-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Fusion proteins and antibodies comprising thereof for promoting apoptosis |
US9441032B2 (en) | 2010-04-07 | 2016-09-13 | Agency For Science, Technology And Research | Binding molecules against Chikungunya virus and uses thereof |
WO2016177984A1 (en) * | 2015-05-07 | 2016-11-10 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Fc mutants with modified functional activity |
US9493578B2 (en) | 2009-09-02 | 2016-11-15 | Xencor, Inc. | Compositions and methods for simultaneous bivalent and monovalent co-engagement of antigens |
WO2016188911A1 (en) | 2015-05-22 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor |
WO2017006052A2 (en) | 2015-07-06 | 2017-01-12 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Use of modified fc fragments in immunotherapy |
US9605061B2 (en) | 2010-07-29 | 2017-03-28 | Xencor, Inc. | Antibodies with modified isoelectric points |
US9605084B2 (en) | 2013-03-15 | 2017-03-28 | Xencor, Inc. | Heterodimeric proteins |
US9650446B2 (en) | 2013-01-14 | 2017-05-16 | Xencor, Inc. | Heterodimeric proteins |
US9701759B2 (en) | 2013-01-14 | 2017-07-11 | Xencor, Inc. | Heterodimeric proteins |
US9738722B2 (en) | 2013-01-15 | 2017-08-22 | Xencor, Inc. | Rapid clearance of antigen complexes using novel antibodies |
WO2017162678A1 (en) | 2016-03-22 | 2017-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Humanized anti-claudin-1 antibodies and uses thereof |
KR101792205B1 (en) | 2017-04-13 | 2017-10-31 | 재단법인 오송첨단의료산업진흥재단 | Antibody Fc variants for Prolonged Serum Persistence |
US9822186B2 (en) | 2014-03-28 | 2017-11-21 | Xencor, Inc. | Bispecific antibodies that bind to CD38 and CD3 |
US9828429B2 (en) | 2007-09-26 | 2017-11-28 | Chugai Seiyaku Kabushiki Kaisha | Method of modifying isoelectric point of antibody via amino acid substitution in CDR |
FR3051794A1 (en) * | 2016-05-31 | 2017-12-01 | Lab Francais Du Fractionnement | ANTIBODIES FOR THE TREATMENT OF CANCERS |
US9850320B2 (en) | 2014-11-26 | 2017-12-26 | Xencor, Inc. | Heterodimeric antibodies to CD3 X CD20 |
US9856327B2 (en) | 2014-11-26 | 2018-01-02 | Xencor, Inc. | Heterodimeric antibodies to CD3 X CD123 |
US9868948B2 (en) | 2008-04-11 | 2018-01-16 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly |
WO2018020000A1 (en) | 2016-07-29 | 2018-02-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies targeting tumor associated macrophages and uses thereof |
JP2018088938A (en) * | 2011-10-10 | 2018-06-14 | ゼンコア インコーポレイテッド | Method for purifying antibodies |
WO2018158398A1 (en) | 2017-03-02 | 2018-09-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to nectin-4 and uses thereof |
FR3064007A1 (en) * | 2017-03-20 | 2018-09-21 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | ANTIBODIES FOR THE TREATMENT OF CANCERS |
WO2018186717A1 (en) * | 2017-04-07 | 2018-10-11 | 국민대학교 산학협력단 | Antibody fc variants for improving blood half-life |
US10106624B2 (en) | 2013-03-15 | 2018-10-23 | Xencor, Inc. | Heterodimeric proteins |
KR101913743B1 (en) * | 2017-04-07 | 2018-11-01 | 국민대학교 산학협력단 | Antibody Fc variants for Prolonged Serum Half-Life |
US10131710B2 (en) | 2013-01-14 | 2018-11-20 | Xencor, Inc. | Optimized antibody variable regions |
US10227411B2 (en) | 2015-03-05 | 2019-03-12 | Xencor, Inc. | Modulation of T cells with bispecific antibodies and FC fusions |
US10227410B2 (en) | 2015-12-07 | 2019-03-12 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and PSMA |
EP3456736A1 (en) | 2017-09-19 | 2019-03-20 | Tillotts Pharma Ag | Antibody variants |
EP3456737A1 (en) | 2017-09-19 | 2019-03-20 | Tillotts Pharma Ag | Antibody variants |
US10239946B2 (en) | 2015-03-31 | 2019-03-26 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Cell line overexpressing human CD303 antigen |
US10316088B2 (en) | 2016-06-28 | 2019-06-11 | Xencor, Inc. | Heterodimeric antibodies that bind somatostatin receptor 2 |
EP3498293A1 (en) | 2017-12-15 | 2019-06-19 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Treatment of monogenic diseases with an anti-cd45rc antibody |
WO2019115773A1 (en) * | 2017-12-15 | 2019-06-20 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Variants with fc fragment having an increased affinity for fcrn and an increased affinity for at least one receptor of the fc fragment |
WO2019129848A1 (en) | 2017-12-29 | 2019-07-04 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Method for purifying antibodies from raw milk |
JP2019163262A (en) * | 2012-07-06 | 2019-09-26 | ゲンマブ ビー.ブイ. | Dimeric proteins with triple mutations |
US10428155B2 (en) | 2014-12-22 | 2019-10-01 | Xencor, Inc. | Trispecific antibodies |
US10487155B2 (en) | 2013-01-14 | 2019-11-26 | Xencor, Inc. | Heterodimeric proteins |
US10501543B2 (en) | 2016-10-14 | 2019-12-10 | Xencor, Inc. | IL15/IL15Rα heterodimeric Fc-fusion proteins |
US10519242B2 (en) | 2013-03-15 | 2019-12-31 | Xencor, Inc. | Targeting regulatory T cells with heterodimeric proteins |
US10526417B2 (en) | 2014-11-26 | 2020-01-07 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and CD38 |
US10538583B2 (en) | 2017-10-31 | 2020-01-21 | Staten Biotechnology B.V. | Anti-APOC3 antibodies and compositions thereof |
US10544187B2 (en) | 2013-03-15 | 2020-01-28 | Xencor, Inc. | Targeting regulatory T cells with heterodimeric proteins |
US10604561B2 (en) | 2016-09-16 | 2020-03-31 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
EP3632462A1 (en) * | 2012-07-06 | 2020-04-08 | Genmab B.V. | Dimeric protein with triple mutations |
JP2020055800A (en) * | 2011-07-06 | 2020-04-09 | ゲンマブ ビー.ブイ. | Antibody variants and uses thereof |
US10618965B2 (en) | 2011-02-25 | 2020-04-14 | Chugai Seiyaku Kabushiki Kaisha | Method for altering plasma retention and immunogenicity of antigen-binding molecule |
WO2020148207A1 (en) | 2019-01-14 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies binding to hla-a2 |
WO2020152290A1 (en) | 2019-01-23 | 2020-07-30 | Encefa | Cd31 competitors and uses thereof |
US10787518B2 (en) | 2016-06-14 | 2020-09-29 | Xencor, Inc. | Bispecific checkpoint inhibitor antibodies |
US10793632B2 (en) | 2016-08-30 | 2020-10-06 | Xencor, Inc. | Bispecific immunomodulatory antibodies that bind costimulatory and checkpoint receptors |
US10851178B2 (en) | 2011-10-10 | 2020-12-01 | Xencor, Inc. | Heterodimeric human IgG1 polypeptides with isoelectric point modifications |
US10858417B2 (en) | 2013-03-15 | 2020-12-08 | Xencor, Inc. | Heterodimeric proteins |
US20210010025A1 (en) * | 2017-10-18 | 2021-01-14 | Regenxbio Inc. | Treatment of ocular diseases with human post-translationally modified vegf-trap |
WO2021009263A1 (en) | 2019-07-16 | 2021-01-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity for cd38 and uses thereof |
US10934344B2 (en) | 2006-03-31 | 2021-03-02 | Chugai Seiyaku Kabushiki Kaisha | Methods of modifying antibodies for purification of bispecific antibodies |
US10968276B2 (en) | 2013-03-12 | 2021-04-06 | Xencor, Inc. | Optimized anti-CD3 variable regions |
US10981992B2 (en) | 2017-11-08 | 2021-04-20 | Xencor, Inc. | Bispecific immunomodulatory antibodies that bind costimulatory and checkpoint receptors |
US10982006B2 (en) | 2018-04-04 | 2021-04-20 | Xencor, Inc. | Heterodimeric antibodies that bind fibroblast activation protein |
US11001643B2 (en) | 2014-09-26 | 2021-05-11 | Chugai Seiyaku Kabushiki Kaisha | Cytotoxicity-inducing therapeutic agent |
WO2021116119A1 (en) | 2019-12-09 | 2021-06-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to her4 and uses thereof |
WO2021122733A1 (en) | 2019-12-18 | 2021-06-24 | F. Hoffmann-La Roche Ag | Bispecific anti-ccl2 antibodies |
US11046784B2 (en) | 2006-03-31 | 2021-06-29 | Chugai Seiyaku Kabushiki Kaisha | Methods for controlling blood pharmacokinetics of antibodies |
US11053308B2 (en) | 2016-08-05 | 2021-07-06 | Chugai Seiyaku Kabushiki Kaisha | Method for treating IL-8-related diseases |
US11053316B2 (en) | 2013-01-14 | 2021-07-06 | Xencor, Inc. | Optimized antibody variable regions |
US11072666B2 (en) | 2016-03-14 | 2021-07-27 | Chugai Seiyaku Kabushiki Kaisha | Cell injury inducing therapeutic drug for use in cancer therapy |
US11084863B2 (en) | 2017-06-30 | 2021-08-10 | Xencor, Inc. | Targeted heterodimeric Fc fusion proteins containing IL-15 IL-15alpha and antigen binding domains |
US11091539B2 (en) | 2016-07-08 | 2021-08-17 | Staten Biotechnology B.V. | Anti-ApoC3 antibodies and methods of use thereof |
US11098105B2 (en) | 2013-05-31 | 2021-08-24 | Zymeworks Inc. | Heteromultimers with reduced or silenced effector function |
US11124576B2 (en) | 2013-09-27 | 2021-09-21 | Chungai Seiyaku Kabushiki Kaisha | Method for producing polypeptide heteromultimer |
US11142587B2 (en) | 2015-04-01 | 2021-10-12 | Chugai Seiyaku Kabushiki Kaisha | Method for producing polypeptide hetero-oligomer |
US11168344B2 (en) | 2005-03-31 | 2021-11-09 | Chugai Seiyaku Kabushiki Kaisha | Methods for producing polypeptides by regulating polypeptide association |
WO2021228956A1 (en) | 2020-05-12 | 2021-11-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas |
US11180548B2 (en) | 2015-02-05 | 2021-11-23 | Chugai Seiyaku Kabushiki Kaisha | Methods of neutralizing IL-8 biological activity |
US11242381B2 (en) | 2017-04-21 | 2022-02-08 | Staten Biotechnology B.V. | Anti-ApoC3 antibodies and methods of use thereof |
US11248042B2 (en) | 2017-10-31 | 2022-02-15 | Staten Biotechnology B.V. | Polynucleotides encoding anti-ApoC3 antibodies |
US11312770B2 (en) | 2017-11-08 | 2022-04-26 | Xencor, Inc. | Bispecific and monospecific antibodies using novel anti-PD-1 sequences |
US11319355B2 (en) | 2017-12-19 | 2022-05-03 | Xencor, Inc. | Engineered IL-2 Fc fusion proteins |
US11332533B2 (en) | 2007-09-26 | 2022-05-17 | Chugai Seiyaku Kabushiki Kaisha | Modified antibody constant region |
US11358999B2 (en) | 2018-10-03 | 2022-06-14 | Xencor, Inc. | IL-12 heterodimeric Fc-fusion proteins |
US11472890B2 (en) | 2019-03-01 | 2022-10-18 | Xencor, Inc. | Heterodimeric antibodies that bind ENPP3 and CD3 |
US11505595B2 (en) | 2018-04-18 | 2022-11-22 | Xencor, Inc. | TIM-3 targeted heterodimeric fusion proteins containing IL-15/IL-15RA Fc-fusion proteins and TIM-3 antigen binding domains |
WO2022253756A1 (en) | 2021-06-01 | 2022-12-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of b cell depleting agents for the treatment of rheumatic heart disease |
US11524991B2 (en) | 2018-04-18 | 2022-12-13 | Xencor, Inc. | PD-1 targeted heterodimeric fusion proteins containing IL-15/IL-15Ra Fc-fusion proteins and PD-1 antigen binding domains and uses thereof |
WO2022263501A1 (en) | 2021-06-18 | 2022-12-22 | F. Hoffmann-La Roche Ag | Bispecific anti-ccl2 antibodies |
US11591388B2 (en) | 2019-06-07 | 2023-02-28 | argenx BV | Pharmaceutical formulations of FcRn inhibitors suitable for subcutaneous administration |
US11591401B2 (en) | 2020-08-19 | 2023-02-28 | Xencor, Inc. | Anti-CD28 compositions |
US11649262B2 (en) | 2015-12-28 | 2023-05-16 | Chugai Seiyaku Kabushiki Kaisha | Method for promoting efficiency of purification of Fc region-containing polypeptide |
RU2800558C1 (en) * | 2013-05-31 | 2023-07-24 | Ханми Фарм. Ко., Лтд. | IGG4 Fc FRAGMENT CONTAINING A MODIFIED HINGE REGION |
US11739144B2 (en) | 2021-03-09 | 2023-08-29 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and CLDN6 |
US11795232B2 (en) | 2017-02-17 | 2023-10-24 | Denali Therapeutics Inc. | Engineered transferrin receptor binding polypeptides |
US11820793B2 (en) | 2011-11-30 | 2023-11-21 | Chugai Seiyaku Kabushiki Kaisha | Drug containing carrier into cell for forming immune complex |
US11851476B2 (en) | 2011-10-31 | 2023-12-26 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule having regulated conjugation between heavy-chain and light-chain |
US11858980B2 (en) | 2016-08-02 | 2024-01-02 | Visterra, Inc. | Engineered polypeptides and uses thereof |
US11859012B2 (en) | 2021-03-10 | 2024-01-02 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and GPC3 |
US11891432B2 (en) | 2018-03-15 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
US11891434B2 (en) | 2010-11-30 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding to plurality of antigen molecules repeatedly |
US11919956B2 (en) | 2020-05-14 | 2024-03-05 | Xencor, Inc. | Heterodimeric antibodies that bind prostate specific membrane antigen (PSMA) and CD3 |
WO2024052503A1 (en) | 2022-09-08 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Antibodies having specificity to ltbp2 and uses thereof |
WO2024061930A1 (en) | 2022-09-22 | 2024-03-28 | Institut National de la Santé et de la Recherche Médicale | New method to treat and diagnose peripheral t-cell lymphoma (ptcl) |
Families Citing this family (28)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120071634A1 (en) | 2009-03-19 | 2012-03-22 | Chugai Seiyaku Kabushiki Kaisha | Antibody Constant Region Variant |
EP2543730B1 (en) | 2010-03-04 | 2018-10-31 | Chugai Seiyaku Kabushiki Kaisha | Antibody constant region variant |
KR102099580B1 (en) | 2010-11-17 | 2020-04-10 | 추가이 세이야쿠 가부시키가이샤 | Multi-specific antigen-binding molecule having alternative function to function of blood coagulation factor VIII |
CN110655578A (en) | 2011-09-30 | 2020-01-07 | 中外制药株式会社 | Antigen binding molecules that induce an immune response against a target antigen |
WO2013074598A1 (en) * | 2011-11-18 | 2013-05-23 | Merck Sharp & Dohme Corp. | Fc CONTAINING POLYPEPTIDES HAVING INCREASED ANTI-INFLAMMATORY PROPERTIES AND INCREASED FcRN BINDING |
KR102041412B1 (en) * | 2011-12-30 | 2019-11-11 | 한미사이언스 주식회사 | Derivatives of Immunglobulin Fc fragment |
KR20150016579A (en) | 2012-05-30 | 2015-02-12 | 추가이 세이야쿠 가부시키가이샤 | Target-tissue-specific antigen-binding molecule |
PL2906235T3 (en) * | 2012-10-02 | 2017-12-29 | Proclara Biosciences, Inc. | Use of p3 of bacteriophage fusion proteins as amyloid binding agents |
KR102116495B1 (en) * | 2013-08-28 | 2020-06-03 | 삼성디스플레이 주식회사 | Organic light-emitting diode comprising condensed cyclic compound |
CA2923145A1 (en) * | 2013-09-05 | 2015-03-12 | Amgen Inc. | Fc-containing molecules exhibiting predictable, consistent, and reproducible glycoform profiles |
WO2015054039A1 (en) * | 2013-10-08 | 2015-04-16 | Merck Sharp & Dohme Corp. | Fc CONTAINING POLYPEPTIDES HAVING INCREASED BINDING TO FcGammaRIIB |
WO2015073307A2 (en) * | 2013-11-13 | 2015-05-21 | Merck Sharp & Dohme Corp. | Fc CONTAINING POLYPEPTIDES HAVING INCREASED BINDING TO HUMAN DC-SIGN |
WO2015112597A1 (en) * | 2014-01-21 | 2015-07-30 | Belmont Biosciences, Inc. | Variants of igg fc with limited amine groups that retain functional properties |
US20170211876A1 (en) * | 2014-06-12 | 2017-07-27 | Hoffmann-La Roche Inc. | Method for selecting antibodies with modified fcrn interaction |
FR3024453B1 (en) * | 2014-08-01 | 2018-06-29 | Lab Francais Du Fractionnement | PROCESS FOR PRODUCING VARIANTS HAVING FC HAVING ENHANCED SIALYLATION |
TWI831538B (en) | 2014-12-19 | 2024-02-01 | 日商中外製藥股份有限公司 | ANTI-MYOSTATIN ANTIBODIES, POLYPEPTIDES CONTAINING VARIANT Fc REGIONs, AND METHODS OF USE |
FR3039832A1 (en) * | 2015-08-04 | 2017-02-10 | Univ Francois Rabelais De Tours | IGG1 AND THEIR THERAPEUTIC USE |
FR3053688A1 (en) * | 2016-07-06 | 2018-01-12 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | FC MUTANTS WITH IMPROVED FUNCTIONAL ACTIVITY |
KR101872455B1 (en) * | 2016-11-30 | 2018-06-28 | 국민대학교 산학협력단 | Antibody Fc Region Comprising a New Mutation |
CN108101992B (en) * | 2017-12-31 | 2021-03-26 | 武汉班科生物技术股份有限公司 | CH2 structural domain mutant with enhanced binding with neonatal Fc receptor, and preparation method and application thereof |
MA51666A (en) * | 2018-01-24 | 2020-12-02 | Genmab Bv | POLYPEPTIDIC VARIANTS AND THEIR USES |
JP2018138022A (en) * | 2018-02-23 | 2018-09-06 | ゲンマブ ビー.ブイ. | Human igg1 fc region variants and uses thereof |
GB201809341D0 (en) * | 2018-06-07 | 2018-07-25 | Ucb Biopharma Sprl | Multi-domain proteins with increased native state colloidal stability |
AU2019359475A1 (en) | 2018-10-12 | 2021-05-20 | Xencor, Inc. | PD-1 targeted IL-15/IL-15Ralpha Fc fusion proteins and uses in combination therapies thereof |
WO2020114616A1 (en) | 2018-12-07 | 2020-06-11 | Tillotts Pharma Ag | Topical treatment of immune checkpoint inhibitor induced diarrhoea, colitis or enterocolitis using antibodies and fragments thereof |
EP3897853A1 (en) | 2018-12-20 | 2021-10-27 | Xencor, Inc. | Targeted heterodimeric fc fusion proteins containing il-15/il-15ra and nkg2d antigen binding domains |
TW202128757A (en) | 2019-10-11 | 2021-08-01 | 美商建南德克公司 | Pd-1 targeted il-15/il-15ralpha fc fusion proteins with improved properties |
KR20240019034A (en) * | 2022-08-02 | 2024-02-14 | 주식회사 파노로스바이오사이언스 | Modified fusion protein and the use thereof |
Citations (27)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2228904A (en) | 1939-05-10 | 1941-01-14 | Bjorkman Hugo Leonard | Wrench |
WO1987005330A1 (en) | 1986-03-07 | 1987-09-11 | Michel Louis Eugene Bergh | Method for enhancing glycoprotein stability |
US4703039A (en) | 1984-04-10 | 1987-10-27 | New England Deaconess Hospital Corporation | Method of producing biologically active molecules having extended life time |
WO1991014438A1 (en) | 1990-03-20 | 1991-10-03 | The Trustees Of Columbia University In The City Of New York | Chimeric antibodies with receptor binding ligands in place of their constant region |
WO1992011018A1 (en) | 1990-12-19 | 1992-07-09 | Protein Design Labs, Inc. | Improved humanized immunoglobulins |
US5500362A (en) | 1987-01-08 | 1996-03-19 | Xoma Corporation | Chimeric antibody with specificity to human B cell surface antigen |
WO1996032478A1 (en) | 1995-04-14 | 1996-10-17 | Genentech, Inc. | Altered polypeptides with increased half-life |
WO1997043316A1 (en) | 1996-05-10 | 1997-11-20 | Beth Israel Deaconess Medical Center, Inc. | Physiologically active molecules with extended half-lives and methods of using same |
US5736137A (en) | 1992-11-13 | 1998-04-07 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma |
US5747035A (en) | 1995-04-14 | 1998-05-05 | Genentech, Inc. | Polypeptides with increased half-life for use in treating disorders involving the LFA-1 receptor |
US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
WO1999043713A1 (en) | 1998-02-25 | 1999-09-02 | Lexigen Pharmaceuticals Corporation | Enhancing the circulating half-life of antibody-based fusion proteins |
WO2000009560A2 (en) | 1998-08-17 | 2000-02-24 | Abgenix, Inc. | Generation of modified molecules with increased serum half-lives |
WO2000042072A2 (en) | 1999-01-15 | 2000-07-20 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2000061739A1 (en) | 1999-04-09 | 2000-10-19 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
US6165745A (en) | 1992-04-24 | 2000-12-26 | Board Of Regents, The University Of Texas System | Recombinant production of immunoglobulin-like domains in prokaryotic cells |
WO2001029246A1 (en) | 1999-10-19 | 2001-04-26 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing polypeptide |
WO2001077181A2 (en) | 2000-04-12 | 2001-10-18 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anti-rhesus d monoclonal antibodies |
WO2002031140A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions |
WO2002030954A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Method of purifying antibody |
WO2002038756A1 (en) | 2000-11-08 | 2002-05-16 | Millegen | Use of mutagenic dna polymerase for producing random mutations |
WO2002060919A2 (en) | 2000-12-12 | 2002-08-08 | Medimmune, Inc. | Molecules with extended half-lives, compositions and uses thereof |
US20030050331A1 (en) | 2001-05-31 | 2003-03-13 | Medarex Inc. | Cytotoxic agents |
US6602684B1 (en) | 1998-04-20 | 2003-08-05 | Glycart Biotechnology Ag | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
WO2006064121A2 (en) | 2004-12-15 | 2006-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Cytotoxic antibody directed against type b lymphoid hematopoietic proliferations |
FR2894983A1 (en) | 2005-12-16 | 2007-06-22 | Lab Francais Du Fractionnement | Measuring the capacity of antibodies preparation to activate Fc receptor, useful e.g. to evaluate cell capacity to produce monoclonal antibody, comprises aggregating the antibodies, contacting with the cells and measuring |
US11392902B2 (en) | 2017-06-06 | 2022-07-19 | United Parcel Service Of America, Inc. | Systems, methods, apparatuses and computer program products for providing notification of items for pickup and delivery |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2228908A (en) | 1939-07-12 | 1941-01-14 | Blaw Knox Co | Ferrous alloy mill roll |
AU600575B2 (en) * | 1987-03-18 | 1990-08-16 | Sb2, Inc. | Altered antibodies |
ES2532910T3 (en) * | 1998-04-02 | 2015-04-01 | Genentech, Inc. | Antibody variants and fragments thereof |
US7183387B1 (en) * | 1999-01-15 | 2007-02-27 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2385069A3 (en) * | 2003-11-12 | 2012-05-30 | Biogen Idec MA Inc. | Neonatal Fc rReceptor (FcRn)- binding polypeptide variants, dimeric Fc binding proteins and methods related thereto |
CN101124245A (en) * | 2003-11-12 | 2008-02-13 | 比奥根艾迪克Ma公司 | Neonatal Fc receptor (FcRn)-binding polypeptide variants, dimeric Fc binding proteins and methods related thereto |
KR101027427B1 (en) * | 2004-11-12 | 2011-04-11 | 젠코어 인코포레이티드 | Fc VARIANTS WITH INCREASED BINDING TO FcRn |
US8802820B2 (en) * | 2004-11-12 | 2014-08-12 | Xencor, Inc. | Fc variants with altered binding to FcRn |
KR100932915B1 (en) | 2007-12-11 | 2009-12-21 | 한국전자통신연구원 | Radial Control Device and Method |
MX2011004001A (en) * | 2008-10-14 | 2011-05-19 | Genentech Inc | Immunoglobulin variants and uses thereof. |
US20100113929A1 (en) | 2008-10-31 | 2010-05-06 | National Tsing Hua University | High-frequency ultrasonic imaging system and method |
US10817851B2 (en) | 2009-12-23 | 2020-10-27 | Aristocrat Technologies Australia Pty Limited | System and method for cashless gaming |
-
2009
- 2009-03-20 EP EP09305250A patent/EP2233500A1/en not_active Withdrawn
-
2010
- 2010-03-19 TR TR2019/04385T patent/TR201904385T4/en unknown
- 2010-03-19 KR KR1020117021990A patent/KR101797248B1/en active IP Right Grant
- 2010-03-19 US US13/257,502 patent/US8742074B2/en not_active Ceased
- 2010-03-19 US US14/993,277 patent/USRE46585E1/en active Active
- 2010-03-19 CN CN201080017521.8A patent/CN102405231B/en active Active
- 2010-03-19 KR KR1020167034673A patent/KR101781318B1/en active IP Right Grant
- 2010-03-19 CN CN201510303059.2A patent/CN104892762A/en active Pending
- 2010-03-19 EP EP20151751.3A patent/EP3674318A1/en active Pending
- 2010-03-19 EP EP14163605.0A patent/EP2805969B1/en active Active
- 2010-03-19 CA CA2995516A patent/CA2995516C/en active Active
- 2010-03-19 AU AU2010224800A patent/AU2010224800B2/en active Active
- 2010-03-19 CA CA2755905A patent/CA2755905C/en active Active
- 2010-03-19 BR BRPI1014525-7A patent/BRPI1014525B1/en active IP Right Grant
- 2010-03-19 KR KR1020167023815A patent/KR101757136B1/en active IP Right Grant
- 2010-03-19 BR BR122021019353-3A patent/BR122021019353B1/en active IP Right Grant
- 2010-03-19 ES ES14163605T patent/ES2726625T3/en active Active
- 2010-03-19 DK DK14163605.0T patent/DK2805969T3/en active
- 2010-03-19 US US14/338,413 patent/USRE45992E1/en active Active
- 2010-03-19 CA CA3069425A patent/CA3069425C/en active Active
- 2010-03-19 JP JP2012500274A patent/JP5770710B2/en active Active
- 2010-03-19 EP EP10709546A patent/EP2408813A2/en not_active Withdrawn
- 2010-03-19 EP EP18175587.7A patent/EP3395831B1/en active Active
- 2010-03-19 PL PL14163605T patent/PL2805969T3/en unknown
- 2010-03-19 WO PCT/EP2010/053644 patent/WO2010106180A2/en active Application Filing
-
2011
- 2011-09-08 IL IL215041A patent/IL215041A/en active IP Right Grant
-
2015
- 2015-06-24 JP JP2015126168A patent/JP5951856B2/en active Active
-
2016
- 2016-04-11 IL IL245050A patent/IL245050A0/en active IP Right Grant
Patent Citations (27)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2228904A (en) | 1939-05-10 | 1941-01-14 | Bjorkman Hugo Leonard | Wrench |
US4703039A (en) | 1984-04-10 | 1987-10-27 | New England Deaconess Hospital Corporation | Method of producing biologically active molecules having extended life time |
WO1987005330A1 (en) | 1986-03-07 | 1987-09-11 | Michel Louis Eugene Bergh | Method for enhancing glycoprotein stability |
US5500362A (en) | 1987-01-08 | 1996-03-19 | Xoma Corporation | Chimeric antibody with specificity to human B cell surface antigen |
WO1991014438A1 (en) | 1990-03-20 | 1991-10-03 | The Trustees Of Columbia University In The City Of New York | Chimeric antibodies with receptor binding ligands in place of their constant region |
WO1992011018A1 (en) | 1990-12-19 | 1992-07-09 | Protein Design Labs, Inc. | Improved humanized immunoglobulins |
US6165745A (en) | 1992-04-24 | 2000-12-26 | Board Of Regents, The University Of Texas System | Recombinant production of immunoglobulin-like domains in prokaryotic cells |
US5736137A (en) | 1992-11-13 | 1998-04-07 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma |
WO1996032478A1 (en) | 1995-04-14 | 1996-10-17 | Genentech, Inc. | Altered polypeptides with increased half-life |
US5747035A (en) | 1995-04-14 | 1998-05-05 | Genentech, Inc. | Polypeptides with increased half-life for use in treating disorders involving the LFA-1 receptor |
US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
WO1997043316A1 (en) | 1996-05-10 | 1997-11-20 | Beth Israel Deaconess Medical Center, Inc. | Physiologically active molecules with extended half-lives and methods of using same |
WO1999043713A1 (en) | 1998-02-25 | 1999-09-02 | Lexigen Pharmaceuticals Corporation | Enhancing the circulating half-life of antibody-based fusion proteins |
US6602684B1 (en) | 1998-04-20 | 2003-08-05 | Glycart Biotechnology Ag | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
WO2000009560A2 (en) | 1998-08-17 | 2000-02-24 | Abgenix, Inc. | Generation of modified molecules with increased serum half-lives |
WO2000042072A2 (en) | 1999-01-15 | 2000-07-20 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2000061739A1 (en) | 1999-04-09 | 2000-10-19 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
WO2001029246A1 (en) | 1999-10-19 | 2001-04-26 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing polypeptide |
WO2001077181A2 (en) | 2000-04-12 | 2001-10-18 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anti-rhesus d monoclonal antibodies |
WO2002031140A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions |
WO2002030954A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Method of purifying antibody |
WO2002038756A1 (en) | 2000-11-08 | 2002-05-16 | Millegen | Use of mutagenic dna polymerase for producing random mutations |
WO2002060919A2 (en) | 2000-12-12 | 2002-08-08 | Medimmune, Inc. | Molecules with extended half-lives, compositions and uses thereof |
US20030050331A1 (en) | 2001-05-31 | 2003-03-13 | Medarex Inc. | Cytotoxic agents |
WO2006064121A2 (en) | 2004-12-15 | 2006-06-22 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Cytotoxic antibody directed against type b lymphoid hematopoietic proliferations |
FR2894983A1 (en) | 2005-12-16 | 2007-06-22 | Lab Francais Du Fractionnement | Measuring the capacity of antibodies preparation to activate Fc receptor, useful e.g. to evaluate cell capacity to produce monoclonal antibody, comprises aggregating the antibodies, contacting with the cells and measuring |
US11392902B2 (en) | 2017-06-06 | 2022-07-19 | United Parcel Service Of America, Inc. | Systems, methods, apparatuses and computer program products for providing notification of items for pickup and delivery |
Non-Patent Citations (70)
Title |
---|
"Current Protocols in Molecular Biology", JOHN WILEY & SONS |
1993: "Gene Targeting, A Practical Approach", IRL PRESS |
1994: "Manipulating the Mouse Embryo, A Laboratory Manual", COLD SPRING HARBOR LABORATORY PRESS |
APLIN; WRISTON, CRC CRIT. REV. BIOCHEM., 1981, pages 259 - 306 |
ASHKENAZI A; CHAMOW SM., CURR OPIN IMMUNOL., vol. 9, no. 2, 1997, pages 195 - 200 |
BRAMBELL, LANCET, vol. 2, no. 7473, 1966, pages 1087 - 93 |
CARTER ET AL., PROC NATL ACAD SCI USA, vol. 89, 1992, pages 4285 - 9 |
CIBELLI ET AL., SCIENCE, vol. 280, 1998, pages 1256 - 1258 |
DALL'ACQUA ET AL., J IMMUNOL., vol. 169, 2002, pages 5171 - 80 |
DALL'ACQUA ET AL., J. BIOL. CHEM., vol. 281, 2006, pages 23514 - 24 |
DALL'ACQUA ET AL., J. IMMUNOL., vol. 169, 2002, pages 5171 - 5180 |
DALL'OZZO S; TARTAS S; PAINTAUD G; CARTRON G; COLOMBAT P; BARDOS P; WATIER H; THIBAULT G, CANCER RES., vol. 64, no. 13, 1 July 2004 (2004-07-01), pages 4664 - 9 |
DAVIES ET AL., BIOTECHNOL BIOENG, vol. 74, 2001, pages 288 - 294 |
DAVIS ET AL., IMMUNOLOGICAL REVIEWS, vol. 190, 2002, pages 123 - 136 |
DE LORENZO ET AL., CARCINOGENESIS, vol. 26, 2005, pages 1890 - 1895 |
DE ROMEUF C; DUTERTRE CA; LE GARFF-TAVERNIER M; FOURNIER N; GAUCHER C; GLACET A; JORIEUX S; BIHOREAU N; BEHRENS CK; BÉLIARD R: "Chronic lymphocytic leukaemia cells are efficiently killed by an anti-CD20 monoclonal antibody selected for improved engagement of FcgammaRIIIA/CD16", BR J HAEMATOL., vol. 140, no. 6, March 2008 (2008-03-01), pages 635 - 43 |
DUSKIN ET AL., J. BIOL. CHEM., vol. 257, 1982, pages 3105 |
EDGE ET AL., ANAL. BIOCHEM., vol. 118, 1981, pages 131 |
EMOND ET AL., PROTEIN ENG. DES. SEL., vol. 21, 2008, pages 267 - 274 |
EVANS; KAUFMAN: "Nature", vol. 292, 1981, pages: 154 - 156 |
GHETIE ET AL., NAT. BIOTECHNOL, vol. 15, 1997, pages 637 - 40 |
GHETIE; WARD, IMMUNOL TODAY, vol. 18, no. 12, 1997, pages 592 - 598 |
GHETIE; WARD, NAT. BIOTECHNOL., vol. 15, 1997, pages 637 - 40 |
GORDON ET AL., PROC NATL ACAD SCI U S A., vol. 77, 1980, pages 7380 - 4 |
GORMAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 4181 - 4185 |
GURBAXANI ET AL., MOL IMMUNOL., vol. 43, no. 9, 2006, pages 1462 - 73 |
HAKIMUDDIN ET AL., ARCH. BIOCHEM. BIOPHYS., vol. 259, 1987, pages 52 |
HE ET AL., J. IMMUNOL., vol. 160, 1998, pages 1029 - 1035 |
HINTON ET AL., J BIOL CHEM., vol. 279, 2004, pages 6213 - 6 |
HINTON PR ET AL., J. BIOL. CHEM., vol. 279, no. 8, 2004, pages 6213 - 6216 |
HOLLIGER; WINTER, CURRENT OPINION BIOTECHNOL., vol. 4, 1993, pages 446 - 449 |
HORNICK ET AL., J NUCL MED., vol. 41, 2000, pages 355 - 62 |
HU ET AL., CANCER RES., vol. 56, 1996, pages 3055 - 3061 |
JONES ET AL., J CLIN INVEST., vol. 51, no. 11, 1972, pages 2916 - 27 |
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525 |
JONES, NATURE, vol. 321, 1986, pages 522 - 525 |
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH |
KIM ET AL., EUR J IMMUNOL, vol. 24, 1994, pages 542 - 8 |
KIM ET AL., EUR J IMMUNOL, vol. 29, 1999, pages 2819 - 25 |
KIM ET AL., EUR J IMMUNOL., vol. 24, 1994, pages 2429 - 34 |
KUNKEL, PROC. NATL. ACAD. SCI USA 82:488, 1985 |
MANIATIS: "Molecular Cloning - A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
MEDESAN ET AL., EUR J IMMUNOL., vol. 26, 1996, pages 2533 - 6 |
MEDESAN ET AL., J IMMUNOL., vol. 158, 1997, pages 2211 - 7 |
MONDON ET AL., BIOTECHNOL J., vol. 2, 2007, pages 76 - 82 |
NATURE, vol. 372, no. 6504, 1994, pages 379 - 83 |
O'CONNOR ET AL., PROTEIN ENG, vol. 11, 1998, pages 321 - 8 |
PIERCE CHEMICAL COMPANY CATALOG, 2005, pages 321 - 350 |
POPOV ET AL., MOL. IMMUNOL., vol. 33, 1996, pages 521 - 530 |
POPOV S. ET AL., MOL IMMUNOL., vol. 33, no. 6, 1996, pages 521 - 530 |
POUL MA ET AL., EUR. J. IMMUNOL., vol. 25, no. 7, 1995, pages 2005 - 2009 |
PRESTA ET AL., CANCER RES., vol. 57, no. 20, 1997, pages 4593 - 9 |
QUEEN ET AL., PROC NATL ACAD SCI, USA, vol. 86, 1989, pages 10029 - 33 |
RAGHAVAN ET AL., BIOCHEMISTRY, vol. 34, 1995, pages 14649 - 57 |
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 329 |
RODEWALD, J CELL BIOL., vol. 71, no. 2, 1976, pages 666 - 9 |
ROGUSKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 969 - 973 |
ROQUE ET AL., BIOTECHNOL. PROG., vol. 20, 2004, pages 639 - 654 |
RYAN ET AL., SCIENCE, vol. 278, 1997, pages 873 - 876 |
SHIELDS ET AL., J BIOL CHEM, vol. 276, 2001, pages 6591 - 604 |
SHIELDS ET AL., J BIOL CHEM, vol. 277, 2002, pages 26733 - 26740 |
SHINKAWA ET AL., J BIOL CHEM, vol. 278, 2003, pages 3466 - 3473 |
SIMISTER; MOSTOV, COLD SPRING HARB SYMP QUANT BIO, vol. 54, 1989, pages 571 - 80 |
SMITH, SCIENCE, vol. 228, 1985, pages 1315 |
THOTAKURA ET AL., METH. ENZYMOL., vol. 138, 1987, pages 350 |
TSURUSHITA; VASQUEZ: "Humanization of Monoclonal Antibodies, Molecular Biology of B Cells", 2004, ELSEVIER SCIENCE, pages: 533 - 545 |
UMANA ET AL., NAT BIOTECHNOL, vol. 17, 1999, pages 176 - 180 |
VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536 |
ZHU X ET AL., J IMMUNOL., vol. 166, 2001, pages 3266 - 76 |
ZOLLER; SMITH, NUCL. ACIDS RES., vol. 10, 1982, pages 6487 - 6500 |
Cited By (231)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11168344B2 (en) | 2005-03-31 | 2021-11-09 | Chugai Seiyaku Kabushiki Kaisha | Methods for producing polypeptides by regulating polypeptide association |
US11046784B2 (en) | 2006-03-31 | 2021-06-29 | Chugai Seiyaku Kabushiki Kaisha | Methods for controlling blood pharmacokinetics of antibodies |
US10934344B2 (en) | 2006-03-31 | 2021-03-02 | Chugai Seiyaku Kabushiki Kaisha | Methods of modifying antibodies for purification of bispecific antibodies |
US11248053B2 (en) | 2007-09-26 | 2022-02-15 | Chugai Seiyaku Kabushiki Kaisha | Method of modifying isoelectric point of antibody via amino acid substitution in CDR |
US9828429B2 (en) | 2007-09-26 | 2017-11-28 | Chugai Seiyaku Kabushiki Kaisha | Method of modifying isoelectric point of antibody via amino acid substitution in CDR |
US11332533B2 (en) | 2007-09-26 | 2022-05-17 | Chugai Seiyaku Kabushiki Kaisha | Modified antibody constant region |
US11371039B2 (en) | 2008-04-11 | 2022-06-28 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly |
US9890377B2 (en) | 2008-04-11 | 2018-02-13 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly |
US10472623B2 (en) | 2008-04-11 | 2019-11-12 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding two or more antigen molecules repeatedly |
US9868948B2 (en) | 2008-04-11 | 2018-01-16 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly |
US11359194B2 (en) | 2008-04-11 | 2022-06-14 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding two or more antigen molecules repeatedly |
US9493578B2 (en) | 2009-09-02 | 2016-11-15 | Xencor, Inc. | Compositions and methods for simultaneous bivalent and monovalent co-engagement of antigens |
JP2013528357A (en) * | 2010-03-29 | 2013-07-11 | ザイムワークス,インコーポレイテッド | Antibody with enhanced or suppressed effector function |
JP2017165728A (en) * | 2010-03-29 | 2017-09-21 | ザイムワークス,インコーポレイテッド | Antibodies having enhanced or suppressed effector functions |
US9296815B2 (en) | 2010-03-29 | 2016-03-29 | Zymeworks Inc. | Antibodies with enhanced or suppressed effector function |
US9441032B2 (en) | 2010-04-07 | 2016-09-13 | Agency For Science, Technology And Research | Binding molecules against Chikungunya virus and uses thereof |
US9738704B2 (en) | 2010-04-07 | 2017-08-22 | Agency For Science, Technology And Research | Binding molecules against Chikungunya virus and uses thereof |
US11959118B2 (en) | 2010-05-27 | 2024-04-16 | Merck Sharp & Dohme Llc | Fc-containing polypeptides having improved properties and comprising mutations at positions 243 and 264 of the Fc-region |
US10858686B2 (en) | 2010-05-27 | 2020-12-08 | Merck Sharp & Dohme Corp. | Method for preparing antibodies having improved properties |
US9187552B2 (en) | 2010-05-27 | 2015-11-17 | Merck Sharp & Dohme Corp. | Method for preparing antibodies having improved properties |
US9605061B2 (en) | 2010-07-29 | 2017-03-28 | Xencor, Inc. | Antibodies with modified isoelectric points |
US11891434B2 (en) | 2010-11-30 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule capable of binding to plurality of antigen molecules repeatedly |
US11718678B2 (en) | 2011-02-25 | 2023-08-08 | Chugai Seiyaku Kabushiki Kaisha | Method for altering plasma retention and immunogenicity of antigen-binding molecule |
US10618965B2 (en) | 2011-02-25 | 2020-04-14 | Chugai Seiyaku Kabushiki Kaisha | Method for altering plasma retention and immunogenicity of antigen-binding molecule |
WO2012132067A1 (en) * | 2011-03-30 | 2012-10-04 | 中外製薬株式会社 | Retention of antigen-binding molecules in blood plasma and method for modifying immunogenicity |
WO2012156309A1 (en) | 2011-05-13 | 2012-11-22 | Millegen | Antibodies against her3 |
US9328170B2 (en) | 2011-05-25 | 2016-05-03 | Merck Sharp & Dohme Corp. | Method for preparing Fc containing polypeptides having improved properties |
WO2012175692A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2012175691A1 (en) | 2011-06-22 | 2012-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
WO2012175751A3 (en) * | 2011-06-24 | 2013-08-08 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Fc variants with reduced effector functions |
EP2537864A1 (en) * | 2011-06-24 | 2012-12-26 | LFB Biotechnologies | Fc variants with reduced effector functions |
CN107474138A (en) * | 2011-06-24 | 2017-12-15 | 法国血液分割暨生化制品实验室 | The Fc variants of effector function with reduction |
JP2014519836A (en) * | 2011-06-24 | 2014-08-21 | ラボラトワール フランセ デュ フラクショヌマン エ デ ビオテクノロジ | Fc mutant with reduced effector function |
CN103827142A (en) * | 2011-06-24 | 2014-05-28 | 法国血液分割暨生化制品实验室 | Fc variants with reduced effector functions |
US20140378663A1 (en) * | 2011-06-24 | 2014-12-25 | Laboratoire Francais Du Fractionnement Et De Biotechnologies | Fc variants with reduced effector functions |
CN106084039B (en) * | 2011-07-06 | 2020-09-11 | 根马布私人有限公司 | Antibody variants and uses thereof |
US10759867B2 (en) | 2011-07-06 | 2020-09-01 | Genmab B.V. | Antibody variants and uses thereof |
JP2020055800A (en) * | 2011-07-06 | 2020-04-09 | ゲンマブ ビー.ブイ. | Antibody variants and uses thereof |
JP7509716B2 (en) | 2011-07-06 | 2024-07-02 | ジェンマブ ビー.ブイ. | Antibody variants and uses thereof |
US12049512B2 (en) | 2011-07-06 | 2024-07-30 | Genmab B.V. | Antibody variants and uses thereof |
JP2018035140A (en) * | 2011-07-06 | 2018-03-08 | ゲンマブ ビー.ブイ. | Antibody variants and uses thereof |
WO2013004842A3 (en) * | 2011-07-06 | 2013-04-04 | Genmab A/S | Antibody variants and uses thereof |
CN106084039A (en) * | 2011-07-06 | 2016-11-09 | 根马布私人有限公司 | Antibody variants and application thereof |
EP3970746A3 (en) * | 2011-07-06 | 2022-08-03 | Genmab B.V. | Polypeptide variants and uses thereof |
JP2014520788A (en) * | 2011-07-06 | 2014-08-25 | ゲンマブ ビー.ブイ. | Antibody variants and uses thereof |
AU2012280222B8 (en) * | 2011-07-06 | 2017-12-07 | Genmab B.V. | Antibody variants and uses thereof |
AU2012280222A8 (en) * | 2011-07-06 | 2017-12-07 | Genmab B.V. | Antibody variants and uses thereof |
CN104220093A (en) * | 2011-07-06 | 2014-12-17 | 根马布私人有限公司 | Antibody variants and uses thereof |
JP2021120385A (en) * | 2011-07-06 | 2021-08-19 | ゲンマブ ビー.ブイ. | Antibody variants and uses thereof |
AU2012280222B2 (en) * | 2011-07-06 | 2017-09-14 | Genmab B.V. | Antibody variants and uses thereof |
JP2020109118A (en) * | 2011-09-30 | 2020-07-16 | 中外製薬株式会社 | Antigen-binding molecule for promoting elimination of antigen having plural bioactivities |
JP2022034037A (en) * | 2011-09-30 | 2022-03-02 | 中外製薬株式会社 | ANTIGEN BINDING MOLECULE FOR TREATMENT WITH FcRn BINDING DOMAIN WHICH PROMOTES ANTIGEN CLEARANCE |
WO2013047748A1 (en) | 2011-09-30 | 2013-04-04 | 中外製薬株式会社 | Antigen-binding molecule promoting disappearance of antigens having plurality of biological activities |
WO2013047752A1 (en) | 2011-09-30 | 2013-04-04 | 中外製薬株式会社 | Antigen-binding molecule for promoting loss of antigens |
JP2019206526A (en) * | 2011-09-30 | 2019-12-05 | 中外製薬株式会社 | ANTIGEN BINDING MOLECULE FOR TREATMENT WITH FcRn BINDING DOMAIN WHICH PROMOTES ANTIGEN CLEARANCE |
EP3680251A1 (en) | 2011-09-30 | 2020-07-15 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecules for promoting elimination of antigens |
EP3939996A1 (en) | 2011-09-30 | 2022-01-19 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule promoting disappearance of antigens having plurality of biological activities |
US11827699B2 (en) | 2011-09-30 | 2023-11-28 | Chugai Seiyaku Kabushiki Kaisha | Methods for producing antibodies promoting disappearance of antigens having plurality of biological activities |
AU2012313670B2 (en) * | 2011-09-30 | 2017-06-15 | Chugai Seiyaku Kabushiki Kaisha | Therapeutic antigen-binding molecule with a FcRn-binding domain that promotes antigen clearance |
JP7001637B2 (en) | 2011-09-30 | 2022-02-03 | 中外製薬株式会社 | Therapeutic antigen-binding molecule with FcRn-binding domain that promotes antigen clearance |
JP2018115148A (en) * | 2011-09-30 | 2018-07-26 | 中外製薬株式会社 | Antigen-binding molecule for promoting elimination of antigen having plural bioactivities |
JP7149306B2 (en) | 2011-09-30 | 2022-10-06 | 中外製薬株式会社 | Antigen-binding molecule that promotes elimination of antigens with multiple physiological activities |
JP2018048120A (en) * | 2011-09-30 | 2018-03-29 | 中外製薬株式会社 | ANTIGEN BINDING MOLECULE FOR TREATMENT WITH FcRn BINDING DOMAIN WHICH PROMOTES ANTIGEN CLEARANCE |
US10253100B2 (en) | 2011-09-30 | 2019-04-09 | Chugai Seiyaku Kabushiki Kaisha | Therapeutic antigen-binding molecule with a FcRn-binding domain that promotes antigen clearance |
JP2014528906A (en) * | 2011-09-30 | 2014-10-30 | 中外製薬株式会社 | Therapeutic antigen binding molecules with FcRn binding domains that promote antigen clearance |
JP2018088938A (en) * | 2011-10-10 | 2018-06-14 | ゼンコア インコーポレイテッド | Method for purifying antibodies |
US20210284754A1 (en) * | 2011-10-10 | 2021-09-16 | Xencor, Inc. | HETERODIMERIC HUMAN IgG1 POLYPEPTIDES WITH ISOELECTRIC POINT MODIFICATIONS |
US10851178B2 (en) | 2011-10-10 | 2020-12-01 | Xencor, Inc. | Heterodimeric human IgG1 polypeptides with isoelectric point modifications |
US11851476B2 (en) | 2011-10-31 | 2023-12-26 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule having regulated conjugation between heavy-chain and light-chain |
US11820793B2 (en) | 2011-11-30 | 2023-11-21 | Chugai Seiyaku Kabushiki Kaisha | Drug containing carrier into cell for forming immune complex |
WO2013125667A1 (en) | 2012-02-24 | 2013-08-29 | 中外製薬株式会社 | ANTIGEN-BINDING MOLECULE FOR PROMOTING DISAPPEARANCE OF ANTIGEN VIA FcγRIIB |
EP3738980A1 (en) | 2012-02-24 | 2020-11-18 | Chugai Seiyaku Kabushiki Kaisha | Antigen-binding molecule for promoting disappearance of antigen via fc gamma riib |
WO2014006217A1 (en) * | 2012-07-06 | 2014-01-09 | Genmab B.V. | Dimeric protein with triple mutations |
JP2019163262A (en) * | 2012-07-06 | 2019-09-26 | ゲンマブ ビー.ブイ. | Dimeric proteins with triple mutations |
US11180572B2 (en) | 2012-07-06 | 2021-11-23 | Genmab B.V. | Dimeric protein with triple mutations |
EP3632462A1 (en) * | 2012-07-06 | 2020-04-08 | Genmab B.V. | Dimeric protein with triple mutations |
JP2015524387A (en) * | 2012-07-06 | 2015-08-24 | ゲンマブ ビー.ブイ. | Dimeric protein with triple mutation |
US10919953B2 (en) | 2012-08-24 | 2021-02-16 | Chugai Seiyaku Kabushiki Kaisha | FcgammaRIIB-specific Fc region variant |
EP3721900A1 (en) | 2012-08-24 | 2020-10-14 | Chugai Seiyaku Kabushiki Kaisha | Fcgammariib-specific fc region variant |
WO2014030728A1 (en) | 2012-08-24 | 2014-02-27 | 中外製薬株式会社 | Fcγriib-specific fc region variant |
EP2733153A1 (en) | 2012-11-15 | 2014-05-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the preparation of immunoconjugates and uses thereof |
WO2014108198A1 (en) | 2013-01-10 | 2014-07-17 | Genmab B.V. | Human igg1 fc region variants and uses thereof |
US10487155B2 (en) | 2013-01-14 | 2019-11-26 | Xencor, Inc. | Heterodimeric proteins |
US10472427B2 (en) | 2013-01-14 | 2019-11-12 | Xencor, Inc. | Heterodimeric proteins |
US10738133B2 (en) | 2013-01-14 | 2020-08-11 | Xencor, Inc. | Heterodimeric proteins |
US10738132B2 (en) | 2013-01-14 | 2020-08-11 | Xencor, Inc. | Heterodimeric proteins |
US11634506B2 (en) | 2013-01-14 | 2023-04-25 | Xencor, Inc. | Heterodimeric proteins |
US10131710B2 (en) | 2013-01-14 | 2018-11-20 | Xencor, Inc. | Optimized antibody variable regions |
US9701759B2 (en) | 2013-01-14 | 2017-07-11 | Xencor, Inc. | Heterodimeric proteins |
US11718667B2 (en) | 2013-01-14 | 2023-08-08 | Xencor, Inc. | Optimized antibody variable regions |
US9650446B2 (en) | 2013-01-14 | 2017-05-16 | Xencor, Inc. | Heterodimeric proteins |
US11053316B2 (en) | 2013-01-14 | 2021-07-06 | Xencor, Inc. | Optimized antibody variable regions |
US9738722B2 (en) | 2013-01-15 | 2017-08-22 | Xencor, Inc. | Rapid clearance of antigen complexes using novel antibodies |
EP2767548A3 (en) * | 2013-02-19 | 2015-07-15 | Argen-X B.V. | Modified IgG molecules |
US10968276B2 (en) | 2013-03-12 | 2021-04-06 | Xencor, Inc. | Optimized anti-CD3 variable regions |
US10544187B2 (en) | 2013-03-15 | 2020-01-28 | Xencor, Inc. | Targeting regulatory T cells with heterodimeric proteins |
US11299554B2 (en) | 2013-03-15 | 2022-04-12 | Xencor, Inc. | Heterodimeric proteins |
US9605084B2 (en) | 2013-03-15 | 2017-03-28 | Xencor, Inc. | Heterodimeric proteins |
US10106624B2 (en) | 2013-03-15 | 2018-10-23 | Xencor, Inc. | Heterodimeric proteins |
US10287364B2 (en) | 2013-03-15 | 2019-05-14 | Xencor, Inc. | Heterodimeric proteins |
US10519242B2 (en) | 2013-03-15 | 2019-12-31 | Xencor, Inc. | Targeting regulatory T cells with heterodimeric proteins |
US10858417B2 (en) | 2013-03-15 | 2020-12-08 | Xencor, Inc. | Heterodimeric proteins |
US11814423B2 (en) | 2013-03-15 | 2023-11-14 | Xencor, Inc. | Heterodimeric proteins |
WO2014163101A1 (en) | 2013-04-02 | 2014-10-09 | 中外製薬株式会社 | Fc region variant |
US11267868B2 (en) | 2013-04-02 | 2022-03-08 | Chugai Seiyaku Kabushiki Kaisha | Fc region variant |
EP3783017A1 (en) | 2013-04-02 | 2021-02-24 | Chugai Seiyaku Kabushiki Kaisha | Fc region variant |
CN116059393A (en) * | 2013-05-31 | 2023-05-05 | 韩美药品株式会社 | IgG4FC fragments comprising modified hinge regions |
US10973881B2 (en) * | 2013-05-31 | 2021-04-13 | Hanmi Pharm. Co., Ltd. | IgG4 Fc fragment comprising modified hinge region |
RU2800558C1 (en) * | 2013-05-31 | 2023-07-24 | Ханми Фарм. Ко., Лтд. | IGG4 Fc FRAGMENT CONTAINING A MODIFIED HINGE REGION |
CN105377877A (en) * | 2013-05-31 | 2016-03-02 | 韩美药品株式会社 | Igg4 fc fragment comprising modified hinge region |
US20160129129A1 (en) * | 2013-05-31 | 2016-05-12 | Hanmi Pharm. Co., Ltd. | Igg4 fc fragment comprising modified hinge region |
US11098105B2 (en) | 2013-05-31 | 2021-08-24 | Zymeworks Inc. | Heteromultimers with reduced or silenced effector function |
US11147857B2 (en) | 2013-05-31 | 2021-10-19 | Hanmi Pharm. Co., Ltd. | IgG4 Fc fragment comprising modified hinge region |
US11124576B2 (en) | 2013-09-27 | 2021-09-21 | Chungai Seiyaku Kabushiki Kaisha | Method for producing polypeptide heteromultimer |
WO2015063728A1 (en) | 2013-10-31 | 2015-05-07 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Chimeric protein in the treatment of amyloidosis |
US11345730B2 (en) | 2013-10-31 | 2022-05-31 | Centre National De La Recherche Scientifique (Cnrs) | Chimeric protein in the treatment of amyloidosis |
FR3012453A1 (en) * | 2013-10-31 | 2015-05-01 | Lab Francais Du Fractionnement | CHIMERIC PROTEIN FOR THE TREATMENT OF AMYLOSIS |
WO2015067986A1 (en) | 2013-11-07 | 2015-05-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuregulin allosteric anti-her3 antibody |
EP3626738A1 (en) * | 2013-12-24 | 2020-03-25 | Argenx BVBA | Fcrn antagonists and methods of use |
WO2015100299A1 (en) * | 2013-12-24 | 2015-07-02 | Argen-X N.V. | Fcrn antagonists and methods of use |
EA035324B1 (en) * | 2013-12-24 | 2020-05-28 | Ардженкс Бвба | NEONATAL Fc RECEPTOR (FcRn) ANTAGONISTS AND METHODS OF USE THEREOF |
US10316073B2 (en) | 2013-12-24 | 2019-06-11 | Argenx Bvba | FCRN antagonists and methods of use |
US11505585B2 (en) | 2013-12-24 | 2022-11-22 | argenx BV | FcRn antagonists and methods of use |
US9822186B2 (en) | 2014-03-28 | 2017-11-21 | Xencor, Inc. | Bispecific antibodies that bind to CD38 and CD3 |
US10858451B2 (en) | 2014-03-28 | 2020-12-08 | Xencor, Inc. | Bispecific antibodies that bind to CD38 and CD3 |
US11840579B2 (en) | 2014-03-28 | 2023-12-12 | Xencor, Inc. | Bispecific antibodies that bind to CD38 and CD3 |
US11001643B2 (en) | 2014-09-26 | 2021-05-11 | Chugai Seiyaku Kabushiki Kaisha | Cytotoxicity-inducing therapeutic agent |
US10526417B2 (en) | 2014-11-26 | 2020-01-07 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and CD38 |
US11673972B2 (en) | 2014-11-26 | 2023-06-13 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US11225528B2 (en) | 2014-11-26 | 2022-01-18 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US9856327B2 (en) | 2014-11-26 | 2018-01-02 | Xencor, Inc. | Heterodimeric antibodies to CD3 X CD123 |
US10889653B2 (en) | 2014-11-26 | 2021-01-12 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US10259887B2 (en) | 2014-11-26 | 2019-04-16 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US9850320B2 (en) | 2014-11-26 | 2017-12-26 | Xencor, Inc. | Heterodimeric antibodies to CD3 X CD20 |
US10913803B2 (en) | 2014-11-26 | 2021-02-09 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US11111315B2 (en) | 2014-11-26 | 2021-09-07 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US11352442B2 (en) | 2014-11-26 | 2022-06-07 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and CD38 |
US11859011B2 (en) | 2014-11-26 | 2024-01-02 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
US11945880B2 (en) | 2014-11-26 | 2024-04-02 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and tumor antigens |
WO2016091891A1 (en) | 2014-12-09 | 2016-06-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies against axl |
US10428155B2 (en) | 2014-12-22 | 2019-10-01 | Xencor, Inc. | Trispecific antibodies |
US11180548B2 (en) | 2015-02-05 | 2021-11-23 | Chugai Seiyaku Kabushiki Kaisha | Methods of neutralizing IL-8 biological activity |
WO2016135066A1 (en) | 2015-02-26 | 2016-09-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Fusion proteins and antibodies comprising thereof for promoting apoptosis |
US11091548B2 (en) | 2015-03-05 | 2021-08-17 | Xencor, Inc. | Modulation of T cells with bispecific antibodies and Fc fusions |
US10227411B2 (en) | 2015-03-05 | 2019-03-12 | Xencor, Inc. | Modulation of T cells with bispecific antibodies and FC fusions |
US10611843B2 (en) | 2015-03-31 | 2020-04-07 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Anti-CD303 monoclonal antibodies |
US10239946B2 (en) | 2015-03-31 | 2019-03-26 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Cell line overexpressing human CD303 antigen |
US11142587B2 (en) | 2015-04-01 | 2021-10-12 | Chugai Seiyaku Kabushiki Kaisha | Method for producing polypeptide hetero-oligomer |
WO2016177984A1 (en) * | 2015-05-07 | 2016-11-10 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Fc mutants with modified functional activity |
AU2016259124B2 (en) * | 2015-05-07 | 2022-06-16 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Fc mutants with modified functional activity |
FR3035879A1 (en) * | 2015-05-07 | 2016-11-11 | Lab Francais Du Fractionnement | MUTANTS FC WITH MODIFIED FUNCTIONAL ACTIVITY |
US11649271B2 (en) | 2015-05-07 | 2023-05-16 | Laboratoire Franç-̧Ais Du Fractionnement Et Des Biotechnologies | Fc mutants with modified functional activity |
WO2016188911A1 (en) | 2015-05-22 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies fragments inhibiting both the cath-d catalytic activity and its binding to the lrp1 receptor |
WO2017006052A2 (en) | 2015-07-06 | 2017-01-12 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Use of modified fc fragments in immunotherapy |
US10227410B2 (en) | 2015-12-07 | 2019-03-12 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and PSMA |
US11623957B2 (en) | 2015-12-07 | 2023-04-11 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and PSMA |
US11649262B2 (en) | 2015-12-28 | 2023-05-16 | Chugai Seiyaku Kabushiki Kaisha | Method for promoting efficiency of purification of Fc region-containing polypeptide |
US11072666B2 (en) | 2016-03-14 | 2021-07-27 | Chugai Seiyaku Kabushiki Kaisha | Cell injury inducing therapeutic drug for use in cancer therapy |
WO2017162678A1 (en) | 2016-03-22 | 2017-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Humanized anti-claudin-1 antibodies and uses thereof |
WO2017207628A1 (en) * | 2016-05-31 | 2017-12-07 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Antibody for cancer treatment |
FR3051794A1 (en) * | 2016-05-31 | 2017-12-01 | Lab Francais Du Fractionnement | ANTIBODIES FOR THE TREATMENT OF CANCERS |
US11236170B2 (en) | 2016-06-14 | 2022-02-01 | Xencor, Inc. | Bispecific checkpoint inhibitor antibodies |
US10787518B2 (en) | 2016-06-14 | 2020-09-29 | Xencor, Inc. | Bispecific checkpoint inhibitor antibodies |
US11492407B2 (en) | 2016-06-14 | 2022-11-08 | Xencor, Inc. | Bispecific checkpoint inhibitor antibodies |
US11225521B2 (en) | 2016-06-28 | 2022-01-18 | Xencor, Inc. | Heterodimeric antibodies that bind somatostatin receptor 2 |
US10316088B2 (en) | 2016-06-28 | 2019-06-11 | Xencor, Inc. | Heterodimeric antibodies that bind somatostatin receptor 2 |
US11091539B2 (en) | 2016-07-08 | 2021-08-17 | Staten Biotechnology B.V. | Anti-ApoC3 antibodies and methods of use thereof |
WO2018020000A1 (en) | 2016-07-29 | 2018-02-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies targeting tumor associated macrophages and uses thereof |
US11858980B2 (en) | 2016-08-02 | 2024-01-02 | Visterra, Inc. | Engineered polypeptides and uses thereof |
US11780912B2 (en) | 2016-08-05 | 2023-10-10 | Chugai Seiyaku Kabushiki Kaisha | Composition for prophylaxis or treatment of IL-8 related diseases |
US11053308B2 (en) | 2016-08-05 | 2021-07-06 | Chugai Seiyaku Kabushiki Kaisha | Method for treating IL-8-related diseases |
US10793632B2 (en) | 2016-08-30 | 2020-10-06 | Xencor, Inc. | Bispecific immunomodulatory antibodies that bind costimulatory and checkpoint receptors |
US10844113B2 (en) | 2016-09-16 | 2020-11-24 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US10604561B2 (en) | 2016-09-16 | 2020-03-31 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US11780908B2 (en) | 2016-09-16 | 2023-10-10 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant FC regions, and methods of use |
US10501543B2 (en) | 2016-10-14 | 2019-12-10 | Xencor, Inc. | IL15/IL15Rα heterodimeric Fc-fusion proteins |
US10550185B2 (en) | 2016-10-14 | 2020-02-04 | Xencor, Inc. | Bispecific heterodimeric fusion proteins containing IL-15-IL-15Rα Fc-fusion proteins and PD-1 antibody fragments |
US11795232B2 (en) | 2017-02-17 | 2023-10-24 | Denali Therapeutics Inc. | Engineered transferrin receptor binding polypeptides |
US11912778B2 (en) | 2017-02-17 | 2024-02-27 | Denali Therapeutics Inc. | Methods of engineering transferrin receptor binding polypeptides |
WO2018158398A1 (en) | 2017-03-02 | 2018-09-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to nectin-4 and uses thereof |
FR3064007A1 (en) * | 2017-03-20 | 2018-09-21 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | ANTIBODIES FOR THE TREATMENT OF CANCERS |
WO2018172286A1 (en) | 2017-03-20 | 2018-09-27 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Antibodies targeting a ligand from an immune checkpoint, with an fc fragment having an improved affinity for cd16a |
KR101913743B1 (en) * | 2017-04-07 | 2018-11-01 | 국민대학교 산학협력단 | Antibody Fc variants for Prolonged Serum Half-Life |
AU2018249796B2 (en) * | 2017-04-07 | 2021-03-11 | Kookmin University Industry Academy Cooperation Foundation | Antibody Fc variants for improving blood half-life |
WO2018186717A1 (en) * | 2017-04-07 | 2018-10-11 | 국민대학교 산학협력단 | Antibody fc variants for improving blood half-life |
CN110691796B (en) * | 2017-04-07 | 2024-05-07 | 国民大学校产学协力团 | Antibody FC variants for increasing blood half-life |
US11492415B2 (en) | 2017-04-07 | 2022-11-08 | Kookmin University Industry Academy | Antibody Fc variants for increased blood half-life |
CN110691796A (en) * | 2017-04-07 | 2020-01-14 | 国民大学校产学协力团 | Antibody FC variants for increasing blood half-life |
KR101792205B1 (en) | 2017-04-13 | 2017-10-31 | 재단법인 오송첨단의료산업진흥재단 | Antibody Fc variants for Prolonged Serum Persistence |
US11242381B2 (en) | 2017-04-21 | 2022-02-08 | Staten Biotechnology B.V. | Anti-ApoC3 antibodies and methods of use thereof |
US11084863B2 (en) | 2017-06-30 | 2021-08-10 | Xencor, Inc. | Targeted heterodimeric Fc fusion proteins containing IL-15 IL-15alpha and antigen binding domains |
WO2019057567A1 (en) | 2017-09-19 | 2019-03-28 | Tillotts Pharma Ag | Antibody variants |
EP3456736A1 (en) | 2017-09-19 | 2019-03-20 | Tillotts Pharma Ag | Antibody variants |
WO2019057565A1 (en) | 2017-09-19 | 2019-03-28 | Tillotts Pharma Ag | Antibody variants |
EP3456737A1 (en) | 2017-09-19 | 2019-03-20 | Tillotts Pharma Ag | Antibody variants |
US20210010025A1 (en) * | 2017-10-18 | 2021-01-14 | Regenxbio Inc. | Treatment of ocular diseases with human post-translationally modified vegf-trap |
US10538583B2 (en) | 2017-10-31 | 2020-01-21 | Staten Biotechnology B.V. | Anti-APOC3 antibodies and compositions thereof |
US11248042B2 (en) | 2017-10-31 | 2022-02-15 | Staten Biotechnology B.V. | Polynucleotides encoding anti-ApoC3 antibodies |
US11248041B2 (en) | 2017-10-31 | 2022-02-15 | Staten Biotechnology B.V. | Anti-ApoC3 antibodies |
US10981992B2 (en) | 2017-11-08 | 2021-04-20 | Xencor, Inc. | Bispecific immunomodulatory antibodies that bind costimulatory and checkpoint receptors |
US11312770B2 (en) | 2017-11-08 | 2022-04-26 | Xencor, Inc. | Bispecific and monospecific antibodies using novel anti-PD-1 sequences |
CN111601821A (en) * | 2017-12-15 | 2020-08-28 | 法国血液分割暨生化制品实验室 | Variants of an Fc fragment having an increased affinity for FcRn and an increased affinity for at least one Fc fragment receptor |
EP3498293A1 (en) | 2017-12-15 | 2019-06-19 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Treatment of monogenic diseases with an anti-cd45rc antibody |
WO2019115791A1 (en) | 2017-12-15 | 2019-06-20 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Treatment of monogenic diseases with an anti-cd45rc antibody |
WO2019115773A1 (en) * | 2017-12-15 | 2019-06-20 | Laboratoire Français Du Fractionnement Et Des Biotechnologies | Variants with fc fragment having an increased affinity for fcrn and an increased affinity for at least one receptor of the fc fragment |
FR3075200A1 (en) * | 2017-12-15 | 2019-06-21 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | VARIANTS WITH FC FRAGMENT HAVING INCREASED AFFINITY FOR FCRN AND INCREASED AFFINITY FOR AT LEAST ONE FRAGMENT FC RECEPTOR |
US11319355B2 (en) | 2017-12-19 | 2022-05-03 | Xencor, Inc. | Engineered IL-2 Fc fusion proteins |
WO2019129848A1 (en) | 2017-12-29 | 2019-07-04 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Method for purifying antibodies from raw milk |
US11891432B2 (en) | 2018-03-15 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
US10982006B2 (en) | 2018-04-04 | 2021-04-20 | Xencor, Inc. | Heterodimeric antibodies that bind fibroblast activation protein |
US11524991B2 (en) | 2018-04-18 | 2022-12-13 | Xencor, Inc. | PD-1 targeted heterodimeric fusion proteins containing IL-15/IL-15Ra Fc-fusion proteins and PD-1 antigen binding domains and uses thereof |
US11505595B2 (en) | 2018-04-18 | 2022-11-22 | Xencor, Inc. | TIM-3 targeted heterodimeric fusion proteins containing IL-15/IL-15RA Fc-fusion proteins and TIM-3 antigen binding domains |
US11358999B2 (en) | 2018-10-03 | 2022-06-14 | Xencor, Inc. | IL-12 heterodimeric Fc-fusion proteins |
WO2020148207A1 (en) | 2019-01-14 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Human monoclonal antibodies binding to hla-a2 |
WO2020152290A1 (en) | 2019-01-23 | 2020-07-30 | Encefa | Cd31 competitors and uses thereof |
US11472890B2 (en) | 2019-03-01 | 2022-10-18 | Xencor, Inc. | Heterodimeric antibodies that bind ENPP3 and CD3 |
US11591388B2 (en) | 2019-06-07 | 2023-02-28 | argenx BV | Pharmaceutical formulations of FcRn inhibitors suitable for subcutaneous administration |
WO2021009263A1 (en) | 2019-07-16 | 2021-01-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity for cd38 and uses thereof |
WO2021116119A1 (en) | 2019-12-09 | 2021-06-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to her4 and uses thereof |
WO2021122733A1 (en) | 2019-12-18 | 2021-06-24 | F. Hoffmann-La Roche Ag | Bispecific anti-ccl2 antibodies |
US11739142B2 (en) | 2019-12-18 | 2023-08-29 | Hoffmann-La Roche Inc. | Bispecific anti-CCL2 antibodies |
WO2021228956A1 (en) | 2020-05-12 | 2021-11-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | New method to treat cutaneous t-cell lymphomas and tfh derived lymphomas |
US11919956B2 (en) | 2020-05-14 | 2024-03-05 | Xencor, Inc. | Heterodimeric antibodies that bind prostate specific membrane antigen (PSMA) and CD3 |
US11919958B2 (en) | 2020-08-19 | 2024-03-05 | Xencor, Inc. | Anti-CD28 compositions |
US11591401B2 (en) | 2020-08-19 | 2023-02-28 | Xencor, Inc. | Anti-CD28 compositions |
US11739144B2 (en) | 2021-03-09 | 2023-08-29 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and CLDN6 |
US11859012B2 (en) | 2021-03-10 | 2024-01-02 | Xencor, Inc. | Heterodimeric antibodies that bind CD3 and GPC3 |
WO2022253756A1 (en) | 2021-06-01 | 2022-12-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of b cell depleting agents for the treatment of rheumatic heart disease |
WO2022263501A1 (en) | 2021-06-18 | 2022-12-22 | F. Hoffmann-La Roche Ag | Bispecific anti-ccl2 antibodies |
WO2024052503A1 (en) | 2022-09-08 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Antibodies having specificity to ltbp2 and uses thereof |
WO2024061930A1 (en) | 2022-09-22 | 2024-03-28 | Institut National de la Santé et de la Recherche Médicale | New method to treat and diagnose peripheral t-cell lymphoma (ptcl) |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2010224800B2 (en) | Optimized Fc variants | |
JP2012524522A5 (en) | ||
JP6224739B2 (en) | Anti-LAG-3 binding protein | |
CA3073887A1 (en) | Igg1 fc mutants with ablated effector functions | |
AU2015200990A1 (en) | Optimized Fc variants | |
AU2016213792B2 (en) | Optimized Fc variants | |
US20230077531A1 (en) | Fc VARIANT WITH ENHANCED AFFINITY TO Fc RECEPTORS AND IMPROVED THERMAL STABILITY | |
TW202342524A (en) | Antigen binding proteins |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 201080017521.8 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10709546 Country of ref document: EP Kind code of ref document: A2 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 7088/DELNP/2011 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2012500274 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 13257502 Country of ref document: US Ref document number: 2755905 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 20117021990 Country of ref document: KR Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010224800 Country of ref document: AU Ref document number: 2010709546 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2010224800 Country of ref document: AU Date of ref document: 20100319 Kind code of ref document: A |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1014525 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: PI1014525 Country of ref document: BR Kind code of ref document: A2 Effective date: 20110919 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 245050 Country of ref document: IL |