WO2010092333A1 - Pathogen detector assay, method and kit - Google Patents

Pathogen detector assay, method and kit Download PDF

Info

Publication number
WO2010092333A1
WO2010092333A1 PCT/GB2010/000226 GB2010000226W WO2010092333A1 WO 2010092333 A1 WO2010092333 A1 WO 2010092333A1 GB 2010000226 W GB2010000226 W GB 2010000226W WO 2010092333 A1 WO2010092333 A1 WO 2010092333A1
Authority
WO
WIPO (PCT)
Prior art keywords
pathogen
binding
gold
nanoparticles
assay
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2010/000226
Other languages
French (fr)
Inventor
Neil R Thomas
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Nottingham
Original Assignee
University of Nottingham
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Nottingham filed Critical University of Nottingham
Publication of WO2010092333A1 publication Critical patent/WO2010092333A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54346Nanoparticles
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54366Apparatus specially adapted for solid-phase testing
    • G01N33/54386Analytical elements
    • G01N33/54387Immunochromatographic test strips
    • G01N33/54388Immunochromatographic test strips based on lateral flow

Definitions

  • the present invention relates to a pathogen detector assay device, method and kit for the detection of harmful pathogens in critical environments, such as healthcare and food preparation environments.
  • a one-step immunochromatographic assay for the detection of S. aureus in food has been reported by S.-H. Huang et al (Food Control, 2007, 18, 893; Sens Actuators B 2007 127, 335; latex agglutination, J. Food Protection, 1993, 56, 759).
  • This uses a lateral flow device in which a sandwich assay formed from staphylococcal protein A, a cell wall protein of S. aureus, is trapped by an anti-protein A IgG immobilised on a nitrocellulose membrane and a second anti-protein A IgG that is conjugated to a gold nanoparticle.
  • a limitation of this system is that protein A has to be separated from the bacteria before analysis, adding 24 hours to the 10 minutes required to run the lateral flow device. A substantial bacterial population (around 10 - 10 cells per ml) is also required to produce a detectable quantity of protein A.
  • a first aspect of the present invention provides a pathogen detector assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold nanoparticles or other nanoparticles capable of providing a visible change due to their aggregation, each gold or other nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen.
  • the term "pathogen” describes any disease- producing biological agent, specifically bacteria, viruses and other microorganisms.
  • the term “directly binding a recognition element” means that the GNP or other nanoparticle construct is able to bind to the recognition element, being a peptidoglycan, protein/peptidoglycan or glycoprotein, that is exposed on either the cell wall, the outer or cytoplasmic membranes of the pathogen or within the periplasmic space between the membranes, without any prior separation of the protein from the pathogen.
  • the cell envelope includes the cell membrane and cell wall.
  • the recognition elements that may be recognised by the binding element include membrane proteins, the N-acetylmuramic acid-N-acetylglucosamine (NAG-NAM) oligosaccharide polymer of peptidoglycan; the polypeptide polymer of peptidoglycan; peptide linkers that anchor proteins to peptidoglycan; oligosaccaride/carbohydrate structures on the cytoplasmic or outer membranes; lipopolysaccharides on the membrane and proteins that make up the capsids of viruses.
  • NAG-NAM N-acetylmuramic acid-N-acetylglucosamine
  • individual cells should bind multiple nanoparticles to provide sufficient aggregation to effect a visible change for detection of the pathogens.
  • the pathogen comprises a bacterium wherein each gold or other nanoparticle is conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a species or broad spectrum of bacteria.
  • the pathogen may comprise a virus particle or a fungal spore.
  • the pathogen should have multiple copies of the recognition element for the binding element that is attached to the nanoparticle. Examples include, but are not limited to, the GP 120 protein on the HIV virus that can bind to the CD4 protein provided on the nanoparticle, the neuraminidase enzyme on influenza viruses that can bind to nanoparticles functionalised with tamiflu (also known as oseltamivir). Other tight binding competitive inhibitors of neuraminidase could also be used.
  • the N- acetylneuraminyllactose ligand may also be provided on the nanoparticles for binding hemaglutinin found on influenza cell surfaces. Other lectin (sugar binding proteins) - carbohydrate interactions could also be included.
  • the fluidic medium may comprise a flow channel within a syringe, or a flow channel provided within a porous membrane.
  • the syringe preferably comprises a vessel, a plunger, an inlet and an outlet, the vessel comprising a first compartment for receiving a test sample and a second compartment comprising the capture zone for receiving the gold nanoparticles conjugated with the binding elements.
  • a coarse filter for preventing the passage of larger particles, such as any carrier material used for collection of the test sample preferably separates the first and second compartments.
  • a suitable coarse filter may have a pore size greater than l ⁇ m.
  • a second filter is provided between the second compartment and the outlet for forming the detection zone.
  • the second filter has a pore size sufficient to inhibit the passage of bound pathogen but allow unattached nanoparticles to pass through.
  • a suitable second filter may have a pore size of > O. l ⁇ m.
  • the aforementioned device allows for quick and easy detection of the presence or absence of pathogens, such as bacteria, in a test sample.
  • a test sample contained on a suitable absorbent compressible carrier, such as a cotton wool bud, is placed in the first compartment and water or an aqueous buffer solution is added thereto.
  • the syringe plunger forces fluid from the carrier through the filter into the second compartment for mixing with the functionalised gold or other nanoparticles.
  • the absorbent compressible carrier may be fixed to the plunger of the syringe device.
  • an easily cleavable seal or membrane may be provided below the filter to keep the nanoparticles within a specific region of the syringe, i.e to enable the syringe to be stored in a non- vertical position prior to use.
  • the plunger is depressed further to expel the solution through the second filter. If bacteria are present, these will bind to multiple gold nanoparticles causing aggregation thereof resulting in their retention on the filter, visibly staining the filter (generally, a dark red, purple or blue).
  • the functionalised nanoparticles may be provided within an easily punctured bag or pouch made of polyethylene or a similar material. The syringe plunger may be provided with means to puncture the bag or pouch during its depression.
  • the fluidic medium may comprise a porous membrane defining a flow channel in the form of a lateral flow assay.
  • the fluidic medium comprises a porous membrane, such as a nitrocellulose membrane, having a sample pad, a wicking pad, a capture zone and a detection zone.
  • the capture zone contains the gold (or other) nanoparticles conjugated with at least one binding element for binding a recognition element on or within the cell envelope of a pathogen and the detection zone preferably comprises a binding element for the pathogen, which may be the same or different to that attached to the nanoparticle, attached to the porous membrane.
  • the device may also include a control zone within the fluidic medium which does not contact the test sample or will not bind the binding element for comparing the colour of the fluidic medium having bound and non-bound bacteria.
  • a method for detecting the presence or absence of a pathogen comprising obtaining a sample from a surface to be tested, introducing fluid to the test sample and contacting an assay device according to the first aspect of the present invention with the fluid test sample.
  • a third aspect of the present invention provides a pathogen.
  • detector assay kit comprising a swab, preferably sterile, for obtaining a test sample, a container for mixing the sample with water or an aqueous buffer and an assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold or other nanoparticles capable of providing a visible change due to their aggregation, each nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen.
  • the binding element conjugated to a gold nanoparticle for binding a recognition element on or within the cell envelope of a bacterium is the glycopeptide antibiotic vancomycin.
  • Vancomycin is an example of a binding element which recognises a broad spectrum of Gram positive and Gram negative bacteria, specifically for vancomycin all those having the dipeptide sequence D-Alanine-D-Alanine in their cell wall structure.
  • D-AIa-D-AIa motifs including mono- and polyclonal antibodies and their fragments, such as sc-Fv's and Fabs
  • D-Ala-D-Ser or D-Ala-D-Lac (where Ala is alanine, Ser is serine and Lac is Lactate), as found in vancomycin resistant bacteria.
  • the binding element conjugated to a gold nanoparticle for binding a recognition element of a bacterium comprises at least part of lysostaphin, in particular the targeting domain of lysostaphin which recognises specific species S. aureus including methicillin resistant S.aureus (MRSA), vancomycin intermediate S.aureus (VISA) and glycopeptide intermediate S.aureus (GISA), the so-called "super-bugs”.
  • MRSA methicillin resistant S.aureus
  • VSA vancomycin intermediate S.aureus
  • GISA glycopeptide intermediate S.aureus
  • lysostaphin examples include, for example, homologues thereof, ZoocinA, LytM, Millericin B and Stapylococcal and Streptococcal phase enzymes such as Twort and phi85 for Gram-positive bacteria and the colicin binding protein for Gram-negative bacteria.
  • the colicin sequence (for colicin E9 residues 434-418) attach to a specific E.coli receptor binding protein for which the sequence in known (CN. Penfold et al. MoI Microbiol. 2000, 38, 639-649).
  • Additional examples include the (bacterio)phage proteins, each of which bind specifically to one species of bacteria (which may be Gram-positive or Gram-negative), lysozyme that has been catalytically deactivated and binds the NAG-NAM polymer of peptidoglycan and lectins (sugar binding proteins) that bind to sugars on the surface of pathogens.
  • bacteria which may be Gram-positive or Gram-negative
  • lysozyme that has been catalytically deactivated and binds the NAG-NAM polymer of peptidoglycan and lectins (sugar binding proteins) that bind to sugars on the surface of pathogens.
  • a fourth aspect of the present invention provides the use of a functionalised gold or other nanoparticle construct conjugated with a binding element for binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen, which may be specific to a single species of pathogen or bind to a broad spectrum of pathogens, for detecting the presence or absence of the pathogen in a test sample.
  • a functionalised gold or other nanoparticle comprising a gold nanoparticle having a lysostaphin-targeting domain attached thereto.
  • the lysostaphin targeting domain has the DNA sequence identified as Seq. ID No. 1 and has the amino sequence identified as Seq ID No. 2.
  • Homologues (isoproteins) of the binding elements may also be used for the functionalised GNP construct.
  • each gold or other nanoparticle will have one to multiple binding elements attached thereto and that multiple gold nanoparticles will bind to one or more cells simultaneously.
  • Figure 1 is a schematic diagram illustrating the binding of vancomycin to a gold nanoparticle
  • Figures 2a to 2c is a schematic diagram illustrating the steps involved in the detection of bacteria using a syringe-based device according to one embodiment of the present invention
  • Figure 3 is a schematic diagram illustrating the binding of lysostaphin to a gold nanoparticle according to an embodiment of the present invention
  • Figures 4a to 4c illustrate the steps involved in the detection of bacteria using a lateral flow device according to a further embodiment of the present invention.
  • Figures 5a to 5d is a schematic diagram illustrating the steps involved in the detection of bacteria using a syringe-based device according to yet a further embodiment of the present invention.
  • the present invention provides a method and device for the detection of dead and live pathogens, such as bacteria on a swabbed surface in minimal time and without the need for complex equipment and specially trained staff.
  • the basic concept involves the attachment of a pathogen recognition binding site, in particular, but not exclusively, for binding a recognition element, such as a protein in the outer cellular membrane of a bacteria, to a gold nanoparticle (GNP) which is then able to bind a broad spectrum or specific species of bacteria present at low concentrations on a surface.
  • GNP gold nanoparticle
  • aureus cell is ⁇ l ⁇ m in diameter whilst the functionalised GNPs used in the present invention are in the range 10-100 nm allowing 100-100Os of GNPs to be accommodated on the surface of a single cell. Furthermore, the sites being recognised by the functionalised GNPs are present in large amounts per cell (> 50,000 per cell) causing multiple functionalised GNPs to bind to a single bacterial cell to cause aggregation of the cells, bringing the GNPs into close proximity causing a visual colour change (red to blue for a an aqueous solution) indicating the presence of a pathogen in a short period of time.
  • This system requires no prior separation of the recognition element from bacterial cell envelope to allow for binding of the recognition element with the functionalised GNP.
  • the device and method of the present invention allows for rapid detection using methodology and instrumentation that can be used daily by, for example, cleaning and nursing staff through a one-step process that is economically viable.
  • Example 1 A syringe-based device containing a GNP-vancomycin construct.
  • a functionalised GNP construct was prepared having the antibiotic vancomycin attached thereto. This binds to a broad spectrum of both Gram positive and Gram negative bacteria. Vancomycin binds the D-Alanine-D-Alanine dipeptide sequence found in the cell walls of almost all bacteria including S. aureus, C. difficle and E. coli.
  • Vancomycin attached to a variety of nanoparticles, including gold, has previously been reported.
  • the syringe, loaded with functionalised gold nanoparticles, is used to detect for a broad spectrum of bacteria present at low concentrations on a surface.
  • the surface to be tested was wiped with a sterile cotton wool bud over a defined area (for example, 1 Ocm x 10cm), as illustrated in Figure 2a.
  • the cotton wool bud was then placed within the syringe via the inlet and a volume of water ( ⁇ 2ml) was added.
  • the plunger 6 was then pressed down to force the water containing the pathogen from the cotton wool bud through the coarse filter (»1 ⁇ m) into the second compartment containing the functionalised nanoparticles.
  • the water and nanoparticles were left to mix for a specified period of time (2-3 minutes), so that any bacteria present could bind with the nanoparticles.
  • the plunger 6 was then depressed further expelling the solution through a white 0.2 ⁇ m filter 12. If any bacteria were present in the solution, these were retained by means of the aggregated gold nanoparticles on the filter 12, visibly staining the filter (generally purple-blue colour). Unattached gold nanoparticles passed through the filter.
  • the solution expelled from the syringe was sterile as all bacteria were trapped by the filter 12. The whole pathogen detector process took around 10 minutes to complete. The expelled solution is retained within a receptacle for safe disposal.
  • Example 2 A lateral flow device containing a GNP-lysostaphin construct.
  • Lss-TD Lss targeting domain
  • a 5nm gold nanoparticle is ⁇ 10 3 smaller than a bacterium and thus multiple GNPs can bind to a single cell. Nanopaiticles less than lOOnm are considered suitable for use with the present invention.
  • the modified version of the lysostaphin targeting domain protein has a cysteine residue (the only one in the protein) introduced close to the exposed C-terminal of the protein. The cysteine residue has a thiol (-SH) group that reacts with gold to form a stable covalent bond anchoring the Lss-TD to the GNP surface.
  • the amino acid sequence for the Lysotaphin Targeting Domain + Linker region is shown below (SEQ. ID No. 2).
  • the sequence was cloned into the pET-21a vector with C- terminal His-tag and Leucine to Cysteine mutation:
  • the gold nanoparticles having Lss-TDs attached thereto were then incorporated into a lateral flow device.
  • Lateral flow devices are currently available on the market, for example, in the form of home pregnancy kits for testing for the presence of human chorionic gonadotrophin in the urine of pregnant women.
  • the basic design is shown in Figures 4a to 4c of the accompanying drawings.
  • the fluidic medium comprises a nitrocellulose membrane 20 attached to a suitable backing sheet 22, such as a flat sheet of glass, metal or plastics material.
  • a conjugate pad 30 is provided adjacent to the sample pad containing the gold nanoparticles functionalised with Lss-TD 40' (the "capture zone").
  • Two further parallel strips of material are provided towards the wicking end of the membrane.
  • a first strip 32 comprises the detection zone and has Lss-TD sites 40 attached to the membrane and a second strip 34 has a lysostaphin construct 40" attached to the cell membrane which has its targeting domain altered or removed so that it will not bind to a bacterial cell membrane. This strip forms the control zone.
  • a surface to be tested was again sampled with a sterile cotton wool ball and this was placed in a syringe with water or an aqueous buffer for transferring the aqueous sample S to the pad 24 (see Figure 4a).
  • Any bacteria present in the sample bind to the Lss- TD recognition sites on the gold nanoparticles 40' on the conjugate pad 30. These were then drawn along the membrane by means of capillary flow (denoted by A in Figure 4a) where they contact further Lss-TD sites 40 provided in the detection zone 32. This caused aggregation of the GNPs to produce a colour change in the strip 32 to provide a positive test result. This can be compared with the colour in the neighbouring control zone 34 which will not allow binding of bacteria conjugated to the functionalised GNPs.
  • the aforementioned example uses lysostaphin-conjugated nanoparticles in a lateral flow device but other conjugated particles could equally be used, such as vancomycin- conjugated particles.
  • the majority of the lateral flow device may be encased in a suitable housing with only the sample pad extending therefrom to allow contact with the fluid sample.
  • a suitable viewing window may be provided within the housing to view the detection and control zones.
  • the assay device according to the invention may include different types of conjugated particles, such as both lysostaphin-conjugated nanoparticles and vancomycin-conjugated particles.
  • GNPs bearing more than one type of detection (binding) element on a single nanoparticle could also be used. These may provide multiple detection zones for the detection of different types of pathogen.
  • Suitable recognition elements for bacteria and viruses attached to gold nanoparticles or similar include homologues of the lysostaphin targeting/cellwall domain, as detailed below:
  • ALE-I Cell wall binding domain Sugai,M., Fujiwara,T., Akiyama,T., Ohara,M., Komatsuzawa,H., Inoue,S. and Suginaka,H. "Purification and molecular characterization of glycylglycine endopeptidase produced by Staphylococcus capitis EPKl". (J. Bacteriol. 179 (4), 1193-1202 (1997)).
  • Staphylococcus phage TWORT Loessner,M.J., Gaeng,S., Wendlinger,G., Maier,S.K. and Scherer,S. "The two-component lysis system of Staphylococcus Aureus bacteriophage Twort: a large TTG-start holin and an associated amidase endolysin". (FEMS Microbiol. Lett. 162 (2), 265-274 (1998)).
  • Bacteriophage phiMR25 Hoshiba,H., Uchiyama,J., Rashel,M, Maeda,Y., Takemura,I., Sugihara,Y., Muraoka,A. and Matsuzaki,S. "Characterization of two staphylococcal bacteriophage". Unpublished.
  • Streptococcus group B streptococcus secreted protein/choline binding protein [Streptococcus agalactiae]
  • a recognition element comprising a 76-residue of colicin E9 (residues 343-418), or its homologues can be used. See Penfold CN, Garinot-Schneider C, Hemmings AM, Moore GR, Kleanthous C, James R., (MoI Microbiol. 2000 Nov;38(3):639-49).
  • the protein sequence of the colicin receptor binding protein is:
  • GNPs bound to a binding element that directly recognises and binds to a cell surface protein of a bacterium incorporated into a fluid flow device of the present invention allows for simple, effective and quick detection of bacteria on a surface.
  • the syringe or lateral flow device can be provided cheaply as single-use disposable systems. A yes/no result is obtained in a relatively short period of time (5-20 mins) without any off site analysis being required.
  • sampling techniques used with the present invention do not leave any undesirable material on the surface being tested
  • the present invention detects the presence of live and dead bacteria and therefore it is proposed that a positive test result using the device and method of the present invention be followed up with a subsequent test for live bacteria, such as a procedure to detect sugar consumption in a liquid sample (S. Nath et al Anal Chem 2008, 80, 1033). This takes longer and is more expensive than the test according to the present invention and hence, it is desirable to use this test only upon a positive detection of pathogens in a test area.
  • FIGS. 5a to 5d of the accompanying drawings illustrate a further embodiment of a syringe-based device according to the present invention.
  • a plunger 206 for a syringe 200 has a sterile cotton wool ball 201 attached to one end thereof and includes a sharp point 202 The cotton wool ball is wiped over a defined area S to be tested (for example, 10cm x lOcm), as illustrated in Figure 5a.
  • the syringe plunger is then mounted in a syringe body 200 having an inlet 204, a coarse filter 208, a micro filter 212 (around 0.2 ⁇ m) and an outlet port 214.
  • the coarse filter is in the form of a movable solid disc requiring signf ⁇ cant pressure to move it from position C to D, as shown in the figures.
  • the upper chamber of the syringe body above the coarse filter contains a pouch 217 holding the functionalised gold or other nanoparticles, together with a suitable amount of a buffer solution or water. Movement of the plunger downwardly (as indicated by arrow B in Figures 5b and 5c) pierces the pouch by means of the sharp point 202, thereby releasing GNPs in solution.
  • the GNPs and any bacteria in solution picked up by the cotton wool bud are able to pass through the coarse filter 208 into a lower chamber where they are left to mix for a short period of time (2-3 minutes), thereby enabling the bacteria to bind with the GNPs to form bacteria-GNP aggregate 220.
  • the plunger 206 is depressed further (see Fig. 5d) to expel the solution and any unbound GNPs through the fine filter 212 and out of the outlet 214 where it is collected in a receptacle 230.
  • the bateria-GNP aggregate is retained on the filter, visibly staining the filter.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Nanotechnology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A pathogen detector assay device, method and kit, the device comprising a fluidic medium such as a flow channel in a syringe or porous membrane (20), the fluidic medium having at least one capture zone (30) and detection zone (32); the fluidic medium in said capture and detection zone being in fluid communication with a detection probe (40 ' ) comprising a plurality of gold nanoparticles or other nanoparticles capable of providing a visible change due to their aggregation, each gold or other nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within a cell envelope of a pathogen, such as a bacterium or viral particle, for detecting the presence or absence of the pathogen in a sample.

Description

Pathogen Detector Assay, Method and Kit
The present invention relates to a pathogen detector assay device, method and kit for the detection of harmful pathogens in critical environments, such as healthcare and food preparation environments.
It is desirable to be able to quickly and simply detect the presence of harmful bacteria in critical environments, particularly in the healthcare and food preparation environments. Other critical environments where detection of harmful pathogens is beneficial include, but are not limited to, residential care homes, mass transit systems (subways, aircraft cabins) and leisure facilities. It is also highly desirable to be able to detect the presence of harmful viruses in a similar manner.
The incidences of hospital-acquired infections have increased dramatically over recent years. It is important to be able to detect the presence of harmful pathogens so that the necessary measures can be quickly put in place to reduce the spread of any infection. However, current methods of identifying harmful pathogens require the use of expensive equipment, specialised staff and generally require at least 24 hours for the results.
A one-step immunochromatographic assay for the detection of S. aureus in food has been reported by S.-H. Huang et al (Food Control, 2007, 18, 893; Sens Actuators B 2007 127, 335; latex agglutination, J. Food Protection, 1993, 56, 759). This uses a lateral flow device in which a sandwich assay formed from staphylococcal protein A, a cell wall protein of S. aureus, is trapped by an anti-protein A IgG immobilised on a nitrocellulose membrane and a second anti-protein A IgG that is conjugated to a gold nanoparticle. A limitation of this system is that protein A has to be separated from the bacteria before analysis, adding 24 hours to the 10 minutes required to run the lateral flow device. A substantial bacterial population (around 10 - 10 cells per ml) is also required to produce a detectable quantity of protein A.
It is object of the present invention to provide a pathogen detector which aims to overcome, or at least alleviate, the abovementioned drawbacks.
Accordingly, a first aspect of the present invention provides a pathogen detector assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold nanoparticles or other nanoparticles capable of providing a visible change due to their aggregation, each gold or other nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen.
In the context of this disclosure, the term "pathogen" describes any disease- producing biological agent, specifically bacteria, viruses and other microorganisms. Furthermore, the term "directly binding a recognition element" means that the GNP or other nanoparticle construct is able to bind to the recognition element, being a peptidoglycan, protein/peptidoglycan or glycoprotein, that is exposed on either the cell wall, the outer or cytoplasmic membranes of the pathogen or within the periplasmic space between the membranes, without any prior separation of the protein from the pathogen.
The cell envelope includes the cell membrane and cell wall. The recognition elements that may be recognised by the binding element include membrane proteins, the N-acetylmuramic acid-N-acetylglucosamine (NAG-NAM) oligosaccharide polymer of peptidoglycan; the polypeptide polymer of peptidoglycan; peptide linkers that anchor proteins to peptidoglycan; oligosaccaride/carbohydrate structures on the cytoplasmic or outer membranes; lipopolysaccharides on the membrane and proteins that make up the capsids of viruses.
Ideally, individual cells should bind multiple nanoparticles to provide sufficient aggregation to effect a visible change for detection of the pathogens.
In one embodiment of the present invention, the pathogen comprises a bacterium wherein each gold or other nanoparticle is conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a species or broad spectrum of bacteria.
In another embodiment of the present invention, the pathogen may comprise a virus particle or a fungal spore. The pathogen should have multiple copies of the recognition element for the binding element that is attached to the nanoparticle. Examples include, but are not limited to, the GP 120 protein on the HIV virus that can bind to the CD4 protein provided on the nanoparticle, the neuraminidase enzyme on influenza viruses that can bind to nanoparticles functionalised with tamiflu (also known as oseltamivir). Other tight binding competitive inhibitors of neuraminidase could also be used. The N- acetylneuraminyllactose ligand may also be provided on the nanoparticles for binding hemaglutinin found on influenza cell surfaces. Other lectin (sugar binding proteins) - carbohydrate interactions could also be included.
The fluidic medium may comprise a flow channel within a syringe, or a flow channel provided within a porous membrane. In the former, the syringe preferably comprises a vessel, a plunger, an inlet and an outlet, the vessel comprising a first compartment for receiving a test sample and a second compartment comprising the capture zone for receiving the gold nanoparticles conjugated with the binding elements. A coarse filter for preventing the passage of larger particles, such as any carrier material used for collection of the test sample, preferably separates the first and second compartments. For example, a suitable coarse filter may have a pore size greater than lμm. Ideally, a second filter is provided between the second compartment and the outlet for forming the detection zone. The second filter has a pore size sufficient to inhibit the passage of bound pathogen but allow unattached nanoparticles to pass through. For example, a suitable second filter may have a pore size of > O. lμm.
The aforementioned device allows for quick and easy detection of the presence or absence of pathogens, such as bacteria, in a test sample. A test sample, contained on a suitable absorbent compressible carrier, such as a cotton wool bud, is placed in the first compartment and water or an aqueous buffer solution is added thereto. The syringe plunger forces fluid from the carrier through the filter into the second compartment for mixing with the functionalised gold or other nanoparticles. The absorbent compressible carrier may be fixed to the plunger of the syringe device. Optionally, an easily cleavable seal or membrane may be provided below the filter to keep the nanoparticles within a specific region of the syringe, i.e to enable the syringe to be stored in a non- vertical position prior to use. After a predetermined period of time, the plunger is depressed further to expel the solution through the second filter. If bacteria are present, these will bind to multiple gold nanoparticles causing aggregation thereof resulting in their retention on the filter, visibly staining the filter (generally, a dark red, purple or blue). Alternatively, the functionalised nanoparticles may be provided within an easily punctured bag or pouch made of polyethylene or a similar material. The syringe plunger may be provided with means to puncture the bag or pouch during its depression.
In an alternative embodiment of the present invention, the fluidic medium may comprise a porous membrane defining a flow channel in the form of a lateral flow assay. In this embodiment, the fluidic medium comprises a porous membrane, such as a nitrocellulose membrane, having a sample pad, a wicking pad, a capture zone and a detection zone. The capture zone contains the gold (or other) nanoparticles conjugated with at least one binding element for binding a recognition element on or within the cell envelope of a pathogen and the detection zone preferably comprises a binding element for the pathogen, which may be the same or different to that attached to the nanoparticle, attached to the porous membrane.
The device may also include a control zone within the fluidic medium which does not contact the test sample or will not bind the binding element for comparing the colour of the fluidic medium having bound and non-bound bacteria.
According to a second aspect of the present invention, there is provided a method for detecting the presence or absence of a pathogen comprising obtaining a sample from a surface to be tested, introducing fluid to the test sample and contacting an assay device according to the first aspect of the present invention with the fluid test sample.
A third aspect of the present invention provides a pathogen. detector assay kit comprising a swab, preferably sterile, for obtaining a test sample, a container for mixing the sample with water or an aqueous buffer and an assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold or other nanoparticles capable of providing a visible change due to their aggregation, each nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen. In one embodiment of the present invention, the binding element conjugated to a gold nanoparticle for binding a recognition element on or within the cell envelope of a bacterium is the glycopeptide antibiotic vancomycin. Vancomycin is an example of a binding element which recognises a broad spectrum of Gram positive and Gram negative bacteria, specifically for vancomycin all those having the dipeptide sequence D-Alanine-D-Alanine in their cell wall structure. Other molecules which may be used include other glycopeptide antibiotics and molecules that bind the D-AIa-D-AIa motifs (including mono- and polyclonal antibodies and their fragments, such as sc-Fv's and Fabs) or its alternatives of D-Ala-D-Ser or D-Ala-D-Lac (where Ala is alanine, Ser is serine and Lac is Lactate), as found in vancomycin resistant bacteria.
In an alternative embodiment of the present invention, the binding element conjugated to a gold nanoparticle for binding a recognition element of a bacterium comprises at least part of lysostaphin, in particular the targeting domain of lysostaphin which recognises specific species S. aureus including methicillin resistant S.aureus (MRSA), vancomycin intermediate S.aureus (VISA) and glycopeptide intermediate S.aureus (GISA), the so-called "super-bugs". Other alternatives to lysostaphin include, for example, homologues thereof, ZoocinA, LytM, Millericin B and Stapylococcal and Streptococcal phase enzymes such as Twort and phi85 for Gram-positive bacteria and the colicin binding protein for Gram-negative bacteria. The colicin sequence (for colicin E9 residues 434-418) attach to a specific E.coli receptor binding protein for which the sequence in known (CN. Penfold et al. MoI Microbiol. 2000, 38, 639-649). Additional examples include the (bacterio)phage proteins, each of which bind specifically to one species of bacteria (which may be Gram-positive or Gram-negative), lysozyme that has been catalytically deactivated and binds the NAG-NAM polymer of peptidoglycan and lectins (sugar binding proteins) that bind to sugars on the surface of pathogens. A fourth aspect of the present invention provides the use of a functionalised gold or other nanoparticle construct conjugated with a binding element for binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen, which may be specific to a single species of pathogen or bind to a broad spectrum of pathogens, for detecting the presence or absence of the pathogen in a test sample.
To this end, there is provided a functionalised gold or other nanoparticle comprising a gold nanoparticle having a lysostaphin-targeting domain attached thereto. Preferably, the lysostaphin targeting domain has the DNA sequence identified as Seq. ID No. 1 and has the amino sequence identified as Seq ID No. 2.
Homologues (isoproteins) of the binding elements may also be used for the functionalised GNP construct.
It is to be appreciated that in the present invention each gold or other nanoparticle will have one to multiple binding elements attached thereto and that multiple gold nanoparticles will bind to one or more cells simultaneously.
For a better understanding of the present invention and to show more clearly how it may be carried into effect reference will now be made by way of example only to the accompanying drawings in which:
Figure 1 is a schematic diagram illustrating the binding of vancomycin to a gold nanoparticle;
Figures 2a to 2c is a schematic diagram illustrating the steps involved in the detection of bacteria using a syringe-based device according to one embodiment of the present invention; Figure 3 is a schematic diagram illustrating the binding of lysostaphin to a gold nanoparticle according to an embodiment of the present invention;
Figures 4a to 4c illustrate the steps involved in the detection of bacteria using a lateral flow device according to a further embodiment of the present invention; and
Figures 5a to 5d is a schematic diagram illustrating the steps involved in the detection of bacteria using a syringe-based device according to yet a further embodiment of the present invention.
The present invention provides a method and device for the detection of dead and live pathogens, such as bacteria on a swabbed surface in minimal time and without the need for complex equipment and specially trained staff. The basic concept involves the attachment of a pathogen recognition binding site, in particular, but not exclusively, for binding a recognition element, such as a protein in the outer cellular membrane of a bacteria, to a gold nanoparticle (GNP) which is then able to bind a broad spectrum or specific species of bacteria present at low concentrations on a surface. A S. aureus cell is ~ lμm in diameter whilst the functionalised GNPs used in the present invention are in the range 10-100 nm allowing 100-100Os of GNPs to be accommodated on the surface of a single cell. Furthermore, the sites being recognised by the functionalised GNPs are present in large amounts per cell (> 50,000 per cell) causing multiple functionalised GNPs to bind to a single bacterial cell to cause aggregation of the cells, bringing the GNPs into close proximity causing a visual colour change (red to blue for a an aqueous solution) indicating the presence of a pathogen in a short period of time. This system requires no prior separation of the recognition element from bacterial cell envelope to allow for binding of the recognition element with the functionalised GNP. The device and method of the present invention allows for rapid detection using methodology and instrumentation that can be used daily by, for example, cleaning and nursing staff through a one-step process that is economically viable.
Example 1: A syringe-based device containing a GNP-vancomycin construct.
The use of gold nanoparticles functionalised with a broad spectrum bacterial binding element was investigated. A functionalised GNP construct was prepared having the antibiotic vancomycin attached thereto. This binds to a broad spectrum of both Gram positive and Gram negative bacteria. Vancomycin binds the D-Alanine-D-Alanine dipeptide sequence found in the cell walls of almost all bacteria including S. aureus, C. difficle and E. coli.
Vancomycin attached to a variety of nanoparticles, including gold, has previously been reported. (A. J. KeIl et al. ACS Nano, 2008, 2, 1777; A. J. KeIl and B. Simard, ChemComm, 2007, 1227; W.-C-Huang et al. Nanomed,, 2007, 2, 777; J. Gao et al Adv Matter., 2006, 18, 3145; G.H. Gu et al. Nano Lett. 2003, 3, 1261).
In the present example, we used the method of Sundram and Griffiths (J. Org. Chem., 2005, 60, 1 102; U.N. Sundram et al, J. Am. Chem. Soc, 1996, 118, 13107) to prepare 6w(cystamine)-vancomycin from vancomycin in a one step process using standard peptide coupling chemistry. The 6/5(cystamine)-vancomycin was then immobilised onto gold nanoparticles via the formation of a gold-sulfur bond, as described by W.-C-Huang (vide supra). The chemistry to achieve this linkage is illustrated in Figure 1 of the accompanying drawings. Alternative linkage chemistry such as via maleimide functionalised GNPs is also possible. The functionalised gold nanoparticles 10 were then provided within a syringe 2 having an inlet 4, plunger 6, coarse filter 8, a micro filter 12 (0.2 μm) and outlet port 14, as shown in Figures 2b and 2c.
The syringe, loaded with functionalised gold nanoparticles, is used to detect for a broad spectrum of bacteria present at low concentrations on a surface. The surface to be tested was wiped with a sterile cotton wool bud over a defined area (for example, 1 Ocm x 10cm), as illustrated in Figure 2a. The cotton wool bud was then placed within the syringe via the inlet and a volume of water (< 2ml) was added. The plunger 6 was then pressed down to force the water containing the pathogen from the cotton wool bud through the coarse filter (»1 μm) into the second compartment containing the functionalised nanoparticles. The water and nanoparticles were left to mix for a specified period of time (2-3 minutes), so that any bacteria present could bind with the nanoparticles. The plunger 6 was then depressed further expelling the solution through a white 0.2 μm filter 12. If any bacteria were present in the solution, these were retained by means of the aggregated gold nanoparticles on the filter 12, visibly staining the filter (generally purple-blue colour). Unattached gold nanoparticles passed through the filter. The solution expelled from the syringe was sterile as all bacteria were trapped by the filter 12. The whole pathogen detector process took around 10 minutes to complete. The expelled solution is retained within a receptacle for safe disposal.
Whilst the aforementioned example uses vancomycin-conjugated nanoparticles, it is to be appreciated that alternative conjugated nanoparticles may be utilised in the syringe device to identify other pathogens. For example, lysostaphin-conjugated nanoparticles may be incorporated into the device to recognise the bacterial species S. aureus. Example 2: A lateral flow device containing a GNP-lysostaphin construct.
In ongoing studies, the inventor and his team have cloned, expressed and re- engineered lysostaphin and a number of closely related enzymes (LytM, Ale 1, Zoocin A) and also produced versions of the proteins in which the targeting domain recognising specific types of bacteria was fused either genetically to green fluorescent protein (GFP) or to synthetic small molecule fluorescent labels such as fluorescein. One of the constructs engineered includes the Lss targeting domain (Lss-TD) fused to GFP which was found to retain its ability to bind to S, aureus. Whilst the exact receptor of the Lss-TD is unknown, it has been estimated that -100,000 Lss-TD-GFP fusion proteins can bind a single S. aureus cell (diameter ~1 μm).
In view of the above, it was decided to engineer a GNP construct conjugated with the Cys-mutant of the Lss-TD. A 5nm gold nanoparticle is ~103 smaller than a bacterium and thus multiple GNPs can bind to a single cell. Nanopaiticles less than lOOnm are considered suitable for use with the present invention. The modified version of the lysostaphin targeting domain protein has a cysteine residue (the only one in the protein) introduced close to the exposed C-terminal of the protein. The cysteine residue has a thiol (-SH) group that reacts with gold to form a stable covalent bond anchoring the Lss-TD to the GNP surface.
The amino acid sequence for the Lysotaphin Targeting Domain + Linker region is shown below (SEQ. ID No. 2). The sequence was cloned into the pET-21a vector with C- terminal His-tag and Leucine to Cysteine mutation:
Construct' s DNA sequence: atgcctttctgcaagagcgcaggatatggaaaagcaggtggtacagtaactccaacgccgaatacaggttggaaaacaaacaaa tatggcacactatataaatcagagtcagctagcttcacacctaatacagatataataacaagaacgactggtccatttagaagcatgc cgcagtcaggagtcttaaaagcaggtcaaacaattcattatgatgaagtgatgaaacaagacggtcatgtttgggtaggttatacag gtaacagtggccaacgtatttacttgcctgtaagaacatggaataaatctactaatactttaggtgttctttggggaactataaagctcg agcaccaccaccaccaccac
(SEQ ID No. 1) Lss-T (Cys) amino-acid sequence:
MPFCKSAGYGKAGGTVTPTPNTGWKT^KYGTL^^
MPQSGVI&AGQTTHYDEVM^
LWGTIKLEHHHHHH
(SEQ. ID NO. 2)
Leu -> Cys mutation is underlined.
Amino acids not found in the lysostaphin gene (artefact of cloning) shown in bold.
The process for preparing the GNP-lysostaphin construct (Lss-TD@Au nanoparticle) is illustrated in Figure 3 of the accompanying drawings. Alternative maleimide-cysteine linkage is also possible.
The gold nanoparticles having Lss-TDs attached thereto were then incorporated into a lateral flow device. Lateral flow devices are currently available on the market, for example, in the form of home pregnancy kits for testing for the presence of human chorionic gonadotrophin in the urine of pregnant women. The basic design is shown in Figures 4a to 4c of the accompanying drawings. The fluidic medium comprises a nitrocellulose membrane 20 attached to a suitable backing sheet 22, such as a flat sheet of glass, metal or plastics material. One end of the membrane has a sample pad 24 for receiving a fluid sample and the other end has a wicking pad 28 for drawing fluid along the membrane 20 A conjugate pad 30 is provided adjacent to the sample pad containing the gold nanoparticles functionalised with Lss-TD 40' (the "capture zone"). Two further parallel strips of material are provided towards the wicking end of the membrane. A first strip 32 comprises the detection zone and has Lss-TD sites 40 attached to the membrane and a second strip 34 has a lysostaphin construct 40" attached to the cell membrane which has its targeting domain altered or removed so that it will not bind to a bacterial cell membrane. This strip forms the control zone.
A surface to be tested was again sampled with a sterile cotton wool ball and this was placed in a syringe with water or an aqueous buffer for transferring the aqueous sample S to the pad 24 (see Figure 4a). Any bacteria present in the sample bind to the Lss- TD recognition sites on the gold nanoparticles 40' on the conjugate pad 30. These were then drawn along the membrane by means of capillary flow (denoted by A in Figure 4a) where they contact further Lss-TD sites 40 provided in the detection zone 32. This caused aggregation of the GNPs to produce a colour change in the strip 32 to provide a positive test result. This can be compared with the colour in the neighbouring control zone 34 which will not allow binding of bacteria conjugated to the functionalised GNPs.
The aforementioned example uses lysostaphin-conjugated nanoparticles in a lateral flow device but other conjugated particles could equally be used, such as vancomycin- conjugated particles.
It is to be appreciated that the majority of the lateral flow device may be encased in a suitable housing with only the sample pad extending therefrom to allow contact with the fluid sample. A suitable viewing window may be provided within the housing to view the detection and control zones. '
Additionally, the assay device according to the invention may include different types of conjugated particles, such as both lysostaphin-conjugated nanoparticles and vancomycin-conjugated particles. GNPs bearing more than one type of detection (binding) element on a single nanoparticle could also be used. These may provide multiple detection zones for the detection of different types of pathogen.
Other suitable recognition elements for bacteria and viruses attached to gold nanoparticles or similar include homologues of the lysostaphin targeting/cellwall domain, as detailed below:
1. ALE-I Cell wall binding domain: Sugai,M., Fujiwara,T., Akiyama,T., Ohara,M., Komatsuzawa,H., Inoue,S. and Suginaka,H. "Purification and molecular characterization of glycylglycine endopeptidase produced by Staphylococcus capitis EPKl". (J. Bacteriol. 179 (4), 1193-1202 (1997)).
2. Putative N-acetylmuramoyl L-alanine amidase from S. haemolyticus Takeuchi,F., Watanabe,S., Baba,T., Yuzawa,H., Ito,T., Morimoto,Y., Kuroda,M., Cui,L., Takahashi,M., Ankai,A., Baba,S., Fukui,S., Lee,J.C. and Hiramatsu,K. "Whole-genome sequencing of staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species". ( J. Bacteriol. 187 (21), 7292- 7308 (2005)).
3. Staphylococcus phage TWORT. Loessner,M.J., Gaeng,S., Wendlinger,G., Maier,S.K. and Scherer,S. "The two-component lysis system of Staphylococcus Aureus bacteriophage Twort: a large TTG-start holin and an associated amidase endolysin". (FEMS Microbiol. Lett. 162 (2), 265-274 (1998)).
4. . Bacteriophage phiWMY. Yokoi,K.J., Kawahigashi,N., Uchida,M., Sugahara,K., Shinohara,M., Kawasaki, K., Nakamura,S., Taketo,A. and Kodaira,K. "The two-component cell lysis genes hoi WM Y and lysWMY of the Staphylococcus warneri M phage varphiWMY: cloning, sequencing, expression, and mutational analysis in Escherichia coli". (Gene 351 , 97-108 (2005)). 5. Bacteriophage 85. Kwan,T., Liu,J., Dubow,M., Gros,P. and Pelletier,J. "The complete genomes and proteomes of 27 Staphylococcus aureus Bacteriophages". (Proc. Natl. Acad. Sci. U.S.A. 102 (14), 5174-5179 (2005)).
6. Bacteriophage phiMR25. Hoshiba,H., Uchiyama,J., Rashel,M, Maeda,Y., Takemura,I., Sugihara,Y., Muraoka,A. and Matsuzaki,S. "Characterization of two staphylococcal bacteriophage". Unpublished.
7. Autolysin/endolysin. Howden,B.P., Stinear,T., Johnson,P.D.R., Ward,P.B.
and Davies,J.K. "Genome Sequencing Identifies a Point Mutation in a Sensor Gene graS that Leads to Vancomycin-Intermediate Resistance in a Clinical Staphylococcus aureus Isolate". Unpublished (dbilBAG48165.1 |)
8. Amidase (phage phi 1 1). Iandolo,J.J., Worrell,V., Groicher,K.H., Qian,Y., Tian,R.Kenton,S., Dorman,A., Ji,H., Lin,S., Loh,P., Qi,S., Zhu,H. and Roe,B.A. "Comparative analysis of the genomes of the temperate bacteriophages phil 1, phi 12 and phi 13 of Staphylococcus aureus 8325". (Gene 289 (1 -2), 109-1 18 (2002)).
9. Streptococcus (group B streptococcus secreted protein/choline binding protein [Streptococcus agalactiae]) Reinscheid,D.J., Stosser,C, Ehlert,K., Jack,R.W., Moller,K. Eikmanns,B.J. and Chhatwal,G.S. "Influence of proteins Bsp and FemH on cell shape and peptidoglycan composition in group B streptococcus". (Microbiology (Reading, Engl.) 148 (PT 10), 3245-3254 (2002)).
10. autolysin [Streptococcus equi subsp. zooepidemicus MGCS 10565] Beres,S.B., Sesso,R., Pinto,S.W., Hoe,N.P., Porcella,S.F., Deleo,F.R. and Musser,J.M. "Genome sequence of a lancefield group C Streptococcus zooepidemicus strain causing epidemic nephritis: new information about an old Disease". (PLoS ONE 3 (8), E3026 (2008)). 1 1. endolysin [Enterococcus faecalis V583]. Paulsen,L, Banerjei,L., Myers, G. S. A., Nelson,K.E., Seshadri,R., Read,T.D., Fouts,D.E., Eisen,J.A., Gill.S.R., Heidelberg,J.F.,Tettelin,H., Dodson,R.J., Umayam,L., Brinkac,L., Beanan,M., Daugherty,S., DeBoy.R.T., Durkin,S., KolonayJ., Madupu,R., Nelson,W., VamathevanJ., Tran,B., Upton,J., Hansen,T., Shetty,J., Khouri,H., Utterback,T., Radune,D., Ketchum,K.A., Dougherty,B.A. and Fraser,C.M. "Role of Mobile DNA in the Evolution of Vancomycin-Resistant. Enterococcus faecalis". (Science 299 (5615), 2071-2074 (2003)).
12. putative choline binding protein [Streptococcus pyogenes Ml GAS]. REFERENCE 1 (residues 1 to 374). FerrettiJ.J., McShan,W.M., Adjic,D., Savic,D., Savic.G., Lyon,K., Primeaux,C, Sezate,S.S., Surorov,A.N., Kenton,S., Lai, H., Lin,S.,Qian,Y., Jia,H.G., Najar,F.Z., Ren,Q., Zhu,H., Song.L., White,!, Yuan,X., Clifton,S.W., Roe,B.A. and McLaughlin,R.E. "Complete genome sequence of an Ml strain of Streptococcus pyogenes". (Proc. Natl. Acad. Sci. U.S.A. 98 (8), 4658-4663 (2001)).
Also highly similar sequences found in the following phage: SAP-2, 44AHJD, Staphylococcus phage 66, X2, 37, 812, K, EW, Gl, 52A, MRl 1, 92, 55, 11, 29, 69, RF122, 80alpha, 88, mu50, 2638A, 85.
For E. CoIi, a recognition element comprising a 76-residue of colicin E9 (residues 343-418), or its homologues can be used. See Penfold CN, Garinot-Schneider C, Hemmings AM, Moore GR, Kleanthous C, James R., (MoI Microbiol. 2000 Nov;38(3):639-49).
The protein sequence of the colicin receptor binding protein is:
nqerqakavq vynsrkseld aanktladai aeikqfnrfa hdpmagghrm wqmaglkaqr aqtdvnnkqa afdaaake
(SEQ. ID No. 3) DNA sequence: ccggttgaagcggctgagcgaaattatgaacgcgcgcgtgcagagctgaatcaggcaaatgaagatgttgccagaaatca ggagcgacaggctaaagctgttcaggtttataattcgcgtaaaagcgaacttgatgca'gcgaataaaactcttgctgatgcatagct gaaataaaacaatttaatcgatttgcccatgacccaatggctggcggtcacagaatgtggcaaatggccgggcttaaagctcagcg ggcgcagacggatgtaaataataagcaggctgcatttgatgctgctgcaaaagagaagtcagatgctgatgctgcattaagtgccg cgcaggagcgccgcaaacagaaggaaaataaagaaaaggacgctaaggataaatta
(SEQ. ID No 4)
This would require a cysteine residue to be introduced to allow it to be attached to the gold nanoparticles
Other potential proteins would include lysozyme which had been inactivated but still had a high affinity for peptidoglycan.
The use of GNPs bound to a binding element that directly recognises and binds to a cell surface protein of a bacterium incorporated into a fluid flow device of the present invention allows for simple, effective and quick detection of bacteria on a surface. The syringe or lateral flow device can be provided cheaply as single-use disposable systems. A yes/no result is obtained in a relatively short period of time (5-20 mins) without any off site analysis being required. Furthermore, the sampling techniques used with the present invention do not leave any undesirable material on the surface being tested
The present invention detects the presence of live and dead bacteria and therefore it is proposed that a positive test result using the device and method of the present invention be followed up with a subsequent test for live bacteria, such as a procedure to detect sugar consumption in a liquid sample (S. Nath et al Anal Chem 2008, 80, 1033). This takes longer and is more expensive than the test according to the present invention and hence, it is desirable to use this test only upon a positive detection of pathogens in a test area.
Figures 5a to 5d of the accompanying drawings illustrate a further embodiment of a syringe-based device according to the present invention. A plunger 206 for a syringe 200 has a sterile cotton wool ball 201 attached to one end thereof and includes a sharp point 202 The cotton wool ball is wiped over a defined area S to be tested (for example, 10cm x lOcm), as illustrated in Figure 5a. The syringe plunger is then mounted in a syringe body 200 having an inlet 204, a coarse filter 208, a micro filter 212 (around 0.2μm) and an outlet port 214. The coarse filter is in the form of a movable solid disc requiring signfϊcant pressure to move it from position C to D, as shown in the figures. The upper chamber of the syringe body above the coarse filter contains a pouch 217 holding the functionalised gold or other nanoparticles, together with a suitable amount of a buffer solution or water. Movement of the plunger downwardly (as indicated by arrow B in Figures 5b and 5c) pierces the pouch by means of the sharp point 202, thereby releasing GNPs in solution. The GNPs and any bacteria in solution picked up by the cotton wool bud are able to pass through the coarse filter 208 into a lower chamber where they are left to mix for a short period of time (2-3 minutes), thereby enabling the bacteria to bind with the GNPs to form bacteria-GNP aggregate 220. The plunger 206 is depressed further (see Fig. 5d) to expel the solution and any unbound GNPs through the fine filter 212 and out of the outlet 214 where it is collected in a receptacle 230. The bateria-GNP aggregate is retained on the filter, visibly staining the filter.

Claims

1. A pathogen detector assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold nanoparticles or other nanoparticles capable of providing a visible change due to their aggregation, each gold or other nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within a cell envelope of a pathogen for detecting the presence or absence of the pathogen.
2. A pathogen detector assay device as claimed in claim 1 wherein each nanoparticle is <100nm.
3. A pathogen detector assay device as claimed in claim 1 or claim 2 wherein the fluidic medium comprises a flow channel within a syringe, the syringe comprising a vessel and plunger, the vessel having at least one first compartment defining the capture zone for housing the gold or other nanoparticles conjugated with the binding element and a trap defining the detection zone downstream from the capture zone for collection of any bound pathogen.
4. A pathogen detector assay as claimed in claim 3 wherein the syringe is provided with a second compartment upstream to the capture zone for receiving an aqueous test sample.
5. A pathogen detector assay as claimed in claim 4 wherein a coarse filter is provided between the first and second compartments, said coarse filter having a pore size sufficient to allow passage of pathogens but inhibit the passage of larger particles.
6. A pathogen detector assay as claimed in claim 5 wherein the coarse filter has a pore size of greater than 1 μm.
7. A pathogen detector assay as claimed in claim 5 or claim 6 wherein the coarse filter is in the form of a movable solid disc requiring significant pressure to move it downwardly towards the second compartment.
8. A pathogen detector assay as claimed in any one of claims 3 to 7 wherein the trap is a second filter having a pore size sufficient to inhibit the passage of bound pathogen but allow passage of unattached nanoparticles.
9. A pathogen detector assay as claimed in claim 8 wherein the second filter has a pore size of less than 0.1 μm.
10. A pathogen detector as claimed in any one of claims 3 to 9 wherein the gold or other nanoparticles conjugated with a binding element are contained within a piercable pouch provided within the first compartment.
1 1. A pathogen detector as claimed in claim 10 wherein the plunger of the syringe includes a sharp portion for puncturing the pouch.
12. A pathogen detector assay device as claimed in claim 1 or claim 2 wherein the fluidic medium comprises a porous membrane defining a flow channel, the porous membrane having a sample pad, a wicking pad, a capture zone and a detection zone.
13. A pathogen detector assay device as claimed in claim 12 wherein the capture zone contains the gold or other nanoparticles conjugated with a binding element for binding a recognition element provided on or within the cell envelope of a pathogen and the detection zone comprises a binding element for the pathogen, which may be the same or different to that attached to the nanoparticle, attached to the porous membrane.
14. A pathogen detector assay as claimed in any one of the preceding claims further comprising a control zone.
15. A pathogen detector assay as claimed in any one of the preceding claims wherein the binding element is for binding a recognition element of a viral particle.
16. A pathogen detector assay as claimed in any one of claims 1 to 14 wherein the binding element is for binding a recognition element of a species or a broad spectrum of bacteria.
17. A pathogen detector as claimed in any one of the preceding claims wherein nanoparticles conjugated with different binding elements for different pathogens are included in the detector.
18. A pathogen detector assay as claimed in claim 16 wherein the binding element for binding a recognition element of a broad spectrum of bacteria is vancomycin.
19. A pathogen detector assay as claimed in claim 16 wherein the binding element for binding a reognition element of a species of bacteria comprises at least part of lysostaphin.
20. A pathogen detector assay as claimed in claim 19 wherein the binding element is the targeting domain of lysostaphin which recognises a species of S. aureus.
21. A pathogen detector assay as claimed in claim 20 wherein the binding element contains the amino acid sequence of SEQ ID No. 2.
22. A pathogen detector assay as claimed in claim 16 wherein the detector includes nanoparticles conjugated with vancomycin and nanoparticles conjugated with at least part of lysostaphin.
23. A method for detecting the presence or absence of a pathogen comprising obtaining a sample from a surface to be tested, introducing a fluid to the test sample and contacting an assay device as claimed in any one of the preceding claims with the fluid test sample.
24. A method according to claim 23 further comprising collecting the sample on an inert carrier material and adding water or aqueous buffer solution to the collected sample.
25. A method according to claim 23 or 24 further comprising detecting the presence of a pathogen by a colour change from red to blue due to aggregation of the nanoparticles.
26. A method according to claim 25 further comprising detecting the intensity of the colour change to quantify the amount of pathogen detected.
27. A pathogen detector assay kit comprising a swab for obtaining a test sample, a container for mixing the sample with water or an aqueous buffer and an assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture zone being in fluid communication with a detection probe comprising a plurality of gold nanoparticles or other nanoparticles capable of providing a visible change due to their aggregation, each gold or other nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of said pathogen.
28. A functionalised gold nanoparticle comprising a gold nanoparticle having a lysostaphin-targeting domain attached thereto via a sulfur bond.
29. A functionalised gold nanoparticle as claimed in claim 28 wherein the lysostaphin- targeting domain contains the amino acid sequence of SEQ ID No. 2.
30. The use of a functionalised gold or other nanoparticle conjugated with at least one binding element for directly binding a recognition element on or within a cell envelope of a pathogen for detecting the presence or absence of the pathogen in a fluid test sample.
PCT/GB2010/000226 2009-02-12 2010-02-10 Pathogen detector assay, method and kit Ceased WO2010092333A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0902316.9A GB0902316D0 (en) 2009-02-12 2009-02-12 Pathogen detector assay, method and kit
GB0902316.9 2009-02-12

Publications (1)

Publication Number Publication Date
WO2010092333A1 true WO2010092333A1 (en) 2010-08-19

Family

ID=40548071

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2010/000226 Ceased WO2010092333A1 (en) 2009-02-12 2010-02-10 Pathogen detector assay, method and kit

Country Status (2)

Country Link
GB (1) GB0902316D0 (en)
WO (1) WO2010092333A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012144912A1 (en) * 2011-04-19 2012-10-26 Miedzynarodowy Instytut Biologii Molekularnej I A method of peptide hydrolysis, peptidase, the composition for use as a bacteriostatic and bactericidal agent, a kit and the uses of the active form of lytm from s. aureus or derivatives thereof
GB2497317A (en) * 2011-12-06 2013-06-12 Univ Dublin System and method for the detection of analytes using rod-shaped nanoparticles
EP2904394A4 (en) * 2012-10-05 2016-11-16 Verax Biomedical Inc Multi-analyte assay
WO2018009756A1 (en) * 2016-07-07 2018-01-11 Vanderbilt University Fluidic device for the detection, capture, or removal of a disease material
US9987633B2 (en) 2014-06-09 2018-06-05 3M Innovative Properties Company Assay devices and method of detecting a target analyte
FR3110574A1 (en) * 2020-05-20 2021-11-26 Vetophage CAPTURE OF BACTERIA USING BACTERIOPHAGES OR BACTERIOPHAGE PROTEINS
FR3110703A1 (en) * 2020-05-20 2021-11-26 Vetophage DEVICE FOR DETECTION OF BACTERIA OF INTEREST
WO2022109480A1 (en) * 2020-11-23 2022-05-27 Tangen Biosciences, Inc. Method, system and apparatus for respiratory testing
US20220205989A1 (en) * 2016-09-19 2022-06-30 Massachusetts Institute Of Technology Systems including janus droplets
US11883816B2 (en) 2014-11-03 2024-01-30 Tang Biosciences, Inc. Apparatus and method for cell, spore, or virus capture and disruption
US12078630B2 (en) 2018-01-05 2024-09-03 Path Ex, Inc. Device for the capture and removal of disease material from fluids
US12274993B2 (en) 2019-09-18 2025-04-15 Massachusetts Institute Of Technology Systems and methods for affecting interactions of electromagnetic radiation with janus droplets for sensitive detection of species

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4853335A (en) * 1987-09-28 1989-08-01 Olsen Duane A Colloidal gold particle concentration immunoassay
WO2007015105A2 (en) * 2005-08-04 2007-02-08 Thomas William Rademacher Nanoparticles comprising antibacterial ligands
WO2007065116A2 (en) * 2005-11-30 2007-06-07 Nano Science Diagnostics, Inc. Method for detection of antigens

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4853335A (en) * 1987-09-28 1989-08-01 Olsen Duane A Colloidal gold particle concentration immunoassay
WO2007015105A2 (en) * 2005-08-04 2007-02-08 Thomas William Rademacher Nanoparticles comprising antibacterial ligands
WO2007065116A2 (en) * 2005-11-30 2007-06-07 Nano Science Diagnostics, Inc. Method for detection of antigens

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
A. J. KELL ET AL., ACS NANO, vol. 2, 2008, pages 1777
A. J. KELL; B. SIMARD, CHEMCOMM, 2007, pages 1227
BERES,S.B.; SESSO,R.; PINTO,S.W.; HOE,N.P.; PORCELLA,S.F.; DELEO,F.R.; MUSSER,J.M.: "Genome sequence of a lancefield group C Streptococcus zooepidemicus strain causing epidemic nephritis: new information about an old Disease", PLOS ONE, vol. 3, no. 8, 2008, pages E3026
C.N. PENFOLD ET AL., MOL MICROBIOL., vol. 38, 2000, pages 639 - 649
FERRETTI,J.J.; MCSHAN,W.M.; ADJIC,D.; SAVIC,D.; SAVIC,G.; LYON,K.; PRIMEAUX,C.; SEZATE,S.S.; SUROROV,A.N.; KENTON,S.: "Complete genome sequence of an M1 strain of Streptococcus pyogenes", PROC. NATL. ACAD. SCI. U.S.A., vol. 98, no. 8, 2001, pages 4658 - 4663, XP002344854, DOI: doi:10.1073/pnas.071559398
G.H. GU ET AL., NANO LETT., vol. 3, 2003, pages 1261
HOSHIBA,H.; UCHIYAMA,J.; RASHEL,M.; MAEDA,Y.; TAKEMURA,I.; SUGIHARA,Y.; MURAOKA,A.; MATSUZAKI,S., CHARACTERIZATION OF TWO STAPHYLOCOCCAL BACTERIOPHAGE
HOWDEN,B.P.; STINEAR,T.; JOHNSON,P.D.R.; WARD,P.B.; DAVIES,J.K., GENOME SEQUENCING IDENTIFIES A POINT MUTATION IN A SENSOR GENE GRAS THAT LEADS TO VANCOMYCIN-INTERMEDIATE RESISTANCE IN A CLINICAL STAPHYLOCOCCUS AUREUS ISOLATE
IANDOLO,J.J.; WORRELL,V.; GROICHER,K.H.; QIAN,Y.; TIAN,R.; KENTON,S.; DORMAN,A.; JI,H.; LIN,S.; LOH,P.: "Comparative analysis of the genomes of the temperate bacteriophages phi 11, phi 12 and phil3 of Staphylococcus aureus 8325", GENE, vol. 289, no. 1-2, 2002, pages 109 - 118
J FOOD PROTECTION, vol. 56, 1993, pages 759
J. GAO ET AL., ADV MATTER., vol. 18, 2006, pages 3145
KWAN,T.; LIU,J.; DUBOW,M.; GROS,P.; PELLETIER,J.: "The complete genomes and proteomes of 27 Staphylococcus aureus Bacteriophages", PROC. NATL. ACAD. SCI. U.S.A., vol. 102, no. 14, 2005, pages 5174 - 5179, XP009136820, DOI: doi:10.1073/pnas.0501140102
LOESSNER,M.J.; GAENG,S.; WENDLINGER,G.; MAIER,S.K.; SCHERER,S.: "The two-component lysis system of Staphylococcus Aureus bacteriophage Twort: a large TTG-start holin and an associated amidase endolysin", FEMS MICROBIOL. LETT., vol. 162, no. 2, 1998, pages 265 - 274, XP055019222, DOI: doi:10.1111/j.1574-6968.1998.tb13008.x
PAULSEN,!.; BANERJEI,L.; MYERS,G.S.A.; NELSON,K.E.; SESHADRI,R.; READ,T.D.; FOUTS,D.E.; EISEN,J.A.; GILL,S.R.; HEIDELBERG,J.F.: "Role of Mobile DNA in the Evolution of Vancomycin-Resistant. Enterococcus faecalis", SCIENCE, vol. 299, no. 5615, 2003, pages 2071 - 2074, XP002268057, DOI: doi:10.1126/science.1080613
PENFOLD CN; GARINOT-SCHNEIDER C; HEMMINGS AM; MOORE GR; KLEANTHOUS C; JAMES R., MOL MICROBIOL., vol. 38, no. 3, November 2000 (2000-11-01), pages 639 - 49
REINSCHEID,D.J.; STOSSER,C.; EHLERT,K.; JACK,R.W.; MOLLER,K.; EIKMANNS,B.J.; CHHATWAL,G.S.: "Influence of proteins Bsp and FemH on cell shape and peptidoglycan composition in group B streptococcus", MICROBIOLOGY, vol. 148, 2002, pages 3245 - 3254
S. NATH ET AL., ANAL.CHEM., vol. 80, 2008, pages 1033
S.-H. HUANG ET AL., FOOD CONTROL, vol. 18, 2007, pages 893
SENS ACTUATORS B, vol. 127, 2007, pages 335
SUGAI,M.; FUJIWARA,T.; AKIYAMA,T.; OHARA,M.; KOMATSUZAWA,H.; INOUE,S.; SUGINAKA,H.: "Purification and molecular characterization of glycylglycine endopeptidase produced by Staphylococcus capitis EPK1", J. , BACTERIOL., vol. 179, no. 4, 1997, pages 1193 - 1202
SUNDRAM; GRIFFITHS, J. ORG. CHEM., vol. 60, 2005, pages 1102
TAKEUCHI,F.; WATANABE,S.; BABA,T.; YUZAWA,H.; ITO,T.; MORIMOTO,Y.; KURODA,M.; CUI,L.; TAKAHASHI,M.; ANKAI,A.: "Whole-genome sequencing of staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species", J. BACTERIOL., vol. 187, no. 21, 2005, pages 7292 - 7308
TRUDIL, DAVID: "CRITIQUE OF TEST METHODOLOGIES FOR BIOLOGICAL AGENT DETECTIONANDIDENTIFICATION SYSTEMS FOR MILITARY AND FIRST RESPONDERS", 1 January 2002 (2002-01-01), XP002581262, Retrieved from the Internet <URL:http://www.dtic.mil/cgi-bin/GetTRDoc?AD=ADA436075&Location=U2&doc=GetTRDoc.pdf> [retrieved on 20100506] *
U.N. SUNDRAM ET AL., J AM. CHEM. SOC., vol. 118, 1996, pages 13107
W.-C-HUANG ET AL., NANOMED., vol. 2, 2007, pages 777
YOKOI,K.J.; KAWAHIGASHI,N.; UCHIDA,M.; SUGAHARA,K.; SHINOHARA,M.; KAWASAKI,K.; NAKAMURA,S.; TAKETO,A.; KODAIRA,K.: "The two-component cell lysis genes holWMY and lysWMY of the Staphylococcus warneri M phage varphiWMY: cloning, sequencing, expression, and mutational analysis in Escherichia coli", GENE, vol. 351, 2005, pages 97 - 108

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014514319A (en) * 2011-04-19 2014-06-19 ミエドジナロドウィ インスティタット バイオロジーモレキュラーネイ アイ コモルコウェイ Methods for peptide hydrolysis, compositions for use as peptidases, bacteriostatic and fungicides, kits and uses of active forms of LytM from Staphylococcus aureus or derivatives thereof
US9487771B2 (en) 2011-04-19 2016-11-08 Miedzynarodowy Instytut Biologii Molekularnej I Komorkowej Method of peptide hydrolysis, peptidase, the composition for use as a bacteriostatic and bactericidal agent, a kit and the uses of the active form of LytM from S. aureus or derivatives thereof
WO2012144912A1 (en) * 2011-04-19 2012-10-26 Miedzynarodowy Instytut Biologii Molekularnej I A method of peptide hydrolysis, peptidase, the composition for use as a bacteriostatic and bactericidal agent, a kit and the uses of the active form of lytm from s. aureus or derivatives thereof
GB2497317A (en) * 2011-12-06 2013-06-12 Univ Dublin System and method for the detection of analytes using rod-shaped nanoparticles
US10436777B2 (en) 2011-12-06 2019-10-08 University College Dublin, National University Of Ireland, Dublin System and method for the detection of analytes by controlled aggregation nanoparticles
EP2904394A4 (en) * 2012-10-05 2016-11-16 Verax Biomedical Inc Multi-analyte assay
US10610866B2 (en) 2014-06-09 2020-04-07 3M Innovative Properties Company Assay devices and method of detecting a target analyte
US9987633B2 (en) 2014-06-09 2018-06-05 3M Innovative Properties Company Assay devices and method of detecting a target analyte
US11883816B2 (en) 2014-11-03 2024-01-30 Tang Biosciences, Inc. Apparatus and method for cell, spore, or virus capture and disruption
US11154861B2 (en) 2016-07-07 2021-10-26 Vanderbilt University Fluidic device for the detection, capture, or removal of a disease material
EP3482203A4 (en) * 2016-07-07 2020-01-01 Vanderbilt University FLUIDIC DEVICE FOR THE DETECTION, CAPTURE AND / OR ELIMINATION OF A PATHOLOGICAL MATERIAL
US11883821B2 (en) 2016-07-07 2024-01-30 Vanderbilt University Fluidic device for the detection, capture, or removal of a disease material
WO2018009756A1 (en) * 2016-07-07 2018-01-11 Vanderbilt University Fluidic device for the detection, capture, or removal of a disease material
US20220205989A1 (en) * 2016-09-19 2022-06-30 Massachusetts Institute Of Technology Systems including janus droplets
US12061194B2 (en) * 2016-09-19 2024-08-13 Massachusetts Institute Of Technology Systems including Janus droplets with binding moieties for a virus, a pathogen or a bacterium
US12078630B2 (en) 2018-01-05 2024-09-03 Path Ex, Inc. Device for the capture and removal of disease material from fluids
US12274993B2 (en) 2019-09-18 2025-04-15 Massachusetts Institute Of Technology Systems and methods for affecting interactions of electromagnetic radiation with janus droplets for sensitive detection of species
FR3110574A1 (en) * 2020-05-20 2021-11-26 Vetophage CAPTURE OF BACTERIA USING BACTERIOPHAGES OR BACTERIOPHAGE PROTEINS
FR3110703A1 (en) * 2020-05-20 2021-11-26 Vetophage DEVICE FOR DETECTION OF BACTERIA OF INTEREST
WO2021234321A3 (en) * 2020-05-20 2022-02-10 Vetophage Device for detecting a bacterium of interest
WO2022109480A1 (en) * 2020-11-23 2022-05-27 Tangen Biosciences, Inc. Method, system and apparatus for respiratory testing

Also Published As

Publication number Publication date
GB0902316D0 (en) 2009-04-01

Similar Documents

Publication Publication Date Title
WO2010092333A1 (en) Pathogen detector assay, method and kit
Liu et al. Colorimetric assay of bacterial pathogens based on Co3O4 magnetic nanozymes conjugated with specific fusion phage proteins and magnetophoretic chromatography
AU733215B2 (en) Method based on the use of bacteriophages for the detection biological molecules in biological samples
CN104198703B (en) People&#39;s mycoplasma pneumoniae gold label silver stain immunochromatographytest test kit and its preparation method and application
US20070128589A1 (en) Substrates, sensors, and methods for assessing conditions in females
JP4767863B2 (en) Colorimetric substrate, colorimetric sensor, and method of use
EP2771456A1 (en) Device and method for bacterial culture and assay
CN111378018A (en) Test strip for detecting novel coronavirus antibody and preparation method and application thereof
WO2017128888A1 (en) 3d probe-magnetic bead complex based on protein nanowires and use thereof
CN105319359B (en) Streptococcus pneumoniae quantum dot immunochromatographic assay detection card and preparing method and application thereof
US10859575B2 (en) Mycobacterium tuberculosis specific peptides for detection of infection or immunization in non-human primates
JP6770805B2 (en) How to detect specific bacteria in a sample
US9212386B2 (en) Enzymatic cleavage based lateral flow assays
Braz et al. A novel electrochemical immunosensor for the determination of tuberculosis diagnosis exploiting graphene-affinity peptide
Huang et al. Lysozyme for capture of microorganisms on protein biochips
CN104297494A (en) Enzyme-linked immunoassay kit for anti-hepatitis B virus X protein antibody and preparation method for kit
KR20080075285A (en) Immunochromatography Diagnostic Kit for Detection of Japanese Encephalitis Virus Antibody from Porcine Serum
CN204028084U (en) People&#39;s Chlamydia pneumoniae quantum dot immune chromatography test card
CN113388039A (en) Antigen mimic epitope of SARS-COV-2 coronavirus and immunochromatography test strip
CN101561438A (en) Colloidal gold detection test paper for abrin, preparation method thereof and application thereof
CN109337894A (en) A preparation method of yeast functional microspheres and its application in immunoassay
KR102253761B1 (en) Multiple detection kit
CN105242040B (en) Human Haemophilus influenza quantum dot immunochromatography detection card, preparation method and application thereof
CN105277694B (en) Human group A streptococci quantum dot immunochromatography detection card, preparation method and applications
KR101774749B1 (en) Recombinant antigenic protein for diagnosis of canine leptospira IgG,IgM antibody and diagnostic kit by using the same simultaneously

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10704843

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10704843

Country of ref document: EP

Kind code of ref document: A1