WO2010090513A2 - Culture medium for epithelial stem cells and organoids comprising said stem cells. - Google Patents

Culture medium for epithelial stem cells and organoids comprising said stem cells. Download PDF

Info

Publication number
WO2010090513A2
WO2010090513A2 PCT/NL2010/000017 NL2010000017W WO2010090513A2 WO 2010090513 A2 WO2010090513 A2 WO 2010090513A2 NL 2010000017 W NL2010000017 W NL 2010000017W WO 2010090513 A2 WO2010090513 A2 WO 2010090513A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
wnt
organoids
cell
stem cells
Prior art date
Application number
PCT/NL2010/000017
Other languages
French (fr)
Other versions
WO2010090513A3 (en
Inventor
Toshiro Sato
Johannes Carolus Clevens
Meritxell Huch Ortega
Original Assignee
Koninklijke Nederlandse Akademie Van Wetenschappen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=42144924&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2010090513(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to RU2011136704/10A priority Critical patent/RU2555545C2/en
Priority to EP18182285.9A priority patent/EP3441458B9/en
Priority to DK10703131.2T priority patent/DK2393917T3/en
Priority to PL16151949T priority patent/PL3061808T3/en
Priority to CA2751332A priority patent/CA2751332C/en
Priority to EP10703131.2A priority patent/EP2393917B1/en
Priority to NZ594271A priority patent/NZ594271A/en
Priority to EP16151949.1A priority patent/EP3061808B1/en
Priority to KR1020117020340A priority patent/KR101904224B1/en
Application filed by Koninklijke Nederlandse Akademie Van Wetenschappen filed Critical Koninklijke Nederlandse Akademie Van Wetenschappen
Priority to MX2011008044A priority patent/MX2011008044A/en
Priority to US13/147,163 priority patent/US8642339B2/en
Priority to SG2011055399A priority patent/SG173492A1/en
Priority to AU2010211428A priority patent/AU2010211428B2/en
Priority to CN201080013109.9A priority patent/CN102439135B/en
Priority to EP23176802.9A priority patent/EP4253529A3/en
Priority to JP2011547839A priority patent/JP5458112B2/en
Priority to ES10703131.2T priority patent/ES2579909T3/en
Priority to BRPI1008086-4A priority patent/BRPI1008086A2/en
Publication of WO2010090513A2 publication Critical patent/WO2010090513A2/en
Publication of WO2010090513A3 publication Critical patent/WO2010090513A3/en
Priority to US13/194,866 priority patent/US9752124B2/en
Priority to IL214381A priority patent/IL214381A/en
Priority to HK12104502.9A priority patent/HK1163746A1/en
Priority to US14/079,545 priority patent/US10947510B2/en
Priority to HRP20160791TT priority patent/HRP20160791T1/en
Priority to US15/654,243 priority patent/US20180072995A1/en
Priority to US16/113,445 priority patent/US20190100728A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/38—Chemical stimulation of growth or activity by addition of chemical compounds which are not essential growth factors; Stimulation of growth by removal of a chemical compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0607—Non-embryonic pluripotent stem cells, e.g. MASC
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • C12N5/0677—Three-dimensional culture, tissue culture or organ culture; Encapsulated cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0679—Cells of the gastro-intestinal tract
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/117—Keratinocyte growth factors (KGF-1, i.e. FGF-7; KGF-2, i.e. FGF-12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40—Regulators of development
    • C12N2501/415—Wnt; Frizzeled
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70—Enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/90—Substrates of biological origin, e.g. extracellular matrix, decellularised tissue

Definitions

  • the invention relates to a novel culture medium for cultu ⁇ ng epithelial stem cells, especially intestinal and colonic epithelial stem cells, and for cultu ⁇ ng organoids comprising said stem cells
  • the invention further relates to the progeny of cells and organoids that were cultured using a culture medium of the invention, and to the use of said progeny in toxicity assays or in regenerative medicine
  • the self-renewing epithelium of the small intestine is ordered into crypts and villi
  • Lgr5 A gene, Lgr5, was recently identified which is specifically expressed in a fifth cell type, cycling Crypt Base Columnar (CBC) cells, which are small cells that are interspersed between the Paneth cells (indicated by black arrows in Fig 8b) (Barker et al , 2007 Nature 449 1003- 1007)
  • CBC cycling Crypt Base Columnar
  • Lgr6 is a unique marker for adult stem cells While Lgr 5 is expressed in stem cells of brain, kidney, liver, retina, stomach, intestine, pancreas, breast, hair follicle, ovary, adrenal medulla, and skin, Lgr6 is expressed in stem cells of brain, lung, breast, hair follicle, and skin It is generally believed that an intimate contact between epithelial stem cells and subepithelial fibroblasts is required to anchor and support epithelial stem cells and to provide the correct orientation necessary to generate a properly polarized, three dimensional structure
  • the invention therefore provides a method for culturing epithelial stem cells, isolated epithelial tissue fragments comprising said epithelial stem cells, or adenoma cells, the method comprising providing an extracellular matrix, incubating an epithelial stem cell, an isolated tissue fragment comprising said epithelial stem cells, or an adenoma cell with the extracellular matrix, culturing the stem cell, isolated tissue fragment, or adenoma cell in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, between 5 and 500 ngram/ml or at least 5 and not higher than 500 ngram/ml of a mitogenic growth factor, whereby a Wnt agonist is added if epithelial stem cells and isolated tissue fragments are cultured
  • BMP Bone Morphogenetic Protein
  • a method of the invention allows culturing of epithelial stem cells, isolated fragments from the small intestine, colon, stomach and pancreas comprising said stem cells and adenoma cells, while preserving the presence of stem cells that retain an undifferentiated phenotype and self- maintenance capabilities
  • isolated crypts that are cultured according to a method of the invention develop into crypt-villus organoids, comprising a central lumen lined by a villus-like epithelium
  • the growth of isolated crypts was fuelled by stem cells that are present in the crypts
  • the resulting organoids undergo multiple crypt fission events
  • a method of the invention allows the outgrowth of single, isolated epithelial stem cells into crypt-villus organoids in the absence of a stem cell niche Isolated gastric fragments from the pyloric region of the stomach behaved as intestinal crypt organoids
  • the opened upper part of the unit was sealed and the lumen was filled with
  • the epithelium lining the pyloric region of the small and large bowel encompasses luminal protrusions, villi, and invaginations, crypts
  • Each cell along the crypt-villus axis is polarized, whereby cells on the top of the intestinal villi, or in the upper positions of colonic crypts, are the most differentiated and are continuously lost into the lumen
  • Continuous proliferation of stem cells residing in the basis of the crypts, and massive proliferation of progenitor cells residing in the middle of the crypts ensures proper replacement of the shed cells
  • Stem cells are found in many organs of adult humans and mice Although there may be great variation in the exact characteristics of adult stem cells in individual tissues, adult stem cells share the following characteristics They retain an undifferentiated phenotype, their offspring can differentiate towards all lineages present in the pertinent tissue, they retain self-maintenance capabilities throughout life, and they are able to regenerate the pertinent tissue after injury Stem cells reside in a specialized location, the stem cell niche, which supplies the appropriate cell-cell contacts and signals for maintenance of said stem cell population
  • Epithelial stem cells are able to form the distinct cell types of which the epithelium is composed Some epithelia, such as skin or intestine, show rapid cell turnover, indicating that the residing stem cells must be continuously proliferating Other epithelia, such as the liver or pancreas, show a very slow turnover under normal conditions Crypts can be isolated from the duodenum, small and large intestine, including jejunum, ileum, and colon, and the pyloric region of the stomach by protocols that are known to the skilled person For example, crypts can be isolated by incubation of isolated tissue with chelating agents that release cells from their calcium- and magnesium-dependent interactions with the basement membrane and stromal cell types After washing the tissue, the epithelial cell layer is scraped from the submucosa with a glass slide and minced This is followed by incubation in trypsin or, more preferred, EDTA and/or EGTA and separation of undigested tissue fragments and single cells from crypts using,
  • a preferred method is based on the fact that stem cells express Lgr 5 and/or Lgr 6 on their surface, which belong to the large G protein-coupled receptor (GPCR) superfamily
  • GPCR G protein-coupled receptor
  • the Lgr subfamily is unique in carrying a large leucine-rich ectodomain important for ligand binding Ligands for Lgr 5 and Lgr 6 are not yet described in the literature
  • a preferred method therefore comprises preparing a cell suspension from said epithelial tissue, contacting said cell suspension with an Lgr5 and/or 6 binding compound, isolating said Lgr5 and/or 6 binding compound, and isolating the stem cells from said binding compound It is preferred that a single cell suspension comprising the epithelial stem cells is mechanically generated from the isolated crypts as it was found that at this stage epithelial stem cells treated with trypsin yielded rather low survival rates
  • Lgr5 and/or 6 binding compounds comprises antibodies, such as monoclonal antibodies that specifically recognize and bind to the extracellular domain of either Lgr5 or Lgr6, such as monoclonal antibodies including mouse and rat monoclonal antibodies Using such an antibody, Lgr5 and/or Lgr6-expressing stem cells can be isolated, for example with the aid of magnetic beads or through fluorescence-activated cell sorting, as is clear to a skilled person
  • said epithelial stem cells are isolated from the crypts, gastric fragments or pancreatic fragments
  • said epithelial stem cells are isolated from crypts that are isolated from the bowel
  • Preferred epithelial stem cells are isolated from the small intestine, including duodenum, jejunum and ileum, pancreas or stomach
  • Isolated stem cells are preferably cultured in a microenvironment that mimics at least in part a cellular niche in which said stem cells naturally reside Said cellular niche is mimicked by cultu ⁇ ng said stem cells in the presence of biomate ⁇ als, such as matrices, scaffolds, and culture substrates that represent key regulatory signals controlling stem cell fate Said biomate ⁇ als comprise natural, semi-synthetic and synthetic biomate ⁇ als, and/or mixtures thereof
  • a scaffold provides a two-dimensional or three dimensional network Suitable synthetic materials for said scaffold comprise polymers selected from porous solids, nanofibers, and hydrogels such as, for example, peptides including self-assembling peptides, hydrogels composed of polyethylene glycol phosphate, polyethylene glycol fumarate, polyacrylamide, polyhydroxyethyl methacrylate, polycellulose acetate, and/or co-polymers thereof (see, for example, Saha et al , 2007 Curr Opin Chem Biol 1 1(4) 381-387, Sa
  • a cellular niche is in part determined by the stem cells and surrounding cells, and the extracellular matrix (ECM) that is produced by the cells in said niche
  • ECM extracellular matrix
  • isolated crypts or epithelial stem cells are attached to an ECM
  • ECM is composed of a variety of polysaccharides, water, elastin, and glycoproteins, wherein the glycoproteins comprise collagen, entactin (nidogen), fibronectin, and laminin ECM is secreted by connective tissue cells
  • Different types of ECM are known, comprising different compositions including different types of glycoproteins and/or different combination of glycoproteins
  • Said ECM can be provided by culturing ECM-producing cells, such as for example fibroblast cells, in a receptacle, prior to the removal of these cells and the addition of isolated crypts or epithelial stem cells
  • extracellular matrix-producing cells are chondrocytes, producing mainly collagen and proteoglycans, fibroblast cells, producing
  • a preferred ECM for use in a method of the invention comprises at least two distinct glycoproteins, such as two different types of collagen or a collagen and laminin Said ECM can be a synthetic hydrogel extracellular matrix or a naturally occurring ECM A most preferred ECM is provided by Mat ⁇ gelTM (BD Biosciences), which comprises laminin, entactin, and collagen IV
  • a cell culture medium that is used in a method of the invention comprises any cell culture medium
  • a preferred cell culture medium is a defined synthetic medium that is buffered at a pH of 7 4 (preferably between 7 2 and 7 6 or at least 7 2 and not higher than 7 6) with a carbonate-based buffer, while the cells are cultured in an atmosphere comprising between 5 % and 10% CO2, or at least 5% and not more than 10% CO2, preferably 5 % CO2
  • a preferred cell culture medium is selected from DMEM/F12 and RPMI 1640 supplemented with glutamine, insulin, Penicillin/streptomycin and transferrin
  • Advanced DMEM/F12 or Advanced RPMI is used, which is optimized for serum free culture and already includes insulin
  • said Advanced DMEM/F12 or Advanced RPMI medium is preferably supplemented with glutamine and Penicillin/streptomycin It is furthermore preferred that said cell culture medium is supplemented with a purified, natural, semi-synthetic and/or synthetic growth factor and does
  • a component that is added to the basal culture medium is a BMP inhibitor BMPs bind as a dime ⁇ c ligand to a receptor complex consisting of two different receptor serine/threonine kinases, type I and type II receptors
  • the type II receptor phosphorylates the type I receptor, resulting in the activation of this receptor kinase
  • the type I receptor subsequently phosphorylates specific receptor substrates (SMAD), resulting in a signal transduction pathway leading to transcriptional activity
  • Said BMP inhibitor is defined as an agent that binds to a BMP molecule to form a complex wherein the BMP activity is neutralized, for example by preventing or inhibiting the binding of the BMP molecule to a BMP receptor
  • said inhibitor is an agent that acts as an antagonist or reverse agonist
  • This type of inhibitor binds with a BMP receptor and prevents binding of a BMP to said receptor
  • An example of a latter agent is an antibody that binds a BMP receptor and prevents binding of BMP to the antibody-bound receptor
  • Said BMP inhibitor inhibits a BMP-dependent activity in a cell to at most 90%, more preferred at most 80%, more preferred at most 70%, more preferred at most 50%, more preferred at most 30%, more preferred at most 10%, more preferred 0%, relative to a level of a BMP activity in the absence of said inhibitor
  • a BMP activity can be determined by measuring the transcriptional activity of BMP, for example as exemplified in Zilberberg et al , 2007 BMC Cell Biol 8 41
  • BMP-binding proteins including Noggin (Peprotech), Chordin and chordin-like proteins (R&D sytems) comprising chordin domains, Follistatin and follistatin-related proteins (R&D sytems) comprising a follistatin domain, DAN and DAN-like proteins (R&D sytems) comprising a DAN cysteine-knot domain, sclerostin /SOST (R&D sytems), deco ⁇ n (R&D sytems), and alpha-2 macroglobulin (R&D systems)
  • a preferred BMP inhibitor for use in a method of the invention is selected from Noggin, DAN, and DAN-like proteins including Cerberus and Gremlin (R&D sytems) These diffusible proteins are able to bind a BMP ligand with varying degrees of affinity and inhibit their access to signalling receptors.
  • Noggin, DAN, and DAN-like proteins including Cerberus and Gremlin (R&D sytems)
  • a most preferred BMP inhibitor is Noggin Noggin is preferably added to the basal culture medium at a concentration of at least 10 ng/ml, more preferred at least 20 ng/ml, more preferred at least 50 ng/ml, more preferred at least 100 ng/ml A most preferred concentration is approximately 100 ng/ml or 100 ng/ml During cultu ⁇ ng of stem cells, said BMP inhibitor is preferably added to the culture medium every second day, while the culture medium is refreshed preferably every fourth day
  • a further component that is added to the basal culture medium is a Wnt agonist
  • the Wnt signalling pathway is defined by a series of events that occur when a Wnt protein binds to a cell-surface receptor of a Frizzled receptor family member This results in the activation of Dishevelled family proteins which inhibit a complex of proteins that includes axin, GSK-3, and the protein APC to degrade intracellular ⁇ - catenin
  • the resulting enriched nuclear ⁇ -catenin enhances transcription by TCF/LEF family transcription factors
  • a Wnt agonist is defined as an agent that activates TCF/LEF-mediated transcription in a cell Wnt agonists are therefore selected from true Wnt agonists that bind and activate a Frizzled receptor family member including any and all of the Wnt family proteins, an inhibitor of intracellular ⁇ -catenin degradation, and activators of TCF/LEF Said Wnt agonist stimulates a Wnt activity in a cell by at least 10%, more preferred at least 20%, more preferred at least 30%, more preferred at least 50%, more preferred at least 70%
  • a Wnt agonist comprises a secreted glycoprotein including Wnt- l/Int- 1 , Wnt- 2/Irp (InM -related Protein). Wnt-2b/13, Wnt-3/Int-4, Wnt-3a (R&D sytems), Wnt- 4,Wnt-5a, Wnt-5b, Wnt-6 (Ki ⁇ koshi H et al 2001 Biochem Biophys Res Com 283 798-805),, Wnt-7a (R&D sytems).
  • R-spondin 1 NU206, Nuvelo, San Carlos, CA
  • R-spond ⁇ n 2 ((R&D sytems), R-spondin 3, and R-spondin-4)
  • Norrin also called Nome Disease Protein or NDP
  • R&D sytems which is a secreted regulatory protein that functions like a Wnt protein in that it binds with high affinity to the
  • RNAs small-interfering RNAs (siRNA, Cell
  • said Wnt agonist is selected from one or more of a Wnt family member, R-spondin 1-4, Norrin, and a GSK-inhibitor It was found by the inventors that the addition of at least one Wnt agonists to the basal culture medium is essential for proliferation of the epithelial stem cells or isolated crypts
  • said Wnt agonist comprises or consists of R- spondin 1
  • R-spondin 1 is preferably added to the basal culture medium at a concentration of at least 50 ng/ml, more preferred at least 100 ng/ml, more preferred at least 200 ng/ml, more preferred at least 300 ng/ml, more preferred at least 500 ng/ml
  • a most preferred concentration of R-spondin 1 is approximately 500 ng/ml or 500 ng/ml
  • said Wnt family member is preferably added to the culture medium every second day, while the culture medium is refreshed preferably every fourth day
  • a Wnt agonist is selected from the group consisting of R-spondin, Wnt-3a and Wnt-6 More preferably, R-spondin and Wnt-3a are both used as Wnt agonist This combination is particularly preferred since this combination surprisingly has a synergetic effect on organoid formation Preferred concentrations are approximately 500 ng/ml or 500 ng/ml for R-spondin and approximately 100 ng/ml or 100 ng/ml for Wnt3a
  • a further component that is added to the basal culture medium is a mitogenic growth factor selected from a family of growth factors comprising epidermal growth factor (EGF, (Peprotech), Transforming Growth Factor-alpha (TGF-alpha, Peprotech), basic Fibroblast Growth Factor (bFGF, Peprotech), brain-derived neurotrophic factor (BDNF, R&D Systems), and Keratinocyte Growth Factor (KGF, Peprotech)
  • EGF is a potent mitogenic factor for a variety of cultured ectodermal and mesodermal cells and has a profound effect on the differentiation of specific cells in vivo and in vitro and of some fibroblasts in cell culture
  • the EGF precursor exists as a membrane-bound molecule which is proteolytically cleaved to generate the 53-amino acid peptide hormone that stimulates cells
  • a preferred mitogenic growth factor is EGF EGF is preferably added to the basal culture medium at a concentration of between 5 and 500 ng/ml or
  • a further embodiment of a method according to the invention comprises a culture medium comprising a Rock (Rho-kinase) inhibitor
  • a Rock inhibitor was found to prevent anoikis, especially when cultering single stem cells
  • Said Rock inhibitor is preferably selected from R)-(+)-trans-4-( l-aminoethyl)-N-(4- Py ⁇ dyl)cyclohexanecarboxamide dihydrochloride monohydrate (Y-27632, Sigma- Ald ⁇ ch), 5-( l ,4-diazepan- l-ylsulfonyl)isoquinoline (fasudil or HA1077, Cayman Chemical), and (S)-(+)-2-methyl- l-[(4-methyl-5-isoquinolinyl)sulfonyl] -hexahydro- l H- l ,4-diazepine dihydrochloride (H- 1 152, Tocris Bio
  • Notch receptor proteins can interact with a number of surface-bound or secreted ligands, including but not limited to Delta 1 , Jagged 1 and 2, and Delta-like 1, Delta-like 3, Delta-like 4.
  • Notch receptors Upon ligand binding, Notch receptors are activated by serial cleavage events involving members of the ADAM protease family, as well as an intramembranous cleavage regulated by the gamma secretase presinilin The resultant is a translocation of the intracellular domain of Notch to the nucleus where it transcriptionally activates downstream genes.
  • a preferred Notch agonist is selected from Jagged 1 and Delta 1 , or an active fragment or derivative thereof.
  • a most preferred Notch agonist is DSL peptide (Dontu et al., 2004. Breast Cancer Res 6. R605-R615). with the sequence CDDYYYGFGCNKFCRPR Said DSL peptide (ANA spec) is preferably used at a concentration between 10 ⁇ M and 100 nM or at least 10 ⁇ M and not higher than 100 nM.
  • ANA spec is preferably used at a concentration between 10 ⁇ M and 100 nM or at least 10 ⁇ M and not higher than 100 nM
  • Said Notch agonist is preferably added to the culture medium every second day during the first seven days of culturing said stem cells
  • a Notch agonist is defined as a molecule that stimulates a Notch activity in a cell by at least 10%, more preferred at least 20%, more preferred at least 30%, more preferred at least 50%, more preferred at least 70%, more preferred at least 90%, more preferred at least 100%, relative to a level of a Notch activity in the absence of said molecule.
  • a Notch activity can be determined by measuring the transcriptional activity of Notch, for example by a 4xwtCBFl-luciferase reporter construct as described (Hsieh et al , 1996 MoI Cell. Biol. 16, 952-959)
  • the invention further provides a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, a Wnt agonist; and between 5 and 500 nanogram/ml or at least 5 and not more than 500 nanogram/ml of a mitogenic growth factor selected from the group consisting of EGF, TGFD , KGF, FGFlO and a FGF.
  • BMP Bone Morphogenetic Protein
  • a mitogenic factor is selected from the groups consisting of EGF, TGF-D and KGF or from EGF, TGF-D and FGF7 or from EGF, TGF-D and FGF or from EGF and KGF or from EGF and FGF7 or from EGF and a FGF or from TGFD and KGF or from TGFD and FGF7 or from TGFD and a FGF EGF may be replaced by TGFD
  • EGF EGF, TGF-D and KGF or from EGF, TGF-D and FGF or from EGF and KGF or from EGF and FGF7 or from EGF and a FGF or from TGFD and KGF or from TGFD and FGF7 or from TGFD and a FGF EGF may be replaced by TGFD
  • Several preferred culture media are later on identified depending on the organoid to be obtained
  • a cell culture medium according to the invention allows the survival and/or proliferation and/or differentiation of epithelial stem cells or isolated crypts on an extracellular matrix
  • a first culture medium comprises Noggin as BMP inhibitor, both Epidermal Growth Factor and Keratinocyte Growth Factor as mitogenic growth factors, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein KGF could be replaced by a FGF, or by FGFlO [Leul5]-Gast ⁇ n I, Exendin and/or Nicotinamide may also be added to this first medium
  • said culture medium called a second culture medium is identical as said first medium except that there is no Noggin and preferably no [Leul5]-Gast ⁇ n I, Exendin and/or Nicotinamide Said second culture medium therefore comprises both Epidermal Growth Factor and Keratinocyte Growth Factor as mitogenic growth factors, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein KGF could also be replaced by a FGF, or by FGFlO
  • These two cell culture media support pancreatic fragments comprising pancreatic stem cells that are grown in these media in a Mat ⁇ gel extracellular matrix to form pancreatic organoids comprising pancreatic islet-like structures on an extracellular matrix
  • the second medium without Noggin is a minimum medium whereas the first one with Noggin leads to an improved medium for expanding pancreatic fragments
  • An expanding medium is a medium which preferably promote survival and/or proliferation of cells during at least two days of culture
  • a third medium has been designed which is able to promote, induce the differentiation of cells towards a pancreatic organoids within at least 5 days
  • One preferred differentiation marker towards the formation of a pancreatic organoid is Neurogenin-3 whose expression could be detected by RT-PCR or by immunohistochemistry
  • a differentiation medium as for example a third or fourth medium is said to be functional when Neurogenin-3 could be detected by RT-PCR or by immunohistochemistry after at least five days of culture in said medium
  • This differentiation step is preferably carried out after a first expanding step in a medium as the first or second medium as defined above
  • This third medium is identical with the second medium identified above except that there is no FGF or KGF or FGFlO
  • This third medium comprises Epidermal Growth Factor and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N- Acetylcystein
  • a fourth medium has been designed that is identical with said first medium wherein said fourth medium is also supplemented with [Leul5]-
  • pancreatic organoid that is functional and alive after at least ten month of culture (see experimental part)
  • Functionality is preferably characterized by the secretion of insulin Since the final amount of pancreas organoids obtained correlates with the duration of culture, the skilled person understands that the invention is a pioneer invention and potentially opens new possibilities in for example regenerative medicine
  • epithelial stem cells in a preferred method for obtaining and/or cultu ⁇ ng a pancreatic organoid, epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellularmat ⁇ x in a first step in a medium comprising EGF, KGF or FGF, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein , subsequently in a second step in a medium comprising EGF and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein
  • a culture medium comprises Noggin as BMP inhibitor.
  • Epidermal Growth Factor as mitogenic growth factor, R-spondin 1 and/or Wnt3a as Wnt agonist
  • This cell culture medium supports cultu ⁇ ng of isolated small intestinal crypts in 3 dimensional cultures comprising Mat ⁇ gel as extracellular matrix
  • a culture medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor as mitogenic growth factor, R-spondin 1 as Wnt agonist, Jagged-DSL peptide as Notch agonist and the Rho kinase inhibitor Y-27632
  • This cell culture medium supports cultu ⁇ ng of isolated single epithelial stem cells in 3 dimensional cultures comprising Mat ⁇ gel as extracellular matrix
  • a culture medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor and/or BDNF as mitogenic growth factors, R-spondin 1 and/or Wnt-3a as Wnt agonists, supplemented with at least one of B27, N2 and N-Acetylcystein Wnt-3a is a preferred Wnt agonist in this preferred method
  • This cell culture medium supports cultu ⁇ ng of isolated colon crypts Ui 3 dimensional cultures comprising Mat ⁇ gel as extracellular matrix
  • This medium is able to promote survival and/or proliferation and/or differentiation of cells during at least two days of culture
  • a preferred differentiation marker towards the formation of a colon crypt may be selected from the following group alkaline phosphatise indicating the presence of enterocyte, Muc2 indicating the presente of goblet cells and Neurogenic 3 or Chromogranin indicating the presence of endocrine cells The expression of each of these markers could be detected by RTPCR or by immunohistochemistry
  • a colon crypt obtainable by a method of the invention is a further aspect of the invention. To the best of our knowledge, this is the first time that a colon crypt had been obtained that is functional and alive after at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12 month of culture (see experimental part) Functionality is preferably characterized by the presence of at least one of the markers as identified above.
  • the invention is a pioneer invention and potentially opens new possibilities in for example regenerative medicine
  • epithelial stem cells in a preferred method for obtaining and/or cultu ⁇ ng a colon crypt, epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellular matrix in a medium comprising Noggin, EGF, and R-spondin 1 and/or Wnt-3 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein
  • a culture medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor as mitogenic growth factor, R-spondin las Wnt agonist, supplemented with either Wnt-3a or KGF, and further comprising B27, N2, N-Acetylcystein
  • KGF may be replaced by a FGF or by FGFlO
  • This medium preferably comprises Noggin as BMP inhibitor, Epidermal Growth Factor and FGFlO as mitogenic growth factor, R-spondin 1 and Wnt-3a as Wnt agonist, and further comprising B27, N2, N-Acetylcystein FGFlO is preferred as a FGF since it gives better results than for example FGF7 (figure 32)
  • This cell culture medium supports culturing of isolated gastric fragments or gastric organoid in 3 dimensional cultures comprising Mat ⁇ gel as extracellular matrix
  • This sixth medium is a medium for expanding
  • Said seventh medium is a differentiation medium
  • a differentiation medium is a medium which preferably induces or promotes a specific differentiation of cells during at least two, 3, 4, 5, 6, 7, 8, 9, 10 days of culture or longer
  • differentiation may be measured by detecting the presence of a specific marker associated with the gastric lineage
  • markers associated with the gastric lineage include MUC5AC (a pit cell marker), GASTRIN and/or SOMATOSTATIN (both, endocrine cell markers)
  • the presence of at least one of said markers is preferably carried out using RT-PCR and/or immunohistochemistry or immunofluorescence
  • the presence of at least one of these markers is preferably detectable after at least 6 days in the differentiation conditions, more preferably at least 10 days
  • a differentiation medium as for example a seventh medium is said to be functional when at least one of the above-identified markers could be detected by RT- PCR or by immunohistochemistry after at least six days of culture in said medium
  • This differentiation step is preferably carried out after a first expanding step
  • epithelial stem cells in a preferred method for obtaining and/or cultu ⁇ ng a gastric fragment , epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellularmatrix in a first step in a medium comprising Noggin as BMP inhibitor, Epidermal Growth Factor and FGFlO as mitogenic growth factor, R-spondin 1 and Wnt-3a as Wnt agonist, and further comprising B27, N2, N-Acetylcystein, subsequently in a second step in a medium comprising Epidermal Growth Factor and R-spondin 1 and Wnt-3a as Wnt agonist, Noggin and FGFlO supplemented with B27, N2, and N-Acetylcystein, wherein the concentration of Wnt-3 is reduced in the second step by comparison to the Wnt-3a concentration as present in the first step
  • a culture medium comprises
  • a ligand such as for example Wnt3a
  • Wnt3a can be freshly added to a culture medium
  • a ligand is expressed in a cell line by transfecting or infected a cell line with a suitable expression construct expressing said ligand Said cell line is cultured and the culture medium comprising the secreted ligand is harvested at suitable time intervals
  • cells will produce Wnt3a as soon as they reach confluency and stop growing Culture medium from cells that were not transfected or infected with said expression construct is used as a control
  • the conditioned medium is harvested and tested, for example in an assay wherein luciferase expression in controlled by TCF responsive elements to test for the presence of a Wnt agonist such as Wnt3a (Ko ⁇ nek et al , 1997 Science 275 1784-1787)
  • the medium is diluted when used in the cultures to regenerate tissue
  • the addition of an excess of ligand sometimes is as detrimental for the culture as is the addition of too
  • the invention further provides the use of a culture medium according to the invention for cultu ⁇ ng epithelial stem cells or isolated organoid structures that comprise these stem cells on an extracellular matrix, whereby said stem cells preferably do not comprise human embryonic stem cells Preferred are human adult stem cells.
  • single sorted epithelial stem cells from the small intestine, colon, and stomach are also able to initiate these 3 dimensional organoids in a culture medium according to the invention
  • the invention further provides the use of a culture medium according to the invention for cultu ⁇ ng pancreatic fragments comprising stem cells that form pancreatic organoids comprising pancreatic island-like structures
  • stem cells are pancreas, stomach, intestinal or colonic epithelial stem cells, whereby most preferred stem cells are small intestinal stem cells.
  • a culture medium according to the invention allowed the establishment of long-term culture conditions under which single crypts undergo multiple crypt fission events, while simultanously generating villus-like epithelial domains in which all differentiated cell types are present Using a culture method according to the invention allowed culture periods of at least seven months, at least eight months, at least nine months, at least ten months
  • the crypt-like extensions comprise all differentiated epithelial cell types, including proliferative cells, Paneth cells, enterocytes and goblet cells No myofibroblasts or other non-epithelial cells were identified in the organoids at any stage
  • Expansion of the budding crypt structures created organoids comprising >40 crypt-like structures surrounding a central lumen lined by a villus-like epithelium and filled with apoptotic cell bodies
  • the crypt-villus organoids comprise a central lumen lined by a villus-like epithelium The lumen is opened at consecutive time intervals to release the content into the medium
  • the organoids can be passaged and maintained in culture for at least 6 months without losing the essential characteristics Passaging preferably involves manual fragmentation of organoids
  • a similar crypt-villus organoid structure is formed when single epithelial stem cells are cultured After about one week, structures are formed that strongly resemble the crypt-villus organoid structures that are obtained with intact crypts Histological analysis of these organoids also revealed the preservation of the basic crypt-villus architecture, the presence of all differentiated cell types, and the absence of non- epithelial elements
  • the invention therefore provides crypt-villus organoids, comprising a central lumen lined by a villus-like epithelium that result from cultu ⁇ ng of epithelial stem cells or isolated crypts in a culture medium of the invention
  • said crypt-villus organoid is obtainable using a method of the invention
  • the invention provides pancreatic organoids generated or obtainable by culturing pancreatic fragments according to a method of the invention
  • pancreatic organoid comprising a central lumen
  • gastric organoid is obtainable by a method of the invention
  • Further growth factors that may be added to a culture medium, for example to increase the presence of pancreatic islets in the organoids or to further support the culturing of isolated fragments such as gastric fragments, comprise cyclopamine (Sonic-hedgehog inhibitor, Tocris Bioscience), Activin, GLP (Glucagon like peptide) and its derivative (Exendin 4, California Peptide Research), gastrin (Gensc ⁇ pt), a Notch agonist (Jagged peptide, Ana Spec), Nicotinamide and a Wnt agonist such as Wnt-3a Wnt-3a is attractive to be used when one starts culture with a single cell
  • cyclopamine Sonic-hedgehog inhibitor, Tocris Bioscience
  • Activin Activin
  • GLP Glucagon like peptide
  • gastrin Genesc ⁇ pt
  • a Notch agonist Jagged peptide, Ana Spec
  • Nicotinamide and a Wnt agonist such as Wnt-3
  • the invention further provides a collection of crypt-villus, gastric or pancreatic organoids, each comprising more than 10, preferably more than 20, more preferably more than 40 organoids
  • the crypt-villus organoids surround a central lumen lined by a villus-like epithelium The lumen is filled with apoptotic cell bodies
  • the cells in the crypt-villus organoids are polarized, with stem cells residing in the basis of the structures
  • the top of the crypt-like structures comprise apoptotic cells that are shed into the lumen
  • Said collection of crypt-villus organoids preferably comprises at least 10% viable cells, more preferred at least 20% viable cells, more preferred at least 50% viable cells, more preferred at least 60% viable cells, more preferred at least 70% viable cells, more preferred at least 80% viable cells, more preferred at least 90% viable cells Viability of cells may be assessed using Hoechst staining or Propidium Iodide staining in FACS
  • the invention provides the use of the crypt-villus organoids,
  • said crypt-villus, gastric or pancreatic organoids are cultured in multiwell plates such as. for example, 96 well plates or 384 well plates.
  • Libraries of molecules are used to identify a molecule that affects said organoids
  • Preferred libraries comprise antibody fragment libraries, peptide phage display libraries, peptide libraries (e g LOPAPTM, Sigma Ald ⁇ ch), lipid libraries (BioMol), synthetic compound libraries (e g LOP ACTM, Sigma Ald ⁇ ch) or natural compound libraries (Specs, TimTec)
  • genetic libraries can be used that induce or repress the expression of one of more genes in the progeny of the adenoma cells
  • These genetic libraries comprise cDNA libraries, antisense libraries, and siRNA or other non- coding RNA libraries
  • the cells are preferably exposed to multiple concentrations of a test agent for certain period of time At the end of the exposure period, the cultures are evaluated
  • the term "affecting" is used to cover any change in a cell, including, but not limited to,
  • Said crypt-villus, gastric or pancreatic organoids can further replace the use of cell lines such as Caco-2 cells in toxicity assays of potential novel drugs or of known or novel food supplements
  • said crypt-villus, gastric or pancreatic organoids can be used for cultu ⁇ ng of a pathogen such as a norovirus which presently lacks a suitable tissue culture or animal model
  • Cultures comprising crypt-villus organoids are useful in regenerative medicine, for example in post-radiation and/or post-surgery repair of the intestinal epithelium, in the repair of the intestinal epithelium in patients suffering from inflammatory bowel disease such as Crohn's disease and ulcerative colitis, and in the repair of the intestinal epithelium in patients suffering from short bowel syndrome Further use is present in the repair of the intestinal epithelium in patients with hereditary diseases of the small intestine/colon Cultures comprising pancreatic organoids are also useful in regenerative medicine, for example as implants after resection of the pancreas or part thereof and for treatment of diabetes such as diabetes I and diabetes II
  • the expanded epithelial stem cells are reprogrammed into related tissue fates such as, for example, pancreatic cells including pancreatic ⁇ -cells, and liver cells
  • pancreatic cells including pancreatic ⁇ -cells
  • liver cells Thus far, it has not been possible to regenerate pancreatic cells or liver stem, from adult stem cells
  • the culturing methods of the present invention will enable to analyse for factors that trans-differentiate the closely related epithelial stem cell to a pancreatic cell, including a pancreatic ⁇ -cell, and a liver cell
  • gene therapy can additionally be used in a method directed at repairing damaged or diseased tissue Use can, for example, be made of an adenoviral or retroviral gene delivery vehicle to deliver genetic information, like DNA and/or RNA to stem cells
  • a skilled person can replace or repair particular genes targeted in gene therapy
  • a normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene
  • an abnormal gene sequence can be replaced for a normal gene sequence through homologous recombination
  • selective reverse mutation can return a gene to its normal function
  • a further example is altering the regulation (the degree to which a gene is turned on or off) of a particular gene
  • the stem cells are ex vivo treated by a gene therapy approach and are subsequently transferred to the mammal, preferably a human being in need of treatment
  • the invention provides a method for culturing an epithelial adenoma cell, comprising providing an extracellular matrix, attaching an epithelial adenoma cell to the extracellular matrix, culturing the cell in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, and between 5 and 500 ngram/ml or at least 5 and not more than 500 ngram/ml of a mitogenic growth factor selected from EGF, TGF-alpha and KGF KGF may be replaced by a FGF or FGFlO
  • BMP Bone Morphogenetic Protein
  • An epithelial colon adenoma cell comprises an alteration in a gene coding for APC protein, which results in less efficient degradation of intracellular ⁇ -catenin by a complex of proteins comprising APC
  • Other mutations common in colon adenomas comprise mutations in ⁇ -catenin or Axin2
  • the overall result is enhanced TCF/LEF signalling because of an increased amount of ⁇ -catenin in the nucleus A culture medium without a Wnt agonist was found to be sufficient for proliferation of adenoma cells
  • Said adenoma cell can be isolated from epithelial adenoma by methods known in the art, comprising the use of dissociating agents such as EDTA
  • single Lgr5- or Lgr-6- positive adenoma cells can be isolated from the adenoma by using a Lgr5-binding compound, followed by magnetic beads or FACS analyses
  • the invention further provides progeny of an epithelial adenoma cell that was cultured in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor and between 5 and 500 ngram/ml or at least 5 and not more than 500 ngram/ml of Epidermal Growth Factor (EGF)
  • BMP Bone Morphogenetic Protein
  • EGF Epidermal Growth Factor
  • the invention provides the use of the progeny of the adenoma cells for a targeted drug discovery screen to identify a drug that specifically affects adenoma cells compared to expanded normal epithelial cells that are cultured in the same culture medium
  • the progeny of adenoma cells is cultured in multiwell plates such as, for example, 96 well plates or 384 well plates
  • genetic libraries can be used that induce or repress the expression of one of more genes in the progeny of the adenoma cells
  • These genetic libraries comprise cDNA libraries, antisense libraries, and siRNA or other non-coding RNA libraries
  • progeny can also be used in a high throughput approach for the determination of in vitro metabolic stability and metabolic profiles of drug candidates
  • the invention furthermore provides the use of the progeny of adenoma cells according to the invention, of pancreatic organoids, of gastric organoids and of crypt- villus organoids of the invention, in toxicity assays
  • Said progeny and crypt-villus organoids are easy to culture and more closely resemble primary epithelial cells than, for example, epithelial cell lines such as Caco-2 (ATCC HTB-37), 1-407 (ATCC CCL6), and XBF (ATCC CRL 8808) which are currently used in toxicity assays
  • toxicity results obtained with primary adenoma cultures or with crypt- villus organoids more closely resemble results obtained in patients
  • a cell-based toxicity test is used for determining organ specific cytotoxicity Compounds that are tested in said test comprise cancer chemopreventive agents, environmental chemicals, food supplements, and potential toxicants
  • the cells are exposed to multiple concentrations of a test agent for certain period of time The concentration ranges for test agents in the assay
  • FIG. 1 Growth factor requirement of crypt culture a 500 crypts were seeded with EGF (E, 0-50 ng/ml) and R-spondin 1 (R 0-500 ng/ml) in triplicate, crypt organoids were counted 7 days after seeding b 500 Crypts/crypt organoids were cultured with EGF (50 ng/ml) and R-spondin 1 (500 ng/ml) with the indicated amounts of Noggin and followed for 3 passages Crypt organoids were counted at each passage The experiment was repeated three times with comparable results
  • FIG. 2 Establishment of intestinal crypt culture system a Time course of an isolated single crypt growing into an organoid Differential interference contrast image reveals granule-containing Paneth cells at crypt bottoms (arrows) b, c Single isolated crypts efficiently form crypt organoids Through repeated crypt fission, the structures generate numerous octopus-like crypt organoids at day 14 d 3D reconstructed confocal image of a single organoid after a 3 week culture Lgr5- GFP + stem cells (light grey) are localized at the tip of crypt-like domains Counterstaining for DNA ToPro-3 (dark grey) e Schematic representation of a crypt organoid The organoid consists of a central lumen lined by villus-like epithelium and a number of surrounding crypt-like domains Dark grey cells at the tip of the crypt domain indicates the position of Lgr5 + stem cells, which are present in each crypt domain Scale bar indicates 50 ⁇ m
  • FIG. 3 Cluster analysis of gene expression profiling Cluster analysis of expression levels using freshly isolated colonic and small intestinal crypts as well as small intestinal organoids showed high degree of similarity between small intestinal organoids and the tissue they were derived from, small intestinal crypts Colonic crypts clustered on a separate branch, indicating a different gene expression pattern of this closely related tissue Of note, only 1 2% of all genes expressed were significantly enriched in organoids relative to small intestinal crypts, while -wee ⁇ ersa- 2% were enriched in small intestinal crypts Ingenuity Pathway analysis on these differential genes revealed the specific presence of a lymphocyte signature in freshly isolated crypts, while no significant pathway could be identified in the small number of genes enriched in the organoids (not shown) We conclude that the latter group represents biological noise, while the lymphocyte signature derives from contaminating intraepithelial immune cells, lost upon culture
  • FIG. 7 a-c A crypt from an Lgr5-EGFP- ⁇ res-CreERT2/Rosa26-YFP reporter mouse was stimulated by tamoxifen in vitro for 12 hr, and imaged for the indicated days Lgr5 + cells are light grey and indicated by the white arrows d Seven-day-old organoids derived from an Lgr5-EGFP- ⁇ res-CreERT2/Rosa26-YFP crypts were stimulated by tamoxifen in vitro for 12 hr, and cultured and imaged for the indicated days. YFP fluorescence (light grey) shows that scattered single YFP + cells (day 1 ) generated multiple offspring in vitro over the next five days. The villus domain burst during Dayl-1 5, following by new villus domain formation (white circle) Note that YFP+ cells are migrating toward villus domain
  • Lgr5-GFP + cells prepared from an Lgr5-EGFP- ⁇ res-CreERT2 intestine (bottom) compared to wild-type littermate (top) GFP + cells were divided into two populations; GFP 11 ' and GFP 10* b: Confocal microscopic analysis of a freshly isolated crypt shows GFP hl in CBC cells (black arrowheads) and GFP low above CBC (white arrowheads) c Sorted GFP hl cells, d: 1000 sorted GFP hl cells (left) and GFP' 0W cells (right) after 14 day culture e-f: Fourteen days after sorting, single GFP hl cells form crypt organoids, with Lgr5-GFP + cells (light grey cells) and Paneth cells (white arrows) located at crypt bottoms Scale bar, 50 ⁇ m.
  • Figure 9 a Colony-forming efficiency of single cells sorted in individual wells The average is given for 4 individual experiments, of which in each experiment 100 cells were visually verified and then followed for growth, b: An example of a successfully growing single GFP 111 cell, c: Numbers of cells per single organoid averaged for 5 growing organoids d: Single cell suspension derived from a single-cell-de ⁇ ved- organoid was replated and grown for 2 weeks
  • Figure 10 Colony-forming potency of a single cell sorted in an individual well. An example of a successfully growing single GFP ' cell. The arrows point to a dust particle as a landmark Scale bar: 50 ⁇ m
  • Figure 1 Composition of single stem cell-derived organoids, a-d Three dimensional reconstructed confocal image for a: Villin in light grey (apex of enterocytes lining central lumen) b: Muc2 staining indicated by white arrows (goblet cells), c lysozyme in light grey (Paneth cells), d: Chromogranin A in light grey (enteroendoc ⁇ ne cells). Nucleus was counterstained with DAPI. e-g: Paraffin section staining e: Alkaline phosphatase in black (apex of enterocytes lining central lumen) f.
  • PAS in dark grey (goblet cells), g lysozyme in dark grey (Paneth cells), h: Synaptophysin in dark grey (enteroendoc ⁇ ne cells).
  • i-p Electron microscopy sections of crypt organoids demonstrates the presence of enterocytes (i), goblet cells (j), Paneth cells (k) and enteroendoc ⁇ ne cells (1)
  • m/o Low power crypt image illustrates absence of stromal cells, n-o Higher magnification of m.
  • n Maturation of brush border towards the luminal compartment of the organoid, as indicated by the difference of length of microvilli (black arrows)
  • p Low power image of villus domain Lu, lumen of crypt organoid filled with apoptotic bodies and lined by polarized enterocytes G, goblet cells ; EC, enteroendoc ⁇ ne cells ; P, Paneth cells; asterisk, mat ⁇ gel. Scale bar: 5 ⁇ m (m, p), 1 ⁇ m (n, o).
  • Figure 12 Comparison of electron microscopic images between in vivo crypt and in ⁇ tro cultured crypt a, b' Normal intestine at the base of the crypt with the connective tissue underneath (arrows) For comparison see c-g of the organoids also taken at the base of a crypt d: High magnification image from the apical membrane; There are intercellular clefts (arrows) between the membranes of two adjacent cells.
  • Colon derived crypts can be maintained in culture as well Single isolated crypts derived from colon efficiently form crypt organoids using the same culturing conditions as used for small intestinal crypts Through repeated crypt fission, the structures generate numerous octopus-like crypt organoids at day 14
  • Adenoma isolated from APC7- mice can grow in ⁇ ⁇ tro Single isolated adenoma from APC-/- mice were dissociated and cultured using conditions as described above with the exception that R-spondin was not included in the culture media a Adenoma organoids as shown here on day 4 generally grow as a simple cyst, containing one central lumen containing apoptotic cells b A larger magnification of one adenoma organoid c One adenoma organoid was stained with ⁇ -Catenin (dark grey) and hematoxylin (light grey in lumen) The outer layer of the organoid consists of epithelial cells with a nuclear ⁇ -Catenin staining The inner lumen contains dead cells that have taken up hematoxylin, staining dark grey d A larger magnification of the outer layer of epithelial cells showing clear nuclear ⁇ -Catenin
  • Wnt/ ⁇ -catenin signalling is initiated upon binding of a canonical Wnt ligand to Frizzled and association with LRP5/6 receptors In the absence of R-spondinl , Wnt signalling is limited by the amount of LRP6 on the cell surface, which is kept low by
  • DKK 1/Kremenl -mediated internalization R-spondinl enhances Wnt signalling by antagonizing DKK 1/Kremenl -mediated LRP6 turnover, resulting in increased cell surface levels of LRP6 This figure was taken from PNAS 104 14700, 2007
  • Paneth cells are located adjacent to Lgr5 + stem cells in the small intestines Crypts were isolated from the small intestine of Lgr5-EGFP- ⁇ res-CreERT2 knock-in mice Examples of representative crypts are presented here
  • the GFP + cells are Lgr5 + (light grey, indicated by black arrows) and these are generally located adjacent to Paneth cells (indicated by *)
  • FIG. 21 Efficiency of gastric organoid culture
  • GFP arrows, indicating GFP positive cells
  • Nuclei are stained with DAPI
  • Magnification 63x 100 gastric glands/well were seeded in duplicates with EGF (E), R-spondin 1 (R), Noggin (N), EGF + R-spondin 1 (ER).
  • ENRWK Wnt3A recombinant protein
  • ENRWCMK Wnt3A conditioned media
  • Figure 22 Formation of gastric organoids in vitro
  • (a) Isolated gastric glands growing into organoids. Differential interference contrast images from days 1, 2, 5 and 7 after seeding. Magnification 1Ox (days 1, 2, 5). Day 7 magnification 4x, inset 10x
  • Figure 23 Markers of gastric glands
  • a gastric cultures from Lgr5-LacZ mice Lac Z expression was detected in the gastric budding at day 5 after seeding (see arrow, indicating LacZ positive (dark grey) cells), indicating the presence of Lgr5 positive cells
  • Magnification 20x (b) Ki67 staining (black) shows positive proliferating cells at the base of the gland-like structure, (c) caspase-3 (dark grey) apoptotic cells present inside the lumen of the organoid (d) Gastric mucin 5AC (dark grey) positive cells present in the gastric organoids. Lu, organoid lumen Magnification 20x.
  • Pancreatic ducts can form pancreatic like organoids in vitro Freshly isolated pancreatic ducts were cultured in the presence of EGF, Noggin, R-spondin- 1 and KGF Differential interference contrast images from days 0, 4 and 14 after seeding.
  • FIG. 25 Pancreatic islet like structures form after appr 3 weeks of in vitro culture Differential interference contrast images from day 21 after seeding.
  • Axin-LacZ mice were injected with vehicle alone (A) or R-Spondin (B). After 2 days, the pancreas was isolated and the presence of LacZ expression was determined by staining with X-gal.
  • the middle panel of B shows a larger magnification of a duct that shows positive staining for LacZ, indicating the expression of Axin-LacZ along the lining of the pancreatic duct.
  • the left panel shows that small duct cells in centroacinar or intercalated duct cells expressed Axin2-LacZ (examples of which are indicated by black arrows) Magnifications are shown in the corner of each image Pancreatic duct ligation was performed in wild type mice At different times after PDL, the pancreas was isolated and tissue sections obtained from the PDL and non-PDL area were stained with H&E Magnifications are shown for each time point (C) Pancreatic duct ligation was performed in wt and Axin2-LacZ mice 7 days after PDL, the pancreas was isolated and Axin2-LacZ expression was determined by staining with X-gal of fixed tissue sections (D) or whole mounted organ fragments (E) The white circles indicate ligated portion of the pancreas Expression of Ki67 (examples indicated by arrows) in pancreas tissue sections 5 days after PDL Magnifications are shown (F) Incorporation of BrdU (examples indicated by arrow
  • FIG. 27 Images of pancreatic ductal fragments grown in vitro in EM taken at different time points after isolated from a wild type mouse (A, top panel) Centroacinar cells did not grow for periods longer than 7 days, after which they disintegrated (A, bottom panel) Pancreatic fragments were grown in the presence or absence of EGF (50 ng/ml), R- spondin (1 ⁇ g/ml), FGFlO ( 100 ng/ml) or Noggin (100 ng/ml) Images of the cultures were taken 7 and 14 days after the start of the culture with freshly isolated pancreatic fragments Cultures without EGF did not survive for longer that 10 days (B) Pancreatic fragments isolated from Axin2-LacZ mice were cultured in the absence or presence of R-spondin (1 ⁇ g/ml) for 3 days X-gal staining showed expression of Wnt-responsive Axin-LacZ in the ductal cells after 3 and 14 days only in the presence of R-spondin (exa
  • Pancreas was isolated from mice 7days after PDL treatment and pancreatic cells were stained with EpCAM-APC and fluorescent substrate for LacZ (FluoroReporter kit), sorted and cultured in EM including 50% Wnt3A conditioned medium and 10 mM Y- 27632 for 4 days Culture medium was changed into EM medium without Wnt and Y- 27632 after 4 days Pictures were taken on the indicated days and a 4Ox magnification is shown
  • Pancreatic organoids were transferred from EM to DM The effect of removal of FGFlO from the expansion medium, resulting in DM, induced differentiation into islets Pancreatic organoids were cultured for 10 days in DM after which islet like structures could be detected in vitro Pictures of the cultures in the presence and absence of FGFlO are shown (A) and shows increased expression of certain differentiation markers, Ngn3 and somatostatin as measured by PCR Hprt is a housekeeping gene (B) At several time points after the transferral to DM, expression of a number of markers was assessed by PCR (C) Change in morphology from pancreatic cysts to ⁇ cell-like structures (D) accompanied the appearance of certain ⁇ cell markers, such as Insulin and C-peptide as detected by immunofluorescence (E) The presence of R-spondin in DM is essential for the regeneration of ⁇ cell progenitors, as indicated by positive immunofluorescent staining for Ngn3 (examples are indicated by white arrows) (
  • Figure 32 Establishment of human intestinal crypt culture Human organoids cultured out of small intestine (A-D) and colon (E-H) after 3 (A, C, E, G) and 5 (B, D F, H) days in medium supplemented with EGF, Noggin and Rspondin with (A, B, E, F) and without (C, D, G, H) Wnt3a conditioned medium
  • FIG. 33 Establishment of the gastric organoid culture (A) A total of 100 gastric glands/well were seeded in duplicate with EGF (E), R- spondin 1 (R), Noggin (N), EGF + R-spondin 1 (ER), EGF + Noggin (EN), EGF + R- spondin 1 + Noggin (ERN), EGF + R-spondin 1 + Noggin + Wnt3A (ERNW), EGF + R-spondin 1 + Noggin + Wnt3A + FGFlO (ERNWF), EGF + R-spondin 1 + Noggin + control conditioned media + FGFlO (ERNCCMF) or EGF + R-spondin 1 + Noggin + Wnt3A conditioned media + FGFlO (ERNWCMF) The number of gastric organoids was counted 2, 5 and 7 days later Results are shown as mean ⁇ SEM of 2 independent experiments
  • FIG. 34 Single Lgr5+ve cells build long-lived gastric organoids in-vitro (A) Confocal analysis of a freshly isolated pyloric gastric unit from an Lgr5-EGFP- ires-CreERT2 mouse stomach. Arrows showing GFPhi (grey), GFPIo (black) and
  • Lgr5-EGFP+ve cells are discriminated from the GFPIo and GFP- ve populations according to their GFP expression level.
  • FSC forward scatter
  • C Representative example of a growing organoid originating from a single Lgr5+ve cell Arrows showing the formation of gland-like domain buds at day 7 Original magnifications: days 1-4; 4Ox magnification, days 5-6, 2Ox magnification, days 7-8;
  • Example 1 Cultu ⁇ ng of small intestine crypts and villi in vitro
  • mice of 6- 12 weeks of age were used Generation and genotyping of the Lgr5-EGFP-Ires-CreERT2 allele 1 has been previously described 1 Rosa26-lacZ or YFP Cre reporter mice were obtained from Jackson Labs
  • RNA isolation We prepared labeled cRNA following the manufacturer's instruction (Agilent Technologies) Differentially labelled cRNA from small intestinal crypts and organoids were hybridised separately for the two mice on a 4X44k Agilent Whole Mouse Genome dual colour Microarrays (G4122F) in two dye swap experiments, resulting in four individual arrays
  • isolated colonic crypts were hybridized against differentially labelled small intestinal crypts in two dye swap experiments, resulting in four individual arrays
  • Microarray signal and background information were retrieved using Feature Extraction (V 9 5 3, Agilent Technologies) All data analyses were performed using ArrayAssist (5 5 1, Stratagene Inc ) and Microsoft Excel (Microsoft Corporation) Raw signal intensities were corrected by subtract
  • the intestinal epithelium is the most rapidly self-renewing tissue in adult mammals
  • Single sorted Lgr5* stem cells can also initiate these crypt-villus organoids
  • Tracing experiments indicate that the Lgr5 * stem cell hierarchy is maintained in organoids
  • intestinal crypt-villus units are self-organizing structures, which can be built from a single stem cell in the absence of a non-epithelial cellular niche
  • the self-renewing epithelium of the small intestine is ordered into crypts and villr Cells are newly generated in the crypts and are lost by apoptosis at the tips of the villi, with a turn-over time of 5 days in the mouse
  • Self-renewing stem cells have long been known to reside near the crypt bottom and to produce the rapidly proliferating transit amplifying (TA) cells
  • the estimated number of stem cells is between 4 and 6 per crypt Enterocytes, goblet cells and enteroendoc ⁇ ne cells develop from TA cells and continue their migration in coherent bands along the crypt-villus axis
  • the fourth major differentiated cell-type, the Paneth cell resides at the crypt bottom
  • Lgr5 which is specifically expressed in cycling Crypt Base Columnar cells that are interspersed between the Paneth cells' Using a mouse in which a GFP/tamoxifen-inducible Cre recombinase cassette was integrated into the Lgr5 loc
  • a Wnt3a ligand expressing cell line and the same cell line, without the Wnt3a ligand (control medium) are cultured for a period of 3-4 weeks
  • the cells will produce Wnt3a as soon as they stop grown at confluency
  • the medium will be harvested and tested in the TOPflash assay, a luciferase assay using a TCF responsive elements-luc construct (TOP) and the same construct, but with mutations in the TCF responsive elements (FOP)
  • TOP TCF responsive elements-luc construct
  • FOP TCF responsive elements
  • the ratio between TOP/FOP should be more than 20 for the medium to be used in cultures
  • the medium is diluted 25-50% when used in the cultures to regenerate tissue
  • Colonic organoids grow slower and less efficient as compared with small intestinal organoids With the same growth factors condition as small intestine, less than 5% of colonic crypts isolated from distal colon grew and formed organoid structure (Fig 13) It was difficult to grow colonic crypts from proximal part of colon Since we found upregulation of trkB, the receptor of BDNF (Brain derived neurotrophic factor), in the microarray analysis (colon Lgr5-GFP hi cells vs colon Lgr5-GFP low cells), we determined the effect of BDNF for colonic organoids We constantly observed around 2-fold higher culture efficiency in BDNF+ culture than BDNF- culture Typically, one colon organoid would contain approximately 10 crypt domains (Fig 14) Consistent with their origin, no Paneth cells could be detected Compared with small intestinal organoids, colonic crypt possesses no Wnt-3a producing Paneth cells in the crypt base, therefore supplementation of Wnt-3 increases culture efficiency of colonic crypts but
  • Adenomas have been historically difficult to culture in vitro Since the above described conditions were used to successfully culture healthy crypts derived from small intestine as well as colon, it was determined whether similar conditions could sustain adenomas in vitro After isolation of adenoma from APC-/- mice using 2 5mM EDTA, single adenomas were cultured under similar conditions as described above Importantly, these conditions were adequate to maintain growth of the adenomas in vitro, however, R-spondin had become redundant This can be easily explained by the fact that it no longer is necessary to induce the Wnt signaling pathway, since the absence of APC in these cells will automatically result in nuclear ⁇ -Catenin This makes R-spondin, a Wnt agonist, redundant in culturing adenomas in vitro Figure 16a, and in larger magnification in Fig 16b, show that, in contrast to normal crypt organoids, in which you can see crypt budding with central lumen, adenoma organoids simply grow as cysts Dead
  • LgrS-GFP* 11 cells were sorted and cultured with or without Wnt3a ( lOOng/ml) in addition to conventional single cell culture condition (EGF, noggin, R-spondin, Notch ligand and Y-27632, as described above for single cells)
  • Wnt3a lOOng/ml
  • Isolated crypts were incubated with IuM Newport Green-DCF (MolecularProbes) in
  • Frizzled, LRP6, prior to signalling through Frizzled Upon binding of the Wnt factor to Frizzled and the co receptor LRP6, the Wnt signalling pathway is activated ⁇ 1 When LRP6 is present on the cell surface, will Wnt activation take place (Fig 18) Therefore, if R-spondin is not present in the culture medium, Wnt3a will not be able to activate the Wnt pathway, since LRP6 is internalized and not available for signalling in combination with the Wnt factor, thereby preventing activation of the Wnt pathway
  • Wnt3a is a soluble factor that, under physiological circumstances, is produced by
  • Paneth cells These cells are generally located adjacent to the stem cells (Fig 19) and it is hypothesized that these cells support the maintenance of the ongoing differentiation of the intestinal epithelial cell layer
  • Other Wnt factors that are also secreted by Paneth cells are Wnt6, 9b and 1 1
  • Wnt6 will have the same effect on stem cell differentiation as Wnt3a does
  • Example 5 Culture conditions support the growth of stomach organoids as well
  • the stomach consists of 3 topographic regions (fundus, corpus, and antrum) and 2 functional glandular areas (oxyntic and pyloric)
  • the oxyntic gland area comprises 80% of the organ whereas the pyloric area comprises the 20% of the organ
  • the mammalian gastric epithelium is organized into gastric units consisting of a planar surface epithelium, a short pit and a long gland The pit is lined by mucus secreting cells whereas the gland is composed of secreting cells separated in three regions the isthmus, the neck and the base
  • the gastric epithelium is constantly renewed Tracing studies performed in our laboratory have shown that LGR5 positive cells located at the gland base fulfil the definition of sternness (Barker et al under preparation) So far, gastric monolayer cultures have not been able to recapitulate the features of the gastric unit, which is formed by several differentiated gastric cells Furthermore, the 3- D culture method systems reported only reconstruct highly differentiated gastric surface mucous cells, without showing any
  • DMEM/F12 (Invitrogen) Under the stereoscope, the pyloric region was excised and isolated from the body and forestomach and the pyloric mucosa was carefully separated from the muscle layer with tweezers Then, the tissue was chopped into pieces of around 5mm and further washed with cold isolation buffer (Na 2 HPO 4 28 rtiM + KH 2 PO 4 40 mM + NaCl 480 mM + KCl 8 mM + Sucrose 220 mM + D-Sorbitol 274 mM + DL-Dithiotreitol 2 6 mM) The tissue fragments were incubated in 5mM EDTA with isolation buffer for 2 h at 4°C under gentle rocking Following removal of EDTA solution, the tissue fragments were vigorously suspended in 10 ml of cold isolation buffer with a 10 ml pipette The first supernatant containing dead cells was discarded and the sediment was suspended with 10- 15ml cold isolation buffer
  • organoids were directly fixed in the mat ⁇ gel with 0 25% glutaraldehyde (Sigma) in 10OmM MgCl 2 in PBS, for 1-2 h at room temperature After, cultures were washed 3-times with washing solution (0 01% Sodium Deoxycholate + 0,02% NP40 + 5mM MgCl 2 in PBS) and incubated for 16 h at 37°C with lmg/ml X- GaI (Invitrogen) in the presence of 0,21% K 4 Fe(CN) 6 and 0, 16% K 3 Fe(CN) 6 After washing in PBS, cultures were post fixed with 2% PFA in PBS for 15 mm at room temperature All reagents were acquired from Sigma
  • organoids were isolated from the mat ⁇ gel using trypsine (Tryple Select, Invitrogen), fixed with 4% PFA for 1 h at room temperature and embedded in paraffin Paraffin sections were processed with standard techniques and immunohistochemistry was performed as previously described The following antibodies were used anti-mouse Ki67 (clone MMl, Monosan) ( 1 200), anti-rabbit cleaved caspase-3 (Cell Signaling Technology) ( 1 400) and anti-human gastric mucin 5AC (Novocastra clone 45Ml) (1 200) Citrate buffer antigen retrieval was performed in all cases Sections were counterstained with Mayer's haematoxyhn
  • gastric glands (Fig 21a) were suspended in Mat ⁇ gel Gastric culture growth required EGF (50 ng/ml), Noggin (100 ng/ml), R-spondin 1 (1 ug/ml) and Wnt3A (100 ng/ml) (Fig 21b) KGF (50 or 100 ng/ml) was essential for the formation of budding events and, therefore, the expansion of the cultures
  • EGF 50 ng/ml
  • Noggin 100 ng/ml
  • R-spondin 1 (1 ug/ml
  • Wnt3A 100 ng/ml
  • Fig 21b KGF (50 or 100 ng/ml) was essential for the formation of budding events and, therefore, the expansion of the cultures
  • the cultured pyloric units behaved as the intestinal crypt organoids
  • the opened upper part of the unit is sealed and the lumen is filled in with apoptotic cells
  • the newly formed gastric organoids underwent continuous budding events (reminiscent of gland fi
  • Organoids have been cultured for at least 1 month without losing the properties described Weekly, organoids are passaged 1 4 by mechanical dissociation (Fig 22)
  • Culture of Lgr5-LacZ pyloric gastric units revealed the presence of Lgr5 positive stem cells in the gastric organoids (Fig 23a)
  • proliferating cells are located at the base of the gland-like structures (Fig 23b) while apoptotic caspase 3 positive cells are found extruded into the lumen
  • the gastric mucin 5AC (MUC5AC) is a specific marker of the gastric pit cells, also named as foveolar cells MUC5AC positive cells are found in the organoids, indicating the presence of at least one differentiated gastric cell lineage (Fig 23d)
  • no endocrine derived cells have been detected Therefore, additional factors are required These would include gastrin releasing peptide, activators or inhibitors of the Hedgehog and Notch families, other activators of the Wnt pathway and other
  • Example 6a Pancreas organoids can be grown in ⁇ itro
  • pancreas Freshly isolated pancreas was cut into small pieces, and incubated in DMEM (Invitrogen) with digestive enzyme mixture (300 U/ml Collagenase typeXI (Sigma), 0 01 mg Dispase I (Roche) and 0 1 mg DNase) for 10 minutes in orbital shaker (80rpm, 37°C) After incubation, the tissue fragments were mildly dissociated by mechanical pipetting Undigested fragments were settled down for 1 minute with normal gravity, and the supernatant was transferred to a new tube The supernatant was passed through 70 um-cell strainer, and the residue was washed with DMEM The fragments remaining on the cell strainer were harvested by rinsing the inverted cell strainer with DMEM, and pelletted The fragments mostly consist of pancreatic acinar tissue and included pancreatic ducts The pellet was mixed with mat ⁇ gel and cultured as small intestinal organoid culture system (see materials and methods of example 1) The mat ⁇ gel was incubated for 5-
  • Pancreatic tissue formed simple cyst structure 3-4 days after culture in the presence of EGF Noggin and R-spondin synergistically increased the size of cyst structure, but did not affect morphogenesis of organoids KGF significantly induced budding formation as well as culture efficiency Using the optimal combination of growth factors (EGF, Noggin, R-spondin- 1 and KGF), more than 80% of pancreatic duct grew in the best combination of growth factors
  • pancreatic ducts Once the pancreatic ducts had been taken in culture, the ducts quickly sealed both ends of the structure and form a simple structure Approximately 20% of organoids started to form a budding structure 7 days after the start of the culture (Fig 24) The pancreatic ducts rapidly proliferate, in contrast to the acinar tissue, which only grows very slowly
  • pancreatic islet-like structure were observed (Fig 25) These islet-like structures are generally not observed before passage The islets survive for at least 7 days, but proliferate very slowly or not at all These islet-like structure resemble the pancreatic islets of Langerhans that are present in healthy pancreas tissue Such islets contain, among others, alpha cells and beta cells that produce glucagon and insulin respectively The observed islet-like structures contain cells that express insulin, neurogenin 3, and Pdx- 1 Several growth factors will be tested to determine whether they increase the presence of pancreatic ⁇ cells in the organoids that are derived from pancreas tissue Candidate growth factors comprise cyclopamine (Sonic-hedgehog inhibitor), Activin, GLP (Glucagon like peptide) and its derivative (Exendin 4), gastrin and Nicotinamide
  • Example 6b Pancreas organoids can be grown in vitro
  • Pancreatic tissue formed simple cyst structure 3-4 days after culture in the presence of EGF Noggin and R-spondin synergistically increased the size of cyst structure, but did not affect morphogenesis of organoids FGF7 (KGF) /FGFlO significantly induced budding formation as well as culture efficiency Using the optimal combination of growth factors (EGF, Noggin, R-spondin-1 and FGF7 (KGF) /FGFlO), more than 80% of pancreatic duct grew in the best combination of growth factors Once the pancreatic ducts had been taken in culture, the ducts quickly sealed both ends of the structure and form a simple structure Approximately 80% of organoids started to form a budding structure 7 days after the start of the culture (Fig 24) The pancreatic ducts rapidly proliferate, in contrast to the acinar tissue, which only grows very slowly Interestingly, after passage of the organoids, appr 2-3 weeks after the start of the culture, pancreatic islet-like structure were observed (Fig 25) These islet
  • Example 7 Unimpeded expansion of adult pancreatic progenitors in ⁇ tro by driving a Wnt/Lgr5 regenerative response
  • Pancreatic tissue was obtained from the following mice Axin-LacZ knock in (Lustig et al MoI Cell Biol 2002), Lgr5-LacZ Knockin (Barker et al, 2007), Lgr5-GFP (Barker et al, 2007) Axin-LacZ mice were injected IP with 100 ⁇ g of purified human R- spondinl (kindly provided by A Abo, Nuvelo Inc, CA, USA) and sacrificed 48 hours later for LacZ expression analysis in the pancreas
  • Pancreatic duct ligation was performed as described in rats (Wang et al , 1995) with some minor modifications
  • the experimental procedure for PDL was the following animals are anesthetized with a mixture of fluanisone fentanyl midazolam injected intraperitoneally at a dosage of 3 3 mg/Kg, 0 105 mg/Kg and 1 25 mg/ Kg respectively Animals are placed in supine position and the abdominal surface is shaved and cleaned with antiseptic solution (iodine solution) Following, a median incision at the upper anterior abdominal wall from the xiphisternum is performed and the pancreas is exposed Under a dissecting microscope, the pancreatic splenic lobe is localized and the pancreatic duct is ligated with a 7-0 polypropylene suture monofilament at approximately 1 mm distal to the junction with the gastric lobe duct Following surgery the analgesic buprenorphine is administered s c at a dose
  • FGFlO was obtained from Peprotech BrdU was obtained from Sigma
  • cDNA was amplified in a thermal cycler Primers used are shown below mmTBP (forward) TATTGTATCTACCGTGAATCTTGG mmTBP (reverse) CAGTTGTCCGTGGCTCTC
  • Hprt (F) AAGTTTGTTGTTGGATATGC (R) CATCTTAGGCTTTGTATTTGG (Tm ) 57°C, 106bp
  • Chromogranin A (F) GCTGACAGCAGAGAAGCGGCT(R)
  • Glut2 (slc2a2) (F) AAGTTGGAAGAGGAAGTCAG (R) AGACCTTCTGCTCAGTCG (Tm ) 57°C 124bp
  • pancreas organoids were isolated from Mat ⁇ gel using Dispase (Invitrogen), and fixed with 4%PFA, followed by permeabilization with 0 1% Triton X- 100 Following antibodies were used for immunohistochemistry; anti-BrdU (Amersham), anti-Ki67 (Dako), anti- Insulin (Sigma), anti-C-peptide (Cell signaling), anti-Ngn3 (Developmental hyb ⁇ doma studies bank)
  • DNA was stained with DAPI or ToPro-3 (Molecular Probes). Three-dimensional images were acquired with confocal microscopy. The staining with X-gal was performed as described under example 5 under immunohistochemistry and imaging analysis
  • Pancreatic organoids were cultured in the presence or absence of R-Spondin ( l ⁇ g/ml) were removed from mat ⁇ gel mechanically or enzymatically (TrypLE) Isolated organoids were further digested by TrypLE for 10 mm at 37C Dissociated cells were passed through 40 um cell strainer (BD bioscience) and stained with APC conjugated anti- EpCAM (eBioscience). LacZ was stained by FluoReporter kit(Invitrogen) following manufacturer's protocol.
  • Single Wnt-dependent Lgr5 + stem cells derived from the small intestine can be cultured to form continuously expanding gut-like organoids (Sato et al, 2009)
  • the Wnt pathway is inactive and -consequently- Lgr5 is not expressed
  • PDL partial duct ligation
  • freshly isolated adult duct fragments initiate expression of Lgr5 and form budding cysts which expand 10-fold weekly for >30 weeks
  • Removal of growth stimuli converts these cysts into structures with immature islet morphology, expressing endocrine and ⁇ -cell markers
  • Single Wnt- stimulated cells from injured pancreas can also initiated these long-term cultures
  • the Hayflick limit does not apply to adult progenitor cells when cultured under optimized conditions
  • culture methods favoring expansion of organ- specific adult stem cells may represent
  • Lgr5 a marker for that population of cells was Lgr5
  • the Lgr5 gene is, like Axin2, a Wnt-responsive gene Yet in the intestine and the skin it is only expressed in Wnt-stimulated stem cells but not in transit amplifying cells (Barker et al, 2007, Jaks et al, 2008)) It is therefore considered to be a genuine stem cell marker
  • Lgr5+ cells in the pancreas may also be the origin of the ⁇ cell progenitors as detected after injury
  • pancreas progenitors may by expanded in the previously defined gut organoid culture conditions (Sato et al, 2009) Cultures of heterogeneous populations of pancreas cells have been previously established and typically include growth factors such as EGF (Githens et al In Vitro Cell Dev Biol 1989), FGFlO (Miralles et al Proc Natl Acad Sci U S A 1999) and HGF (Lefebvre et al Diabetes 1998, Suzuki et al , Diabetes 53, 2004) and serum supplements such as Gastrin (Rooman et al Gastroenterology 2001), Nicotinamide (Rooman et al Diabetologia 2000) and others A number of such cultures resulted in the in vitro generation of cells with a ⁇ cell-like phenotypes (Bonner-Weir et al , 2000, Seaberg et al , 2004, Suzuki
  • DM Differentiation Medium
  • Example 8 In vitro expansion of human pancreas fragments During embryonic pancreas development, neurogenin3+ or insulin expressing cells were seen in the pancreas ductal network, and it was suggested that pancreas duct cells give rise to endocrine progenitors and consequently mature endocrine cells. It has been shown that human pancreas duct cells differentiate into glucose responsive insulin producing cells in vitro (Bonner-Weir, S et al 2000 PNAS), and this finding made pancreas duct cells attractive source for beta cells replace therapy However, it has been difficult to expand duct cells without losing endocrine differentiation capacity.
  • pancreas duct cells lost epithelial property or underwent senescence after 2 weeks up to 5 weeks (Trautmann B et al. Pancreas vol.8 248-254). . Therefore, there is no robust culture system to expand human pancreas duct cells, which retain endocrine differentiation ability Taking advantage of establishment of mouse pancreas organoid culture system, here, we attempted to establish human pancreas organoid culture system.
  • pancreatic fragments Under these expansion conditions, the culture efficiency of the pancreatic fragments was appr. 80%, meaning that 80% of the freshly isolated pancreatic fragments were efficiently expanded in vitro for a longer period of time. As compared with mouse pancreas, acinar tissue more easily forms cyst structures, however, these structure ceased to proliferate within 4 weeks. Pancreas duct cells from larger ductular network more efficiently produce cyst structures and eventually form organoids with bud. The pancreas organoids were splitted 1 :5 ratio once per week and maintained in vitro at least 5 weeks without losing proliferation ability.
  • Crypt-villus organoids grow through the supplementation of a set of divined growth factors and an extracellular matrix
  • the organoids contain intestinal stem cells that actively divide and giving rise to all major differentiated cell lineages present in the intestine.
  • these culture conditions are not unique to the mouse intestinal epithelium but can also be used to grow human intestinal epithelium.
  • Wnt3a Human colon crypts were isolated from resected normal colonic specimen and cultured as organoid structures for 7 days using the established organoid culture system (Sato et al , 2009 Nature May 14,459(7244) 262-5) Since this protocol was optimized for mouse derived organoid cultures, we made a small change by the addition of Wnt3a conditioned medium, in order to ensure optimal growth of the human colon organoids
  • Wnt3a is expressed in a cell line by transfecting a suitable expression construct encoding said ligand Said cell line is cultured and the culture medium comprising the secreted ligand is harvested at suitable time intervals For example, cells start the production of Wnt3a at the moment they reach confluency and stop growing Culture medium from cells that were not transfected or infected with said empty expression construct was used as a negative control
  • the conditioned medium was harvested and tested, for example in an assay wherein luciferase expression in controlled by TCF responsive elements to quantitate
  • Gastric unit isolation, single cell dissociation and EGFP +ve cell sorting Gastric glands were isolated from mouse pylorus regions as previously described with some modifications (Bjerknes and Cheng, 2002, Am J Physiol Gastrointest Liver Physiol Sep, 283(3) G767-77) Briefly, under the microscope, the stomach was opened along the greater curvature, washed with saline solution and the pylorus isolated The muscular layer of the stomach was removed and the remaining epithelia was divided into 5 mm pieces and incubated for 3-5 h in a buffered saline solution (Na2HPO4 28 mM, KH2PO4 40 mM, NaCl 480 mM, KCl 8 niM, Sucrose 220 mM, D-Sorbitol 274 mM, DL-Dithiotreitol 2 6 mM) containing 10 mM EDTA (for culturing or staining) or 5mM
  • the Wnt3a media was prepared following protocol described elsewhere (Willert et al ,
  • the TOP/FOP assay was used to test the Wnt activity of the Wnt3a conditioned media and the Control conditioned media, as described by van de Wete ⁇ ng and colleagues (van de Wete ⁇ ng et al , 2001 Cancer Res Jan 1 ,61( 1) 278-84)
  • a TOP/FOP ratio > 50 was considered high Wnt media and diluted 1 1 with the gastric organoid culture media
  • a 1 10 dilution of this high Wnt3a media was considered low Wnt media and used for differentiation purposes
  • Muc5ac CCATGAAGTGGGAGTGTGTGTG, TTGGGATAGCATCCTTCCAG Ghrl GCCCAGCAGAGAAAGGAATCCA, GCGCCTCTTTGACCTCTTCC
  • Gast GCCAACTATTCCCCAGCTCT GGCTCTGGAAGAGTGTTGCT Stt: GAGGCAAGGAAGATGCTGTC, GGGCATCATTCTCTGTCTGG Muc2 GAACGGGGCCATGGTCAGCA, CATAATTGGTCTTGCATGCC Cdx2: CTTGCTGCAGACGCTCAAC, TCTGTGTACACCACCCGGTA Hprt AAGCTTGCTGGTGAAAAGGA, TTGCGCTCATCTTAGGCTTT
  • FGFlO proved to be an essential component for driving budding events and for the expansion of the cultures into multi-unit organoids (fig 33B).
  • FGFlO can be used to replace FGF7 (KGF), which has been used in example 5, and even results in a 2-fold increase of % of budding organoids 4 days after the start of the culture (fig 33C).
  • KGF FGF7
  • the newly-formed gastric organoids underwent continuous budding events, whilst maintaining their polarity, with gastric gland-domain buds distributed around a central lumen (fig 33D).
  • FIG 34A To determine whether gastric Lgr5 +ve cells (Fig 34A) were capable of generating and maintaining pyloric gastric glands units in vitro we sorted Lgr5-EGFP high cells (Fig 34B). When single Lgr5-EGFP high cells were sorted, an average of 8 % of the cells grew into organoids, whereas the remaining cells died within the first 24 h The sorted Lgr5-EGFPhi cells rapidly began dividing and small cyst-like structures were already visible after 5 days. During the following days, the newly-formed (cyst-like) structures started to generate gland-like domains ( Figure 34C).
  • the cultures expressed the gastric epithelial markers Gastric intrinsic Factor, Mucin 6 and Pepsinogen C No differentiation to the pit or enteroendocrine lineages was observed under these culture conditions (This is different from example 5 were the pit cell lineage was observed. However in that example Wnt3a protein was used instead of Wnt conditioned medium which is less active.
  • thermolysin thermolysin to generate viable human normal intestinal epithelial cell cultures. Exp Cell Res 224, 354- 64 ( 1996)

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Diabetes (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Emergency Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Developmental Biology & Embryology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Materials For Medical Uses (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to a method for culturing epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells, or adenoma cells, and culturing the cells or fragments in the presence of a Bone Morphogenetic Protein (BMP) inhibitor, a mitogenic growth factor, and a Wnt agonist when culturing epithelial stem cells and isolated tissue fragments. The invention further relates to a cell culture medium comprising a BMP inhibitor, a mitogenic growth factor, and a Wnt agonist, to the use of said culture medium, and to crypt-villus organoids, gastric organoids and pancreatic organoids that are formed in said culture medium.

Description

CULTURE MEDIUM FOR EPITHELIAL STEM CELLS AND ORGANOIDS COMPRISING SAID STEM CELLS
The invention relates to a novel culture medium for cultuπng epithelial stem cells, especially intestinal and colonic epithelial stem cells, and for cultuπng organoids comprising said stem cells The invention further relates to the progeny of cells and organoids that were cultured using a culture medium of the invention, and to the use of said progeny in toxicity assays or in regenerative medicine
The self-renewing epithelium of the small intestine is ordered into crypts and villi
(Gregoπeff and Clevers, 2005 Genes Dev 19, 877-90) Cells are newly generated in the crypts and are lost by apoptosis at the tips of the villi, with a resulting epithelial turn-over time of 5 days in the mouse Self-renewing stem cells have long been known to reside near the crypt bottom and to produce the rapidly proliferating transit amplifying (TA) cells capable of differentiating towards all lineages The estimated number of stem cells is between 4 and 6 per crypt (Bjerknes and Cheng, 1999 Gastroenterology 1 16, 7- 14) Three differentiated cell types, enterocytes, goblet cells and enteroendocπne cells, form from TA cells and continue their migration in coherent bands along the crypt-villus axis Each villus receives cells from multiple different crypts The fourth major differentiated cell-type, the Paneth cell, resides at the crypt bottom
A gene, Lgr5, was recently identified which is specifically expressed in a fifth cell type, cycling Crypt Base Columnar (CBC) cells, which are small cells that are interspersed between the Paneth cells (indicated by black arrows in Fig 8b) (Barker et al , 2007 Nature 449 1003- 1007) Using a mouse in which a GFP/tamoxifen-inducible Cre recombinase cassette was integrated into the Lgr5 locus, it was shown by lineage tracing that the Lgr5+ CBC cells constitute multipotent stem cells which generate all cell types of the epithelium even when assessed 14 months after Cre induction
It was recently discovered that also Lgr6, besides Lgr5, but not Lgr4, is a unique marker for adult stem cells While Lgr 5 is expressed in stem cells of brain, kidney, liver, retina, stomach, intestine, pancreas, breast, hair follicle, ovary, adrenal medulla, and skin, Lgr6 is expressed in stem cells of brain, lung, breast, hair follicle, and skin It is generally believed that an intimate contact between epithelial stem cells and subepithelial fibroblasts is required to anchor and support epithelial stem cells and to provide the correct orientation necessary to generate a properly polarized, three dimensional structure
Although a variety of culture systems have been described for culturing primary epithelial stem cells, including intestinal epithelium stem cells (Bjerknes and Cheng, 2006 Methods Enzymol 419 337-83), to date no long-term culture system has been established which maintains the pluripotency of epithelial stem cells Furthermore, no culture system is known that preserves the basic crypt-villus physiology of crypts that have been isolated from colon or intestine, or that preserves the basic physiology of isolated pancreatic fragments or gastric tissue fragments
The invention therefore provides a method for culturing epithelial stem cells, isolated epithelial tissue fragments comprising said epithelial stem cells, or adenoma cells, the method comprising providing an extracellular matrix, incubating an epithelial stem cell, an isolated tissue fragment comprising said epithelial stem cells, or an adenoma cell with the extracellular matrix, culturing the stem cell, isolated tissue fragment, or adenoma cell in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, between 5 and 500 ngram/ml or at least 5 and not higher than 500 ngram/ml of a mitogenic growth factor, whereby a Wnt agonist is added if epithelial stem cells and isolated tissue fragments are cultured
It was surprisingly found by the present inventors that a method of the invention allows culturing of epithelial stem cells, isolated fragments from the small intestine, colon, stomach and pancreas comprising said stem cells and adenoma cells, while preserving the presence of stem cells that retain an undifferentiated phenotype and self- maintenance capabilities For example, isolated crypts that are cultured according to a method of the invention develop into crypt-villus organoids, comprising a central lumen lined by a villus-like epithelium The growth of isolated crypts was fuelled by stem cells that are present in the crypts The resulting organoids undergo multiple crypt fission events Even more surprising was the observation that a method of the invention allows the outgrowth of single, isolated epithelial stem cells into crypt-villus organoids in the absence of a stem cell niche Isolated gastric fragments from the pyloric region of the stomach behaved as intestinal crypt organoids The opened upper part of the unit was sealed and the lumen was filled with apoptotic cells The newly formed gastric organoids underwent continuous budding events (reminiscent of gland fission) while maintaining their polarity with a central lumen Furthermore, cultuπng pancreatic fragments resulted in the appearance of pancreatic islet-like structures that express insulin and other pancreatic islet specific markers, resembling the pancreatic islets of Langerhans
The epithelium lining the pyloric region of the small and large bowel encompasses luminal protrusions, villi, and invaginations, crypts Each cell along the crypt-villus axis is polarized, whereby cells on the top of the intestinal villi, or in the upper positions of colonic crypts, are the most differentiated and are continuously lost into the lumen Continuous proliferation of stem cells residing in the basis of the crypts, and massive proliferation of progenitor cells residing in the middle of the crypts, ensures proper replacement of the shed cells
Stem cells are found in many organs of adult humans and mice Although there may be great variation in the exact characteristics of adult stem cells in individual tissues, adult stem cells share the following characteristics They retain an undifferentiated phenotype, their offspring can differentiate towards all lineages present in the pertinent tissue, they retain self-maintenance capabilities throughout life, and they are able to regenerate the pertinent tissue after injury Stem cells reside in a specialized location, the stem cell niche, which supplies the appropriate cell-cell contacts and signals for maintenance of said stem cell population
Epithelial stem cells are able to form the distinct cell types of which the epithelium is composed Some epithelia, such as skin or intestine, show rapid cell turnover, indicating that the residing stem cells must be continuously proliferating Other epithelia, such as the liver or pancreas, show a very slow turnover under normal conditions Crypts can be isolated from the duodenum, small and large intestine, including jejunum, ileum, and colon, and the pyloric region of the stomach by protocols that are known to the skilled person For example, crypts can be isolated by incubation of isolated tissue with chelating agents that release cells from their calcium- and magnesium-dependent interactions with the basement membrane and stromal cell types After washing the tissue, the epithelial cell layer is scraped from the submucosa with a glass slide and minced This is followed by incubation in trypsin or, more preferred, EDTA and/or EGTA and separation of undigested tissue fragments and single cells from crypts using, for example, filtration and/or centπfugations steps Other proteolytic enzymes, such as collagenase and/or dispase I, can be used instead of trypsin Similar methods are used to isolate fragments of the pancreas and stomach
Methods to isolate stem cells from epithelial tissue are known in the art A preferred method is based on the fact that stem cells express Lgr 5 and/or Lgr 6 on their surface, which belong to the large G protein-coupled receptor (GPCR) superfamily The Lgr subfamily is unique in carrying a large leucine-rich ectodomain important for ligand binding Ligands for Lgr 5 and Lgr 6 are not yet described in the literature A preferred method therefore comprises preparing a cell suspension from said epithelial tissue, contacting said cell suspension with an Lgr5 and/or 6 binding compound, isolating said Lgr5 and/or 6 binding compound, and isolating the stem cells from said binding compound It is preferred that a single cell suspension comprising the epithelial stem cells is mechanically generated from the isolated crypts as it was found that at this stage epithelial stem cells treated with trypsin yielded rather low survival rates
Preferred Lgr5 and/or 6 binding compounds comprises antibodies, such as monoclonal antibodies that specifically recognize and bind to the extracellular domain of either Lgr5 or Lgr6, such as monoclonal antibodies including mouse and rat monoclonal antibodies Using such an antibody, Lgr5 and/or Lgr6-expressing stem cells can be isolated, for example with the aid of magnetic beads or through fluorescence-activated cell sorting, as is clear to a skilled person In a preferred method of the invention, said epithelial stem cells are isolated from the crypts, gastric fragments or pancreatic fragments For example, said epithelial stem cells are isolated from crypts that are isolated from the bowel Preferred epithelial stem cells are isolated from the small intestine, including duodenum, jejunum and ileum, pancreas or stomach
Isolated stem cells are preferably cultured in a microenvironment that mimics at least in part a cellular niche in which said stem cells naturally reside Said cellular niche is mimicked by cultuπng said stem cells in the presence of biomateπals, such as matrices, scaffolds, and culture substrates that represent key regulatory signals controlling stem cell fate Said biomateπals comprise natural, semi-synthetic and synthetic biomateπals, and/or mixtures thereof A scaffold provides a two-dimensional or three dimensional network Suitable synthetic materials for said scaffold comprise polymers selected from porous solids, nanofibers, and hydrogels such as, for example, peptides including self-assembling peptides, hydrogels composed of polyethylene glycol phosphate, polyethylene glycol fumarate, polyacrylamide, polyhydroxyethyl methacrylate, polycellulose acetate, and/or co-polymers thereof (see, for example, Saha et al , 2007 Curr Opin Chem Biol 1 1(4) 381-387, Saha et al , 2008 Biophysical Journal 95 4426-4438, Little et al , 2008 Chem Rev 108, 1787-1796) As is known to a skilled person, the mechanical properties such as, for example, the elasticity of the scaffold influences proliferation, differentiation and migration of stem cells A preferred scaffold comprises biodegradable (co)polymers that are replaced by natural occurring components after transplantation in a subject, for example to promote tissue regeneration and/or wound healing It is furthermore preferred that said scaffold does not substantially induce an immunogenic response after transplantation is a subject Said scaffold is supplemented with natural, semi-synthetic or synthetic ligands, which provide the signals that are required for proliferation and/or differentiation, and/or migration of stem cells In a preferred embodiment, said ligands comprise defined amino acid fragments Examples of said synthetic polymers comprise Pluronic® F 127 block copolymer surfactant (BASF), and Ethisorb ® (Johnson and Johnson)
A cellular niche is in part determined by the stem cells and surrounding cells, and the extracellular matrix (ECM) that is produced by the cells in said niche In a preferred method of the invention, isolated crypts or epithelial stem cells are attached to an ECM ECM is composed of a variety of polysaccharides, water, elastin, and glycoproteins, wherein the glycoproteins comprise collagen, entactin (nidogen), fibronectin, and laminin ECM is secreted by connective tissue cells Different types of ECM are known, comprising different compositions including different types of glycoproteins and/or different combination of glycoproteins Said ECM can be provided by culturing ECM-producing cells, such as for example fibroblast cells, in a receptacle, prior to the removal of these cells and the addition of isolated crypts or epithelial stem cells Examples of extracellular matrix-producing cells are chondrocytes, producing mainly collagen and proteoglycans, fibroblast cells, producing mainly type IV collagen, laminin, interstitial procollagens, and fibronectin, and colonic myofibroblasts producing mainly collagens (type I, III, and V), chondroitin sulfate proteoglycan, hyaluronic acid, fibronectin, and tenascin-C Alternatively, said ECM is commercially provided Examples of commercially available extracellular matrices are extracellular matrix proteins (Invitrogen) and Matπgel™ (BD Biosciences) The use of an ECM for culturing stem cells enhanced long-term survival of the stem cells and the continued presence of undifferentiated stem cells In the absence of an ECM, stem cell cultures could not be cultured for longer periods and no continued presence of undifferentiated stem cells was observed In addition, the presence of an ECM allowed culturing of three-dimensional tissue organoids, which could not be cultured in the absence of an ECM
A preferred ECM for use in a method of the invention comprises at least two distinct glycoproteins, such as two different types of collagen or a collagen and laminin Said ECM can be a synthetic hydrogel extracellular matrix or a naturally occurring ECM A most preferred ECM is provided by Matπgel™ (BD Biosciences), which comprises laminin, entactin, and collagen IV
A cell culture medium that is used in a method of the invention comprises any cell culture medium A preferred cell culture medium is a defined synthetic medium that is buffered at a pH of 7 4 (preferably between 7 2 and 7 6 or at least 7 2 and not higher than 7 6) with a carbonate-based buffer, while the cells are cultured in an atmosphere comprising between 5 % and 10% CO2, or at least 5% and not more than 10% CO2, preferably 5 % CO2 A preferred cell culture medium is selected from DMEM/F12 and RPMI 1640 supplemented with glutamine, insulin, Penicillin/streptomycin and transferrin In a further preferred embodiment, Advanced DMEM/F12 or Advanced RPMI is used, which is optimized for serum free culture and already includes insulin In this case, said Advanced DMEM/F12 or Advanced RPMI medium is preferably supplemented with glutamine and Penicillin/streptomycin It is furthermore preferred that said cell culture medium is supplemented with a purified, natural, semi-synthetic and/or synthetic growth factor and does not comprise an undefined component such as fetal bovine serum or fetal calf serum Supplements such as, for example, B27 (Invitrogen), N-Acetylcysteine (Sigma) and N2 (Invitrogen) stimulate proliferation of some cells and can further be added to the medium, if required
A component that is added to the basal culture medium is a BMP inhibitor BMPs bind as a dimeπc ligand to a receptor complex consisting of two different receptor serine/threonine kinases, type I and type II receptors The type II receptor phosphorylates the type I receptor, resulting in the activation of this receptor kinase The type I receptor subsequently phosphorylates specific receptor substrates (SMAD), resulting in a signal transduction pathway leading to transcriptional activity
Said BMP inhibitor is defined as an agent that binds to a BMP molecule to form a complex wherein the BMP activity is neutralized, for example by preventing or inhibiting the binding of the BMP molecule to a BMP receptor Alternatively, said inhibitor is an agent that acts as an antagonist or reverse agonist This type of inhibitor binds with a BMP receptor and prevents binding of a BMP to said receptor An example of a latter agent is an antibody that binds a BMP receptor and prevents binding of BMP to the antibody-bound receptor
Said BMP inhibitor inhibits a BMP-dependent activity in a cell to at most 90%, more preferred at most 80%, more preferred at most 70%, more preferred at most 50%, more preferred at most 30%, more preferred at most 10%, more preferred 0%, relative to a level of a BMP activity in the absence of said inhibitor As is known to a skilled person, a BMP activity can be determined by measuring the transcriptional activity of BMP, for example as exemplified in Zilberberg et al , 2007 BMC Cell Biol 8 41
Several classes of natural BMP-binding proteins are known, including Noggin (Peprotech), Chordin and chordin-like proteins (R&D sytems) comprising chordin domains, Follistatin and follistatin-related proteins (R&D sytems) comprising a follistatin domain, DAN and DAN-like proteins (R&D sytems) comprising a DAN cysteine-knot domain, sclerostin /SOST (R&D sytems), decoπn (R&D sytems), and alpha-2 macroglobulin (R&D systems)
A preferred BMP inhibitor for use in a method of the invention is selected from Noggin, DAN, and DAN-like proteins including Cerberus and Gremlin (R&D sytems) These diffusible proteins are able to bind a BMP ligand with varying degrees of affinity and inhibit their access to signalling receptors The addition of any of these BMP inhibitors to the basal culture medium prevents the loss of stem cells, which otherwise occurs after about 2-3 weeks of culture
A most preferred BMP inhibitor is Noggin Noggin is preferably added to the basal culture medium at a concentration of at least 10 ng/ml, more preferred at least 20 ng/ml, more preferred at least 50 ng/ml, more preferred at least 100 ng/ml A most preferred concentration is approximately 100 ng/ml or 100 ng/ml During cultuπng of stem cells, said BMP inhibitor is preferably added to the culture medium every second day, while the culture medium is refreshed preferably every fourth day
A further component that is added to the basal culture medium is a Wnt agonist
The Wnt signalling pathway is defined by a series of events that occur when a Wnt protein binds to a cell-surface receptor of a Frizzled receptor family member This results in the activation of Dishevelled family proteins which inhibit a complex of proteins that includes axin, GSK-3, and the protein APC to degrade intracellular β- catenin The resulting enriched nuclear β-catenin enhances transcription by TCF/LEF family transcription factors A Wnt agonist is defined as an agent that activates TCF/LEF-mediated transcription in a cell Wnt agonists are therefore selected from true Wnt agonists that bind and activate a Frizzled receptor family member including any and all of the Wnt family proteins, an inhibitor of intracellular β-catenin degradation, and activators of TCF/LEF Said Wnt agonist stimulates a Wnt activity in a cell by at least 10%, more preferred at least 20%, more preferred at least 30%, more preferred at least 50%, more preferred at least 70%, more preferred at least 90%, more preferred at least 100%, relative to a level of said Wnt activity in the absence of said molecule As is known to a skilled person, a Wnt activity can be determined by measuring the transcriptional activity of Wnt, for example by pTOPFLASH and pFOPFLASH Tcf luciferase reporter constructs ( Koπnek et al , 1997 Science 275 1784-1787)
A Wnt agonist comprises a secreted glycoprotein including Wnt- l/Int- 1 , Wnt- 2/Irp (InM -related Protein). Wnt-2b/13, Wnt-3/Int-4, Wnt-3a (R&D sytems), Wnt- 4,Wnt-5a, Wnt-5b, Wnt-6 (Kiπkoshi H et al 2001 Biochem Biophys Res Com 283 798-805),, Wnt-7a (R&D sytems). Wnt-7b, Wnt-8a/8d, Wnt-8b, Wnt-9a/14, Wnt- 9b/14b/15, Wnt- lOa, Wnt-10b/12, WnM l , and Wnt- 16 An overview of human Wnt proteins is provided in "THE WNT FAMILY OF SECRETED PROTEINS", R&D Systems Catalog, 2004 Further Wnt agonists include the R-spondin family of secreted proteins, which is implicated in the activation and regulation of Wnt signaling pathway and which is comprised of 4 members (R-spondin 1 (NU206, Nuvelo, San Carlos, CA), R-spondιn 2 ((R&D sytems), R-spondin 3, and R-spondin-4), and Norrin (also called Nome Disease Protein or NDP) (R&D sytems), which is a secreted regulatory protein that functions like a Wnt protein in that it binds with high affinity to the Fπzzled-4 receptor and induces activation of the Wnt signaling pathway (Kestutis Planutis et al (2007) BMC Cell Biol 8 12) A small-molecule agonist of the Wnt signaling pathway, an aminopyπmidine derivative, was recently identified and is also expressly included as a Wnt agonist (Lm et al (2005) Angew Chem Int Ed Engl 44, 1987-90)
Known GSK-inhibitors comprise small-interfering RNAs (siRNA, Cell
Signaling), lithium (Sigma), kenpaullone (Biomol International, Leost, M et al (2000) Eur J Biochem 267, 5983-5994), 6-Bromoindirubin-30-acetoxime (Meyer, L et al (2003) Chem Biol 10, 1255-1266), SB 216763 and SB 415286 (Sigma-Aldπch), and FRAT-family members and FRAT-deπved peptides that prevent interaction of GSK-3 with axin An overv iew is provided by Meijer et al , (2004) Trends in Pharmacological Sciences 25, 471-480, which is hereby incorporated by reference Methods and assays for determining a level of GSK-3 inhibition are known to a skilled person and comprise, for example, the methods and assay as described in Liao et al 2004, Endocrinology, 145(6) 2941-9)
In a preferred embodiment, said Wnt agonist is selected from one or more of a Wnt family member, R-spondin 1-4, Norrin, and a GSK-inhibitor It was found by the inventors that the addition of at least one Wnt agonists to the basal culture medium is essential for proliferation of the epithelial stem cells or isolated crypts
In a further preferred embodiment, said Wnt agonist comprises or consists of R- spondin 1 R-spondin 1 is preferably added to the basal culture medium at a concentration of at least 50 ng/ml, more preferred at least 100 ng/ml, more preferred at least 200 ng/ml, more preferred at least 300 ng/ml, more preferred at least 500 ng/ml A most preferred concentration of R-spondin 1 is approximately 500 ng/ml or 500 ng/ml During cultuπng of stem cells, said Wnt family member is preferably added to the culture medium every second day, while the culture medium is refreshed preferably every fourth day
In a preferred embodiment, a Wnt agonist is selected from the group consisting of R-spondin, Wnt-3a and Wnt-6 More preferably, R-spondin and Wnt-3a are both used as Wnt agonist This combination is particularly preferred since this combination surprisingly has a synergetic effect on organoid formation Preferred concentrations are approximately 500 ng/ml or 500 ng/ml for R-spondin and approximately 100 ng/ml or 100 ng/ml for Wnt3a
Yet a further component that is added to the basal culture medium is a mitogenic growth factor selected from a family of growth factors comprising epidermal growth factor (EGF, (Peprotech), Transforming Growth Factor-alpha (TGF-alpha, Peprotech), basic Fibroblast Growth Factor (bFGF, Peprotech), brain-derived neurotrophic factor (BDNF, R&D Systems), and Keratinocyte Growth Factor (KGF, Peprotech) EGF is a potent mitogenic factor for a variety of cultured ectodermal and mesodermal cells and has a profound effect on the differentiation of specific cells in vivo and in vitro and of some fibroblasts in cell culture The EGF precursor exists as a membrane-bound molecule which is proteolytically cleaved to generate the 53-amino acid peptide hormone that stimulates cells A preferred mitogenic growth factor is EGF EGF is preferably added to the basal culture medium at a concentration of between 5 and 500 ng/ml or of at least 5 and not higher than 500 ng/ml A preferred concentration is at least 10, 20, 25, 30, 40, 45, or 50 ng/ml and not higher than 500, 450, 400, 350, 300, 250, 200, 150, or 100 ng/ml A more preferred concentration is at least 50 and not higher than 100 ng/ml An even more preferred concentration is about 50 ng/ml or 50 ng/ml The same concentrations could be used for a FGF, preferably for FGFlO or FG F7 If more than one FGF is used, for example FG F7 and FGFlO, the concentration of a FGF is as defined above and refers to the total concentration of FGF used During cultuπng of stem cells, said mitogenic growth factor is preferably added to the culture medium every second day, while the culture medium is refreshed preferably every fourth day Any member of the bFGF family may be used Preferably, FGF7 and/or FGFlO is used FGF7 is also known as KGF (Keratinocyte Growth Factor) In a further preferred embodiment, a combination of mitogenic growth factors such as, for example, EGF and KGF, or EGF and BDNF, is added to the basal culture medium In a further preferred embodiment, a combination of mitogenic growth factors such as, for example, EGF and KGF, or EGF and FGFlO, is added to the basal culture medium
A further embodiment of a method according to the invention comprises a culture medium comprising a Rock (Rho-kinase) inhibitor The addition of a Rock inhibitor was found to prevent anoikis, especially when cultering single stem cells Said Rock inhibitor is preferably selected from R)-(+)-trans-4-( l-aminoethyl)-N-(4- Pyπdyl)cyclohexanecarboxamide dihydrochloride monohydrate (Y-27632, Sigma- Aldπch), 5-( l ,4-diazepan- l-ylsulfonyl)isoquinoline (fasudil or HA1077, Cayman Chemical), and (S)-(+)-2-methyl- l-[(4-methyl-5-isoquinolinyl)sulfonyl] -hexahydro- l H- l ,4-diazepine dihydrochloride (H- 1 152, Tocris Bioschience) Said Rho-kinase inhibitor, for example Y-27632, is preferably added to the culture medium every second day during the first seven days of culturing said stem cells A preferred concentration for Y27632 is 10 DM In yet a further embodiment, a method according to the invention comprises a culture medium further comprising a Notch agonist Notch signaling has been shown to play an important role in cell-fate determination, as well as in cell survival and proliferation. Notch receptor proteins can interact with a number of surface-bound or secreted ligands, including but not limited to Delta 1 , Jagged 1 and 2, and Delta-like 1, Delta-like 3, Delta-like 4. Upon ligand binding, Notch receptors are activated by serial cleavage events involving members of the ADAM protease family, as well as an intramembranous cleavage regulated by the gamma secretase presinilin The resultant is a translocation of the intracellular domain of Notch to the nucleus where it transcriptionally activates downstream genes. A preferred Notch agonist is selected from Jagged 1 and Delta 1 , or an active fragment or derivative thereof. A most preferred Notch agonist is DSL peptide (Dontu et al., 2004. Breast Cancer Res 6. R605-R615). with the sequence CDDYYYGFGCNKFCRPR Said DSL peptide (ANA spec) is preferably used at a concentration between 10 μM and 100 nM or at least 10 μM and not higher than 100 nM The addition of a Notch agonist, especially during the first week of cultuπng, increases the culture efficiency by a factor of 2-3. Said Notch agonist is preferably added to the culture medium every second day during the first seven days of culturing said stem cells
A Notch agonist is defined as a molecule that stimulates a Notch activity in a cell by at least 10%, more preferred at least 20%, more preferred at least 30%, more preferred at least 50%, more preferred at least 70%, more preferred at least 90%, more preferred at least 100%, relative to a level of a Notch activity in the absence of said molecule. As is known to a skilled person, a Notch activity can be determined by measuring the transcriptional activity of Notch, for example by a 4xwtCBFl-luciferase reporter construct as described (Hsieh et al , 1996 MoI Cell. Biol. 16, 952-959)
The invention further provides a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, a Wnt agonist; and between 5 and 500 nanogram/ml or at least 5 and not more than 500 nanogram/ml of a mitogenic growth factor selected from the group consisting of EGF, TGFD , KGF, FGFlO and a FGF. Preferably, a mitogenic factor is selected from the groups consisting of EGF, TGF-D and KGF or from EGF, TGF-D and FGF7 or from EGF, TGF-D and FGF or from EGF and KGF or from EGF and FGF7 or from EGF and a FGF or from TGFD and KGF or from TGFD and FGF7 or from TGFD and a FGF EGF may be replaced by TGFD Several preferred culture media are later on identified depending on the organoid to be obtained A cell culture medium according to the invention allows the survival and/or proliferation and/or differentiation of epithelial stem cells or isolated crypts on an extracellular matrix The term cell culture medium is synonymous with medium, culture medium or cell medium
In a preferred method according to the invention, a first culture medium comprises Noggin as BMP inhibitor, both Epidermal Growth Factor and Keratinocyte Growth Factor as mitogenic growth factors, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein KGF could be replaced by a FGF, or by FGFlO [Leul5]-Gastπn I, Exendin and/or Nicotinamide may also be added to this first medium
In another preferred embodiment, said culture medium, called a second culture medium is identical as said first medium except that there is no Noggin and preferably no [Leul5]-Gastπn I, Exendin and/or Nicotinamide Said second culture medium therefore comprises both Epidermal Growth Factor and Keratinocyte Growth Factor as mitogenic growth factors, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein KGF could also be replaced by a FGF, or by FGFlO These two cell culture media support pancreatic fragments comprising pancreatic stem cells that are grown in these media in a Matπgel extracellular matrix to form pancreatic organoids comprising pancreatic islet-like structures on an extracellular matrix The second medium without Noggin is a minimum medium whereas the first one with Noggin leads to an improved medium for expanding pancreatic fragments An expanding medium is a medium which preferably promote survival and/or proliferation of cells during at least two days of culture
A third medium has been designed which is able to promote, induce the differentiation of cells towards a pancreatic organoids within at least 5 days One preferred differentiation marker towards the formation of a pancreatic organoid is Neurogenin-3 whose expression could be detected by RT-PCR or by immunohistochemistry A differentiation medium as for example a third or fourth medium is said to be functional when Neurogenin-3 could be detected by RT-PCR or by immunohistochemistry after at least five days of culture in said medium This differentiation step is preferably carried out after a first expanding step in a medium as the first or second medium as defined above This third medium is identical with the second medium identified above except that there is no FGF or KGF or FGFlO This third medium comprises Epidermal Growth Factor and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N- Acetylcystein A fourth medium has been designed that is identical with said first medium wherein said fourth medium is also supplemented with [Leul5]-Gastπn I and/or Exendin Said third medium is a minimal differentiation medium, whereas said fourth medium is an improved differentiation medium A differentiation medium is a medium which preferably induces or promotes a specific differentiation of cells during at least five days of culture In the case of pancreatic organoid, differentiation may be measured by detecting the presence of a specific marker associated with the pancreatic lineage as defined earlier herein Examples of other markers associated with the pancreatic lineage include the secretion of insulin which is detectable by RTPCR or immunohistrochemistry after at least 7, 8, 9, 10 days of culture in a differentiation medium Therefore in a preferred method for obtaining and/or cultuπng a pancreatic organoid, epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in a first step either in the first or second medium, subsequently in a second step either in the third or fourth medium The first step may have a duration of at least two weeks and may be longer A first step may be carried out for more than 1 , 2, 3, 4, 5, 6, 7, 8, 9, or more than 10 months The second step may have a duration of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16 days or longer Each step is preferably carried out using an extracellular matrix as defined herein Preferred concentrations of each compound present in each medium have already been defined herein in the description or in the examples In a preferred embodiment, if a pancreatic organoid is to be used for regenerative medicine, one starts from epithelial cells or from an isolated pancreatic fragment In another preferred embodiment, if a pancreatic organoid is to be used as a drug discovery system, one starts from adenoma Accordingly, a pancreatic organoid obtainable by a method of the invention is a further aspect of the invention Accordingly, in a further aspect, the invention provides a first, second, third, fourth medium as defined herein
To the best of our knowledge, this is the first time that a pancreatic organoid had been obtained that is functional and alive after at least ten month of culture (see experimental part) Functionality is preferably characterized by the secretion of insulin Since the final amount of pancreas organoids obtained correlates with the duration of culture, the skilled person understands that the invention is a pioneer invention and potentially opens new possibilities in for example regenerative medicine
Accordingly, in a preferred method for obtaining and/or cultuπng a pancreatic organoid, epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellularmatπx in a first step in a medium comprising EGF, KGF or FGF, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein , subsequently in a second step in a medium comprising EGF and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein
In a further preferred method according to the invention, a culture medium comprises Noggin as BMP inhibitor. Epidermal Growth Factor as mitogenic growth factor, R-spondin 1 and/or Wnt3a as Wnt agonist This cell culture medium supports cultuπng of isolated small intestinal crypts in 3 dimensional cultures comprising Matπgel as extracellular matrix
In a further preferred method according to the invention, a culture medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor as mitogenic growth factor, R-spondin 1 as Wnt agonist, Jagged-DSL peptide as Notch agonist and the Rho kinase inhibitor Y-27632 This cell culture medium supports cultuπng of isolated single epithelial stem cells in 3 dimensional cultures comprising Matπgel as extracellular matrix
In yet a further preferred method according to the invention, a culture medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor and/or BDNF as mitogenic growth factors, R-spondin 1 and/or Wnt-3a as Wnt agonists, supplemented with at least one of B27, N2 and N-Acetylcystein Wnt-3a is a preferred Wnt agonist in this preferred method This cell culture medium supports cultuπng of isolated colon crypts Ui 3 dimensional cultures comprising Matπgel as extracellular matrix This medium is able to promote survival and/or proliferation and/or differentiation of cells during at least two days of culture A preferred differentiation marker towards the formation of a colon crypt may be selected from the following group alkaline phosphatise indicating the presence of enterocyte, Muc2 indicating the presente of goblet cells and Neurogenic 3 or Chromogranin indicating the presence of endocrine cells The expression of each of these markers could be detected by RTPCR or by immunohistochemistry A medium functional for promoting survival and/or proliferation and/or differentiation of cells for obtaining a colon crypt is such that at least one of the identified markers could be detected after at least 2, 3, 4, 5, 6, 7, 8, 9, 10 days of culture of longer A preferred medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor as mitogenic growth factor, and R-spondin 1 and/or Wnt-3a as Wnt agonists, supplemented with at least one of B27, N2 and N-Acetylcystein This medium is called the firth medium of the invention which represents a further aspect of the invention
Therefore in a preferred method for obtaining and/or cultuπng a colon crypt, epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in a medium as identified abve, preferably the fifth medium This method is preferably carried out using an extracellular matrix as defined herein Preferred concentrations of each compound present in said medium have already been defined herein in the description or in the examples Accordingly, a colon crypt obtainable by a method of the invention is a further aspect of the invention To the best of our knowledge, this is the first time that a colon crypt had been obtained that is functional and alive after at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12 month of culture (see experimental part) Functionality is preferably characterized by the presence of at least one of the markers as identified above The invention is a pioneer invention and potentially opens new possibilities in for example regenerative medicine
Accordingly, in a preferred method for obtaining and/or cultuπng a colon crypt, epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellular matrix in a medium comprising Noggin, EGF, and R-spondin 1 and/or Wnt-3 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein
In yet a further preferred method according to the invention, a culture medium comprises Noggin as BMP inhibitor, Epidermal Growth Factor as mitogenic growth factor, R-spondin las Wnt agonist, supplemented with either Wnt-3a or KGF, and further comprising B27, N2, N-Acetylcystein This medium is called the sixth medium and represents accordingly a further aspect of the invention KGF may be replaced by a FGF or by FGFlO This medium preferably comprises Noggin as BMP inhibitor, Epidermal Growth Factor and FGFlO as mitogenic growth factor, R-spondin 1 and Wnt-3a as Wnt agonist, and further comprising B27, N2, N-Acetylcystein FGFlO is preferred as a FGF since it gives better results than for example FGF7 (figure 32) This cell culture medium supports culturing of isolated gastric fragments or gastric organoid in 3 dimensional cultures comprising Matπgel as extracellular matrix This sixth medium is a medium for expanding a gastric fragment An expanding medium is a medium which preferably promote survival and/or proliferation of cells during at least two days of culture An additional medium, i e a seventh medium has been designed which is able to promote, induce the differentiation of cells towards a gastric organoid or gastric fragment within at least 2 days This seventh medium is identical to the sixth medium identified above except that the concentration of Wnt-3a is reduced compared to the one present in the sixth medium The concentration is reduced of at least 25%, 50%, 100%, 200%, 300%, 400%, 500%, 600% or more by comparison to the Wnt-3a concentration present in the sixth medium This seventh medium comprises Epidermal Growth Factor and R-spondin 1 and Wnt-3a as Wnt agonist, Noggin and FGFlO supplemented with B27, N2, N-Acetylcystein and Gastrin Gastrin is preferably used at a concentration of 1 nM
Said seventh medium is a differentiation medium A differentiation medium is a medium which preferably induces or promotes a specific differentiation of cells during at least two, 3, 4, 5, 6, 7, 8, 9, 10 days of culture or longer In the case of a gastric organoid or gastric fragment, differentiation may be measured by detecting the presence of a specific marker associated with the gastric lineage Examples of markers associated with the gastric lineage include MUC5AC (a pit cell marker), GASTRIN and/or SOMATOSTATIN (both, endocrine cell markers) The presence of at least one of said markers is preferably carried out using RT-PCR and/or immunohistochemistry or immunofluorescence The presence of at least one of these markers is preferably detectable after at least 6 days in the differentiation conditions, more preferably at least 10 days A differentiation medium as for example a seventh medium is said to be functional when at least one of the above-identified markers could be detected by RT- PCR or by immunohistochemistry after at least six days of culture in said medium This differentiation step is preferably carried out after a first expanding step in a medium as the sixth medium as defined above Therefore in a preferred method for obtaining and/or cultuπng a gastric fragment, epithelial stem cells isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in a first step either in the sixth medium, subsequently in a second step either in the seventh medium Each step is preferably carried out using an extracellular matrix as defined herein The first step may have a duration of at least 3 days and may be longer A first step may be carried out for more than 3, 4, 5, 6, 7, 8, 9, or more The second step may have a duration of 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15. 16 days or longer Preferred concentrations of each compound present in each medium have already been defined herein in the description or in the examples Accordingly, a gastric fragment obtainable by a method of the invention is a further aspect of the invention
Accordingly, in a preferred method for obtaining and/or cultuπng a gastric fragment , epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellularmatrix in a first step in a medium comprising Noggin as BMP inhibitor, Epidermal Growth Factor and FGFlO as mitogenic growth factor, R-spondin 1 and Wnt-3a as Wnt agonist, and further comprising B27, N2, N-Acetylcystein, subsequently in a second step in a medium comprising Epidermal Growth Factor and R-spondin 1 and Wnt-3a as Wnt agonist, Noggin and FGFlO supplemented with B27, N2, and N-Acetylcystein, wherein the concentration of Wnt-3 is reduced in the second step by comparison to the Wnt-3a concentration as present in the first step In yet a further preferred method according to the invention, a culture medium comprises Noggin as BMP inhibitor and Epidermal Growth Factor as mitogenic growth factor This cell culture medium supports cultuπng of isolated adenoma fragments or isolated single adenoma cells in 3 dimensional cultures comprising Matπgel as extracellular matrix
A ligand, such as for example Wnt3a, can be freshly added to a culture medium Alternatively, a ligand is expressed in a cell line by transfecting or infected a cell line with a suitable expression construct expressing said ligand Said cell line is cultured and the culture medium comprising the secreted ligand is harvested at suitable time intervals For example, cells will produce Wnt3a as soon as they reach confluency and stop growing Culture medium from cells that were not transfected or infected with said expression construct is used as a control The conditioned medium is harvested and tested, for example in an assay wherein luciferase expression in controlled by TCF responsive elements to test for the presence of a Wnt agonist such as Wnt3a (Koπnek et al , 1997 Science 275 1784-1787) The medium is diluted when used in the cultures to regenerate tissue As is known to the skilled person, the addition of an excess of ligand sometimes is as detrimental for the culture as is the addition of too little ligand Therefore, the actual dilution of the conditioned medium will depend on the amount of ligand that is determined in the test
The invention further provides the use of a culture medium according to the invention for cultuπng epithelial stem cells or isolated organoid structures that comprise these stem cells on an extracellular matrix, whereby said stem cells preferably do not comprise human embryonic stem cells Preferred are human adult stem cells Furthermore, single sorted epithelial stem cells from the small intestine, colon, and stomach are also able to initiate these 3 dimensional organoids in a culture medium according to the invention The invention further provides the use of a culture medium according to the invention for cultuπng pancreatic fragments comprising stem cells that form pancreatic organoids comprising pancreatic island-like structures
It is preferred that said stem cells are pancreas, stomach, intestinal or colonic epithelial stem cells, whereby most preferred stem cells are small intestinal stem cells A culture medium according to the invention allowed the establishment of long-term culture conditions under which single crypts undergo multiple crypt fission events, while simultanously generating villus-like epithelial domains in which all differentiated cell types are present Using a culture method according to the invention allowed culture periods of at least seven months, at least eight months, at least nine months, at least ten months
Cultured crypts undergo dramatic morphological changes after taking them into culture The upper opening of freshly isolated crypts becomes sealed and this region gradually balloons out and becomes filled with apoptotic cells, much like apoptotic cells are pinched off at the villus tip The crypt region was found to undergo continuous budding events which create additional crypts, a process reminiscent of crypt fission The crypt-like extensions comprise all differentiated epithelial cell types, including proliferative cells, Paneth cells, enterocytes and goblet cells No myofibroblasts or other non-epithelial cells were identified in the organoids at any stage
Expansion of the budding crypt structures created organoids, comprising >40 crypt-like structures surrounding a central lumen lined by a villus-like epithelium and filled with apoptotic cell bodies The crypt-villus organoids comprise a central lumen lined by a villus-like epithelium The lumen is opened at consecutive time intervals to release the content into the medium The organoids can be passaged and maintained in culture for at least 6 months without losing the essential characteristics Passaging preferably involves manual fragmentation of organoids
A similar crypt-villus organoid structure is formed when single epithelial stem cells are cultured After about one week, structures are formed that strongly resemble the crypt-villus organoid structures that are obtained with intact crypts Histological analysis of these organoids also revealed the preservation of the basic crypt-villus architecture, the presence of all differentiated cell types, and the absence of non- epithelial elements
In one aspect, the invention therefore provides crypt-villus organoids, comprising a central lumen lined by a villus-like epithelium that result from cultuπng of epithelial stem cells or isolated crypts in a culture medium of the invention Preferably, said crypt-villus organoid is obtainable using a method of the invention
In a further aspect, the invention provides pancreatic organoids generated or obtainable by culturing pancreatic fragments according to a method of the invention
Approximately 20% of the pancreatic organoids form a budding structure 7 days after the start of the culture The pancreatic ducts rapidly proliferate, in contrast to the acinar tissue, which only grows very slowly After passaging of the pancreatic organoids, pancreatic islet-like structures that secrete insulin are observed which resemble the pancreatic islets of Langerhans that are present in healthy pancreas tissue The invention further provides a gastric organoid comprising a central lumen Preferably said gastric organoid is obtainable by a method of the invention
Further growth factors that may be added to a culture medium, for example to increase the presence of pancreatic islets in the organoids or to further support the culturing of isolated fragments such as gastric fragments, comprise cyclopamine (Sonic-hedgehog inhibitor, Tocris Bioscience), Activin, GLP (Glucagon like peptide) and its derivative (Exendin 4, California Peptide Research), gastrin (Genscπpt), a Notch agonist (Jagged peptide, Ana Spec), Nicotinamide and a Wnt agonist such as Wnt-3a Wnt-3a is attractive to be used when one starts culture with a single cell
The invention further provides a collection of crypt-villus, gastric or pancreatic organoids, each comprising more than 10, preferably more than 20, more preferably more than 40 organoids The crypt-villus organoids surround a central lumen lined by a villus-like epithelium The lumen is filled with apoptotic cell bodies The cells in the crypt-villus organoids are polarized, with stem cells residing in the basis of the structures The top of the crypt-like structures comprise apoptotic cells that are shed into the lumen Said collection of crypt-villus organoids preferably comprises at least 10% viable cells, more preferred at least 20% viable cells, more preferred at least 50% viable cells, more preferred at least 60% viable cells, more preferred at least 70% viable cells, more preferred at least 80% viable cells, more preferred at least 90% viable cells Viability of cells may be assessed using Hoechst staining or Propidium Iodide staining in FACS In a further aspect, the invention provides the use of the crypt-villus organoids, gastric organoids or pancreatic organoids according to the invention in a drug discovery screen, toxicity assay or in regenerative medicine
For high-throughput purposes, said crypt-villus, gastric or pancreatic organoids are cultured in multiwell plates such as. for example, 96 well plates or 384 well plates Libraries of molecules are used to identify a molecule that affects said organoids Preferred libraries comprise antibody fragment libraries, peptide phage display libraries, peptide libraries (e g LOPAP™, Sigma Aldπch), lipid libraries (BioMol), synthetic compound libraries (e g LOP AC™, Sigma Aldπch) or natural compound libraries (Specs, TimTec) Furthermore, genetic libraries can be used that induce or repress the expression of one of more genes in the progeny of the adenoma cells These genetic libraries comprise cDNA libraries, antisense libraries, and siRNA or other non- coding RNA libraries The cells are preferably exposed to multiple concentrations of a test agent for certain period of time At the end of the exposure period, the cultures are evaluated The term "affecting" is used to cover any change in a cell, including, but not limited to, a reduction in, or loss of, proliferation, a morphological change, and cell death Said crypt-villus, gastric or pancreatic organoids can also be used to identify drugs that specifically target epithelial carcinoma cells, but not said crypt-villus, gastric or pancreatic organoids
Said crypt-villus, gastric or pancreatic organoids can further replace the use of cell lines such as Caco-2 cells in toxicity assays of potential novel drugs or of known or novel food supplements
Furthermore, said crypt-villus, gastric or pancreatic organoids can be used for cultuπng of a pathogen such as a norovirus which presently lacks a suitable tissue culture or animal model
Cultures comprising crypt-villus organoids are useful in regenerative medicine, for example in post-radiation and/or post-surgery repair of the intestinal epithelium, in the repair of the intestinal epithelium in patients suffering from inflammatory bowel disease such as Crohn's disease and ulcerative colitis, and in the repair of the intestinal epithelium in patients suffering from short bowel syndrome Further use is present in the repair of the intestinal epithelium in patients with hereditary diseases of the small intestine/colon Cultures comprising pancreatic organoids are also useful in regenerative medicine, for example as implants after resection of the pancreas or part thereof and for treatment of diabetes such as diabetes I and diabetes II
In an alternative embodiment, the expanded epithelial stem cells are reprogrammed into related tissue fates such as, for example, pancreatic cells including pancreatic β-cells, and liver cells Thus far, it has not been possible to regenerate pancreatic cells or liver stem, from adult stem cells The culturing methods of the present invention will enable to analyse for factors that trans-differentiate the closely related epithelial stem cell to a pancreatic cell, including a pancreatic β-cell, and a liver cell
It will be clear to a skilled person that gene therapy can additionally be used in a method directed at repairing damaged or diseased tissue Use can, for example, be made of an adenoviral or retroviral gene delivery vehicle to deliver genetic information, like DNA and/or RNA to stem cells A skilled person can replace or repair particular genes targeted in gene therapy For example, a normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene In another example, an abnormal gene sequence can be replaced for a normal gene sequence through homologous recombination Alternatively, selective reverse mutation can return a gene to its normal function A further example is altering the regulation (the degree to which a gene is turned on or off) of a particular gene Preferably, the stem cells are ex vivo treated by a gene therapy approach and are subsequently transferred to the mammal, preferably a human being in need of treatment
In another aspect, the invention provides a method for culturing an epithelial adenoma cell, comprising providing an extracellular matrix, attaching an epithelial adenoma cell to the extracellular matrix, culturing the cell in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, and between 5 and 500 ngram/ml or at least 5 and not more than 500 ngram/ml of a mitogenic growth factor selected from EGF, TGF-alpha and KGF KGF may be replaced by a FGF or FGFlO
An epithelial colon adenoma cell comprises an alteration in a gene coding for APC protein, which results in less efficient degradation of intracellular β-catenin by a complex of proteins comprising APC Other mutations common in colon adenomas comprise mutations in β-catenin or Axin2 The overall result is enhanced TCF/LEF signalling because of an increased amount of β-catenin in the nucleus A culture medium without a Wnt agonist was found to be sufficient for proliferation of adenoma cells
Said adenoma cell can be isolated from epithelial adenoma by methods known in the art, comprising the use of dissociating agents such as EDTA Alternatively, single Lgr5- or Lgr-6- positive adenoma cells can be isolated from the adenoma by using a Lgr5-binding compound, followed by magnetic beads or FACS analyses
The invention further provides progeny of an epithelial adenoma cell that was cultured in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor and between 5 and 500 ngram/ml or at least 5 and not more than 500 ngram/ml of Epidermal Growth Factor (EGF) The cultured adenoma cells are not able to develop a polarized three-dimensional structure such as a crypt-villus-like architecture Rather, adenoma cells form balloon-like structures in which cells are randomly oriented towards either the periphery or the central lumen There is no sign of differentiation into other epithelial cell types This result indicates a role for APC in the three-dimension organization of the crypt-villus-like architecture
In addition, the invention provides the use of the progeny of the adenoma cells for a targeted drug discovery screen to identify a drug that specifically affects adenoma cells compared to expanded normal epithelial cells that are cultured in the same culture medium For high-throughput purposes, the progeny of adenoma cells is cultured in multiwell plates such as, for example, 96 well plates or 384 well plates Libraries of molecules are used to identify a molecule that affects said progeny Preferred libraries comprise antibody fragment libraries, peptide phage display libraries, peptide libraries (e g LOPAP™, Sigma Aldπch), lipid libraries (BioMol), synthetic compound libraries (e g LOP AC™, Sigma Aldπch) or natural compound libraries (Specs, TimTec) Furthermore, genetic libraries can be used that induce or repress the expression of one of more genes in the progeny of the adenoma cells These genetic libraries comprise cDNA libraries, antisense libraries, and siRNA or other non-coding RNA libraries A compound that affects adenoma cells is subsequently, or in parallel, tested for affecting expanded normal epithelial cells The term "affecting" is used to cover any change in a cell, including a reduction in, or loss of, proliferation, a morphological change, and cell death Said progeny can also be used to identify drugs that specifically target epithelial carcinoma cells, compared to epithelial adenoma cells, including reversion of the carcinoma cells
It will be clear that said progeny can also be used in a high throughput approach for the determination of in vitro metabolic stability and metabolic profiles of drug candidates
The invention furthermore provides the use of the progeny of adenoma cells according to the invention, of pancreatic organoids, of gastric organoids and of crypt- villus organoids of the invention, in toxicity assays Said progeny and crypt-villus organoids are easy to culture and more closely resemble primary epithelial cells than, for example, epithelial cell lines such as Caco-2 (ATCC HTB-37), 1-407 (ATCC CCL6), and XBF (ATCC CRL 8808) which are currently used in toxicity assays It is anticipated that toxicity results obtained with primary adenoma cultures or with crypt- villus organoids more closely resemble results obtained in patients A cell-based toxicity test is used for determining organ specific cytotoxicity Compounds that are tested in said test comprise cancer chemopreventive agents, environmental chemicals, food supplements, and potential toxicants The cells are exposed to multiple concentrations of a test agent for certain period of time The concentration ranges for test agents in the assay are determined in a preliminary assay using an exposure of five days and log dilutions from the highest soluble concentration At the end of the exposure period, the cultures are evaluated for inhibition of growth Data are analyzed to determine the concentration that inhibited end point by 50 percent (TC50) In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded In addition the verb "to consist" may be replaced by "to consist essentially of meaning that a product as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention In addition a method as defined herein may comprise additional step(s) than the ones specifically identified, said additional step(s) not altering the unique characteristic of the invention In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements The indefinite article "a" or "an" thus usually means "at least one" The word "about" or "approximately" when used in association with a numerical value (about 10) preferably means that the value may be the given value of 10 more or less 1 % of the value
All patent and literature references cited in the present specification are hereby incorporated by reference in then" entirety
The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way
Description of Figures
Figure 1 Growth factor requirement of crypt culture a 500 crypts were seeded with EGF (E, 0-50 ng/ml) and R-spondin 1 (R 0-500 ng/ml) in triplicate, crypt organoids were counted 7 days after seeding b 500 Crypts/crypt organoids were cultured with EGF (50 ng/ml) and R-spondin 1 (500 ng/ml) with the indicated amounts of Noggin and followed for 3 passages Crypt organoids were counted at each passage The experiment was repeated three times with comparable results
Figure 2 Establishment of intestinal crypt culture system a Time course of an isolated single crypt growing into an organoid Differential interference contrast image reveals granule-containing Paneth cells at crypt bottoms (arrows) b, c Single isolated crypts efficiently form crypt organoids Through repeated crypt fission, the structures generate numerous octopus-like crypt organoids at day 14 d 3D reconstructed confocal image of a single organoid after a 3 week culture Lgr5- GFP+ stem cells (light grey) are localized at the tip of crypt-like domains Counterstaining for DNA ToPro-3 (dark grey) e Schematic representation of a crypt organoid The organoid consists of a central lumen lined by villus-like epithelium and a number of surrounding crypt-like domains Dark grey cells at the tip of the crypt domain indicates the position of Lgr5+ stem cells, which are present in each crypt domain Scale bar indicates 50 μm
Figure 3 Cluster analysis of gene expression profiling Cluster analysis of expression levels using freshly isolated colonic and small intestinal crypts as well as small intestinal organoids showed high degree of similarity between small intestinal organoids and the tissue they were derived from, small intestinal crypts Colonic crypts clustered on a separate branch, indicating a different gene expression pattern of this closely related tissue Of note, only 1 2% of all genes expressed were significantly enriched in organoids relative to small intestinal crypts, while -wee \ersa- 2% were enriched in small intestinal crypts Ingenuity Pathway analysis on these differential genes revealed the specific presence of a lymphocyte signature in freshly isolated crypts, while no significant pathway could be identified in the small number of genes enriched in the organoids (not shown) We conclude that the latter group represents biological noise, while the lymphocyte signature derives from contaminating intraepithelial immune cells, lost upon culture
Figure 4 Crypt organoids preserve basic crypt-villus characteristics a-e The Wnt activation code is preserved in crypt domains a Nuclear β-catenin (dark grey, arrows) was only seen in crypt domains Higher resolution image in Fig 5 Asterisk, matπgel, Lu, lumen b EphB2 (light grey) is expressed in a gradient on CBC cells and TA cells Note Lgr5-GFP+ stem cells as indicated by white arrow c Caspase- 3+ apoptotic cells (dark grey, arrows) shedding into the central lumen lined by enterocytes d 40 chromosomes in a spread of cells from a > 3 months old crypt culture e-g Lineage tracing of Lgr5+ stem cells in \ itro e Crypts from Lgr5-EGFP-ιres- CreERT2/Rosa26-\acZ reporter mice were stimulated by tamoxifen in \ itro for 12 hr, and cultured for the indicated days LacZ staining (dark grey) shows that scattered single LacZ+ cells (day 1) generated entire LacZ+ crypts in \ itro (Day2- 14) Insets show higher magnification of stained crypt organoids f Histological analysis shows an entire LacZ+ crypt-domain (dark grey/black) feeds into the villus domain g The percentage of crypt organoids with LacZ+ cells remained steady over time, indicating that Lgr5+ cells possess long-term stem cell activity 500 crypts were seeded in triplicate, and LacZ+ crypt organoids were counted Error bars are standard deviation of triplicates The experiment was repeated three times with similar results
Figure 5 Higher resolution image of Fig 4a, Fig 1 I m and 1 Ip
Figure 6 No evidence of subepithelial fibroblasts in crypt organoids a Immunostaining for smooth muscle actin (SMA, dark grey, examples indicated by black arrows) demonstrates the presence of subepithelial fibroblasts beneath the epithelial layer b Absence of SMA+ cells in matπgel (asterisk) indicates the absence of subepithelial fibroblasts in the culture system Scale bar, 50 μm
Figure 7 a-c A crypt from an Lgr5-EGFP-ιres-CreERT2/Rosa26-YFP reporter mouse was stimulated by tamoxifen in vitro for 12 hr, and imaged for the indicated days Lgr5+ cells are light grey and indicated by the white arrows d Seven-day-old organoids derived from an Lgr5-EGFP-ιres-CreERT2/Rosa26-YFP crypts were stimulated by tamoxifen in vitro for 12 hr, and cultured and imaged for the indicated days. YFP fluorescence (light grey) shows that scattered single YFP+ cells (day 1 ) generated multiple offspring in vitro over the next five days. The villus domain burst during Dayl-1 5, following by new villus domain formation (white circle) Note that YFP+ cells are migrating toward villus domain
Figure 8. Single sorted Lgr5+ stem cells generate entire crypt-villus structures. a'
Lgr5-GFP+ cells prepared from an Lgr5-EGFP-ιres-CreERT2 intestine (bottom) compared to wild-type littermate (top) GFP+ cells were divided into two populations; GFP11' and GFP10* b: Confocal microscopic analysis of a freshly isolated crypt shows GFPhl in CBC cells (black arrowheads) and GFPlow above CBC (white arrowheads) c Sorted GFPhl cells, d: 1000 sorted GFPhl cells (left) and GFP'0W cells (right) after 14 day culture e-f: Fourteen days after sorting, single GFPhl cells form crypt organoids, with Lgr5-GFP+ cells (light grey cells) and Paneth cells (white arrows) located at crypt bottoms Scale bar, 50 μm. f: Higher magnification of crypt bottom in e g To visualize proliferating cells, the organoids were cultured with the thymidine analog EdU (light grey, examples indicated by white arrows) for 1 hr, after which they were fixed Note that only crypt domains incorporated EdU Counterstain: DAPI (dark grey)
Figure 9 a: Colony-forming efficiency of single cells sorted in individual wells The average is given for 4 individual experiments, of which in each experiment 100 cells were visually verified and then followed for growth, b: An example of a successfully growing single GFP111 cell, c: Numbers of cells per single organoid averaged for 5 growing organoids d: Single cell suspension derived from a single-cell-deπved- organoid was replated and grown for 2 weeks
Figure 10. Colony-forming potency of a single cell sorted in an individual well. An example of a successfully growing single GFP ' cell. The arrows point to a dust particle as a landmark Scale bar: 50 μm
Figure 1 1. Composition of single stem cell-derived organoids, a-d Three dimensional reconstructed confocal image for a: Villin in light grey (apex of enterocytes lining central lumen) b: Muc2 staining indicated by white arrows (goblet cells), c lysozyme in light grey (Paneth cells), d: Chromogranin A in light grey (enteroendocπne cells). Nucleus was counterstained with DAPI. e-g: Paraffin section staining e: Alkaline phosphatase in black (apex of enterocytes lining central lumen) f. PAS in dark grey (goblet cells), g lysozyme in dark grey (Paneth cells), h: Synaptophysin in dark grey (enteroendocπne cells). i-p: Electron microscopy sections of crypt organoids demonstrates the presence of enterocytes (i), goblet cells (j), Paneth cells (k) and enteroendocπne cells (1) m/o Low power crypt image illustrates absence of stromal cells, n-o Higher magnification of m. n: Maturation of brush border towards the luminal compartment of the organoid, as indicated by the difference of length of microvilli (black arrows), p: Low power image of villus domain Lu, lumen of crypt organoid filled with apoptotic bodies and lined by polarized enterocytes G, goblet cells ; EC, enteroendocπne cells ; P, Paneth cells; asterisk, matπgel. Scale bar: 5 μm (m, p), 1 μm (n, o).
Figure 12 Comparison of electron microscopic images between in vivo crypt and in \ιtro cultured crypt a, b' Normal intestine at the base of the crypt with the connective tissue underneath (arrows) For comparison see c-g of the organoids also taken at the base of a crypt d: High magnification image from the apical membrane; There are intercellular clefts (arrows) between the membranes of two adjacent cells. Note the desmosome (arrow head) followed by an intercellular cleft, e High magnification from the basal site where the membrane of two adjacent cells can be followed by intracellular clefts These images are comparable to a and b from the intestine of a normal mouse The cause of these intercellular clefts may be osmotic shock during aldehyde fixation f,g All cells that make up the organoid are in a healthy state and lack large vacuoles or other signs of stress. One can observe mitosis figures (c) and in each cell many nuclear pores (f, arrows) and intact mitochondria ER and Golgi (g) can be seen without any evidence of swelling. There is no sign of karyorexis, karyolysis or karyopyknosis Therefore, no sign of cell lysis or apoptosis is observed Cells in the lumen of the organoid show the expected apoptotic features as one can observe in the gut of a normal mouse, f shows another example of an enteroendocπne cell Mi. mitotic cells, Lu: lumen, EC: enteroendocrine cells, G: Golgi Figure 13 Colon derived crypts can be maintained in culture as well Single isolated crypts derived from colon efficiently form crypt organoids using the same culturing conditions as used for small intestinal crypts Through repeated crypt fission, the structures generate numerous octopus-like crypt organoids at day 14
Figure 14 Addition of BDNF increases culture efficiency Single isolated colon crypts were cultured in the presence of EGF, Noggin, R-Spondin and BDNF Images of colon crypt organoids taken at day 0, 4 and 14 after the start of the culture
Figure 15 Addition of Wnt3a further increases culture efficiency of colon crypt organoids Single isolated colon crypts were cultured in the presence of EGF, Noggin, R-Spondin The use of Wnt3a conditioned medium (+Wnt3a) increased culture efficiency up to 30% compared to culturing colon organoids in control medium (- Wnt3a)
Figure 16 Adenoma isolated from APC7- mice can grow in \ ιtro Single isolated adenoma from APC-/- mice were dissociated and cultured using conditions as described above with the exception that R-spondin was not included in the culture media a Adenoma organoids as shown here on day 4 generally grow as a simple cyst, containing one central lumen containing apoptotic cells b A larger magnification of one adenoma organoid c One adenoma organoid was stained with β-Catenin (dark grey) and hematoxylin (light grey in lumen) The outer layer of the organoid consists of epithelial cells with a nuclear β-Catenin staining The inner lumen contains dead cells that have taken up hematoxylin, staining dark grey d A larger magnification of the outer layer of epithelial cells showing clear nuclear β-Catenin
Figure 17 Addition of Wnt3a increases the efficiency of organoid formation a Lgr5- GFPhl cells were sorted and cultured with or without Wnt3a (lOOng/ml) in addition to conventional single cell culture condition (EGF, noggin, R-spondin, Notch ligand and Y-27632, as described above for single cells) These images of dishes with cultured organoids in the presence and absence of Wnt3a are representative b 100 cells/well were seeded and the number of organoids were 14 days after seeding The number of organoids/dish is represented in this graph Figure 18 Model for R-spondinl function
Wnt/β-catenin signalling is initiated upon binding of a canonical Wnt ligand to Frizzled and association with LRP5/6 receptors In the absence of R-spondinl , Wnt signalling is limited by the amount of LRP6 on the cell surface, which is kept low by
DKK 1/Kremenl -mediated internalization R-spondinl enhances Wnt signalling by antagonizing DKK 1/Kremenl -mediated LRP6 turnover, resulting in increased cell surface levels of LRP6 This figure was taken from PNAS 104 14700, 2007
Figure 19 Paneth cells are located adjacent to Lgr5+ stem cells in the small intestines Crypts were isolated from the small intestine of Lgr5-EGFP-ιres-CreERT2 knock-in mice Examples of representative crypts are presented here The GFP+ cells are Lgr5+ (light grey, indicated by black arrows) and these are generally located adjacent to Paneth cells (indicated by *)
Figure 20 In the absence of viable Paneth cells, efficiency of organoid formation is reduced
Isolated crypts were incubated with IuM Newport Green-DCF (Molecular probe) in
PBS+ 0 1% Pluronic 127 (Sigma) for 3 min at room temperature, following by PBS wash After this, crypts were embedded in Matπgel and cultured using the standard conditions as described above
Figure 21 Efficiency of gastric organoid culture (a) GFP (arrows, indicating GFP positive cells) and DIC image of isolated gastric glands from the pyloric region of the stomach of a Lgr5-GFP mice Nuclei are stained with DAPI Magnification 63x (b) 100 gastric glands/well were seeded in duplicates with EGF (E), R-spondin 1 (R), Noggin (N), EGF + R-spondin 1 (ER). EGF + Noggin (EN), EGF + R-spondin 1 + Noggin (ERN), EGF + R-spondin 1 + Noggin + Wnt3A (ERNW) or EGF + R-spondin 1 + Noggin + Wnt3A + KGF (ERNWK) The number of gastric organoids was counted 2, 5 and 7 days later Results are shown as mean ±SEM of 2 independent experiments (b) 100 gastric glands/well were seeded in duplicates with Wnt3A recombinant protein (ENRWK) or Wnt3A conditioned media (ENRWCMK) supplemented with the other growht factors described in a. The number of budding organoids was counted at day 7 after seeding and at day 2 after the first passage.
Figure 22 Formation of gastric organoids in vitro (a) Isolated gastric glands growing into organoids. Differential interference contrast images from days 1, 2, 5 and 7 after seeding. Magnification 1Ox (days 1, 2, 5). Day 7 magnification 4x, inset 10x (b) Cultures were passage every 4-7 days by mechanical dissociation. Cultures have been grown at least for one month. Representative images showing budding structures coming out from the organoids at different passages. Passage 1 (Pl), passage 2 (P2) and passage 4 (P4) representing days 8, 1 1 , 20 respectively.
Figure 23 Markers of gastric glands (a) gastric cultures from Lgr5-LacZ mice Lac Z expression was detected in the gastric budding at day 5 after seeding (see arrow, indicating LacZ positive (dark grey) cells), indicating the presence of Lgr5 positive cells Magnification 20x (b) Ki67 staining (black) shows positive proliferating cells at the base of the gland-like structure, (c) caspase-3 (dark grey) apoptotic cells present inside the lumen of the organoid (d) Gastric mucin 5AC (dark grey) positive cells present in the gastric organoids. Lu, organoid lumen Magnification 20x.
Figure 24 Pancreatic ducts can form pancreatic like organoids in vitro Freshly isolated pancreatic ducts were cultured in the presence of EGF, Noggin, R-spondin- 1 and KGF Differential interference contrast images from days 0, 4 and 14 after seeding.
Figure 25 Pancreatic islet like structures form after appr 3 weeks of in vitro culture Differential interference contrast images from day 21 after seeding.
Figure 26
Axin-LacZ mice were injected with vehicle alone (A) or R-Spondin (B). After 2 days, the pancreas was isolated and the presence of LacZ expression was determined by staining with X-gal. The middle panel of B shows a larger magnification of a duct that shows positive staining for LacZ, indicating the expression of Axin-LacZ along the lining of the pancreatic duct. The left panel shows that small duct cells in centroacinar or intercalated duct cells expressed Axin2-LacZ (examples of which are indicated by black arrows) Magnifications are shown in the corner of each image Pancreatic duct ligation was performed in wild type mice At different times after PDL, the pancreas was isolated and tissue sections obtained from the PDL and non-PDL area were stained with H&E Magnifications are shown for each time point (C) Pancreatic duct ligation was performed in wt and Axin2-LacZ mice 7 days after PDL, the pancreas was isolated and Axin2-LacZ expression was determined by staining with X-gal of fixed tissue sections (D) or whole mounted organ fragments (E) The white circles indicate ligated portion of the pancreas Expression of Ki67 (examples indicated by arrows) in pancreas tissue sections 5 days after PDL Magnifications are shown (F) Incorporation of BrdU (examples indicated by arrows) in pancreas tissue 2 days after in vivo treatment with R-spondin Magnifications are shown (G) Lgr5 mRNA expression was determined by Q-PCR in pancreas tissue obtained from mice undergoing PDL or a sham operation In the PDL pancreas, the PDL area and non-PDL area was subjected to Q-PCR The fold increase of Lgr5 expression compared to TATA box binding protein (tbp), a housekeeping gene, is shown (H) 13 days after PDL, the pancreas was isolated and Lgr5-LacZ expression was determined by staining with X-gal of fixed tissue sections Examples of stained cells are indicated by black arrows (I)
Figure 27 Images of pancreatic ductal fragments grown in vitro in EM taken at different time points after isolated from a wild type mouse (A, top panel) Centroacinar cells did not grow for periods longer than 7 days, after which they disintegrated (A, bottom panel) Pancreatic fragments were grown in the presence or absence of EGF (50 ng/ml), R- spondin (1 μg/ml), FGFlO ( 100 ng/ml) or Noggin (100 ng/ml) Images of the cultures were taken 7 and 14 days after the start of the culture with freshly isolated pancreatic fragments Cultures without EGF did not survive for longer that 10 days (B) Pancreatic fragments isolated from Axin2-LacZ mice were cultured in the absence or presence of R-spondin (1 μg/ml) for 3 days X-gal staining showed expression of Wnt-responsive Axin-LacZ in the ductal cells after 3 and 14 days only in the presence of R-spondin (examples indicated by white arrows) No X-gal staining was detected in the acinar or islet cells (C) Ductal fragments were isolated from Lgr5-LacZ mice and cultured for 3 days in the absence or presence of R-spondin Expression of Lgr5-LacZ, as indicated by X-gal staining, shows Lgr5+ cells on the tips of the buds, similar to its expression after PDL (D) FACS staining of cells obtained from pancreatic fragments cultured in the presence of a Wnt agonist, R-spondin Cells were stained for EpCAM, a pan- epithehal cell marker, and LacZ (Fluorescein-di-galactopyranoside, FDG) The percentage of Lgr5+ cells is significantly increased when pancreatic fragments are cultured in the presence of a Wnt signal (E)
Figure 28
Pancreas was isolated from mice 7days after PDL treatment and pancreatic cells were stained with EpCAM-APC and fluorescent substrate for LacZ (FluoroReporter kit), sorted and cultured in EM including 50% Wnt3A conditioned medium and 10 mM Y- 27632 for 4 days Culture medium was changed into EM medium without Wnt and Y- 27632 after 4 days Pictures were taken on the indicated days and a 4Ox magnification is shown
Figure 29
Pancreatic organoids were transferred from EM to DM The effect of removal of FGFlO from the expansion medium, resulting in DM, induced differentiation into islets Pancreatic organoids were cultured for 10 days in DM after which islet like structures could be detected in vitro Pictures of the cultures in the presence and absence of FGFlO are shown (A) and shows increased expression of certain differentiation markers, Ngn3 and somatostatin as measured by PCR Hprt is a housekeeping gene (B) At several time points after the transferral to DM, expression of a number of markers was assessed by PCR (C) Change in morphology from pancreatic cysts to β cell-like structures (D) accompanied the appearance of certain β cell markers, such as Insulin and C-peptide as detected by immunofluorescence (E) The presence of R-spondin in DM is essential for the regeneration of β cell progenitors, as indicated by positive immunofluorescent staining for Ngn3 (examples are indicated by white arrows) (F)
Figure 30
Human pancreas fragments were freshly isolated and cultured in EM Pictures were taken of the cultures at the indicated time points after the start of the culture Figure 31 In vitro crypt cultures produce Wnt ligand(s)
(A) Schematic representation of the Wnt pathway When Wnt ligands are secrected, they can autocrine or paracrine activate the Wnt signaling pathway Porcupine is important for proper Wnt ligands secretion IWP inhibitors result in a inhibition of Wnt ligand secretion
(B) Mouse organoids cultured under normal conditions as indicated in example 1
(C) Incubation of mouse organoid cultures with 1 μM IWP results in cell death of organoid cultures
(D) Addition of Wnt3a conditioned medium enhances the mouse organoid cultures (E) IWP induced organoid death is rescued by the addition of Wnt3a conditioned medium
A magnification of 10x is shown (B-E)
Figure 32 Establishment of human intestinal crypt culture Human organoids cultured out of small intestine (A-D) and colon (E-H) after 3 (A, C, E, G) and 5 (B, D F, H) days in medium supplemented with EGF, Noggin and Rspondin with (A, B, E, F) and without (C, D, G, H) Wnt3a conditioned medium
Figure 33 Establishment of the gastric organoid culture (A) A total of 100 gastric glands/well were seeded in duplicate with EGF (E), R- spondin 1 (R), Noggin (N), EGF + R-spondin 1 (ER), EGF + Noggin (EN), EGF + R- spondin 1 + Noggin (ERN), EGF + R-spondin 1 + Noggin + Wnt3A (ERNW), EGF + R-spondin 1 + Noggin + Wnt3A + FGFlO (ERNWF), EGF + R-spondin 1 + Noggin + control conditioned media + FGFlO (ERNCCMF) or EGF + R-spondin 1 + Noggin + Wnt3A conditioned media + FGFlO (ERNWCMF) The number of gastric organoids was counted 2, 5 and 7 days later Results are shown as mean ±SEM of 2 independent experiments
(B) A total of 100 gastric glands / well were seeded in duplicate with Wnt3A conditioned media (ENRWCM) or Wnt3A conditioned media supplemented with FGFlO (ENRWCMF) The number of budding organoids was counted after 7, 15 (passage 2) and 60 days (passage 10) in culture
(C) A total of 100 gastric glands / well were seeded in Wnt3A conditioned media (WCM) + EGF + Noggin and R-spondin supplemented with either FGF7/KGF (K) or FGFlO (F) both 100 and 1000 ng/ml has been tested. The number of budding organoids was counted after 4 days (passage 7) in culture. A representative experiment has been shown.
(D) Isolated gastric glands developing into organoids Differential-interference contrast images from days 1, 2, 3, 4, 7 after seeding. After one week, cultures required splitting
1 :5 or 1 6. Subcultuπng and maintenance has been performed as described in the supplementary materials and methods section Representative images of the cultures after 15 days, 3 months, 4.5 and 6 months in culture; (10 x magnification).
(E) Example of a 5 day-old culture grown in control conditioned media. Note that the culture is not growing and has failed to form gland domains. Under these conditions the culture survived no longer than 7 days.
(F) Whole-mount E-Cadheπn staining in a 3 month-old gastric organoid.
Figure 34 Single Lgr5+ve cells build long-lived gastric organoids in-vitro (A) Confocal analysis of a freshly isolated pyloric gastric unit from an Lgr5-EGFP- ires-CreERT2 mouse stomach. Arrows showing GFPhi (grey), GFPIo (black) and
GFP- ve (white) distinct populations.
(B) Lgr5-EGFP+ve cells are discriminated from the GFPIo and GFP- ve populations according to their GFP expression level. FSC, forward scatter (C) Representative example of a growing organoid originating from a single Lgr5+ve cell Arrows showing the formation of gland-like domain buds at day 7 Original magnifications: days 1-4; 4Ox magnification, days 5-6, 2Ox magnification, days 7-8;
10x magnification and day 9, 5x magnification
(D) Organoids derived from single Lgr5+ve cells have been dissociated and split every 5-7 days Representative images of a 3 months-old culture. Original magnifications, left panel; 4x magnification, right panel; 10x magnification.
(E) Confocal analysis of Lgr5 EGFP-expressing cells in a 14 day-old gastric culture grown from a single GFPhi cell Note that Lgr5-GFP+ve cells are located at the bottom of the gland domains (white arrow; 10x magnification) (F) Organoids cultured with the thymidine analogue EdU (red) for 1.5 h Only gland domains incorporate EdU (white arrows, 20x magnification) Counterstain, 4,6- diamidino-2-phenylindole (DAPI; nuclear). (G) A 2-week old culture from a single-cell culture of Lgr5-EGFP-ires- CreERT2/Rosa26-YFP reporter mouse was stimulated with tamoxifen ui-vitro for 20 hrs, and imaged on the indicated days. YFP fluorescence (yellow) shows that scattered single yellow cells (day 1 5) generate multiple offspring in-vitro. Note that YFP+ve cells migrate towards the central lumen (white dotted circle).
(H) Expression analysis of gastric-specific genes from 2 month-old cultures derived from Lgr5+ve single cells. Cultures maintained in high (left panel) or low (middle panel) Wnt3A medium. Note that gastπc-deπved cultures are negative for intestine specific genes (right panel).
(I) Cultures maintained in low Wnt3A media for at least 10 days Upper panel: confocal image of ECad staining (red, epithelium derived organoids). Counterstain, Hoescht 33345 (blue). Lower panels paraffin sections stained for Tff2 (brown, mucus neck cells), periodic acid-Schiff (red, pit cells), MUC5AC (brown, pit cells) and chromogranin A (brown, enteroendocπne cells).
Examples
Example 1 Cultuπng of small intestine crypts and villi in vitro
Materials and Methods
Mice Outbred mice of 6- 12 weeks of age were used Generation and genotyping of the Lgr5-EGFP-Ires-CreERT2 allele1 has been previously described1 Rosa26-lacZ or YFP Cre reporter mice were obtained from Jackson Labs
Crypt isolation, cell dissociation and culture Crypts were released from murine small intestine by incubation in 2 rruM EDT A/PBS for 30 mm at 4°C Isolated crypts were counted and pelleted 500 crypts were mixed with 50μ I Matπgel (BD Bioscience) and plated in 24 well plates After polymerization of Matπgel, 500 μl of crypt culture medium (Advanced DMEM/F12 with growth factors ( 10-50 ng/ml EGF (Peprotech), 500 ng/ml R-spondin 1 ' ' and 100 ng/ml Noggin (Peprotech)) was added For sorting experiments, isolated crypts were incubated in culture medium for 45 min at 37 0C, following by resuspension with a glass pipette Dissociated cells were passed through 20-μm cell strainer GFPhl, GFPlow or GFP cells were sorted by flow cytometry (MoFIo, Dako) Single viable epithelial cells were gated by forward scatter, side scatter and pulse-width parameter, and negative staining for propidium iodide Sorted cells were collected in crypt culture medium and embedded in Matπgel including Jagged- 1 peptide (Ana Spec, 1 μ M) at 1 cell/well (in 96 well plate, 5 μl Matπgel) Crypt culture medium (250 μl for 48 well plate, 100 μl for 96 well plate) including Y-27632 (10 μM) was overlaid Growth factors were added every other day and the entire medium was changed every 4 days For passage, organoids were removed from Matπgel and mechanically dissociated into single-crypt domains, and transferred to new Matπgel Passage was performed every 1-2 weeks with 1 5 split ratio
Reagents, Murine recombinant EGF and Noggin were purchased from Peprotech
Human recombinant R-spondin l ", Y-27632 (Sigma), 4-hydroxytamoxifen (Sigma) and Edu (Invitrogen) were used for culture experiments The following antibodies were used for immunostaining anti-lysozyme (Dako), anti-Synaptophysin (Dako), anti-BrdU (Roche), anti-β-catenin (BD Bioscience), anti-E-cadheπn (BD Bioscience). anti- Smooth muscle actin (Sigma), anti-EphB2 and B3 (R&D), anti-villm, anti-Muc2, anti- chromogranin A (Santa Cruz), anti-caspase-3 (Cell Signaling)
Crypt Isolation Isolated small intestines were opened longitudinally, and washed with cold PBS The tissue was chopped into around 5 mm pieces, and further washed with cold PBS The tissue fragments were incubated in 2 mM EDTA with PBS for 30 min on ice After removal of EDTA medium, the tissue fragments were vigorously suspended by 10 ml pipette with cold PBS The supernatant was the villous fraction and was discarded, the sediment was resuspended with PBS After further vigorous suspension and centπfugation, the supernatant was enriched for crypts This fraction was passed through a 70-um cell strainer (BD bioscience) to remove residual villous material Isolated crypts were centπfuged at 300 rpm for 3 min to separate crypts from single cells The final fraction consisted of essentially pure crypts and was used for culture or single cell dissociation
Tamoxifen induction and X-gal staining To activate CreERT2, crypts were incubated with low dose 4-hydroxytamoxifen ( 10OnM) for 12 hr and cultured in crypt culture medium X-gal staining was performed as previously described1 No staining was seen without 4-hydroxytamoxifen treatment
Electron microscopy analysis As described previously1 Matπgel including crypt organoids were fixed in Karnovsky's fixative (2% paraformaldehyde, 2 5% glutaraldehyde, 0 1 M Na-cacodylate, 2 5 mM CaCl2 and 5mM MgCl2, pH 7 4) for 5 hr at room temperature The samples were embedded in Epon resin and were examined with a Phillips CM lO microscope (Eindhoven, The Netherlands)
Microarray analysis Gene expression analysis of colonic crypts, small intestinal crypts and organoids Freshly isolated small intestinal crypts from two mice were divided into two parts RNA was directly isolated from one part (RNeasy Mini Kit, Qiagen), the other part was cultured for one week, followed by RNA isolation We prepared labeled cRNA following the manufacturer's instruction (Agilent Technologies) Differentially labelled cRNA from small intestinal crypts and organoids were hybridised separately for the two mice on a 4X44k Agilent Whole Mouse Genome dual colour Microarrays (G4122F) in two dye swap experiments, resulting in four individual arrays Additionally, isolated colonic crypts were hybridized against differentially labelled small intestinal crypts in two dye swap experiments, resulting in four individual arrays Microarray signal and background information were retrieved using Feature Extraction (V 9 5 3, Agilent Technologies) All data analyses were performed using ArrayAssist (5 5 1, Stratagene Inc ) and Microsoft Excel (Microsoft Corporation) Raw signal intensities were corrected by subtracting local background Negative values were changed into a positive value close to zero (standard deviation of the local background) in order to allow calculation of ratios between intensities for features only present in one channel (small intestinal crypts or organoids) or (small intestinal crypts or colonic crypts) Normalization was performed by applying a Lowess algorithm and individual features were filtered if both (small intestinal crypts or organoids) or (small intestinal crypts or colonic crypts) intensities were changed or if both intensities were less than two times the background signal Furthermore, non-uniform features were filtered Data are available at GEO (Gene Expression Omnibus, number GSE 14594) upon publication Unsupervised hierarchical clustering was performed on normalized intensities (processed signal in Feature Extraction) of small intestinal/colonic crypts and organoids using Cluster 3 (distance city block, correlation average linkage) and visualized with TreeView Genes were considered significantly changed if they were consistently in all arrays more than 3-fold enriched in organoids or crypts
Imaging analysis The images of crypt organoids were taken with either confocal microscopy (Leica, SP5), inverted microscope (Nikon DM-IL) or stereomicroscope (Leica, MZl 6-FA) For lmmunohistochemistry, samples were fixed with 4% paraformaldehyde (PFA) for 1 hr at room temperature, and Paraffin sections were processed with standard technique1 lmmunohistochemistry was performed as previously described1 For whole-mount lmmunostaining, crypts organoids were isolated from matπgel using with Dispase (Invitrogen), and fixed with 4% PFA, following by permiabilization with 0 1 % Tπton-X EdU staining was performed following the manufacturer's protocol (Click-IT, Invitrogen) DNA was stained by DAPI or ToPro-3 (Molecular Probe) 3D images were acquired with confocal microscopy (Leica, SP5) and reconstructed with Volocity Software (Improvision) Results
The intestinal epithelium is the most rapidly self-renewing tissue in adult mammals We have recently demonstrated the presence of approximately six cycling Lgr5+ stem cells at the bottoms of small intestinal crypts' We have now established long-term culture conditions under which single crypts undergo multiple crypt fission events, whilst simultanously generating villus-like epithelial domains in which all differentiated cell types are present Single sorted Lgr5* stem cells can also initiate these crypt-villus organoids Tracing experiments indicate that the Lgr5* stem cell hierarchy is maintained in organoids We conclude that intestinal crypt-villus units are self-organizing structures, which can be built from a single stem cell in the absence of a non-epithelial cellular niche
The self-renewing epithelium of the small intestine is ordered into crypts and villr Cells are newly generated in the crypts and are lost by apoptosis at the tips of the villi, with a turn-over time of 5 days in the mouse Self-renewing stem cells have long been known to reside near the crypt bottom and to produce the rapidly proliferating transit amplifying (TA) cells The estimated number of stem cells is between 4 and 6 per crypt Enterocytes, goblet cells and enteroendocπne cells develop from TA cells and continue their migration in coherent bands along the crypt-villus axis The fourth major differentiated cell-type, the Paneth cell, resides at the crypt bottom We have recently identified a gene, Lgr5, which is specifically expressed in cycling Crypt Base Columnar cells that are interspersed between the Paneth cells' Using a mouse in which a GFP/tamoxifen-inducible Cre recombinase cassette was integrated into the Lgr5 locus, we showed by lineage tracing that the Lgr5+ cells constitute multipotent stem cells which generate all cell types of the epithelium1, even when assessed 14 months after Cre induction3
Although a variety of culture systems has been described4 7, no long-term culture system has been established which maintains basic crypt-villus physiology" Mouse crypt preparations were suspended in Matπgel Crypt growth required
EGF and R-spondin 1 (Fig Ia) Passaging revealed a requirement for Noggin (Fig Ib) The cultured crypts behaved in a stereotypical manner (Fig 2a) The upper opening rapidly became sealed, and the lumen filled with apoptotic cells The crypt region underwent continuous budding events, reminiscent of crypt fission17 Paneth cells were always present at the bud site The majority of crypts could be cultured (Fig 2b) Further expansion created organoids, comprising >40 crypt-domains surrounding a central lumen lined by a villus-like epithelium ("villus domain'") (Fig 2c-e) E-cadheπn staining revealed a single cell layer (Data not shown) Weekly, organoids were mechanically dissociated and replated at 1/5 of the pre-plating density Organoids were cultured for >6 months without losing the characteristics described below Expression analysis by microarray revealed that organoids remained highly similar to freshly isolated small intestinal crypts, when compared for instance to fresh colon crypts (Fig 3)
Culture of Lgr5-EGFP-ιres-CreERT2 crypts revealed Lgr5-GFP+ stem cells intermingled with Paneth cells at the crypt base Wnt activation, as e\ idenced by nuclear β-catenin (Fig 4a, Fig 5) and expression of the Wnt target genes Lgr5 (Fig 2d) and EphB2 (Fig 4b) was confined to the crypts Apoptotic cells were shed into the central lumen, a process reminiscent of the shedding of apopotic cells at villus tips in wvø (Fig 4c) Metaphase spreads of >3 months-old organoids consistently revealed 40 chromosomes/cell (n=20) (Fig 4d) Surprisingly, we found no evidence for the presence of myofibroblasts or other non-epithelial cells (Fig 6)
We cultured crypts from Lgr5-EGFP-ιres-CreERT2 mice crossed with the Cre- activatable Rosa26-LacZ reporter to allow lineage tracing Directly after induction by low-dose tamoxifen, we noted single labeled cells (Fig 4e, g) More than 90% of these generated entirely blue crypts (Fig 4e-g), implying that the Lgr5-GFP+ cells indeed retained stem cell properties Crypts from the Oe-activatable Rosa26-YFP reporter19 mouse allowed lineage tracing by confocal analysis Directly after tamoxifen treatment, we noted single labeled cells that induced lineage tracing over the following days, both in freshly isolated crypts (Fig 7a-c) and in established organoids (Fig 7d)
Recently, mammary gland epithelial structures were established from single stem cells in vιtro2 i When single Lgr5-GFPhl cells were sorted, these died immediately The Rho kinase inhibitor Y-27632, significantly decreased this cell death A Notch agonistic peptide24 was found to support maintenance of proliferative crypts" Under these conditions, significant numbers of Lgr5-GFPhl cells survived and formed large crypt organoids Organoids formed rarely when GFPlow daughter cells were seeded (Fig 8d) Multiple LgrS-GFP11' cells were intermingled with Paneth cells at crypt bottoms (Fig 8e-f) EdU (thymidine analog) incorporation revealed S-phase cells in the crypts (Fig 8g)
We sorted cells at 1 cell/well, visually verified the presence of single cells and followed the resulting growth In each of four individual experiments, we identified and followed 100 single cells On average, approximately 6% of the LgrS-GFP 111 cells grew out into organoids, while the remaining cells typically died within the first 12 hours, presumably due to physical and/or biological stress inherent to the isolation procedure GFPlow cells rarely grew out (Fig 9a) Figure 9b and Fig 10 illustrate the growth of an organoid from a single Lgr5-GFPhl cell By four days of culture, the structures consisted of around 100 cells, consistent with the 12 hour-cell cycle of proliferative crypt cells25 (Fig 9c) After two weeks, the organoids were dissociated into single cells and replated to form new organoids (Fig 9d) This procedure could be repeated at least four times on a 2-weekly basis, without apparent loss of replating efficiency
The single stem cell-derived organoids appeared indistinguishable from those derived from whole crypts Paneth cells and stem cells were located at crypt bottoms (Fig 8 e, f, Fig 1 1 c, g) Fully polarized enterocytes as evidenced by ViIIm+ mature brush borders and apical alkaline phosphase lined the central lumen (Fig 1 1 a, e, i) Goblet cells (Muc2+, Fig 1 1 b, PAS+, Fig 1 1 0 ar|d enteroendocπne cells (chromogranin A+, Fig 1 1 d, synaptophysin+, Fig 1 1 h) were scattered throughout the organoid structure Four types of mature cells were recognized by electron microscopy (Fig 1 li-l) Non- epithelial (stromal/mesenchymal) cells were absent, an observation confirmed by EM imaging (Fig 1 1 i-p, Fig 12 c-g) Both the crypts (Fig 1 Im, o) and the central luminal epithelium (Fig 1 Ip) consisted of a single layer of polarized epithelial cells resting directly on the matπgel support High resolution images of these EM pictures are given in Fig 5 Organoid stained for E-cadheπn in red and counter stained with nuclei in blue, reveals the single-layered nature of the organoid epithelium (data not shown) It is well known that epithelial crypts are in intimate contact with subepithelial myofibroblasts26 28 and it is generally believed that the latter cells create a specialized cellular niche at crypt bottoms" " Such a niche would create a unique environment to anchor and support the intestinal stem cells We now show that a self-renewing epithelium can be established by a limited set of growth signals that are uniformly presented Despite this, the isolated stem cells autonomously generate asymmetry in a highly stereotypic fashion This rapidly leads to the formation of crypt-like structures with de no\o generated stem cells and Paneth cells located at their bottoms and filled with TA cells These crypt-like structures feed into villus-like luminal domains consisting of postmitotic enterocytes, where apoptotic cells pinch off into the lumen, reminiscent of cell loss at villus tips The paradoxical observation that single cells exposed to a uniform growth-promoting environment can generate asymmetric structures is particularly evident upon scrutiny of the Wnt pathway While all cells are exposed to R-spondin 1 , only cells in crypts display hallmarks of active Wnt signaling, i e nuclear β-catenin and the expression of Wnt target genes Apparently, differential responsiveness to Wnt signaling rather than differential exposure to extracellular Wnt signals lies at the heart of the formation of a crypt-villus axis
In summary, we conclude that a single Lgr5+%e intestinal stem cell can operate independently of positional cues from its environment and that it can generate a continuously expanding, self-organizing epithelial structure reminiscent of normal gut The described culture system will simplify the study of stem cell-driven crypt-villus biology Moreover, it may open up new avenues for regenerative medicine and gene therapy
Example 2 Culturing of colon crypts and villi in vitro
Material and Methods Wnt3a conditioned medium
A Wnt3a ligand expressing cell line and the same cell line, without the Wnt3a ligand (control medium) are cultured for a period of 3-4 weeks The cells will produce Wnt3a as soon as they stop grown at confluency The medium will be harvested and tested in the TOPflash assay, a luciferase assay using a TCF responsive elements-luc construct (TOP) and the same construct, but with mutations in the TCF responsive elements (FOP) The ratio between TOP/FOP should be more than 20 for the medium to be used in cultures The medium is diluted 25-50% when used in the cultures to regenerate tissue
Freshly isolated colon was opened and washed with PBS or DMEM, and cut into small pieces The fragments were incubated with 2mM EDT A/PBS for 1 hour at 40C under gentle rocking Following removal of EDTA solution, the tissue fragments were vigorously suspended in 10 ml of cold PBS with a 10 ml pipette The first supernatant containing debris was discarded and the sediment was suspended with 10- 15ml PBS After further vigorous suspension of the tissue fragments the supernatant is enriched in colonic crypts The fragments were pelleted and mixed with matπgel and cultured as small intestinal organoid culture system The matπgel was incubated for 5- 10 min at 37°C After matπgel polymerization, 500 μl of tissue culture media (50% Advanced- DMEM/F12/ 50% Wnt-3a conditioned medium-supplemented with 200ng/ml N- Acetylcystein, 50ng/ml EGF, 1 μg/ml R-spondinl , 100 ng/ml Noggin, lOOng/ml BDNF (Peprotech) was added The entire medium was changed every 2-3 days For passage, the organoids were removed from the Matπgel using a 1000 μl pipette and were dissociated mechanically into small fragments and transferred to fresh Matπgel Passage was performed in 1 4 split ratio at least once every two weeks Under these conditions cultures have been maintained for at least for 3 months
Results
Colonic organoids grow slower and less efficient as compared with small intestinal organoids With the same growth factors condition as small intestine, less than 5% of colonic crypts isolated from distal colon grew and formed organoid structure (Fig 13) It was difficult to grow colonic crypts from proximal part of colon Since we found upregulation of trkB, the receptor of BDNF (Brain derived neurotrophic factor), in the microarray analysis (colon Lgr5-GFP hi cells vs colon Lgr5-GFP low cells), we determined the effect of BDNF for colonic organoids We constantly observed around 2-fold higher culture efficiency in BDNF+ culture than BDNF- culture Typically, one colon organoid would contain approximately 10 crypt domains (Fig 14) Consistent with their origin, no Paneth cells could be detected Compared with small intestinal organoids, colonic crypt possesses no Wnt-3a producing Paneth cells in the crypt base, therefore supplementation of Wnt-3 increases culture efficiency of colonic crypts but not that of small intestinal crypts Typically, we obtained up to 30% culture efficiency when we added Wnt-3a conditioned medium (Fig 15)
In conclusion, both small intestine derived and colon derived crypts can be maintained and propagated in vitro using the above described conditions, making this the first culture method ever described to result in the generation of intestinal epithelium in an artificial system
Example 3 Cultuπng of adenomas in vitro
Materials and Methods (See example 1)
Results
Adenomas have been historically difficult to culture in vitro Since the above described conditions were used to successfully culture healthy crypts derived from small intestine as well as colon, it was determined whether similar conditions could sustain adenomas in vitro After isolation of adenoma from APC-/- mice using 2 5mM EDTA, single adenomas were cultured under similar conditions as described above Importantly, these conditions were adequate to maintain growth of the adenomas in vitro, however, R-spondin had become redundant This can be easily explained by the fact that it no longer is necessary to induce the Wnt signaling pathway, since the absence of APC in these cells will automatically result in nuclear β-Catenin This makes R-spondin, a Wnt agonist, redundant in culturing adenomas in vitro Figure 16a, and in larger magnification in Fig 16b, show that, in contrast to normal crypt organoids, in which you can see crypt budding with central lumen, adenoma organoids simply grow as cysts Dead cells are shed off into the lumen, as can be concluded from the presence of a large quantity of dead cells inside the lumen In normal crypt organoids, nuclear β- catenin is only seen in base of crypt-domain (see Fig 4a) In adenoma organoids (Fig 16c and a larger magnification in 16d), nuclear β-catenin was seen in every epithelial cell, consistent with the genetic APC mutation These organoids can be passaged indefinitely
It was further tested whether single Lgr5+ sorted cells derived from the adenomas in Lgr5-EGFP-Ires-CreERT2/APCflox/flox mice were able to form similar adenoma organoids in vitro using the aforementioned culture conditions (without R-spondin) Indeed, this was the case and the organoids obtained were highly comparable in structure to those that were obtained using complete adenomas as starting material for the in vitro culture (data not shown)
Example 4 Testing the effect of other Wnt agonists
To determine whether other Wnt agonists have the same effect as R-spondin does, namely facilitate formation of crypt-villus organoids in vitro, soluble Wnt3a was added to Lgr5+ sorted single cells and the effect on crypt-villus formation in vitro was assessed
Materials and Methods
LgrS-GFP*11 cells were sorted and cultured with or without Wnt3a ( lOOng/ml) in addition to conventional single cell culture condition (EGF, noggin, R-spondin, Notch ligand and Y-27632, as described above for single cells) We seeded 100 cells/well and counted the number of organoids 14 days after seeding
Isolated crypts were incubated with IuM Newport Green-DCF (MolecularProbes) in
PBS+ 0 1% Pluronic 127 (Sigma) for 3 min at room temperature, following by PBS wash After this, crypts were embedded in Matπgel and cultured using the standard conditions as described above
Results
The addition of Wnt3a in the absence of R-spondin did not have any effect on colony formation little to no colonies were formed in the absence of R-spondin However, in the presence of R-spondin, an increased efficiency in organoid formation was observed only in the presence of Wnt3a (Fig 17) This indicates that both factors support each other in their ability to stimulate and support differentiation of stem cells into all cells necessary for the formation of a complete epithelial cell layer The current hypothesis is that R-spondin is responsible for inhibition of internalization of a co-receptor of
Frizzled, LRP6, prior to signalling through Frizzled Upon binding of the Wnt factor to Frizzled and the co receptor LRP6, the Wnt signalling pathway is activated^1 When LRP6 is present on the cell surface, will Wnt activation take place (Fig 18) Therefore, if R-spondin is not present in the culture medium, Wnt3a will not be able to activate the Wnt pathway, since LRP6 is internalized and not available for signalling in combination with the Wnt factor, thereby preventing activation of the Wnt pathway
Wnt3a is a soluble factor that, under physiological circumstances, is produced by
Paneth cells These cells are generally located adjacent to the stem cells (Fig 19) and it is hypothesized that these cells support the maintenance of the ongoing differentiation of the intestinal epithelial cell layer Other Wnt factors that are also secreted by Paneth cells are Wnt6, 9b and 1 1 It is anticipated that Wnt6 will have the same effect on stem cell differentiation as Wnt3a does These findings support the notion that Paneth cells are important for the formation of a stem cell niche These data are surprising, since a stem cell niche has been extensively speculated on, but so far no experimental data have supported the existence of such a niche Additional support for the presence of a stem cell niche comes from an experiment in which Paneth cells were selectively killed Crypts were isolated from the mouse small intestine and cultured in vitro in the presence of a zinc chelator32 that specifically eradicates Paneth cells This was used at such low concentrations and for such a short time that it only affects the Paneth cells and not other cells within the crypt After treatment with the zinc chelator, organoid formation was assessed A significant reduction of organoid formation was observed when Paneth cells were no longer present in the original crypts (Fig 20) In the presence of Wnt3a, this reduction was partially restored (data not shown) This supports a role for the Paneth cell in the maintenance of a stem cell niche, which supports the differentiation of the Lgr5+ stem cells in the crypt
Example 5 Culture conditions support the growth of stomach organoids as well
The stomach consists of 3 topographic regions (fundus, corpus, and antrum) and 2 functional glandular areas (oxyntic and pyloric) The oxyntic gland area comprises 80% of the organ whereas the pyloric area comprises the 20% of the organ The mammalian gastric epithelium is organized into gastric units consisting of a planar surface epithelium, a short pit and a long gland The pit is lined by mucus secreting cells whereas the gland is composed of secreting cells separated in three regions the isthmus, the neck and the base The gastric epithelium is constantly renewed Tracing studies performed in our laboratory have shown that LGR5 positive cells located at the gland base fulfil the definition of sternness (Barker et al under preparation) So far, gastric monolayer cultures have not been able to recapitulate the features of the gastric unit, which is formed by several differentiated gastric cells Furthermore, the 3- D culture method systems reported only reconstruct highly differentiated gastric surface mucous cells, without showing any endocrine cells Moreover, these cultures had only been carried out over a period of 7 days, thus indicating a lack of self- renewing capacity (Ootani A, Toda S, Fujimoto K, Sugihara H Am J Pathol 2003 Jun, 162(6) 1905- 12) Here we have developed a method to isolate gastric units from the pyloric region of the murine stomach and have been able to develop a 3D-culture system that shows longer-lived maintenance
Materials and Methods Gastric unit isolation Isolated stomachs were opened longitudinally and washed in cold Advanced-
DMEM/F12 (Invitrogen) Under the stereoscope, the pyloric region was excised and isolated from the body and forestomach and the pyloric mucosa was carefully separated from the muscle layer with tweezers Then, the tissue was chopped into pieces of around 5mm and further washed with cold isolation buffer (Na2HPO4 28 rtiM + KH2PO4 40 mM + NaCl 480 mM + KCl 8 mM + Sucrose 220 mM + D-Sorbitol 274 mM + DL-Dithiotreitol 2 6 mM) The tissue fragments were incubated in 5mM EDTA with isolation buffer for 2 h at 4°C under gentle rocking Following removal of EDTA solution, the tissue fragments were vigorously suspended in 10 ml of cold isolation buffer with a 10 ml pipette The first supernatant containing dead cells was discarded and the sediment was suspended with 10- 15ml cold isolation buffer After further vigorous suspension of the tissue fragments the supernatant is enriched in gastric units Every 10-20 suspensions the supernatant is replaced for fresh cold isolation buffer and is kept on ice and checked for the presence of gastric units This procedure is repeated until the complete release of the gastric units, usually 4-5 times Enriched gastric unit suspensions are centπfuged at 600 rpm for 2- 3 min to separate the isolated gastric units from single cells and the sediment is used for culture Gastric culture
Entire gastric units containing the gland, isthmus and pit regions were isolated from the pyloric region of murine stomach by incubating with 5mM EDTA at 4°C for 2h as indicated in the previous section Isolated gastric units were counted and pelleted 100 gastric units were mixed with 25 μl of Matπgel (BD Bioscience), seeded on 48-well tissue culture plates and incubated for 5-10 mm at 37°C until complete polymerization of the Matπgel After polymerization, 250 μl of tissue culture media (Advanced- DMEM/F12 supplemented with B27, N2, 200ng/ml N-Acetylcystein, 50ng/ml EGF, 1 μg/ml R-spondinl, 100 ng/ml Noggin, 100 ng/ml Wnt3A, 50 or 100 ng/ml KGF) was added The entire medium was changed every 2 days For passage, the organoids were removed from the Matπgel using a 1000 μl pipette and were dissociated mechanically into small fragments and transferred to fresh Matπgel Passage was performed in 1 4 split ratio once or twice per week Under these conditions cultures have been maintained for at least 1 month
Reagents
Advanced DMEM/F12 and supplements N2 and B-27 Serum-Free Supplement were purchased from Invitrogen and N-Acetylcysteine from Sigma Murine recombinant EGF, Noggin and human KGF were purchased from Peprotech, and Wnt3A recombinant protein from Stem Cell Research From the mentioned growth factors, different concentrations have only been tested for R-Spondinl and KGF At 50 ng/ml R-Spondin 1 inhibits culture growth KGF can be used either at 50 or 100 ng/ml but the budding efficiency is higher in the 100 ng/ml condition Wnt3A conditioned media was prepared as previously described (Willert K, Brown JD, Danenberg E, Duncan AW, Weissman IL, Reya T, Yates JR 3rd, Nusse R Nature 2003 May 22,423(6938) 448-52)
Immunohistochemistry and imaging analysis
For X-gal staining, organoids were directly fixed in the matπgel with 0 25% glutaraldehyde (Sigma) in 10OmM MgCl2 in PBS, for 1-2 h at room temperature After, cultures were washed 3-times with washing solution (0 01% Sodium Deoxycholate + 0,02% NP40 + 5mM MgCl2 in PBS) and incubated for 16 h at 37°C with lmg/ml X- GaI (Invitrogen) in the presence of 0,21% K4Fe(CN)6 and 0, 16% K3Fe(CN)6 After washing in PBS, cultures were post fixed with 2% PFA in PBS for 15 mm at room temperature All reagents were acquired from Sigma
For immunohistochemistry, organoids were isolated from the matπgel using trypsine (Tryple Select, Invitrogen), fixed with 4% PFA for 1 h at room temperature and embedded in paraffin Paraffin sections were processed with standard techniques and immunohistochemistry was performed as previously described The following antibodies were used anti-mouse Ki67 (clone MMl, Monosan) ( 1 200), anti-rabbit cleaved caspase-3 (Cell Signaling Technology) ( 1 400) and anti-human gastric mucin 5AC (Novocastra clone 45Ml) (1 200) Citrate buffer antigen retrieval was performed in all cases Sections were counterstained with Mayer's haematoxyhn
The images of gastric organoids and isolated gastric glands were taken with either inverted microscope (Nikon DM-IL) or confocal microscopy (Leica SP5)
Results So far, gastric cultures have been grown in monolayers Monolayer cultures, however, lack the ability to recapitulate the features of the entire gastric unit, which is formed by several differentiated gastric cells (pit mucous cells, enteroendocrine cells and proliferating mucous-free cells) Recently our laboratory has demonstrated by in vivo lineage tracing, that the Lgr5 positive cells present at the bottom of the intestinal crypts are true intestinal stem cells (Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth A, Korving J, Begthel H, Peters PJ, Clevers H Nature 2007,449 1003-7) As the intestinal epithelium, the gastric epithelium is constantly renewed Lgr5 positive cells have been found at the bottom of the pyloric gastric gland units and, tracing studies have shown that these LGR5 positive cells fulfil the definition of sternness by showing self-renewal and multipotency capability (Barker et al under preparation) Since we have been able to culture intestinal crypts from single Lgr5+ cells in 3-D structures, it was determined whether similar conditions could sustain the growth of pyloric gastric units in vitro
After isolation of gastric gland units using 5 mM EDTA, gastric glands (Fig 21a) were suspended in Matπgel Gastric culture growth required EGF (50 ng/ml), Noggin (100 ng/ml), R-spondin 1 (1 ug/ml) and Wnt3A (100 ng/ml) (Fig 21b) KGF (50 or 100 ng/ml) was essential for the formation of budding events and, therefore, the expansion of the cultures Thus, the cultured pyloric units behaved as the intestinal crypt organoids The opened upper part of the unit is sealed and the lumen is filled in with apoptotic cells The newly formed gastric organoids underwent continuous budding events (reminiscent of gland fission) while maintaining their polarity with the gastric glands budding with a central lumen When Wnt3A conditioned media, which shows 10-100 times higher Wnt activity when compared to the recombinant Wnt3A recombinant protein, was used a significant increase in the efficiency of budding formation was detected (Fig 21c), revealing a Wnt dose-dependence for the budding formation and morphogenesis
Organoids have been cultured for at least 1 month without losing the properties described Weekly, organoids are passaged 1 4 by mechanical dissociation (Fig 22) Culture of Lgr5-LacZ pyloric gastric units revealed the presence of Lgr5 positive stem cells in the gastric organoids (Fig 23a) As evidenced by Ki67 staining, proliferating cells are located at the base of the gland-like structures (Fig 23b) while apoptotic caspase 3 positive cells are found extruded into the lumen (Fig 23c) The gastric mucin 5AC (MUC5AC) is a specific marker of the gastric pit cells, also named as foveolar cells MUC5AC positive cells are found in the organoids, indicating the presence of at least one differentiated gastric cell lineage (Fig 23d) However, no endocrine derived cells have been detected Therefore, additional factors are required These would include gastrin releasing peptide, activators or inhibitors of the Hedgehog and Notch families, other activators of the Wnt pathway and other inhibitors of the BMP family, activators of the TGF family
Example 6a Pancreas organoids can be grown in \ itro
Material and Methods
Freshly isolated pancreas was cut into small pieces, and incubated in DMEM (Invitrogen) with digestive enzyme mixture (300 U/ml Collagenase typeXI (Sigma), 0 01 mg Dispase I (Roche) and 0 1 mg DNase) for 10 minutes in orbital shaker (80rpm, 37°C) After incubation, the tissue fragments were mildly dissociated by mechanical pipetting Undigested fragments were settled down for 1 minute with normal gravity, and the supernatant was transferred to a new tube The supernatant was passed through 70 um-cell strainer, and the residue was washed with DMEM The fragments remaining on the cell strainer were harvested by rinsing the inverted cell strainer with DMEM, and pelletted The fragments mostly consist of pancreatic acinar tissue and included pancreatic ducts The pellet was mixed with matπgel and cultured as small intestinal organoid culture system (see materials and methods of example 1) The matπgel was incubated for 5- 10 min at 37°C After polymerization of matπgel, 500 μl of tissue culture media (Advanced-DMEM/F12 supplemented with B27, N2, 200ng/ml N- Acetylcystein, 50ng/ml EGF, 1 μg/ml R-spondinl , 100 ng/ml Noggin, 50 or 100 ng/ml KGF (Peprotech) was added The growth factors were added every 2 days The entire medium was changed every 4-6 days For passage, the organoids were removed from the Matπgel using a 1000 μl pipette and were dissociated mechanically into small fragments and transferred to fresh Matπgel Passage was performed in 1 4 split ratio once or twice per week Under these conditions cultures have been maintained for at least for 2 months
Results
Pancreatic tissue formed simple cyst structure 3-4 days after culture in the presence of EGF Noggin and R-spondin synergistically increased the size of cyst structure, but did not affect morphogenesis of organoids KGF significantly induced budding formation as well as culture efficiency Using the optimal combination of growth factors (EGF, Noggin, R-spondin- 1 and KGF), more than 80% of pancreatic duct grew in the best combination of growth factors
Once the pancreatic ducts had been taken in culture, the ducts quickly sealed both ends of the structure and form a simple structure Approximately 20% of organoids started to form a budding structure 7 days after the start of the culture (Fig 24) The pancreatic ducts rapidly proliferate, in contrast to the acinar tissue, which only grows very slowly
Interestingly, after passage of the organoids, appr 2-3 weeks after the start of the culture, pancreatic islet-like structure were observed (Fig 25) These islet-like structures are generally not observed before passage The islets survive for at least 7 days, but proliferate very slowly or not at all These islet-like structure resemble the pancreatic islets of Langerhans that are present in healthy pancreas tissue Such islets contain, among others, alpha cells and beta cells that produce glucagon and insulin respectively The observed islet-like structures contain cells that express insulin, neurogenin 3, and Pdx- 1 Several growth factors will be tested to determine whether they increase the presence of pancreatic β cells in the organoids that are derived from pancreas tissue Candidate growth factors comprise cyclopamine (Sonic-hedgehog inhibitor), Activin, GLP (Glucagon like peptide) and its derivative (Exendin 4), gastrin and Nicotinamide
Example 6b Pancreas organoids can be grown in vitro
Material and Methods
Freshly isolated pancreas was cut into small pieces, and incubated in DMEM
(Invitrogen) with digestive enzyme mixture (300 U/ml Collagenase typeXI (Sigma), 0 01 mg/ml Dispase I (Roche) and 0 1 mg/ml DNase) for 10 minutes in orbital shaker (80rpm, 37°C) After incubation, the tissue fragments were mildly dissociated by mechanical pipetting Undigested fragments were settled down for 1 minute with normal gravity The undigested fragments were further digestive with the digestive enzyme mixture for 10 minutes This digestion procedure was repeated until the undigested fragments were mostly consist of pancreas ducts Pancreas duct structures were manually picked up from undigested fragments under the microscopy The pancreas ducts were mixed with matπgel and cultured as small intestinal organoid culture system (see materials and methods of example 1) The matπgel was incubated for 5- 10 mm at 37°C After polymerization of matπgel, 500 μl of tissue culture media (Advanced-DMEM/F12 supplemented with Ix Glutamax, Penicilin/Streptomycin, 1OmM Hepes, B27, N2, 10 mM N-Acetylcystein, 10 nM [Leul 5]-Gastπn I, 100 nM Exendin4, 10 mM Nicotinamide, 50ng/ml EGF, 1 μg/ml R-spondinl , 100 ng/ml Noggin, 50 or 100 ng/ml FGF7 (KGF) or FGFlO (Peprotech) was added The culture medium was changed every 2 days For passage, the organoids were removed from the Matπgel using a 1000 μl pipette and were dissociated mechanically into small fragments and transferred to fresh Matπgel Passage was performed in 1 4 split ratio once or twice per week Under these conditions cultures have been maintained for at least for 10 months
Results
Pancreatic tissue formed simple cyst structure 3-4 days after culture in the presence of EGF Noggin and R-spondin synergistically increased the size of cyst structure, but did not affect morphogenesis of organoids FGF7 (KGF) /FGFlO significantly induced budding formation as well as culture efficiency Using the optimal combination of growth factors (EGF, Noggin, R-spondin-1 and FGF7 (KGF) /FGFlO), more than 80% of pancreatic duct grew in the best combination of growth factors Once the pancreatic ducts had been taken in culture, the ducts quickly sealed both ends of the structure and form a simple structure Approximately 80% of organoids started to form a budding structure 7 days after the start of the culture (Fig 24) The pancreatic ducts rapidly proliferate, in contrast to the acinar tissue, which only grows very slowly Interestingly, after passage of the organoids, appr 2-3 weeks after the start of the culture, pancreatic islet-like structure were observed (Fig 25) These islet-like structures are generally not observed before passage The islets survive for at least 14 days, but proliferate very slowly or not at all These islet-like structure resemble the pancreatic islets of Langerhans that are present in healthy pancreas tissue Such islets contain, among others, alpha cells and beta cells that produce glucagon and insulin respectively The observed islet-like structures contain cells that express insulin, neurogenin 3, and Pdx- 1 Several growth factors will be tested to determine whether they increase the presence of pancreatic β cells in the organoids that are derived from pancreas tissue Candidate growth factors comprise cyclopamine (Sonic-hedgehog inhibitor), Activin, GLP (Glucagon like peptide) and its derivative (Exendin 4), Gastrin and Nicotinamide
Example 7 Unimpeded expansion of adult pancreatic progenitors in \ιtro by driving a Wnt/Lgr5 regenerative response
Materials and Methods Mice, reagents and tissues
Pancreatic tissue was obtained from the following mice Axin-LacZ knock in (Lustig et al MoI Cell Biol 2002), Lgr5-LacZ Knockin (Barker et al, 2007), Lgr5-GFP (Barker et al, 2007) Axin-LacZ mice were injected IP with 100 μg of purified human R- spondinl (kindly provided by A Abo, Nuvelo Inc, CA, USA) and sacrificed 48 hours later for LacZ expression analysis in the pancreas
Pancreatic duct ligation was performed as described in rats (Wang et al , 1995) with some minor modifications The experimental procedure for PDL was the following animals are anesthetized with a mixture of fluanisone fentanyl midazolam injected intraperitoneally at a dosage of 3 3 mg/Kg, 0 105 mg/Kg and 1 25 mg/ Kg respectively Animals are placed in supine position and the abdominal surface is shaved and cleaned with antiseptic solution (iodine solution) Following, a median incision at the upper anterior abdominal wall from the xiphisternum is performed and the pancreas is exposed Under a dissecting microscope, the pancreatic splenic lobe is localized and the pancreatic duct is ligated with a 7-0 polypropylene suture monofilament at approximately 1 mm distal to the junction with the gastric lobe duct Following surgery the analgesic buprenorphine is administered s c at a dose 0 01-0 05 mg/Kg Following, the abdominal wall and skin was closed with 5-0 silk sutures Freshly isolated pancreas was treated as described under example 6, resulting in pancreatic fragments that were cultured under conditions as described below The main pancreatic duct and first branch of ducts are mechanically isolated The fragments were cut into small pieces and and incubated in DMEM (Invitrogen) with digestive enzyme mixture (300 U/ml Collagenase type XI (Sigma), 0 01 mg/ml Dispase I (Roche) and 0 1 mg/ml DNase) for 30 minutes in orbital shaker (80rpm, 37°C) After the digestion, most of acinar cells were released from the fragments Undigested fragments mostly consist of pancreatic duct cells were settled down for 1 minute with normal gravity, and the supernatant was discarded After three times washing with PBS, the undigested fragments were incubated with 2 mM EDT A/PBS for 30 min at room temperature The fragments were vigorously pipetted and settled down for 1 minute with normal gravity The supernatant enriched with duct cells were transferred to new tubes and washed with PBS for three times The duct cells were pelleted and mixed with the Matπgel The matπgel was incubated for 5-10 min at 37°C After polymerization of matπgel, 500 μl of Expansion medium (Advanced-DMEM/F12 supplemented with Ix Glutamax, Penicilin/Streptomycin, 1OmM Hepes, B27, N2, 1 mM N-Acetylcystein, 10 nM
[Leul 5]-Gastπn I, 100 nM Exendin4, 10 mM Nicotinamide, 50ng/ml EGF, 1 μg/ml R- spondinl , 100 ng/ml Noggin, 50 or 100 ng/ml FG F7 (KGF) or FGFlO (Peprotech) was added The entire medium was changed every 2 days For passage, the organoids were removed from the Matπgel using a 1000 μl pipette and were dissociated mechanically into small fragments and transferred to fresh Matπgel Passage was performed in 1 4 split ratio once per week Under these conditions cultures have been maintained for at least for 2 months For differentiation, expansion medium were changed into differentiation medium (Advanced-DMEM/F12 supplemented with Glutamax, Penicilin/Streptomycin, 1OmM Hepes, B27, N2, 200ng/ml N-Acetylcystein, 10 nM
[Leul 5]-Gastπn I, 100 nM Exendin4, 50ng/ml EGF, 1 μg/ml R-spondinl, 100 ng/ml
Noggin)
FGFlO was obtained from Peprotech BrdU was obtained from Sigma
Q-PCR
RNA was islated by RNA easy mini kit (Quiagen), and reverse transcribed using
Moloney Murine Leukemia Virus reverse transcriptase (Promega) cDNA was amplified in a thermal cycler Primers used are shown below mmTBP (forward) TATTGTATCTACCGTGAATCTTGG mmTBP (reverse) CAGTTGTCCGTGGCTCTC
Lgr5 (forward) TCCAACCTCAGCGTCTTC
Lgr5 (reverse) TGGGAATGTGTGTCAAAG (Tm=57°C)
PCR
All primers were designed to flank or span intron sequences in order to distinguish genomic DNA
Hprt (F) AAGTTTGTTGTTGGATATGC (R) CATCTTAGGCTTTGTATTTGG (Tm ) 57°C, 106bp
Ngn3 (F) TCCTCGGAGCTTTTCTACGA (R) TGTGTCTCTGGGGACACTTG (Tm
) 600C, 239bp/373bp (genomic band)
Pax6 (F) AACAACCTGCCTATGCAACC (R) ACTTGGACGGGAACTGACAC
TM 600C, 206 bp Glucokinase (F) AAGATCATTGGCGGAAAG (R) GAGTGCTCAGGATGTTAAG
(Tm ) 57°C 193bp
Chromogranin A (F) GCTGACAGCAGAGAAGCGGCT(R)
GACAGGCTCTCTAGCTCCTGG(Tm ) 600C 231bp
Glut2 (slc2a2) (F) AAGTTGGAAGAGGAAGTCAG (R) AGACCTTCTGCTCAGTCG (Tm ) 57°C 124bp
Insulin (F) TTTGTCAAGCAGCACCTTTG (R) TCTACAATGCCACGCTTCTG
(Tm ) 570C, 214bp Somatostatin (F) GAGGCAAGGAAGATGCTGTC (R) GGGCATCATTCTCTGTCTGG (Tm ) 57°C, 214bp Glucagon (F) TTACTTTGTGGCTGGATTGCTT (R) AGTGGCGTTTGTCTTCATTCA (Tm ) 57°C, 149bp
Image analysis
The images of crypt organoids were taken by either confocal microscopy with a Leica SP5, an inverted microscope (Nikon DM-IL) or a stereomicroscope (Leica, MZ16-FA) For lmrnunohistochemistry, samples were fixed with 4% paraformaldehyde (PFA) for 1 h at room temperature, and paraffin sections were processed with standard techniques (Barker et al, Nature 2007). Immunohistochemistry was performed as described previously (Barker et al, Nature 2007). For whole-mount immunostaining, pancreas organoids were isolated from Matπgel using Dispase (Invitrogen), and fixed with 4%PFA, followed by permeabilization with 0 1% Triton X- 100 Following antibodies were used for immunohistochemistry; anti-BrdU (Amersham), anti-Ki67 (Dako), anti- Insulin (Sigma), anti-C-peptide (Cell signaling), anti-Ngn3 (Developmental hybπdoma studies bank)
DNA was stained with DAPI or ToPro-3 (Molecular Probes). Three-dimensional images were acquired with confocal microscopy. The staining with X-gal was performed as described under example 5 under immunohistochemistry and imaging analysis
FACS
Pancreatic organoids were cultured in the presence or absence of R-Spondin ( lμg/ml) were removed from matπgel mechanically or enzymatically (TrypLE) Isolated organoids were further digested by TrypLE for 10 mm at 37C Dissociated cells were passed through 40 um cell strainer (BD bioscience) and stained with APC conjugated anti- EpCAM (eBioscience). LacZ was stained by FluoReporter kit(Invitrogen) following manufacturer's protocol. Single viable cells were gated with Pulse-width, Side scatter parameter and propidium iodide staining In vitro expansion of single Axin2-LacZ positive pancreatic cells Pancreas was isolated from mice 7days after PDL treatment, and pancreas ducts were isolated as described above Isolated pancreas ducts were incubated with TrypLE Express (Invitrogen) for 20 mm at 37 C, following by passing through 40um cell strainer (BD bioscience) Cells were stained with EpCAM-APC and fluorescent substrate for LacZ (FluoroReporter kit) as described in Example7 Cells were analyzed and single viable epithelial cells were sorted by flow cytometer (MoFIo, Dako Cytomation), and collected in the EM medium Sorted cells were pelleted, mixed with Matπgel and cultured with EM medium including 50% Wnt conditioned medium and 10 mM Y-27632 for 4 days Culture medium was changed into EM medium without Wnt and Y-27632 after 4 days
Results
Single Wnt-dependent Lgr5+ stem cells derived from the small intestine can be cultured to form continuously expanding gut-like organoids (Sato et al, 2009) In healthy adult pancreas, the Wnt pathway is inactive and -consequently- Lgr5 is not expressed Upon injury by partial duct ligation (PDL), we find that the Wnt pathway becomes robustly activated, while Lgr5 expression appears at the buds of regenerating ducts Under conditions modified from the intestinal culture system, freshly isolated adult duct fragments initiate expression of Lgr5 and form budding cysts which expand 10-fold weekly for >30 weeks Removal of growth stimuli converts these cysts into structures with immature islet morphology, expressing endocrine and β-cell markers Single Wnt- stimulated cells from injured pancreas can also initiated these long-term cultures We conclude that the Hayflick limit does not apply to adult progenitor cells when cultured under optimized conditions Thus, culture methods favoring expansion of organ- specific adult stem cells may represent an alternative to ES- or iPS-based tissue generation
While development of the exocrine and endocrine compartments of the embryonic pancreas are understood in great detail (Jensen, 2004), much less is known about the generation of islet cells in the postnatal pancreas (Bonner-Weir and Weir, 2005, Bouwens and Rooman, 2005) Genetic lineage tracing has provided proof that preexisting β cells, rather than stem/progenitor cells, generate new β cells in adult mice both under normal physiological conditions and after partial pancreatectomy (Dor et al , 2004, Teta et al , 2007) The existence of multipotent progenitor cells in the ductal lining of the pancreas of adult mice has recently described, which can be activated in injured pancreas to increase the functional β cell mass (Xu et al 2008) Controlled injury was obtained by performing PDL on the pancreas of adult mice carrying a promoter reporter of Ngn3, which encodes a master switch for embryonic islet cell progenitors (Apelqvist et al , 1999, Gradwohl et al , 2000, Gu et al , 2002, Schwitzgebel et al , 2000) and which is silent in normal postnatal pancreas (Gu et al , 2002) Differentiation of these β cell progenitors is Ngn3 -dependent and gives rise to all islet cell types, including glucose-responsive β cells (Xu et al, 2008) It is currently not known which signals drive the appearance of these progenitors upon injury Such insights appear important as they may guide the design of in \ιtro approaches to progenitor expansion
To determine whether Wnt signaling plays a role in the induction of β cell progenitors, the expression of the Axιn2-LacZ allele was followed in the adult pancreas The Axin2- LacZ allele has proven to represent a faithful, general reporter for Wnt signaling (Lustig et al , MoI Cell Biol 2002) As expected, the reporter was inactive in adult pancreas (Fig 26A) However, when we injected the Wnt agonist Rspol (Kim et al, 2005) into Axin2-LacZ mice to activate the Wnt signaling pathway, we noticed the presence of Wnt-responsive cells along the ducts, but not in acini or islets of the pancreas (Fig 26B) Since β cell progenitors have previously been detected only upon injury of the pancreas, we then tested if a Wnt-response was physiologically activated in these cells upon injury by performing PDL Figure 26C shows H&E staining of pancreas tissue sections isolated from the PDL and non-PDL area As has been reported previously (Abe et al 1995), the acinar cells become apoptotic after 5 days and are replaced by newly formed duct structures by a mechanism not completely understood After 7 days, an increase in islet number (islet neogenesis) as well and in islet size is also observed (as indicated by an asterisk) This indicates that the PDL was successful Indeed, the Axin2-LacZ reporter was specifically activated along the ducts of the ligated part of the pancreas, while the unligated part did not show this response (Fig 26D and E) Moreover, the proliferative response, as determined by Ki67 staining, was mostly restricted to the ducts of the ligated part, whereas in ducts of the unligated part no nuclear Ki67 could be detected (Fig 26F) This resembled the detection of proliferative, BrdU positive cells in the pancreas after treatment with R-Spondin (Fig 26 G)
We have previously shown in the intestines that a certain population of Wnt responsive cells are stem cells (Barker et al, 2007) A marker for that population of cells was Lgr5 The Lgr5 gene is, like Axin2, a Wnt-responsive gene Yet in the intestine and the skin it is only expressed in Wnt-stimulated stem cells but not in transit amplifying cells (Barker et al, 2007, Jaks et al, 2008)) It is therefore considered to be a genuine stem cell marker We hypothesized that, similar to the Lgr5+ cells in the intestines, Lgr5+ cells in the pancreas may also be the origin of the β cell progenitors as detected after injury To test this hypothesis, we performed PDL in in the pancreas of Axin-LacZ and Lgr5-LacZ mice and determined Lgr5 mRNA expression and LacZ staining Interestingly, Lgr5 became readily detectable by qPCR in a post-PDL time course (Fig 26H) Moreover, PDL in Lgr5-LacZ knockin mice resulted in specific activity of the reporter in the buds of regenerating ducts (indicated by the asteriks), as demonstrated by X-gal staining (Fig 261) The appearance of Lgr5 expression at sites of active regeneration suggested that Lgr5 might not only mark stem cells in physiological self- renewal (e g in the intestine, stomach or hair follicle), but that its expression may also herald the activation by Wnt of regenerative stem cells/progenitors upon injury
Given the appearance of the Wnt-dependent Lgr5 stem cell marker, we reasoned that adult pancreas progenitors may by expanded in the previously defined gut organoid culture conditions (Sato et al, 2009) Cultures of heterogeneous populations of pancreas cells have been previously established and typically include growth factors such as EGF (Githens et al In Vitro Cell Dev Biol 1989), FGFlO (Miralles et al Proc Natl Acad Sci U S A 1999) and HGF (Lefebvre et al Diabetes 1998, Suzuki et al , Diabetes 53, 2004) and serum supplements such as Gastrin (Rooman et al Gastroenterology 2001), Nicotinamide (Rooman et al Diabetologia 2000) and others A number of such cultures resulted in the in vitro generation of cells with a β cell-like phenotypes (Bonner-Weir et al , 2000, Seaberg et al , 2004, Suzuki et al , 2004) that under certain conditions were able to reverse hyperglycemia when transplanted in diabetic mice (Hao et al , 2006, Ramiya et al , 2000) Most of these approaches start with mixed cell populations that undergo senescence over time It appears fair to say that no robust, long-term culture system exists today which maintains robust expansion of defined, non-transformed adult pancreas progenitors over long periods of time that maintain the capacity to differentiate along the endocrine lineage
We first attempted to grow purified duct fragments in Expansion Medium (EM) As shown in Figure 27A, small duct fragments immediately underwent expansion into cyst-like structures undergoing continuous budding, while islets (data not shown) and acini (bottom panel) gradually disintegrated The cultures expand 10-fold/week (and are passaged weekly) for over 30 weeks Multiple growth factors have been tested to determine the required signals for optimal expansion of pancreatic cells in vitro (Fig 27B) Clearly, in the absence of EGF, cultures disintegrated after 7 days Also the absence of R-spondin or FGFlO reduced the viability of the cultures after 14 days In contrast, Noggin, a BMP inhibitor, did not have any effect on the sustained growth of pancreatic fragments The addition of Nicotinamide, Exendin4, Gastrin to the expansion medium was not essential but resulted in an increase in culture efficiency (data not shown)
Since we demonstrated that Wnt signaling was activated upon PDL, the effect of addition of a Wnt agonist to freshly isolated pancreatic fragments in vitro on sustained growth was determined When ducts were isolated from Axin2-LacZ mice, the entire budding cysts stained blue only in the presence of the Wnt agonist Rspondinl (Fig 27C), resembling the situation in wiσ after PDL (Fig 26D and E) No blue staining was observed in freshly isolated islets or acini from Axin2-LacZ pancreas In line with the in \ no observations upon PDL, only the buds of Lgr5-LacZ cysts stained blue (Fig 27D) Moreover, cultuπng of pancreatic Lgr5-LacZ organoids for 14 days in the presence of R-spondin increased the percentage of Lgr5+ cells significantly (Fig 27E) Importantly, when pancreatic fragments were cultured in the absence of R-Spondin in EM, organoids cease to proliferate within 1 month, whereas in the presence of R- spondin, they can be expanded for an unlimited time period These observations imply that Wnt-responsive progenitors located near ducts fueled the growth of the budding cysts, which were subsequently maintained by Lgr5-expressιng cells with stem cell-like properties To test this notion directly we sorted Axin2-LacZ positive cells from mice 7 days post PDL and found that these cells efficiently initiated budding cysts that were indistinguishable from duct-initiated cysts (Fig 28) The single cells require the presence of Wnt3a in the medium Comparison of culture efficiency in the presence of absence of Wnt3A after single cell dissociation showed that the single cells cultured in the absence of Wnt3A initially grow as small cyst structures, but stop proliferation after 2-4 days This is not the case for pancreas cultures started from isolated pancreas fragments Interestingly, the Wnt3A could be removed after 4 days, indicating that either this signal was no longer necessary to stimulate growth or that the production of Wnt3A was initiated by cells derived from the single sorted cells the culture had started with
We then attempted to assess the potential of the budding cysts to generate endocrine lineage cells To this end, we tested a number of changes to the EM to define a
Differentiation Medium (DM) A series of factors was tested for their effect on the differentiation into the endocrine lineages The removal of FGFlO seemed to be crucial to the induction of differentiation Only in the absence of FGFlO did the islet luce structures appear (Fig 29A), which corresponded with the expression of several differentiation markers for β cell progenitors (Ngn3), β cells (Insulin), glucagon (α cells) and somatostatin (δ cells) appear (Fig 29B and C) Moreover, differentiation markers, such as Glucokinase, Pax6 and Chromogranin A were upregulated starting 10 days after exposure to the DM medium Therefore, DM optimally consisted of at least EGF and R-Spondin and did not have any FGF7 or 10 present The sustained expression of Lgr5, a stem cell marker, under differentiation conditions can be explained by the presence of R-spondin, a Wnt agonist, in DM, since Lgr5 is a Wnt responsive gene When cells were cultured in presence of Nicotinamide in EM, it was also important to remove this from the medium as well to obtain full differentation When budding cysts after any period of culture were transferred from EM to DM, the cysts underwent a stereotypic "involution" process Progressive inward folding of the wall lead to impaction of the cyst into a smaller compact body with morphological resemblance to an islet (Fig 29D) Islet-like morphology was confirmed by markers for β cell islets such as Insulin and C-peptide (Fig 29E) To confirm the dependence of this step of the regeneration process on Wnt signaling, pancreatic fragments were cultured in DM in the absence or presence of R-spondin. Importantly, β cell progenitors, as demonstrated by expression of Ngn3, were only detectable in the presence of R- spondin (Fig 29F).
Example 8 In vitro expansion of human pancreas fragments During embryonic pancreas development, neurogenin3+ or insulin expressing cells were seen in the pancreas ductal network, and it was suggested that pancreas duct cells give rise to endocrine progenitors and consequently mature endocrine cells. It has been shown that human pancreas duct cells differentiate into glucose responsive insulin producing cells in vitro (Bonner-Weir, S et al 2000 PNAS), and this finding made pancreas duct cells attractive source for beta cells replace therapy However, it has been difficult to expand duct cells without losing endocrine differentiation capacity. In the previously reported culture system, human pancreas duct cells lost epithelial property or underwent senescence after 2 weeks up to 5 weeks (Trautmann B et al. Pancreas vol.8 248-254). . Therefore, there is no robust culture system to expand human pancreas duct cells, which retain endocrine differentiation ability Taking advantage of establishment of mouse pancreas organoid culture system, here, we attempted to establish human pancreas organoid culture system.
Growth of human pancreatic progenitors in vitro
Human pancreas was obtained from Leiden University Medical Center, The Netherlands Importantly, under the same conditions as described for mouse pancreas fragments above (example 7), human freshly isolated pancreas fragments can also be grown in vitro (Fig. 30).
Under these expansion conditions, the culture efficiency of the pancreatic fragments was appr. 80%, meaning that 80% of the freshly isolated pancreatic fragments were efficiently expanded in vitro for a longer period of time. As compared with mouse pancreas, acinar tissue more easily forms cyst structures, however, these structure ceased to proliferate within 4 weeks. Pancreas duct cells from larger ductular network more efficiently produce cyst structures and eventually form organoids with bud. The pancreas organoids were splitted 1 :5 ratio once per week and maintained in vitro at least 5 weeks without losing proliferation ability. In summary, we established human pancreas organoids culture system and succeeded in expansion of pancreas duct cells at least 3000 times from original volume We are optimizing endocrine differentiation culture condition for human pancreas duct cells, and this in vitro approach, once optimized, might be important implications for making beta cell replacement therapy available to a larger number of people with type 1 and 2 diabetes melhtus.
References Abe K, Watanabe S. ( 1995) Apoptosis of mouse pancreatic acinar cells after duct ligation Arch Histol Cytol 58 221-9
Apelqvist A, Li H, Sommer L, Beatus P, Anderson DJ, Honjo T, Hrabe de Angelis M,
Lendahl U, Edlund H (1999) Notch signalling controls pancreatic cell differentiation.
Nature 400:877-81. Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth
A, Korving J, Begthel H, Peters PJ, Clevers H (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5 Nature. 449: 1003-7.
Bonner-Weir, S., and Weir, G. C (2005) New sources of pancreatic beta-cells Nat.
Biotechnol 23, 857-861 Bonner-Weir, S , Taneja, M., Weir, G. C, Tatarkiewicz, K., Song, K H , Sharma, A , and O'Neil, J.J. (2000). In vitro cultivation of human islets from expanded ductal tissue Proc Natl. Acad. Sci. USA 97, 7999-8004.
Bouwens, L., and Rooman, I. (2005) Regulation of pancreatic beta-cell mass. Physiol
Rev 85, 1255-1270. Dor, Y., Brown, J., Martinez, O I., and Melton, D A. (2004). Adult pancreatic beta- cells are formed by self-duplication rather than stem-cell differentiation. Nature 429,
41-46
Githens S, Schexnayder JA, Desai K, Patke CL. (1989) Rat pancreatic interlobular duct epithelium: isolation and culture in collagen gel In Vitro Cell Dev Biol. 25 679-88. Gradwohl, G., Dieπch, A , LeMeur. M , and Guillemot, F. (2000). neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas Proc
Natl Acad Sci. USA 97, 1607-161 1 Gu, G , Dubauskaite, J , and Melton, D A (2002) Direct evidence for the pancreatic lineage NGN3+ cells are islet progenitors and are distinct from duct progenitors Development 129, 2447-2457
Hao, E , Tyrberg, B , Itkin-Ansaπ, P , Lakey, J R , Geron, I , Monosov, E Z , Barcova, M , Mercola, M , and Levine, F (2006) Beta-cell differentiation from nonendocrine epithelial cells of the adult human pancreas Nat Med 12, 310-316 Jaks V, Barker N, Kasper M, van Es JH, Smppert HJ, Clevers H, Toftgard R (2008) Lgr5 marks cycling, yet long-lived, hair follicle stem cells Nat Genet 40 1291-9 Lefebvre VH, Otonkoski T, Ustinov J, Huotaπ MA, Pipeleers DG, Bouwens L (1998) Culture of adult human islet preparations with hepatocyte growth factor and 804G matrix is autogenic for duct cells but not for beta-cells Diabetes 47 134-7 Lustig B, Jerchow B, Sachs M, Weiler S. Pietsch T, Karsten U, van de Weteπng M, Clevers H, Schlag PM, Birchmeier W, Behrens J (2002) Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors Lustig B, Jerchow B, Sachs M, Weiler S, Pietsch T, Karsten U, van de Weteπng M, Clevers H, Schlag PM, Birchmeier W, Behrens J MoI Cell Biol 1 184-93 Miralles F, Czernichow P, Ozaki K, Itoh N, Scharfmann R (1999) Signaling through fibroblast growth factor receptor 2b plays a key role in the development of the exocrine pancreas Proc Natl Acad Sci U S A 96 6267-72 Ramiya, V K , Maraist, M , Arfors, K E . Schatz, D A , Peck, A B , and Cornelius, J G (2000) Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells Nat Med 6, 278-282
Rooman I, Heremans Y, Heimberg H, Bouwens L (2000) Modulation of rat pancreatic acinoductal transdifferentiation and expression of PDX-I in vitro Diabetologia 2000 Jul,43(7) 907-14
Rooman I, Lardon J, Flamez D, Schuit F, Bouwens L (2001) Mitogenic effect of gastrin and expression of gastrin receptors in duct-like cells of rat pancreas Gastroenterology 121 940-9 Sato T, Vπes RG, Smppert HJ, van de Weteπng M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ, Clevers H (2009) Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche Nature 459 262-5 Schwitzgebel, V M , Scheel, D W , Conners, J R , Kalamaras, J , Lee, J E , Anderson, D J , Sussel, L , Johnson, J D , and German, M S (2000) Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 127, 3533— 3542.
Seaberg, R. M., Smukler, S R., Kieffer, T J., Enikolopov, G., Asghar, Z., Wheeler, M B., Korbutt, G., and van der Kooy, D. (2004). Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nat. Biotechnol. 22, 1 1 15-1 124.
Suzuki, A., Nakauchi, H , and Taniguchi, H. (2004). Prospective isolation of multipotent pancreatic progenitors using flow-cytometπc cell sorting. Diabetes 53, 2143-2152. Teta, M , Rankin, M M., Long, S Y , Stein, G.M , and Kushner, J.A. (2007). Growth and regeneration of adult beta cells does not involve specialized progenitors. Dev. Cell 12, 817-826.
Trautmann B, Schlitt HJ, Hahn EG, Lohr M (1993) Isolation, culture, and characterization of human pancreatic duct cells. Pancreas 8:248-54. Wang, R.N , Kloppel, G., and Bouwens, L ( 1995) Duct- to islet-cell differentiation and islet growth in the pancreas of duct-ligated adult rats Diabetologia 38, 1405-141 1 Xu X, D'Hoker J, Stange G, Bonne S, De Leu N, Xiao X, Van de Casteele M, Mellitzer G, Ling Z, Pipeleers D, Bouwens L, Scharfmann R. Gradwohl G, Heimberg H (2008) Beta cells can be generated from endogenous progenitors in injured adult mouse pancreas Cell 132(2) 197-207
Example 9 Cultuπng of human small intestinal or colon crypts in vitro
As described in examples 1 and 2 it is now for the first time possible to generate long time culture conditions for mouse small intestine and colon epithelium. Crypt-villus organoids grow through the supplementation of a set of divined growth factors and an extracellular matrix The organoids contain intestinal stem cells that actively divide and giving rise to all major differentiated cell lineages present in the intestine. In this example we show that these culture conditions are not unique to the mouse intestinal epithelium but can also be used to grow human intestinal epithelium. Material and Methods
Mouse colon organoid cultures
Mouse organoid cultures were cultured as described in example 1 Inhibitor of Wnt production (IWP-2) was used to inhibit Wnt secretion (Chen et al, Nat Chem Biol 2009 Feb,5(2) 100-7)
Human colon organoid cultures
Human colon crypts were isolated from resected normal colonic specimen and cultured as organoid structures for 7 days using the established organoid culture system (Sato et al , 2009 Nature May 14,459(7244) 262-5) Since this protocol was optimized for mouse derived organoid cultures, we made a small change by the addition of Wnt3a conditioned medium, in order to ensure optimal growth of the human colon organoids To obtain this conditioned medium, Wnt3a is expressed in a cell line by transfecting a suitable expression construct encoding said ligand Said cell line is cultured and the culture medium comprising the secreted ligand is harvested at suitable time intervals For example, cells start the production of Wnt3a at the moment they reach confluency and stop growing Culture medium from cells that were not transfected or infected with said empty expression construct was used as a negative control The conditioned medium was harvested and tested, for example in an assay wherein luciferase expression in controlled by TCF responsive elements to quantitate the presence of a Wnt agonist such as Wnt3a (Koπnek et al , 1997 Science 275 1784-1787)
Results The proliferation of the intestinal epithelium is dependent on the Wnt signalling pathway The exact location of the Wnt source is however unclear (Gregoπeff and Clevers, 2005, Genes Dev Apr 15, 19(8) 877-90) Since the mouse intestinal organoids grew in a niche independent fashion (Sato et al , 2009 Nature May 14,459(7244) 262- 5) we assumed that these organoids may produce their own Wnt ligands To test this we inhibited Wnt secretion through incubation with a porcupine inhibitor Porcupine is important for the Wnt secretion (schematic figure 31A) Incubation with 1 μM FWP (Chen et al, Nat Chem Biol 2009 Feb,5(2) 100-7) resulted in death of the organoids (Fig 31 B and C) The organoids could be rescued by addition of Wnt3a conditioned medium, indicating that the organoids indeed procuce Wnt Iigands (Fig 31 D and E)
We next tried to culture human intestinal organoids It turned out that the addition of Wnt3a to the medium was necessary because without, crypt organoids never formed budding structures and died within 5- 10 days for the small intestine and in 3-4 days for the colon (Figure 32) Overall the human intestinal crypt organoids grew in a comparable fashion to the mouse organoids cultures Typically, we obtained up to 80% culture efficiency depending on activity of Wnt-3a conditioned medium The human intestinal cultures have been in culture for up to 3 months The effect of Wnt-3a in human colon was expected, as it was observed also to enhance the effects in mouse colon organoid culture The requirement of Wnt-3a in human small intestine and colon may come from lower production of endogenous Wnt Iigands by the human organoids, due to the lower numbers of Paneth cells present in the human gut as compared with mouse intestine So far, there was no reproducible long term human intestinal culture system, and our culture system is useful not only to understand human intestinal stem cell biology but also to apply clinic orientated test, such as drug screening
Example 10 Optimized culture conditions for the growth of stomach organoids
As described in example 5 a culture medium has been identified which can be used to culture stomach epithelium for long periods Here we describe the optimized conditions for these stomach organoid cultures
Materials and Methods
Gastric unit isolation, single cell dissociation and EGFP+ve cell sorting Gastric glands were isolated from mouse pylorus regions as previously described with some modifications (Bjerknes and Cheng, 2002, Am J Physiol Gastrointest Liver Physiol Sep, 283(3) G767-77) Briefly, under the microscope, the stomach was opened along the greater curvature, washed with saline solution and the pylorus isolated The muscular layer of the stomach was removed and the remaining epithelia was divided into 5 mm pieces and incubated for 3-5 h in a buffered saline solution (Na2HPO4 28 mM, KH2PO4 40 mM, NaCl 480 mM, KCl 8 niM, Sucrose 220 mM, D-Sorbitol 274 mM, DL-Dithiotreitol 2 6 mM) containing 10 mM EDTA (for culturing or staining) or 5mM EGTA (for RNA isolation) at 4°C After removal of the chelatingagent, the tissue fragments were vigorously suspended in the buffered solution using a 10 ml pipette After suspension and centπfugation, the sediment was enriched in gastric glands After gland isolation, cells were collected and resupended in calcium-free SMEM medium (Invitrogen), supplemented with 10 mg/ml Trypsine and 0 8 Units/μl DNAse I (for microarray analysis) or resuspended in TrypleExpress (GIBCO) supplemented with 0 8Units/ul DNAase (for culturing purposes) In both cases, after incubation at 37 0C for 20-25 minutes, cells were spun down, and filtered through a 40 μM mesh EGFPhi and EGFPIo cells were sorted by flow cytometry (MoFIo, Beckman Coulter) Single viable epithelial cells were gated by forward scatter and pulse-width parameter Where stated, cells were either gated for negative staining of propidium iodide, collected in Tπzol LS (Invitrogen) and RNA isolated according manufacturers' protocol or collected in gastric culture medium, embedded in Matπgel (BD Bioscience) and cultured according to the protocol detailed below
Gastric culture
For culturing, isolated gastric glands were counted and a total of 100 glands mixed with 50 ul of Matπgel (BD Bioscience) and plated in 24-well plates After polymerization of Matπgel, gastric culture medium (Advanced DMEM/F12 supplemented with B27, N2 and nAcetylcistein (Invitrogen) containing growth factors (50 ng/m EGF (Peprotech), 1 ug/ml R-spondinl , 100 ng/ml Noggin (Peprotech), 100 ng/ml FGFlO (Preprotech) and Wnt3A conditioned media) was overlaid For the single cell culture, a total of 100 sorted EGFPh, cells /well were collected in gastric culture medium and embedded in Matπgel (BD Bioscience) After polymerization of Matπgel, gastric culture media was overlaid For the first 2 days after seeding, the media was also supplemented with 10 μM ROCK inhibitor Y-27632 (Sigma Aldπch), to avoid anoikis Growth factors were added every second day and the entire medium was changed every 4 days For passage, gastric organoids were removed from Matπgel, mechanically dissociated and transferred to fresh Matπgel Passage was performed every 1 -2 weeks with a 1 5- 1 8 split ratio To confirm the Wnt3A requirement, mouse Wnt3A recombinant protein (Stem cell technologies) was supplemented instead of the Wnt3A conditioned media For the in-vitro tracing experiments, 2-week old gastric organoids were incubated with 100 nM of 4-hydroxytamoxifen in gastric culture medium for 20 h to activate Lgr5- CreERT2 YFP was subsequently visualized and recorded in live organoids using confocal microscopy (Leica, SP5)
Wnt3a conditioned media
The Wnt3a media was prepared following protocol described elsewhere (Willert et al ,
2003, Nature May 22,423(6938) 448-52) The TOP/FOP assay was used to test the Wnt activity of the Wnt3a conditioned media and the Control conditioned media, as described by van de Weteπng and colleagues (van de Weteπng et al , 2001 Cancer Res Jan 1 ,61( 1) 278-84) A TOP/FOP ratio > 50 was considered high Wnt media and diluted 1 1 with the gastric organoid culture media A 1 10 dilution of this high Wnt3a media (TOP/FOP ratio ~ 5) was considered low Wnt media and used for differentiation purposes
Gastric organoid immunohistochemistry
For immunohistochemistry gastric organoids were washed once with PBS and immediately fixed with Paraformaldehyde 4% for 15-20 min at RT When stated gastric organoids were embedded in paraffin and processed using standard techniques For whole mount staining, samples were permeabilized with PBS 0 5% Tπton-XlOO- 1%BSA and incubated o/n with the primary antibodies Following several washes in PBS 0,3% Triton X lOO, samples were incubated with the secondary antibody EdU staining was performed following manufacturer's instructions (Click-IT, Invitrogen) Nuclei were stained with TOPRO3 iodine or Hoescht33342 The images of gastric glands and gastric organoids were acquired using confocal microscopy (Leica, SP5) Three-dimensional reconstruction was performed using Volocity Software (Improvision)
RT-PCR
RNA was extracted from gastric cell cultures or freshly isolated tissue using the RNeasy Mini RNA Extraction Kit (Qiagen) and reverse-transcribed using Moloney Murine Leukemia Virus reverse transcriptase (Promega) cDNA was amplified in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, London, UK) as previously described (Huch et al., 2009). Primers used are shown below (Gene symbol followed by Forward (5'-3') and Reverse (5'-3') primers)
Lgr5 GGAAATGCTTTGACACACATTC, GGAAGTCATCAAGGTTATTATAA Gif: TGAATCCTCGGCCTTCTATG, CAGTTAAAGTTGGTGGCACTTC Pgc: CCAACCTGTGGGTGTCTTCT, TTAGGGACCTGGATGCTTTG Muc6 TGCATGCTCAATGGTATGGT, TGTGGGCTCTGGAGAAGAGT
Muc5ac CCATGAAGTGGGAGTGTGTG, TTGGGATAGCATCCTTCCAG Ghrl GCCCAGCAGAGAAAGGAATCCA, GCGCCTCTTTGACCTCTTCC
Gast GCCAACTATTCCCCAGCTCT, GGCTCTGGAAGAGTGTTGCT Stt: GAGGCAAGGAAGATGCTGTC, GGGCATCATTCTCTGTCTGG Muc2 GAACGGGGCCATGGTCAGCA, CATAATTGGTCTTGCATGCC Cdx2: CTTGCTGCAGACGCTCAAC, TCTGTGTACACCACCCGGTA Hprt AAGCTTGCTGGTGAAAAGGA, TTGCGCTCATCTTAGGCTTT
Results
To determine optimal growth of gastic units in vitro we isolated gastric gland units which were suspended in Matπgel and cultured under different conditions Gastric culture growth conditions were similar to those of the small intestine cultures
(including EGF, Noggin and R-spondin 1), except for a strict dependence on Wnt3A in the form of conditioned media This requirement was confirmed using purified Wnt3a protein (fig 33A). Furthermore, FGFlO proved to be an essential component for driving budding events and for the expansion of the cultures into multi-unit organoids (fig 33B). FGFlO can be used to replace FGF7 (KGF), which has been used in example 5, and even results in a 2-fold increase of % of budding organoids 4 days after the start of the culture (fig 33C). The newly-formed gastric organoids underwent continuous budding events, whilst maintaining their polarity, with gastric gland-domain buds distributed around a central lumen (fig 33D). In the absence of Wnt3A conditioned medium, the gastric organoids rapidly deteriorated (fig 33E). Each week, organoids were mechanically dissociated and split to one-fifth of their pre-plating density. Cultured pyloric units were single-layered epithelial structures, as evidenced by E-Cad staining (fig 33F). We have successfully cultured gastric organoids for at least 8 months without any detectable loss of the properties described above.
To determine whether gastric Lgr5+ve cells (Fig 34A) were capable of generating and maintaining pyloric gastric glands units in vitro we sorted Lgr5-EGFP high cells (Fig 34B). When single Lgr5-EGFP high cells were sorted, an average of 8 % of the cells grew into organoids, whereas the remaining cells died within the first 24 h The sorted Lgr5-EGFPhi cells rapidly began dividing and small cyst-like structures were already visible after 5 days. During the following days, the newly-formed (cyst-like) structures started to generate gland-like domains (Figure 34C). After 9-1 1 days in culture, gastric organoids were dissociated manually and split to generate new organoids Gastric organoids derived from single cells have been successfully re-plated on a weekly basis for at least 3 months, without losing the properties described (Figure 34D). From day 7 onwards, Lgr5-EGFP expression was restricted to the base of the gland-like domains (Figure 34E) As evidenced by EdU staining, proliferating cells were located at the base of these gland-like domains (Figure 34F), while apoptotic caspase 3-positive cells were found extruded into the lumen (data not shown). Lineage tracing was studied in established organoids derived from single Lgr5+ve cells isolated from an Lgr5-EGFP- ires-CreERT2/Rosa26-YFP reporter mouse. Following tamoxifen induction, the YFP+ve reporter gene was rapidly activated in single Lgr5+ve cells within the gland- like domains Over the next few days, the YFP expression domain expanded considerably within the growing organoids, confirming the contribution of the Lgr5+ve stem cells to organoid growth in-vitro (Figure 34G) The organoids derived from single-cell cultures were single-layered epithelial structures, as evidenced by E- cadheπn staining (Figure 341). In addition to Lgr5, the cultures expressed the gastric epithelial markers Gastric intrinsic Factor, Mucin 6 and Pepsinogen C No differentiation to the pit or enteroendocrine lineages was observed under these culture conditions (This is different from example 5 were the pit cell lineage was observed. However in that example Wnt3a protein was used instead of Wnt conditioned medium which is less active. Lowering the Wnt conditioned medium concentration results in differentiation into the pit cell lineage, see below) Reduction of the Wnt3A concentration in the culture media resulted in the formation of comparable gastric structures harbouring polarized pit cells, as evidenced by the expression of the gastric mucin 5AC (MUC5AC) and Periodic acid-Schiff (PAS), mucus neck cells, as demonstrated by Tff2 expression and some scattered immature enteroendocrine cells (Chromogranin A) (Figure 34H,I). Addition of additional growth factors like: RA, IGF and exendin4 may result into more mature differentiation of stomach cultures towards the various cell lineages. Taken together, these ιn-vivo and in-vitro observations demonstrate that Lgr5 is marking a previously unappreciated population of self- renewing, multipotent adult stem cells in the pyloric stomach
Reference
1. Barker, N. et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1003-7 (2007).
2. Bjerknes, M. & Cheng, H. Intestinal epithelial stem cells and progenitors. Methods Enzymol 419, 337-83 (2006).
3. Barker, N , van de Weteπng, M. & Clevers, H. The intestinal stem cell Genes Dev 22, 1856-64 (2008). 4. Evans, G S., Flint, N., Somers, A S , Eyden, B & Potten, C S The development of a method for the preparation of rat intestinal epithelial cell primary cultures. J Cell Sci 101 ( Pt 1), 219-31 ( 1992).
5. Whitehead, R. H , Demmler, K., Rockman, S. P. & Watson. N. K. Clonogenic growth of epithelial cells from normal colonic mucosa from both mice and humans Gastroenterology 1 17, 858-65 (1999).
6 Fukamachi, H Proliferation and differentiation of fetal rat intestinal epithelial cells in primary serum-free culture J Cell Sci 103 ( Pt 2), 51 1-9 ( 1992)
7. Perreault, N. & Jean-Francois, B. Use of the dissociating enzyme thermolysin to generate viable human normal intestinal epithelial cell cultures. Exp Cell Res 224, 354- 64 ( 1996)
8. Koπnek, V et al Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nat Genet 19, 379-83 (1998).
9. Pinto, D., Gregoπeff, A , Begthel, H & Clevers, H Canonical Wnt signals are essential for homeostasis of the intestinal epithelium. Genes Dev 17, 1709- 13 (2003) 10 Kuhnert, F. et al Essential requirement for Wnt signaling in proliferation of adult small intestine and colon revealed by adenoviral expression of Dickkopf- 1 Proc Natl
Acad Sci U S A 101 , 266-71 (2004)
1 1. Kim, K. A et al Mitogenic influence of human R-spondinl on the intestinal epithelium Science 309, 1256-9 (2005). 12 Dignass, A U. & Sturm, A Peptide growth factors in the intestine Eur J
Gastroenterol Hepatol 13, 763-70 (2001).
13 Haramis, A P et al De novo crypt formation and juvenile polyposis on BMP inhibition in mouse intestine. Science 303, 1684-6 (2004). 14. Hofmann, C. et al. Cell-cell contacts prevent anoikis in primary human colonic epithelial cells. Gastroenterology 132, 587-600 (2007).
15. Sasaki, T., Giltay, R , Talts, U., Timpl, R. & Talts, J. F Expression and distribution of laminin alpha 1 and alpha2 chains in embryonic and adult mouse tissues an immunochemical approach. Exp Cell Res 275, 185-99 (2002)
16 Stingl, J., Eaves, C. J., Zandieh, I & Emerman, J. T. Characterization of bipotent mammary epithelial progenitor cells in normal adult human breast tissue. Breast Cancer Res Treat 67, 93- 109 (2001)
17. St Clair, W. H & Osborne, J W. Crypt fission and crypt number in the small and large bowel of postnatal rats Cell Tissue Kinet 18, 255-62 (1985)
18. Batlle, E et al Beta-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephπnB. Cell 1 1 1 , 251-63 (2002)
19 Sπnivas, S. et al. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1 , 4 (2001) 20 Soriano, P Generalized lacZ expression with the ROSA26 Cre reporter strain Nat Genet 21. 70- 1 (1999)
21. Stingl, J. et al. Purification and unique properties of mammary epithelial stem cells Nature 439, 993-7 (2006).
22. Watanabe, K. et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells Nat Biotechnol 25, 681-6 (2007).
23 van Es, J H. et al. Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435, 959-63 (2005)
24 Li, L. et al The human homolog of rat Jagged 1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch 1 Immunity 8, 43- 55 ( 1998)
25 Cheng, H. & Leblond, C. P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. I. Columnar cell Am J Anat 141 , 461- 79 ( 1974)
26. Powell, D. W. et al Myofibroblasts. II. Intestinal subepithelial myofibroblasts. Am J Physiol 277, C 183-2O1 (1999)
27. Yen, T H. & Wright, N A The gastrointestinal tract stem cell niche Stem Cell Rev 2, 203- 12 (2006). 28. Kedinger, M. et al. Intestinal epithelial-mesenchymal cell interactions. Ann N Y Acad Sci 859, 1- 17 (1998).
29. Spradling, A., Drummond-Barbosa, D. & Kai, T. Stem cells find their niche. Nature 414, 98- 104 (2001). i 30 Li, L. & Xie, T. Stem cell niche: structure and function. Annu Rev Cell Dev Biol 21 , 605-31 (2005).
31. Binnerts ME et al, PNAS, 104.14700-5 (2007).
32. Sawada et al. Int J Exp Pathol;72:407-21 ( 1991).

Claims

Claims
1 A crypt-villus organoid, comprising a central lumen lined by a villus-like epithelium or a colon crypt organoid
2 A method for cultuπng epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells, or adenoma cells, the method comprising providing an extracellular matrix, incubating an epithelial stem cell, an isolated tissue fragment comprising said epithelial stem cells, or an adenoma cell with the extracellular matrix, cultuπng the stem cell, isolated tissue fragment, or adenoma cell in the presence of a cell culture medium, comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, between 5 and 500 ngram/ml of a mitogenic growth factor, whereby a Wnt agonist is added if epithelial stem cells and isolated tissue fragments are cultured
3 A method according to claim 2, in which the BMP inhibitor is Noggin, the mitogenic growth factor is Epidermal Growth Factor and Keratinocyte Growth Factor, and the
Wnt agonist is R-spondin 1
4 A method of claim 2, wherein said BMP inhibitor is selected from Noggin, DAN, and DAN-like proteins including Cerberus and Gremlin
5 A method according to claim 2 or 4, wherein said Wnt agonist is selected from one or more of Wnt, R-spondin 1-4, Norrin, and a GSK-inhibitor
6 A method according to claims 2 and 3-5, wherein said Wnt agonist comprises R- spondin 1 and Wnt-3a and/or said mitogenic growth factor is EGF
7 A method of any one of claims 2 to 6, wherein said culture medium further comprises a Rock (Rho-kinase) inhibitor, selected from Y-27632, Fasudil, and H l 152 8 A method according to any of claims 2 to 7, wherein said culture medium further comprises a notch agonist
9 A method for obtaining and/or cultuπng a colon crypt , preferably according to any one of claims 2 to 8 , wherein
- epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellular matrix in a medium comprising Noggin, EGF, and R-spondin 1 and/or Wnt-3 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein
10 A method preferably according to any one of claims 2 to 8, for obtaining and/or cultuπng a pancreatic organoid wherein
- epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellular matrix in a first step in a medium comprising EGF. KGF or FGF, and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein ,
- subsequently in a second step in a medium comprising EGF and R-spondin 1 as Wnt agonist, supplemented with B27, N2, and N-Acetylcystein
1 1 A method for obtaining and/or cultuπng a gastric fragment , preferably according to any one of claims 2 to 8, wherein
- epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells or adenoma cells are cultured in contact with an extracellularmatπx in a first step in a medium comprising Noggin as BMP inhibitor, Epidermal Growth Factor and FGFlO as mitogenic growth factor, R-spondin 1 and Wnt-3a as Wnt agonist, and further comprising B27, N2, N-Acetylcystein,
- subsequently in a second step in a medium comprising Epidermal Growth Factor and R-spondin 1 and Wnt-3a as Wnt agonist, Noggin and FGFlO supplemented with B27, N2, and N-Acetylcystein, wherein the concentration of Wnt-3 is reduced in the second step by comparison to the Wnt-3a concentration as present in the first step 12 A cell culture medium, comprising a basal medium for animal or human cells to which is added
a Bone Morphogenetic Protein (BMP) inhibitor, a Wnt agonist, and between 5 and 500 nanogram/ml of Epidermal Growth Factor (EGF)
13 Use of a culture medium according to claim 12 for culturing epithelial stem cells, or isolated tissue fragments on an extracellular matrix
14 A crypt-villus organoid, comprising a central lumen lined by a villus-like epithelium or a colon crypt organoid obtainable by a method as defined in claims 2 to 9
15 A pancreatic organoid, comprising islet-like structures, preferably obtainable by a method as defined in claims 2 to 8 or 10
16 A gastric organoid, comprising a central lumen, preferably obtainable by a method as defined in claims 2 to 8 or 1 1
17 Use of the crypt-villus organoids or colon crypt of claim 1 or 14, the pancreatic organoids of claim 15, or the gastric organoids of claim 16 in a drug discovery screen, toxicity assay, or in regenerative medicine
18 Use of a cell culture medium comprising a basal medium for animal or human cells to which is added a Bone Morphogenetic Protein (BMP) inhibitor, and between 5 and 500 nanogram/ml of Epidermal Growth Factor (EGF) for culturing adenoma cells
PCT/NL2010/000017 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells. WO2010090513A2 (en)

Priority Applications (25)

Application Number Priority Date Filing Date Title
SG2011055399A SG173492A1 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells.
AU2010211428A AU2010211428B2 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells.
DK10703131.2T DK2393917T3 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells comprising these ORGANOIDER AND STEM CELLS
PL16151949T PL3061808T3 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
CA2751332A CA2751332C (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
EP10703131.2A EP2393917B1 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells.
NZ594271A NZ594271A (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
EP16151949.1A EP3061808B1 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
KR1020117020340A KR101904224B1 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
EP18182285.9A EP3441458B9 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
MX2011008044A MX2011008044A (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells.
US13/147,163 US8642339B2 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising the stem cells
CN201080013109.9A CN102439135B (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
RU2011136704/10A RU2555545C2 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids, containing thereof
BRPI1008086-4A BRPI1008086A2 (en) 2009-02-03 2010-02-03 Cryptovilloid organoid, method for culturing epithelial stem cells, isolated tissue fragments comprising said epithelial stem cells, or adenoma cell, cell culture medium, use thereof, pancreatic organoid, gastric organoid, and use of organoids
EP23176802.9A EP4253529A3 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells
JP2011547839A JP5458112B2 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids containing the stem cells
ES10703131.2T ES2579909T3 (en) 2009-02-03 2010-02-03 Culture medium for epithelial and organoid stem cells comprising said stem cells
US13/194,866 US9752124B2 (en) 2009-02-03 2011-07-29 Culture medium for epithelial stem cells and organoids comprising the stem cells
IL214381A IL214381A (en) 2009-02-03 2011-08-01 Culture medium for epithelial stem cells and organoids comprising said stem cells
HK12104502.9A HK1163746A1 (en) 2009-02-03 2012-05-08 Culture medium for epithelial stem cells and organoids comprising said stem cells
US14/079,545 US10947510B2 (en) 2009-02-03 2013-11-13 Culture medium for epithelial stem cells and organoids comprising the stem cells
HRP20160791TT HRP20160791T1 (en) 2009-02-03 2016-07-05 Culture medium for epithelial stem cells and organoids comprising said stem cells
US15/654,243 US20180072995A1 (en) 2009-02-03 2017-07-19 Culture medium for epithelial stem cells and organoids comprising the stem cells
US16/113,445 US20190100728A1 (en) 2009-02-03 2018-08-27 Culture medium for epithelial stem cells and organoids comprising the stem cells

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US14962209P 2009-02-03 2009-02-03
EP09151970 2009-02-03
EP09151970.2 2009-02-03
US61/149,622 2009-02-03
EP09171831.2 2009-09-30
EP09171831 2009-09-30

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US13/147,163 A-371-Of-International US8642339B2 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising the stem cells
US13/194,866 Continuation-In-Part US9752124B2 (en) 2009-02-03 2011-07-29 Culture medium for epithelial stem cells and organoids comprising the stem cells
US14/079,545 Continuation US10947510B2 (en) 2009-02-03 2013-11-13 Culture medium for epithelial stem cells and organoids comprising the stem cells

Publications (2)

Publication Number Publication Date
WO2010090513A2 true WO2010090513A2 (en) 2010-08-12
WO2010090513A3 WO2010090513A3 (en) 2010-11-25

Family

ID=42144924

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2010/000017 WO2010090513A2 (en) 2009-02-03 2010-02-03 Culture medium for epithelial stem cells and organoids comprising said stem cells.

Country Status (19)

Country Link
US (3) US8642339B2 (en)
EP (4) EP2393917B1 (en)
JP (2) JP5458112B2 (en)
KR (1) KR101904224B1 (en)
CN (1) CN102439135B (en)
AU (1) AU2010211428B2 (en)
CA (1) CA2751332C (en)
DK (2) DK2393917T3 (en)
ES (2) ES2579909T3 (en)
HK (1) HK1163746A1 (en)
HR (2) HRP20230650T1 (en)
HU (2) HUE028647T2 (en)
IL (1) IL214381A (en)
MX (1) MX2011008044A (en)
NZ (1) NZ594271A (en)
PL (3) PL3061808T3 (en)
RU (1) RU2555545C2 (en)
SG (1) SG173492A1 (en)
WO (1) WO2010090513A2 (en)

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012115254A (en) * 2010-11-11 2012-06-21 Osaka Univ Three-dimensional structural body of cell and method for producing the same
WO2012140274A2 (en) 2011-04-14 2012-10-18 Koninklijke Nederlandse Akademie Van Wetenschappen Compounds
CN102787094A (en) * 2011-05-17 2012-11-21 李晖 Culture medium, kit used for culturing cells and method for culturing cells
WO2012168930A2 (en) 2011-06-10 2012-12-13 Koninklijke Nederlandse Akademie Van Wetenschappen (Knaw) Culture media for stem cells
WO2013063588A1 (en) * 2011-10-28 2013-05-02 The Board Of Trustees Of The Leland Stanford Junior University Ex vivo culture, proliferation and expansion of primary tissue organoids
WO2013093812A2 (en) 2011-12-19 2013-06-27 Umc Utrecht Holding B.V. A rapid quantitative assay to measure cftr function in a primary intestinal culture model
US8642339B2 (en) 2009-02-03 2014-02-04 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
WO2014131033A1 (en) 2013-02-25 2014-08-28 Genentech, Inc. Liquid culturing of epithelial stem cells
EP2772534A1 (en) 2011-10-27 2014-09-03 National University Corporation Tokyo Medical and Dental University Technique for isolating/culturing colorectal epithelial stem cell, and technique for transplanting colorectal epithelium employing said technique
WO2014152321A1 (en) 2013-03-15 2014-09-25 The Jackson Laboratory Isolation of non-embryonic stem cells and uses thereof
WO2015021358A2 (en) 2013-08-09 2015-02-12 Dominique Charmot Compounds and methods for inhibiting phosphate transport
WO2015173425A1 (en) * 2014-05-16 2015-11-19 Koninklijke Nederlandse Akademie Van Wetenschappen Improved culture method for organoids
US20150343018A1 (en) * 2012-10-03 2015-12-03 Institut Pasteur Nod2-dependent pathway of cytoprotection of stem cells
WO2015183920A3 (en) * 2014-05-28 2016-01-28 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
WO2016040895A1 (en) 2014-09-12 2016-03-17 xxTHE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY Wnt signaling agonist molecules
US9345486B2 (en) 2009-03-16 2016-05-24 University Of Washington Nanofibrous conduits for nerve regeneration
EP2929013A4 (en) * 2012-12-06 2016-07-20 Stembios Technologies Inc Lgr5+ somatic stem cells
US20160237400A1 (en) * 2013-03-15 2016-08-18 The Jackson Laboratory Isolation of non-embryonic stem cells and uses thereof
WO2017060240A1 (en) 2015-10-05 2017-04-13 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Method and culture medium for ex vivo culturing of epidermis-derived stem cells
US9719068B2 (en) 2010-05-06 2017-08-01 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
US9752124B2 (en) 2009-02-03 2017-09-05 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
US9765301B2 (en) 2010-07-29 2017-09-19 Koninklijke Nederlandse Akademie Van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
US9790471B2 (en) 2015-04-03 2017-10-17 Propagenix Inc. Ex vivo proliferation of epithelial cells
WO2017220586A1 (en) * 2016-06-20 2017-12-28 Koninklijke Nederlandse Akademie Van Wetenschappen Improved differentiation method
US10066201B2 (en) 2015-09-11 2018-09-04 Propagenix Inc. Ex vivo proliferation of epithelial cells
US10100285B2 (en) 2015-04-03 2018-10-16 Propagenix Inc. Ex vivo proliferation of epithelial cells
WO2018218344A1 (en) * 2017-05-29 2018-12-06 Stemcell Technologies Canada Inc. Compositions and methods for obtaining organoids
EP3423565A1 (en) * 2016-03-01 2019-01-09 Koninklijke Nederlandse Akademie van Wetenschappen Improved differentiation method
GB201903573D0 (en) 2019-03-15 2019-05-01 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for head and neck organoids
EP3611257A1 (en) * 2011-08-29 2020-02-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for preparing induced paraxial mesoderm progenitor (ipam) cells and their use
US10668108B2 (en) 2016-11-04 2020-06-02 Children's Hospital Medical Center Compositions and methods of treating liver disease
WO2020169551A1 (en) 2019-02-19 2020-08-27 Miltenyi Biotec B.V. & Co. KG Cell culture medium and method for generation of epithelial organoids from epithelial stem cells
WO2020234250A1 (en) 2019-05-17 2020-11-26 Koninklijke Nederlandse Akademie Van Wetenschappen Improved culture method using integrin agonist
EP3772538A1 (en) 2019-08-09 2021-02-10 Urosphere Method for differentiating epithelial stem cells
EP3789049A1 (en) 2019-09-06 2021-03-10 QGel SA Method for obtaining healthy intestinal organoids
US10961511B2 (en) 2014-11-27 2021-03-30 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for expanding breast epithelial stem cells
WO2021110665A1 (en) 2019-12-04 2021-06-10 Qgel Sa Method and kit for cell growth
US11066650B2 (en) 2016-05-05 2021-07-20 Children's Hospital Medical Center Methods for the in vitro manufacture of gastric fundus tissue and compositions related to same
GB202109913D0 (en) 2021-07-09 2021-08-25 Stichting Hubrecht Organoid Tech Organoid-derived monolayers and uses thereof
US11130943B2 (en) 2014-11-27 2021-09-28 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
WO2021198385A1 (en) 2020-03-31 2021-10-07 Koninklijke Nederlandse Akademie Van Wetenschappen Methods and tools for studying enteroendocrine cells
US11180735B2 (en) 2016-10-28 2021-11-23 The Board Of Trustees Of The Leland Stanford Junior University Methods to preserve tumor-stromal interactions in culture and therapeutic predictive applications thereof
RU2772435C2 (en) * 2016-06-20 2022-05-20 Конинклейке Недерландсе Академи Ван Ветенсаппен Improved differentiation method
US11369607B2 (en) 2014-09-03 2022-06-28 The Brigham And Women's Hospital, Inc. Compositions, systems, and methods for generating inner ear hair cells for treatment of hearing loss
US11415571B2 (en) 2019-12-05 2022-08-16 Tempus Labs, Inc. Large scale organoid analysis
US11561178B2 (en) 2020-04-20 2023-01-24 Tempus Labs, Inc. Artificial fluorescent image systems and methods
US11584916B2 (en) 2014-10-17 2023-02-21 Children's Hospital Medical Center Method of making in vivo human small intestine organoids from pluripotent stem cells
US11617745B2 (en) 2018-08-17 2023-04-04 Frequency Therapeutics, Inc. Compositions and methods for generating hair cells by downregulating FOXO
US11629385B2 (en) 2019-11-22 2023-04-18 Tempus Labs, Inc. Tumor organoid culture compositions, systems, and methods
US11746150B2 (en) 2017-12-19 2023-09-05 Surrozen Operating, Inc. Anti-LRP5/6 antibodies and methods of use
US11767515B2 (en) 2016-12-05 2023-09-26 Children's Hospital Medical Center Colonic organoids and methods of making and using same
WO2023180578A1 (en) 2022-03-25 2023-09-28 Stichting Hubrecht Organoid Technology Methods for co-culturing genotoxic bacteria and organoids
US11773171B2 (en) 2017-12-19 2023-10-03 Surrozen Operating, Inc. WNT surrogate molecules and uses thereof
US11958891B2 (en) 2017-01-26 2024-04-16 Surrozen Operating, Inc. Tissue-specific Wnt signal enhancing molecules and uses thereof
US12006368B2 (en) 2017-12-19 2024-06-11 Surrozen Operating, Inc. Anti-frizzled antibodies and methods of use

Families Citing this family (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2022848A1 (en) 2007-08-10 2009-02-11 Hubrecht Institut A method for identifying, expanding, and removing adult stem cells and cancer stem cells
US9464275B2 (en) * 2008-08-21 2016-10-11 The Board Of Trustees Of The Leland Stanford Junior University Ex vivo culture, proliferation and expansion of intestinal epithelium
US8563307B2 (en) 2009-02-24 2013-10-22 James Wang Treatment of immunosuppression-related disorders
US8679474B2 (en) 2010-08-04 2014-03-25 StemBios Technologies, Inc. Somatic stem cells
WO2012030854A2 (en) 2010-09-01 2012-03-08 Whitehead Institute For Biomedical Research Compositions and methods for modulating emt and uses thereof
JP6122388B2 (en) 2011-02-28 2017-04-26 プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ Cell culture system
TWI614340B (en) 2011-09-28 2018-02-11 幹細胞生物科技股份有限公司 Somatic stem cells and method of preparing same
US20150017134A1 (en) * 2012-03-01 2015-01-15 Whitehead Institute For Biomedical Research Emt-inducing transcription factors cooperate with sox9
US9616101B2 (en) 2012-07-06 2017-04-11 Kyoto Prefectural Public University Corporation Differentiation marker and differentiation control of eye cell
EP2746770A1 (en) 2012-12-21 2014-06-25 Stembios Technologies, Inc. Method for evaluating effect of action on subject based on stem celldynamics
HUE049377T2 (en) * 2013-03-14 2020-09-28 Brigham & Womens Hospital Inc Compositions and methods for epithelial stem cell expansion and culture
WO2014153294A1 (en) * 2013-03-17 2014-09-25 The Regents Of The University Of California Method to expand and transduce cultured human small and large intestinal stem cells
JP6437184B2 (en) * 2013-06-05 2018-12-12 学校法人関西医科大学 Method for isolating tongue epithelial stem cells
JP6253265B2 (en) * 2013-06-05 2017-12-27 学校法人関西医科大学 Method for isolating esophageal epithelial stem cells
US9589445B2 (en) 2013-08-07 2017-03-07 Nike, Inc. Activity recognition with activity reminders
BR102013021202B1 (en) * 2013-08-20 2022-09-06 Ccb - Centro De Criogenia Brasil Ltda PROCESS OF PRODUCTION OF MULTIPOTENTS AND PROGENITOR STEM CELLS
DK3083941T3 (en) * 2013-12-16 2023-03-13 Fresenius Medical Care Deutschland Gmbh PANCREAS ISLAND-LIKE CELL STRUCTURES AND A METHOD OF MANUFACTURE THEREOF
KR102301180B1 (en) * 2014-01-14 2021-09-13 예일 유니버시티 Compositions and methods of preparing airway cells
JP2015149949A (en) * 2014-02-17 2015-08-24 学校法人明治大学 Evaluation method for immunosuppressive agent and evaluation kit for immunosuppressive agent
EP3158056B1 (en) * 2014-06-20 2021-10-06 Rutgers, the State University of New Jersey Single cell-derived organoids
CA2953524A1 (en) * 2014-06-27 2015-12-30 The Regents Of The University Of California Cultured mammalian limbal stem cells, methods for generating the same, and uses thereof
US9777052B2 (en) 2014-12-02 2017-10-03 The Board Of Regents Of The University Of Oklahoma R-spondin variants, compositions, and methods of use
JP6662518B2 (en) * 2015-04-09 2020-03-11 国立大学法人 東京医科歯科大学 Method for maintaining and expanding intestinal interepithelial lymphocytes in vitro
CN104862272B (en) * 2015-05-29 2018-08-10 吉林大学 Application of the Y-27632 inhibitor in the sorting of CD44 positive intestinal stem cells
WO2017036533A1 (en) * 2015-09-03 2017-03-09 Ecole Polytechnique Federale De Lausanne (Epfl) Three-dimensional hydrogels for culturing adult epithelial stem cells and organoids
JP6979946B2 (en) 2015-10-21 2021-12-15 インディアナ ユニバーシティー リサーチ アンド テクノロジー コーポレーションIndiana University Research And Technology Corporation How to Generate Human Inner Ear Sensory Epithelium and Sensory Neurons
JP6376578B2 (en) * 2016-02-18 2018-08-22 学校法人慶應義塾 Cell culture medium, culture method, and organoid
JP7112957B2 (en) * 2016-03-09 2022-08-04 ベイジン パーカンズ オンコロジー カンパニー リミテッド Tumor cell suspension culture and related methods
CN105695394A (en) * 2016-04-07 2016-06-22 中山大学 In vitro culture method of mouse salivary gland organ
CN111349604B (en) * 2016-05-18 2023-12-12 学校法人庆应义塾 Cell culture medium for organoid culture, culture method and organoid
CN105950539B (en) * 2016-05-23 2020-01-07 华东师范大学 Construction method and application of P-glycoprotein model for human small intestine 3D organ research
CN106190980A (en) * 2016-07-12 2016-12-07 张云霞 A kind of special culture media and cultural method being used for In vitro culture esophageal carcinoma tumor organoid based on Human Esophageal Carcinoma
WO2018038042A1 (en) * 2016-08-24 2018-03-01 学校法人慶應義塾 2d organoid for infection and culture of human diarrhea virus, and use of said 2d organoid
US12104174B2 (en) 2016-09-13 2024-10-01 President And Fellows Of Harvard College Methods relating to intestinal organ-on-a-chip
CN110462028A (en) * 2016-11-21 2019-11-15 北京智康博药肿瘤医学研究有限公司 Epithelial tumor cell culture
US10767164B2 (en) 2017-03-30 2020-09-08 The Research Foundation For The State University Of New York Microenvironments for self-assembly of islet organoids from stem cells differentiation
CN107012116A (en) * 2017-05-09 2017-08-04 华东师范大学 A kind of construction method of small intestine 3D organoids research BCRP mediate drug transshipment models and application
CN109136188A (en) * 2017-06-15 2019-01-04 上海集技生物技术有限公司 A kind of culture of biopsy intestinal canal tumour organoid is passed on, is frozen and method for resuscitation and its application
CN108118026A (en) * 2017-11-29 2018-06-05 宁夏医科大学总医院 A kind of isolated culture method and Optimal Medium of people's endometrial glandular epithelial cells
CA3083253A1 (en) 2017-11-30 2019-06-06 Kyoto University Method for culture of cells
CN107841487A (en) * 2017-12-13 2018-03-27 章毅 The method for cultivating taste stem cells
EP3530732A1 (en) 2018-02-23 2019-08-28 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Ovarian cancer organoid culture
CN110452875A (en) * 2018-05-07 2019-11-15 北京吉尚立德生物科技有限公司 It is a kind of for cultivating the culture medium of lung cancer solid tumor primary cell
FR3081168B1 (en) * 2018-05-21 2022-03-11 Univ Bordeaux BIOREACTOR CELL CULTURE SYSTEM
CN110592018A (en) * 2018-06-13 2019-12-20 北京吉尚立德生物科技有限公司 Method for culturing primary cells of colorectal cancer solid tumors
WO2020032162A1 (en) * 2018-08-08 2020-02-13 中外製薬株式会社 Method for culturing cancer tissue or tissue analogous to cancer tissue
CN109055304B (en) * 2018-08-16 2021-12-07 洪玥 Non-columnar epithelial stem cell culture medium and culture method
CN109207428B (en) * 2018-09-12 2022-03-22 上海易对医生物医药科技有限公司 Method for separating and culturing circulating tumor cells
CN113710795A (en) * 2018-09-26 2021-11-26 株式会社器官再生工学 In vitro proliferation method of hair follicle epithelial stem cells
CN111197024B (en) * 2018-11-16 2023-08-18 杭州捷诺飞生物科技股份有限公司 Pancreatic-like structure, construction method and application thereof
CN109679913A (en) * 2019-02-26 2019-04-26 复旦大学附属眼耳鼻喉科医院 Smell stem cell three-dimensional culture method
JP2022539418A (en) * 2019-07-03 2022-09-08 コーネル ユニヴァーシティー Methods for functional angiogenesis of pancreatic islets and β-cell organoids
US12031977B2 (en) 2019-12-10 2024-07-09 Massachusetts Institute Of Technology Ex vivo system for determining multiple drug-drug transporter interactions and methods of use thereof
CN113528425B (en) * 2020-04-15 2023-05-30 合肥中科普瑞昇生物医药科技有限公司 Culture medium and culture method for mammary gland epithelial tumor cells
CN111534477B (en) * 2020-05-13 2021-12-21 江苏省人民医院（南京医科大学第一附属医院） Method for culturing primary epithelial stem cell balls of lung tissue of mouse
CN114085803B (en) * 2020-08-24 2024-04-26 北京大学 Establishment of organoid culture systems with regenerative properties
CN114134102A (en) * 2021-11-10 2022-03-04 杭州同创越诚基因科技有限公司 Method for separating crypts from colonic mucosal tissue and inducing colon organoids
CN114574426A (en) * 2022-01-25 2022-06-03 湖北省农业科学院畜牧兽医研究所 Method for separating and identifying duck small intestine crypt stem cells and culturing 3D organs
CN117025503A (en) * 2022-05-10 2023-11-10 上海赛立维生物科技有限公司 Intrahepatic duct precursor-like cell, cell preparation, preparation method and application
CN115322948B (en) * 2022-07-20 2023-08-29 创芯国际生物科技(广州)有限公司 Amplification culture method before micro-primary tissue organoid culture

Family Cites Families (117)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5464758A (en) 1993-06-14 1995-11-07 Gossen; Manfred Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters
DE69523750T2 (en) 1994-05-04 2002-08-01 Mount Sinai Hospital Corp., Toronto MODULATORS OF THE CYTOKINS OF THE TGF-BETA OVERFAMILY AND METHOD FOR DETERMINING THEM
US6043092A (en) 1996-03-18 2000-03-28 University Of Pittsburgh Cell culture media for mammalian cells
US6133027A (en) 1996-08-07 2000-10-17 City Of Hope Inducible expression system
US6207455B1 (en) 1997-05-01 2001-03-27 Lung-Ji Chang Lentiviral vectors
NZ500740A (en) 1997-05-13 2001-02-23 Univ North Carolina Recombinant lentivirus-based gene transfer vectors comprising 3 vectors from Equine Infectious Anemia Virus (EIAV)
US5994136A (en) 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6218181B1 (en) 1998-03-18 2001-04-17 The Salk Institute For Biological Studies Retroviral packaging cell line
EP0953633A1 (en) 1998-04-28 1999-11-03 Livercell L.L.C. Cell culturing method and medium for producing proliferated, normal, differentiated human liver cells
WO2000050049A2 (en) 1999-02-24 2000-08-31 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Artificial salivary gland
DE19909769A1 (en) 1999-03-05 2000-09-07 Bundesrepublik Deutschland Let SIVagm-derived lentiviral vectors, processes for their preparation and their use for gene transfer in mammalian cells
FR2794473B1 (en) 1999-06-03 2003-09-26 Centre Nat Rech Scient METHOD FOR MULTIPLYING STEM CELLS
EP1224259A4 (en) 1999-09-27 2005-04-27 Univ Florida Reversal of insulin-dependent diabetes by islet-producing stem cells, islet progenitor cells and islet-like structures
JP2003530124A (en) 2000-04-05 2003-10-14 麒麟麦酒株式会社 Methods and materials for novel stem cell growth factor-like polypeptides and polynucleotides
US20020151487A1 (en) 2000-08-31 2002-10-17 Loyola University Chicago Method and reagents for epithelial barrier formation and treatment of malignant and benign skin disorders by modulating the notch pathway
JP2002247978A (en) 2001-02-23 2002-09-03 Kazumori Funatsu Hepatocyte organoid and method for producing the same
US20030032034A1 (en) 2001-03-05 2003-02-13 Tang Y. Tom Methods and materials relating to stem cell growth factor-like polypeptides and polynucleotides
US7411052B2 (en) 2001-03-05 2008-08-12 Nuvelo, Inc. Methods and materials relating to stem cell growth factor-like polypeptides and polynucleotides
US20030003088A1 (en) * 2001-05-03 2003-01-02 Board Of Trustees Operating Michigan State University Human pancreatic pluripotential stem cell line
US20030129751A1 (en) * 2001-05-16 2003-07-10 Grikscheit Tracy C. Tissue-engineered organs
AU2002331669A1 (en) * 2001-08-23 2003-03-10 The Wistar Institute Of Anatomy And Biology An organotypic intestinal culture and methods of use thereof
CA2458818A1 (en) 2001-08-30 2003-04-10 Nuvelo, Inc. Methods and materials relating to stem cell growth factor-like polypeptides and polynucleotides
AU2002342010A1 (en) 2001-10-03 2003-04-14 Incyte Genomics Inc. Secreted proteins
US20030138951A1 (en) 2001-10-18 2003-07-24 Li Yin Conversion of liver stem and progenitor cells to pancreatic functional cells
WO2003050249A2 (en) * 2001-12-07 2003-06-19 Geron Corporation Islet cells from human embryonic stem cells
EP1504099A4 (en) 2001-12-10 2006-05-10 Nuvelo Inc Novel nucleic acids and polypeptides
GB0130738D0 (en) 2001-12-21 2002-02-06 Serono Internat S A Protein
US7193069B2 (en) 2002-03-22 2007-03-20 Research Association For Biotechnology Full-length cDNA
WO2004050827A2 (en) 2002-12-05 2004-06-17 Technion Research & Development Foundation Ltd. Cultured human pancreatic islets, and uses thereof
US20070020637A1 (en) 2003-01-21 2007-01-25 Research Association For Biotechnology Full-length cDNA
EP1440981A3 (en) 2003-01-21 2005-11-23 Research Association for Biotechnology Full-length human cdna
WO2004076642A2 (en) 2003-02-27 2004-09-10 The Rockefeller University Method for modulating epithelial stem cell lineage
WO2004087896A2 (en) 2003-03-31 2004-10-14 Pfizer Products Inc. Hepatocyte differentiation of stem cells
US20040229355A1 (en) 2003-05-14 2004-11-18 Board Of Regents University Of Texas System Culture medium for long-term culture of hepatocytes
US20070010008A1 (en) 2005-06-29 2007-01-11 Tissuetech, Inc. Ex vivo expansion of primary animal cells
US20050054829A1 (en) 2003-07-22 2005-03-10 Wiley Steven R. Compositions and methods relating to TSP-30a, b, c and d
US20050058687A1 (en) 2003-09-12 2005-03-17 Becton, Dickinson And Company Covalently attached collagen VI for cell attachment and proliferation
ES2345256T3 (en) 2003-10-10 2010-09-20 Deutsches Krebsforschungszentrum COMPOSITIONS FOR DIAGNOSIS AND THERAPY OF DISEASES ASSOCIATED WITH ABERRANT EXPRESSION OF FUTRINAS (R-SPONDINAS) AND / OR WNT.
WO2005040391A1 (en) 2003-10-27 2005-05-06 Murdoch Childrens Research Institute Compositions and methods for differentiating stem cells
AU2005208945A1 (en) 2004-01-27 2005-08-11 Kyowa Hakko Kirin Co., Ltd. Gastrointestinal proliferative factor and uses thereof
SE0400974D0 (en) 2004-04-15 2004-04-15 Cellmax Technologies Ab Dipole design
JP2007536936A (en) * 2004-05-14 2007-12-20 ベクトン・ディキンソン・アンド・カンパニー Stem cell populations and methods of use
US20070036769A9 (en) * 2004-06-03 2007-02-15 Linheng Li BMP pathway methods and compositions
SE0402734D0 (en) 2004-11-10 2004-11-10 Anders Grubb Antimiicrobial compounds
US8597947B2 (en) 2004-12-29 2013-12-03 Hadasit Medical Research Services & Development Limited Undifferentiated stem cell culture systems
US7439327B2 (en) 2005-01-18 2008-10-21 Nuvelo, Inc. Stem cell factor-like proteins and uses thereof
WO2006088867A2 (en) * 2005-02-15 2006-08-24 Medistem Laboratories, Incorporated Method for expansion of stem cells
WO2006090882A1 (en) 2005-02-23 2006-08-31 Foundation For Biomedical Research And Innovation Method for amplification of endothelial progenitor cell in vitro
JP2006325444A (en) 2005-05-24 2006-12-07 Toyobo Co Ltd Medium for cell proliferation
AU2006202209B2 (en) * 2005-05-27 2011-04-14 Lifescan, Inc. Amniotic fluid derived cells
WO2007013666A2 (en) 2005-07-26 2007-02-01 Kirin Pharma Kabushiki Kaisha Anti-tumor agents comprising r-spondins
US7541431B2 (en) 2005-09-07 2009-06-02 Maine Medical Center Cristin/R-spondin ligands active in the Wnt signaling pathway and methods, compositions and kits relating thereto
WO2007030693A2 (en) 2005-09-08 2007-03-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for promoting stem cell proliferation and survival
US20090118176A1 (en) 2005-10-07 2009-05-07 Emtage Peter C R Stem Cell Factor-Like Protein Scfa1 and Uses Thereof
CA2626152A1 (en) 2005-10-24 2007-05-03 Agency For Science, Technology And Research Methods of specifying mesodermal, endodermal and mesoendodermal cell fates
JP2007116926A (en) 2005-10-25 2007-05-17 Reprocell Inc Method related to retention and purification of stem cell outside body, composition and system thereof
EP1792979A1 (en) 2005-12-01 2007-06-06 Stiftung Caesar Center of Advanced European Studies and Research Cell culture system for the enrichment and expansion of stem cells
WO2007071339A1 (en) 2005-12-21 2007-06-28 Universite Catholique De Louvain Isolated liver stem cells
SG170021A1 (en) * 2006-02-23 2011-04-29 Novocell Inc Compositions and methods useful for culturing differentiable cells
WO2007127454A2 (en) * 2006-04-28 2007-11-08 Cythera, Inc. Hepatocyte lineage cells
US8741643B2 (en) * 2006-04-28 2014-06-03 Lifescan, Inc. Differentiation of pluripotent stem cells to definitive endoderm lineage
EP4438720A2 (en) * 2006-04-28 2024-10-02 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US8415153B2 (en) * 2006-06-19 2013-04-09 Geron Corporation Differentiation and enrichment of islet-like cells from human pluripotent stem cells
JP2008044926A (en) 2006-08-14 2008-02-28 Trustees Of Columbia Univ In The City Of New York SECRETORY PROTEIN RELATED TO Wnt SIGNAL TRANSDUCTION
JP2008061569A (en) 2006-09-07 2008-03-21 Toyobo Co Ltd Method for culturing stem cell and medium therefor
US8628964B2 (en) * 2006-10-11 2014-01-14 Drexel University Fetal pulmonary cells and uses thereof
HUE027179T2 (en) 2006-10-20 2016-10-28 Deutsches Krebsforschungszentrum Stiftung Des Oeffentlichen Rechts Rspondins as modulators of angiogenesis and vasculogenesis
RU2323252C1 (en) 2006-10-25 2008-04-27 Антонина Ивановна Колесникова Method for culturing human mesenchymal stem cells ex vivo
US20080182328A1 (en) 2006-12-19 2008-07-31 The Burnham Institute Mammalian extraembryonic endoderm cells and methods of isolation
WO2008075796A1 (en) 2006-12-21 2008-06-26 Kyowa Hakko Kirin Co., Ltd. Agent for promoting recovery from blood cell depletion
WO2008088524A2 (en) 2006-12-28 2008-07-24 Nuvelo, Inc. Thrombospondin-domain-deficient r-spondin 1 protein as gastrointestinal tract epithelial proliferation factor
WO2008094597A2 (en) 2007-01-30 2008-08-07 University Of Georgia Research Foundation, Inc. Early mesoderm cells, a stable population of mesendoderm cells that has utility for generation of endoderm and mesoderm lineages and multipotent migratory cells (mmc)
US20080233088A1 (en) * 2007-02-16 2008-09-25 Varian Medical Systems Technologies, Inc. Preparative regimen for engraftment, growth and differentiation of non-hematopoeitic cells in vivo after transplantation
CA2689658A1 (en) 2007-06-20 2008-12-24 Actogenix Nv Methods and compositions for treating mucositis
PL3009148T3 (en) 2007-07-02 2019-03-29 Oncomed Pharmaceuticals, Inc. Compositions and methods for treating and diagnosing cancer
BRPI0814425A2 (en) * 2007-07-18 2014-10-21 Lifescan Inc DIFFERENTIATION OF HUMAN EMBRYONIC STEM CELLS
EP2022848A1 (en) 2007-08-10 2009-02-11 Hubrecht Institut A method for identifying, expanding, and removing adult stem cells and cancer stem cells
JP2009195142A (en) 2008-02-20 2009-09-03 Institute Of Physical & Chemical Research Method for obtaining liver ovoid cell
JP2011522515A (en) 2008-04-10 2011-08-04 マサチューセッツ インスティテュート オブ テクノロジー Methods for identifying drugs that target cancer stem cells and uses thereof
CN102165058B (en) 2008-07-25 2015-07-01 佐治亚大学研究基金会 Compositions for mesoderm derived ISLl1+ multipotent cells (IMPs), epicardial progenitor cells (EPCs) and multipotent CXCR4+CD56+ cells (C56Cs) and methods of use
WO2010016766A2 (en) 2008-08-08 2010-02-11 Koninklijke Nederlandse Akademie Van Wetenschappen Antibodies recognizing endogenous human lgr5 and/or lgr6
US9464275B2 (en) * 2008-08-21 2016-10-11 The Board Of Trustees Of The Leland Stanford Junior University Ex vivo culture, proliferation and expansion of intestinal epithelium
EP2362899A1 (en) 2008-10-31 2011-09-07 Katholieke Universiteit Leuven Optimized methods for differentiation of cells into cells with hepatocyte and hepatocyte progenitor phenotypes, cells produced by the methods, and methods for using the cells
CA2745930C (en) 2008-12-08 2017-05-02 Soligenix, Inc. Topically active steroids for use in radiation and chemotherapeutics injury
CN102317442B (en) 2008-12-17 2014-08-13 斯克里普斯研究所 Generation and maintenance of stem cells
GB201111244D0 (en) 2011-06-30 2011-08-17 Konink Nl Akademie Van Wetenschappen Knaw Culture media for stem cells
EP2393917B1 (en) 2009-02-03 2016-04-06 Koninklijke Nederlandse Akademie van Wetenschappen Culture medium for epithelial stem cells and organoids comprising said stem cells.
EP2412800A1 (en) 2010-07-29 2012-02-01 Koninklijke Nederlandse Akademie van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
US9752124B2 (en) 2009-02-03 2017-09-05 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
WO2010108001A2 (en) 2009-03-18 2010-09-23 The Brigham And Women's Hospital, Inc. Agents and methods for tissue repair and regeneration
WO2010108126A2 (en) 2009-03-19 2010-09-23 Fate Therapeutics, Inc. Reprogramming compositions and methods of using the same
US20120039912A1 (en) 2009-04-15 2012-02-16 Galapagos Sasu Rspondin-3 inhibition in bone disorders
CN102741396B (en) 2009-04-27 2017-10-20 威盛细胞有限公司 Support the small molecule and its method of pluripotent cell growth
WO2010144696A1 (en) 2009-06-11 2010-12-16 Burnham Institute For Medical Research Directed differentiation of stem cells
EP4438734A2 (en) 2010-06-14 2024-10-02 The Scripps Research Institute Reprogramming of cells to a new fate
SG10201508118WA (en) 2010-09-30 2015-11-27 Agency Science Tech & Res Methods and reagents for detection and treatment of esophageal metaplasia
JP6182456B2 (en) 2010-12-22 2017-08-23 フェイト セラピューティクス，インコーポレイテッド Enhanced cell culture platform and iPSC reprogramming for single cell sorting
GB201106395D0 (en) 2011-04-14 2011-06-01 Hubrecht Inst Compounds
BR112013033674A2 (en) 2011-06-29 2018-07-17 Penn State Res Found compositions, methods and kits for treating leukemia
US20130052729A1 (en) 2011-08-29 2013-02-28 Olivier Pourquie Method for preparing induced paraxial mesoderm progenitor (ipam) cells and their use
US9663573B2 (en) 2011-10-05 2017-05-30 Genentech, Inc. Methods of treating liver conditions using Notch2 antagonists
GB201117469D0 (en) 2011-10-10 2011-11-23 Cell Guidance Systems Ltd Culture media for pluripotent stem cells
EP2772534B1 (en) 2011-10-27 2019-09-18 National University Corporation Tokyo Medical and Dental University Culturing colorectal epithelial stem cells and transplanting colorectal epithelium
DK2795322T3 (en) 2011-12-19 2016-01-25 Umc Utrecht Holding Bv Quantitative rapid test for measuring cftr function in primary intestinal culture model
WO2014066649A1 (en) 2012-10-26 2014-05-01 The Regents Of The University Of California A strategy for engineering various 3d tissues, organoids and vasculature
US10913933B2 (en) 2013-02-13 2021-02-09 Wake Forest University Health Sciences Bioengineered liver constructs and methods relating thereto
WO2014127219A1 (en) 2013-02-14 2014-08-21 The Cleveland Clinic Foundation Methods for induction of cell fates from pluripotent cells
CN105121632B (en) 2013-02-18 2021-08-10 大学健康网络 Method for generating liver cells and bile duct cells from pluripotent stem cells
HUE049377T2 (en) 2013-03-14 2020-09-28 Brigham & Womens Hospital Inc Compositions and methods for epithelial stem cell expansion and culture
AU2014233055B2 (en) 2013-03-15 2018-08-09 Board Of Regents, The University Of Texas System Inhibition of pulmonary fibrosis with nutlin-3a and peptides
BR112015026258A2 (en) 2013-04-16 2017-10-10 Orbsen Therapeutics Ltd therapeutic and immunomodulatory compositions and agents, and uses thereof
US10597633B2 (en) 2014-05-16 2020-03-24 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for organoids
CN108064274A (en) 2014-07-30 2018-05-22 耶达研究及发展有限公司 For cultivating the culture medium of multipotential stem cell
SG11201701844YA (en) 2014-10-08 2017-04-27 Agency Science Tech & Res Methods of differentiating stem cells into liver cell lineages
GB201421094D0 (en) 2014-11-27 2015-01-14 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
GB201421092D0 (en) 2014-11-27 2015-01-14 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
CN111349604B (en) 2016-05-18 2023-12-12 学校法人庆应义塾 Cell culture medium for organoid culture, culture method and organoid

Non-Patent Citations (97)

* Cited by examiner, † Cited by third party
Title
"R&D Systems Catalog", 2004, article "THE WNT FAMILY OF SECRETED PROTEINS"
ABE K; WATANABE S.: "Apoptosis of mouse pancreatic acinar cells after duct ligation", ARCH HISTOL CYTOL., vol. 58, 1995, pages 221 - 9
APELQVIST A; LI H; SOMMER L; BEATUS P; ANDERSON DJ; HONJO T; HRABE DE ANGELIS M; LENDAHL U; EDLUND H: "Notch signalling controls pancreatic cell differentiation", NATURE, vol. 400, 1998, pages 877 - 81, XP009062879, DOI: doi:10.1038/23716
BARKER ET AL., NATURE, 2007
BARKER ET AL., NATURE, vol. 449, 2007, pages 1003 - 1007
BARKER N; VAN ES JH; KUIPERS J; KUJALA P; VAN DEN BORN M; COZIJNSEN M; HAEGEBARTH A; KORVING J; BEGTHEL H; PETERS PJ, NATURE, vol. 449, 2007, pages 1003 - 7
BARKER N; VAN ES JH; KUIPERS J; KUJALA P; VAN DEN BORN M; COZIJNSEN M; HAEGEBARTH A; KORVING J; BEGTHEL H; PETERS PJ: "Identification of stem cells in small intestine and colon by marker gene Lgr5", NATURE, vol. 449, 2007, pages 1003 - 7
BARKER, N. ET AL.: "Identification of stem cells in small intestine and colon by marker gene Lgr5", NATURE, vol. 449, 2007, pages 1003 - 7
BARKER, N.; VAN DE WETERING, M.; CLEVERS, H: "The intestinal stem cell", GENES DEV, vol. 22, 2008, pages 1856 - 64
BATLLE, E. ET AL.: "Beta-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB", CELL, vol. 111, 2002, pages 251 - 63, XP001156842, DOI: doi:10.1016/S0092-8674(02)01015-2
BINNERTS ME ET AL., PNAS, vol. 104, 2007, pages 14700 - 5
BJERKNES, M.; CHENG, H.: "Intestinal epithelial stem cells and progenitors", METHODS ENZYMOL, vol. 419, 2006, pages 337 - 83, XP009101698, DOI: doi:10.1016/S0076-6879(06)19014-X
BJERKNES; CHENG, AM J PHYSIOL GASTROINTEST LIVER PHYSIOL., vol. 283, no. 3, 2002, pages G767 - 77
BJERKNES; CHENG, GASTROENTEROLOGY, vol. 116, 1998, pages 7 - 14
BJERKNES; CHENG, METHODS ENZYMOL, vol. 419, 2006, pages 337 - 83
BONNER-WEIR, S ET AL., PNAS, 2000
BONNER-WEIR, S.; TANEJA, M.; WEIR, G.C.; TATARKIEWICZ, K.; SONG, K.H.; SHARMA, A.; O'NEIL, J.J.: "In vitro cultivation of human islets from expanded ductal tissue", PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 7999 - 8004, XP002931496, DOI: doi:10.1073/pnas.97.14.7999
BONNER-WEIR, S.; WEIR, G.C.: "New sources of pancreatic beta-cells", NAT. BIOTECHNOL., vol. 23, 2005, pages 857 - 861
BOUWENS, L.; ROOMAN, I.: "Regulation of pancreatic beta-cell mass", PHYSIOL. REV., vol. 85, 2005, pages 1255 - 1270
CHEN ET AL., NAT CHEM BIOL., vol. 5, no. 2, 2009, pages 00 - 7
CHEN ET AL., NAT CHEM BIOL., vol. 5, no. 2, 2009, pages 100 - 7
CHENG, H.; LEBLOND, C. P.: "Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine", I. COLUMNAR CELL. AM J ANAT, vol. 141, 1974, pages 461 - 79
DIGNASS, A. U.; STURM, A: "Peptide growth factors in the intestine", EUR J GASTROENTEROL HEPATOL, vol. 13, 2001, pages 763 - 70
DONTU ET AL., BREAST CANCER RES, vol. 6, 2004, pages R605 - R615
DOR, Y.; BROWN, J.; MARTINEZ, O.L; MELTON, D.A.: "Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation", NATURE, vol. 429, 2004, pages 41 - 46, XP002388399, DOI: doi:10.1038/nature02520
EVANS, G. S.; FLINT, N.; SOMERS, A. S.; EYDEN, B.; POTTEN, C. S.: "The development of a method for the preparation of rat intestinal epithelial cell primary cultures", J CELL SCI, vol. 101, 1997, pages 219 - 31, XP009006507
FUKAMACHI, H.: "Proliferation and differentiation of fetal rat intestinal epithelial cells in primary serum-free culture", J CELL SCI, vol. 103, 1998, pages 511 - 9
GITHENS ET AL., VITRO CELL DEV BIOL., 1989
GITHENS S; SCHEXNAYDER JA; DESAI K; PATKE CL: "Rat pancreatic interlobular duct epithelium: isolation and culture in collagen gel", IN VITRO CELL DEV BIOL., vol. 25, 1989, pages 679 - 88
GRADWOHL, G.; DIERICH, A.; LEMEUR, M.; GUILLEMOT, F.: "neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas", PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 1607 - 1611, XP002198929, DOI: doi:10.1073/pnas.97.4.1607
GREGORIEFF; CLEVERS, GENES DEV, vol. 19, 2005, pages 877 - 90
GREGORIEFF; CLEVERS, GENES DEV. APR, vol. 15;19, no. 8, 2005, pages 877 - 90
GU, G.; DUBAUSKAITE, J.; MELTON, D.A.: "Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors", DEVELOPMENT, vol. 129, 2002, pages 2447 - 2457, XP002584751
HAO, E.; TYRBERG, B.; ITKIN-ANSARI, P.; LAKEY, J.R.; GERON, I.; MONOSOV, E.Z.; BARCOVA, M.; MERCOLA, M.; LEVINE, F.: "Beta-cell differentiation from nonendocrine epithelial cells of the adult human pancreas", NAT. MED., vol. 12, 2006, pages 310 - 316, XP055027742, DOI: doi:10.1038/nm1367
HARAMIS, A. P. ET AL.: "De novo crypt formation and juvenile polyposis on BMP inhibition in mouse intestine", SCIENCE, vol. 303, 2004, pages 1684 - 6, XP002529276, DOI: doi:10.1126/science.1093587
HOFMANN, C. ET AL.: "Cell-cell contacts prevent anoikis in primary human colonic epithelial cells", GASTROENTEROLOGY, vol. 132, 2007, pages 587 - 600, XP005920927, DOI: doi:10.1053/j.gastro.2006.11.017
HSIEH ET AL., MOL. CELL. BIOL., vol. 16, 1997, pages 952 - 959
JAKS V; BARKER N; KASPER M; VAN ES JH; SNIPPERT HJ; CLEVERS H; TOFTGFIRD R: "Lgr5 marks cycling, yet long-lived, hair follicle stem cells", NAT GENET, vol. 40, 2008, pages 1291 - 9, XP002525637, DOI: doi:10.1038/NG.239
KEDINGER, M. ET AL.: "Intestinal epithelial-mesenchymal cell interactions", ANN N Y ACAD SCI, vol. 859, 1998, pages 1 - 17
KESTUTIS; PLANUTIS ET AL., BMC CELL BIOL., vol. 8, 2007, pages 12
KIM, K. A. ET AL.: "Mitogenic influence of human R-spondinl on the intestinal epithelium", SCIENCE, vol. 309, 2005, pages 1256 - 9, XP003014398, DOI: doi:10.1126/science.1112521
KIRIKOSHI H ET AL., BIOCHEM BIOPHYS RES COM, vol. 283, 2001, pages 798 - 805
KORINEK ET AL., SCIENCE, vol. 275, 1997, pages 1784 - 1787
KORINEK, V. ET AL.: "Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4", NAT GENET, vol. 19, 1998, pages 379 - 83, XP002233453, DOI: doi:10.1038/1270
KUHNERT, F. ET AL.: "Essential requirement for Wnt signaling in proliferation of adult small intestine and colon revealed by adenoviral expression of Dickkopf-1", PROC NATL ACAD SCI U S A, vol. 101, 2004, pages 266 - 71, XP002984892, DOI: doi:10.1073/pnas.2536800100
LEFEBVRE ET AL., DIABETES, 1998
LEFEBVRE VH; OTONKOSKI T; USTINOV J; HUOTARI MA; PIPELEERS DG; BOUWENS L: "Culture of adult human islet preparations with hepatocyte growth factor and 804G matrix is mitogenic for duct cells but not for beta-cells", DIABETES, vol. 47, 1998, pages 134 - 7
LEOST, M. ET AL.: "Biomol International", EUR. J. BIOCHEM., vol. 267, 2000, pages 5983 - 5994
LI, L. ET AL.: "The human homolog of rat Jaggedl expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notchl", IMMUNITY, vol. 8, 1998, pages 43 - 55
LI, L.; XIE, T.: "Stem cell niche: structure and function", ANNU REV CELL DEV BIOL, vol. 21, 2005, pages 605 - 31
LIAO ET AL., ENDOCRINOLOGY, vol. 145, no. 6, 2004, pages 2941 - 9
LITTLE ET AL., CHEM. REV, vol. 108, 2008, pages 1787 - 1796
LIU ET AL., ANGEW CHEM INT ED ENGL., vol. 44, 2005, pages 1987 - 90
LUSTIG B; JERCHOW B; SACHS M; WEILER S; PIETSCH T; KARSTEN U; VAN DE WETERING M; CLEVERS H; SCHLAG PM; BIRCHMEIER W: "Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors", MOL CELL BIOL., 2002, pages 1184 - 93
LUSTIG ET AL., MOL. CELL. BIOL., 2002
MEIJER ET AL., TRENDS IN PHARMACOLOGICAL SCIENCES, vol. 25, 2004, pages 471 - 480
MEIJER, L. ET AL., CHEM. BIOL., vol. 10, 2003, pages 1255 - 1266
MIRALLES ET AL., PROC NATL ACAD SCI U S A., 1999
MIRALLES F; CZERNICHOW P; OZAKI K; ITOH N; SCHARFMANN R: "Signaling through fibroblast growth factor receptor 2b plays a key role in the development of the exocrine pancreas", PROC NATL ACAD SCI U S A., vol. 96, 1998, pages 6267 - 72
OOTANI A; TODA S; FUJIMOTO K; SUGIHARA H, AM J PATHOL., vol. 162, no. 6, 2003, pages 1905 - 12
PERREAULT, N.; JEAN-FRANCOIS, B: "Use of the dissociating enzyme thermolysin to generate viable human normal intestinal epithelial cell cultures", EXP CELL RES, vol. 224, 1996, pages 354 - 64, XP002127611, DOI: doi:10.1006/excr.1996.0145
PINTO, D.; GREGORIEFF, A.; BEGTHEL, H.; CLEVERS, H.: "Canonical Wnt signals are essential for homeostasis of the intestinal epithelium", GENES DEV, vol. 17, 2003, pages 1709 - 13, XP002984891, DOI: doi:10.1101/gad.267103
POWELL, D. W. ET AL.: "Myofibroblasts. II. Intestinal subepithelial myofibroblasts", AM J PHYSIOL, vol. 277, 1999, pages C183 - 201
RAMIYA, V.K.; MARAIST, M.; ARFORS, K.E.; SCHATZ, D.A.; PECK, A.B.; CORNELIUS, J.G.: "Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells", NAT. MED., vol. 6, 2000, pages 278 - 282, XP002931497, DOI: doi:10.1038/73128
ROOMAN ET AL., DIABETOLOGIA, 2000
ROOMAN ET AL., GASTROENTEROLOGY, 2001
ROOMAN I; HEREMANS Y; HEIMBERG H; BOUWENS L.: "Modulation of rat pancreatic acinoductal transdifferentiation and expression of PDX-1 in vitro", DIABETOLOGIA, vol. 43, no. 7, 2000, pages 907 - 14, XP055085023
ROOMAN I; LARDON J; FLAMEZ D; SCHUIT F; BOUWENS L.: "Mitogenic effect of gastrin and expression of gastrin receptors in duct-like cells of rat pancreas", GASTROENTEROLOGY, vol. 121, 2001, pages 940 - 9
SAHA ET AL., BIOPHYSICAL JOURNAL, vol. 95, 2008, pages 4426 - 4438
SAHA ET AL., CURR OPIN CHEM BIOL., vol. 11, no. 4, 2007, pages 381 - 387
SASAKI, T.; GILTAY, R.; TALTS, U.; TIMPL, R.; TALTS, J. F.: "Expression and distribution of laminin alphal and alpha2 chains in embryonic and adult mouse tissues: an immunochemical approach", EXP CELL RES, vol. 275, 2002, pages 185 - 99
SATO ET AL., NATURE, vol. 459, no. 7244, 2009, pages 262 - 5
SATO T; VRIES RG; SNIPPERT HJ; VAN DE WETERING M; BARKER N; STANGE DE; VAN ES JH; ABO A; KUJALA P; PETERS PJ: "Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche", NATURE, vol. 459, 2009, pages 262 - 5, XP055183787, DOI: doi:10.1038/nature07935
SAWADA ET AL., INT J EXP PATHOL, vol. 72, 1991, pages 407 - 21
SCHWITZGEBEL, V.M.; SCHEEL, D.W.; CONNERS, J.R.; KALAMARAS, J.; LEE, J.E.; ANDERSON, D.J.; SUSSEL, L.; JOHNSON, J.D.; GERMAN, M.S.: "Expression of neurogenin3 reveals an islet cell precursor population in the pancreas", DEVELOPMENT, vol. 127, 2000, pages 3533 - 3542, XP002906536
SEABERG, R.M.; SMUKLER, S.R.; KIEFFER, T.J.; ENIKOLOPOV, G.; ASGHAR, Z.; WHEELER, M.B.; KORBUTT, G.; VAN DER KOOY, D.: "Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages", NAT. BIOTECHNOL., vol. 22, 2004, pages 1115 - 1124, XP002987994, DOI: doi:10.1038/nbt1004
SORIANO, P.: "Generalized lacZ expression with the ROSA26 Cre reporter strain", NAT GENET, vol. 21, 1999, pages 70 - 1, XP002321839, DOI: doi:10.1038/5007
SPRADLING, A.; DRUMMOND-BARBOSA, D.; KAI, T.: "Stem cells find their niche", NATURE, vol. 414, 2001, pages 98 - 104, XP009078342, DOI: doi:10.1038/35102160
SRINIVAS, S. ET AL.: "Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus", BMC DEV BIOL, vol. 1, 2001, pages 4, XP021001303, DOI: doi:10.1186/1471-213X-1-4
ST CLAIR, W. H.; OSBOME, J. W.: "Crypt fission and crypt number in the small and large bowel of postnatal rats", CELL TISSUE KINET, vol. 18, 1985, pages 255 - 62
STINGL, J. ET AL.: "Purification and unique properties of mammary epithelial stem cells", NATURE, vol. 439, 2006, pages 993 - 7, XP002465395
STINGL, J.; EAVES, C. J.; ZANDIEH, I.; EMERMAN, J. T.: "Characterization of bipotent mammary epithelial progenitor cells in normal adult human breast tissue", BREAST CANCER RES TREAT, vol. 67, 2001, pages 93 - 109, XP019274571
SUZUKI ET AL., DIABETES, 2004, pages 53
SUZUKI, A.; NAKAUCHI, H.; TANIGUCHI, H.: "Prospective isolation of multipotent pancreatic progenitors using flow-cytometric cell sorting", DIABETES, vol. 53, 2004, pages 2143 - 2152, XP055016787, DOI: doi:10.2337/diabetes.53.8.2143
TETA, M.; RANKIN, M.M.; LONG, S.Y.; STEIN, G.M.; KUSHNER, J.A.: "Growth and regeneration of adult beta cells does not involve specialized progenitors", DEV. CELL, vol. 12, 2007, pages 817 - 826
TRAUTMANN B ET AL., PANCREAS, vol. 8, pages 248 - 254
TRAUTMANN B; SCHLITT HJ; HAHN EG; L6HR M.: "Isolation, culture, and characterization of human pancreatic duct cells", PANCREAS, vol. 8, 1993, pages 248 - 54
VAN DE WETERING ET AL., CANCER RES., vol. 61, no. 1, 2001, pages 278 - 84
VAN ES, J. H. ET AL.: "Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells", NATURE, vol. 435, 2005, pages 959 - 63, XP055106703, DOI: doi:10.1038/nature03659
WANG, R.N.; KLOPPEL, G.; BOUWENS, L.: "Duct- to islet-cell differentiation and islet growth in the pancreas of duct-ligated adult rats", DIABETOLOGIA, vol. 38, 1995, pages 1405 - 1411, XP008035540, DOI: doi:10.1007/BF00400600
WATANABE, K. ET AL.: "A ROCK inhibitor permits survival of dissociated human embryonic stem cells", NAT BIOTECHNOL, vol. 25, 2007, pages 681 - 6, XP002478043, DOI: doi:10.1038/nbt1310
WHITEHEAD, R. H.; DEMMLER, K.; ROCKMAN, S. P.; WATSON, N. K.: "Clonogenic growth of epithelial cells from normal colonic mucosa from both mice and humans", GASTROENTEROLOGY, vol. 117, 1998, pages 858 - 65, XP009006492, DOI: doi:10.1016/S0016-5085(99)70344-6
WILLERT ET AL., NATURE, vol. 423, no. 6938, 2003, pages 448 - 52
WILLERT K; BROWN JD; DANENBERG E; DUNCAN AW; WEISSMAN IL; REYA T; YATES JR 3RD; NUSSE R., NATURE, vol. 423, no. 6938, 2003, pages 448 - 52
XU X; D'HOKER J; STANGE G; BONNE S; DE LEU N; XIAO X; VAN DE CASTEELE M; MELLITZER G; LING Z; PIPELEERS D: "Beta cells can be generated from endogenous progenitors in injured adult mouse pancreas", CELL, vol. 132, no. 2, 2008, pages 197 - 207, XP002531872, DOI: doi:10.1016/J.CELL.2007.12.015
YEN, T. H.; WRIGHT, N. A.: "The gastrointestinal tract stem cell niche", STEM CELL REV, vol. 2, 2006, pages 203 - 12, XP002457163, DOI: doi:10.1007/s12015-006-0048-1
ZILBERBERG ET AL., BMC CELL BIOL., vol. 8, 2007, pages 41

Cited By (118)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8642339B2 (en) 2009-02-03 2014-02-04 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
US10947510B2 (en) 2009-02-03 2021-03-16 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
US9752124B2 (en) 2009-02-03 2017-09-05 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
US9345486B2 (en) 2009-03-16 2016-05-24 University Of Washington Nanofibrous conduits for nerve regeneration
US9719068B2 (en) 2010-05-06 2017-08-01 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
US10781425B2 (en) 2010-05-06 2020-09-22 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
US11034935B2 (en) 2010-07-29 2021-06-15 Koninklijke Nederlandse Akademie Van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
US9765301B2 (en) 2010-07-29 2017-09-19 Koninklijke Nederlandse Akademie Van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
JP2012115254A (en) * 2010-11-11 2012-06-21 Osaka Univ Three-dimensional structural body of cell and method for producing the same
EP2697255A2 (en) * 2011-04-14 2014-02-19 Koninklijke Nederlandse Akademie van Wetenschappen Agonists and antagonists of the wnt pathway
WO2012140274A2 (en) 2011-04-14 2012-10-18 Koninklijke Nederlandse Akademie Van Wetenschappen Compounds
CN102787094B (en) * 2011-05-17 2015-09-23 李晖 Substratum, cell cultures test kit and cell culture processes
CN102787094A (en) * 2011-05-17 2012-11-21 李晖 Culture medium, kit used for culturing cells and method for culturing cells
EP3318627A1 (en) * 2011-06-10 2018-05-09 Koninklijke Nederlandse Akademie van Wetenschappen (KNAW) Culture media for stem cells
AU2020200515B2 (en) * 2011-06-10 2022-10-06 Koninklijke Nederlandse Akademie Van Wetenschappen Culture media for stem cells
CN104024401A (en) * 2011-06-10 2014-09-03 荷兰皇家科学院 Culture media for stem cells
RU2714256C2 (en) * 2011-06-10 2020-02-13 Конинклейке Недерландсе Академи Ван Ветенсаппен (Кнав) Culture medium for stem cells
IL275204A (en) * 2011-06-10 2020-07-30 Koninklijke Nederlandse Akademie Van Wetenschappen Knaw Culture media for stem cells
CN109136163B (en) * 2011-06-10 2024-07-12 荷兰皇家科学院 Culture medium for stem cells
CN109136163A (en) * 2011-06-10 2019-01-04 荷兰皇家科学院 Culture medium for stem cell
WO2012168930A2 (en) 2011-06-10 2012-12-13 Koninklijke Nederlandse Akademie Van Wetenschappen (Knaw) Culture media for stem cells
KR102167396B1 (en) * 2011-06-10 2020-10-21 코닌클리즈케 네덜란드세 아카데미 반 베텐샤펜 Culture media for stem cells
WO2012168930A3 (en) * 2011-06-10 2013-04-11 Koninklijke Nederlandse Akademie Van Wetenschappen (Knaw) Culture media for stem cells
EP4324913A3 (en) * 2011-06-10 2024-04-03 Koninklijke Nederlandse Akademie van Wetenschappen (KNAW) Culture media for stem cells
CN104024401B (en) * 2011-06-10 2018-07-27 荷兰皇家科学院 Culture medium for stem cell
EP4324913A2 (en) 2011-06-10 2024-02-21 Koninklijke Nederlandse Akademie van Wetenschappen (KNAW) Culture media for stem cells
US20140243227A1 (en) * 2011-06-10 2014-08-28 Koninklijke Nederlandse Akademie Van Wetenschappen Culture media for stem cells
JP2018085999A (en) * 2011-06-10 2018-06-07 コーニンクレッカ ネザーランド アカデミー ヴァン ウェテンシャッペン Culture medium for stem cells
AU2017208270B2 (en) * 2011-06-10 2019-10-24 Koninklijke Nederlandse Akademie Van Wetenschappen Culture media for stem cells
JP2021121214A (en) * 2011-06-10 2021-08-26 コーニンクレッカ ネザーランド アカデミー ヴァン ウェテンシャッペン Culture medium for stem cells
JP7275196B2 (en) 2011-06-10 2023-05-17 コーニンクレッカ ネザーランド アカデミー ヴァン ウェテンシャッペン Culture medium for stem cells
AU2012265814B2 (en) * 2011-06-10 2017-04-27 Koninklijke Nederlandse Akademie Van Wetenschappen (Knaw) Culture media for stem cells
KR20140037210A (en) * 2011-06-10 2014-03-26 코닌클리즈케 네덜란드세 아카데미 반 베텐샤펜 Culture media for stem cells
JP2014516562A (en) * 2011-06-10 2014-07-17 コーニンクレッカ ネザーランド アカデミー ヴァン ウェテンシャッペン Culture medium for stem cells
EP3611257A1 (en) * 2011-08-29 2020-02-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Method for preparing induced paraxial mesoderm progenitor (ipam) cells and their use
EP2772534A1 (en) 2011-10-27 2014-09-03 National University Corporation Tokyo Medical and Dental University Technique for isolating/culturing colorectal epithelial stem cell, and technique for transplanting colorectal epithelium employing said technique
JPWO2013061608A1 (en) * 2011-10-27 2015-04-02 国立大学法人 東京医科歯科大学 Colorectal epithelial stem cell isolation and culture technology, and colorectal epithelial transplantation technology using this
JP2018057383A (en) * 2011-10-27 2018-04-12 国立大学法人 東京医科歯科大学 Isolation and culture technique of colon epithelial stem cells and colon epithelial transplantation technique using the same
EP2772534A4 (en) * 2011-10-27 2016-02-17 Nat Univ Corp Tokyo Med & Dent Technique for isolating/culturing colorectal epithelial stem cell, and technique for transplanting colorectal epithelium employing said technique
US20140302491A1 (en) * 2011-10-28 2014-10-09 The Board Of Trustees Of The Leland Stanford Junior University Ex Vivo Culture, Proliferation and Expansion of Primary Tissue Organoids
WO2013063588A1 (en) * 2011-10-28 2013-05-02 The Board Of Trustees Of The Leland Stanford Junior University Ex vivo culture, proliferation and expansion of primary tissue organoids
US10006904B2 (en) 2011-12-19 2018-06-26 Umc Utrecht Holding B.V. Rapid quantitative assay to measure CFTR function in a primary intestinal culture model
EP3045912A1 (en) 2011-12-19 2016-07-20 UMC Utrecht Holding B.V. A rapid quantitative assay to measure cftr function in a primary intestinal culture model
US11035852B2 (en) 2011-12-19 2021-06-15 Umc Utrecht Holding, B.V. Identifying drug candidates for treating polycystic kidney disease using organoids generated from primary cells
US11988661B2 (en) 2011-12-19 2024-05-21 Umc Utrecht Holding, B.V. Rapid quantitative test to diagnose polycystic kidney disease
WO2013093812A2 (en) 2011-12-19 2013-06-27 Umc Utrecht Holding B.V. A rapid quantitative assay to measure cftr function in a primary intestinal culture model
WO2013093812A3 (en) * 2011-12-19 2013-09-19 Umc Utrecht Holding B.V. A rapid quantitative assay to measure cftr function in a primary intestinal culture model
US20150343018A1 (en) * 2012-10-03 2015-12-03 Institut Pasteur Nod2-dependent pathway of cytoprotection of stem cells
EP2929013A4 (en) * 2012-12-06 2016-07-20 Stembios Technologies Inc Lgr5+ somatic stem cells
WO2014131033A1 (en) 2013-02-25 2014-08-28 Genentech, Inc. Liquid culturing of epithelial stem cells
US20160237400A1 (en) * 2013-03-15 2016-08-18 The Jackson Laboratory Isolation of non-embryonic stem cells and uses thereof
AU2014239954B2 (en) * 2013-03-15 2020-07-16 The Jackson Laboratory Isolation of non-embryonic stem cells and uses thereof
WO2014152321A1 (en) 2013-03-15 2014-09-25 The Jackson Laboratory Isolation of non-embryonic stem cells and uses thereof
EP3884935A1 (en) 2013-08-09 2021-09-29 Ardelyx, Inc. Compounds and methods for inhibiting phosphate transport
EP3492106A1 (en) 2013-08-09 2019-06-05 Ardelyx, Inc. Compounds and methods for inhibiting phosphate transport
WO2015021358A2 (en) 2013-08-09 2015-02-12 Dominique Charmot Compounds and methods for inhibiting phosphate transport
WO2015173425A1 (en) * 2014-05-16 2015-11-19 Koninklijke Nederlandse Akademie Van Wetenschappen Improved culture method for organoids
US10597633B2 (en) 2014-05-16 2020-03-24 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for organoids
US11725184B2 (en) 2014-05-16 2023-08-15 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for organoids
AU2015261380B2 (en) * 2014-05-16 2021-04-15 Koninklijke Nederlandse Akademie Van Wetenschappen Improved culture method for organoids
EP3712254A1 (en) * 2014-05-28 2020-09-23 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
CN106661548B (en) * 2014-05-28 2020-12-11 儿童医院医疗中心 Methods and systems for converting precursor cells to stomach tissue via directed differentiation
US10174289B2 (en) 2014-05-28 2019-01-08 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
CN113249297A (en) * 2014-05-28 2021-08-13 儿童医院医疗中心 Methods and systems for converting precursor cells to stomach tissue via directed differentiation
US11053477B2 (en) 2014-05-28 2021-07-06 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
CN106661548A (en) * 2014-05-28 2017-05-10 儿童医院医疗中心 Methods and systems for converting precursor cells into gastric tissues through directed differentiation
AU2015267148B2 (en) * 2014-05-28 2021-07-29 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
WO2015183920A3 (en) * 2014-05-28 2016-01-28 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
US11369607B2 (en) 2014-09-03 2022-06-28 The Brigham And Women's Hospital, Inc. Compositions, systems, and methods for generating inner ear hair cells for treatment of hearing loss
EP4219564A1 (en) 2014-09-12 2023-08-02 The Board of Trustees of the Leland Stanford Junior University Wnt signaling agonist molecules
US11142577B2 (en) 2014-09-12 2021-10-12 The Board Of Trustees Of The Leland Stanford Junior University WNT signaling agonist molecules
WO2016040895A1 (en) 2014-09-12 2016-03-17 xxTHE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY Wnt signaling agonist molecules
US11584916B2 (en) 2014-10-17 2023-02-21 Children's Hospital Medical Center Method of making in vivo human small intestine organoids from pluripotent stem cells
EP3950937A1 (en) 2014-11-27 2022-02-09 Koninklijke Nederlandse Akademie van Wetenschappen Culture medium for expanding breast epithelial stem cells
US11130943B2 (en) 2014-11-27 2021-09-28 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
US10961511B2 (en) 2014-11-27 2021-03-30 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for expanding breast epithelial stem cells
US10711251B2 (en) 2015-04-03 2020-07-14 Propagenix Inc. Ex vivo proliferation of epithelial cells
US10711250B2 (en) 2015-04-03 2020-07-14 Propagenix Inc. Ex vivo proliferation of epithelial cells
US9790471B2 (en) 2015-04-03 2017-10-17 Propagenix Inc. Ex vivo proliferation of epithelial cells
US9963680B2 (en) 2015-04-03 2018-05-08 Propagenix Inc. Ex vivo proliferation of epithelial cells
US11680246B2 (en) 2015-04-03 2023-06-20 Propagenix Inc. Ex vivo proliferation of epithelial cells
US10100285B2 (en) 2015-04-03 2018-10-16 Propagenix Inc. Ex vivo proliferation of epithelial cells
US10119121B2 (en) 2015-04-03 2018-11-06 Propagenix Inc. Ex vivo proliferation of epithelial cells
US11060715B2 (en) 2015-09-11 2021-07-13 Propagenix Inc. Ex vivo proliferation of epithelial cells
US10514163B2 (en) 2015-09-11 2019-12-24 Propagenix Inc. Ex vivo proliferation of epithelial cells
US10066201B2 (en) 2015-09-11 2018-09-04 Propagenix Inc. Ex vivo proliferation of epithelial cells
WO2017060240A1 (en) 2015-10-05 2017-04-13 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Method and culture medium for ex vivo culturing of epidermis-derived stem cells
EP3423565A1 (en) * 2016-03-01 2019-01-09 Koninklijke Nederlandse Akademie van Wetenschappen Improved differentiation method
US11591572B2 (en) 2016-03-01 2023-02-28 Koninklijke Nederlandse Akademie Van Wetenschappen Differentiation method
US11066650B2 (en) 2016-05-05 2021-07-20 Children's Hospital Medical Center Methods for the in vitro manufacture of gastric fundus tissue and compositions related to same
WO2017220586A1 (en) * 2016-06-20 2017-12-28 Koninklijke Nederlandse Akademie Van Wetenschappen Improved differentiation method
RU2772435C2 (en) * 2016-06-20 2022-05-20 Конинклейке Недерландсе Академи Ван Ветенсаппен Improved differentiation method
US11180735B2 (en) 2016-10-28 2021-11-23 The Board Of Trustees Of The Leland Stanford Junior University Methods to preserve tumor-stromal interactions in culture and therapeutic predictive applications thereof
US10668108B2 (en) 2016-11-04 2020-06-02 Children's Hospital Medical Center Compositions and methods of treating liver disease
US11767515B2 (en) 2016-12-05 2023-09-26 Children's Hospital Medical Center Colonic organoids and methods of making and using same
US11958891B2 (en) 2017-01-26 2024-04-16 Surrozen Operating, Inc. Tissue-specific Wnt signal enhancing molecules and uses thereof
US12029764B2 (en) 2017-05-29 2024-07-09 Stemcell Technologies Canada Inc. Compositions and methods for obtaining organoids
WO2018218344A1 (en) * 2017-05-29 2018-12-06 Stemcell Technologies Canada Inc. Compositions and methods for obtaining organoids
US11773171B2 (en) 2017-12-19 2023-10-03 Surrozen Operating, Inc. WNT surrogate molecules and uses thereof
US12006368B2 (en) 2017-12-19 2024-06-11 Surrozen Operating, Inc. Anti-frizzled antibodies and methods of use
US11746150B2 (en) 2017-12-19 2023-09-05 Surrozen Operating, Inc. Anti-LRP5/6 antibodies and methods of use
US11617745B2 (en) 2018-08-17 2023-04-04 Frequency Therapeutics, Inc. Compositions and methods for generating hair cells by downregulating FOXO
WO2020169551A1 (en) 2019-02-19 2020-08-27 Miltenyi Biotec B.V. & Co. KG Cell culture medium and method for generation of epithelial organoids from epithelial stem cells
GB201903573D0 (en) 2019-03-15 2019-05-01 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for head and neck organoids
WO2020187853A1 (en) 2019-03-15 2020-09-24 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for head and neck organoids
WO2020234250A1 (en) 2019-05-17 2020-11-26 Koninklijke Nederlandse Akademie Van Wetenschappen Improved culture method using integrin agonist
WO2021028361A1 (en) 2019-08-09 2021-02-18 Urosphere Method for differentiating epithelial stem cells
EP3772538A1 (en) 2019-08-09 2021-02-10 Urosphere Method for differentiating epithelial stem cells
WO2021043606A1 (en) 2019-09-06 2021-03-11 Qgel Sa Method for obtaining healthy intestinal organoids
EP3789049A1 (en) 2019-09-06 2021-03-10 QGel SA Method for obtaining healthy intestinal organoids
US11629385B2 (en) 2019-11-22 2023-04-18 Tempus Labs, Inc. Tumor organoid culture compositions, systems, and methods
WO2021110665A1 (en) 2019-12-04 2021-06-10 Qgel Sa Method and kit for cell growth
US11415571B2 (en) 2019-12-05 2022-08-16 Tempus Labs, Inc. Large scale organoid analysis
WO2021198385A1 (en) 2020-03-31 2021-10-07 Koninklijke Nederlandse Akademie Van Wetenschappen Methods and tools for studying enteroendocrine cells
US11561178B2 (en) 2020-04-20 2023-01-24 Tempus Labs, Inc. Artificial fluorescent image systems and methods
GB202109913D0 (en) 2021-07-09 2021-08-25 Stichting Hubrecht Organoid Tech Organoid-derived monolayers and uses thereof
WO2023281122A1 (en) 2021-07-09 2023-01-12 Stichting Hubrecht Organoid Technology Organoid-derived monolayers and uses thereof
WO2023180578A1 (en) 2022-03-25 2023-09-28 Stichting Hubrecht Organoid Technology Methods for co-culturing genotoxic bacteria and organoids

Also Published As

Publication number Publication date
EP4253529A2 (en) 2023-10-04
AU2010211428B2 (en) 2015-09-03
JP2012516685A (en) 2012-07-26
US8642339B2 (en) 2014-02-04
US20140256037A1 (en) 2014-09-11
US10947510B2 (en) 2021-03-16
MX2011008044A (en) 2012-01-12
JP5722835B2 (en) 2015-05-27
ES2948761T9 (en) 2023-11-23
CA2751332C (en) 2024-04-02
AU2010211428A1 (en) 2011-08-18
CA2751332A1 (en) 2010-08-12
IL214381A (en) 2016-09-29
KR20120003855A (en) 2012-01-11
HRP20160791T1 (en) 2016-09-23
PL2393917T3 (en) 2016-12-30
CN102439135B (en) 2014-04-30
RU2011136704A (en) 2013-03-10
RU2555545C2 (en) 2015-07-10
US20120028355A1 (en) 2012-02-02
NZ594271A (en) 2014-02-28
JP2012254081A (en) 2012-12-27
EP3441458C0 (en) 2023-06-07
EP3441458B1 (en) 2023-06-07
DK2393917T3 (en) 2016-04-18
CN102439135A (en) 2012-05-02
HUE028647T2 (en) 2016-12-28
EP4253529A3 (en) 2024-01-17
HRP20230650T1 (en) 2023-09-29
EP3061808A3 (en) 2016-10-19
US20190100728A1 (en) 2019-04-04
PL3441458T3 (en) 2023-11-06
HK1163746A1 (en) 2012-09-14
EP3441458A1 (en) 2019-02-13
ES2948761T3 (en) 2023-09-18
EP3441458B9 (en) 2023-08-23
KR101904224B1 (en) 2018-10-04
ES2579909T3 (en) 2016-08-17
EP2393917A2 (en) 2011-12-14
JP5458112B2 (en) 2014-04-02
PL3061808T3 (en) 2021-02-08
DK3061808T3 (en) 2020-09-07
HUE062459T2 (en) 2023-11-28
EP3061808A2 (en) 2016-08-31
WO2010090513A3 (en) 2010-11-25
EP3061808B1 (en) 2020-08-12
SG173492A1 (en) 2011-09-29
IL214381A0 (en) 2011-09-27
EP2393917B1 (en) 2016-04-06

Similar Documents

Publication Publication Date Title
US20190100728A1 (en) Culture medium for epithelial stem cells and organoids comprising the stem cells
US20180072995A1 (en) Culture medium for epithelial stem cells and organoids comprising the stem cells
AU2020200515B2 (en) Culture media for stem cells
US20150368616A1 (en) Methods for induction of cell fates from pluripotent cells
ES2825713T3 (en) Culture medium for epithelial and organoid stem cells comprising such stem cells
Delaspre Stepwise differentiation of pancreatic acinar cells from mES cells by manipulating signalling pathway

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080013109.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10703131

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2010211428

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 594271

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2011547839

Country of ref document: JP

Ref document number: 5518/CHENP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/008044

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 214381

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2751332

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2010211428

Country of ref document: AU

Date of ref document: 20100203

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20117020340

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010703131

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011136704

Country of ref document: RU

WWE Wipo information: entry into national phase

Ref document number: 13147163

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1008086

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1008086

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110802