Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
  • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
  • C07K14/245—Escherichia (G)
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]

Definitions

• the present invention provides (a) vector (s) containing (a) a gene encoding (i) a CDK4/CDK6 inhibitor or (ii) an RNA interfering with CDK4 and/or CDK6 expression and/or activity, under the control of an inducible promoter and (b) a gene encoding a transactivator protein for said promoter.
• This vector can be transferred into cells where it will exert its protective function to (i) prevent cell death or to (ii) slow down progression of cell death.
• This vector construct can be used in therapeutic applications e.g. to prevent neurodegenerative disorders or to slow down their progression with therapeutic efficacy. Alternatively, the vector construct can be used as disease modifying strategy in disorders where an unscheduled activation of the cell cycle occurs.
• the present invention is based on a gene therapeutic approach that affects cell cycle regulation of targeted cells.
• existing risks with gene therapy and specific challenges for gene therapy posed by the central nervous system will be further met through (i) viral or (ii) non-viral vectors for safe gene transfer, (iii) cell type specific recognition systems, (iv) cell-type specific expression system and (v) controlled delivery by convection- enhanced delivery, preferably, a combination of (i) to (v) .
• AD Alzheimer's disease
• FERRI ET AL. 2005
• AD Alzheimer's disease characterized by a progressive neurodegeneration, a process of progressive structural desintegration that eventually results in neuronal death. This loss of neurons is associated with typical, albeit not specific neuropathological hallmarks, i.e. the deposition of abnormal molecular aggregates in form of intracellular neurofibrillar tangles and extracellular neuritic plaques. Neurofibrillar tangles are made up by 'paired helical filaments' composed by the microtubule-associated protein tau in a hyperphosphorylated form. Neuritic plaques consist of aggregated A ⁇ -peptide that derives by proteolytic cleavage from the much larger Amyloid Precursor Protein (APP) .
• APP Amyloid Precursor Protein
• Neurodegeneration in AD is associated with aberrant structural neuronal plasticity, characterised by neuronal sprouting and re-organisation of cytokeletal proteins (ARENDT ET AL. , 1995A, B, c; 1997) . These processes are intracellularly mediated through abnormal activation of the Ras-MAP-kinase -pathway ( Figure 1) . This pathway is activated at very early stages of the disease and prior to any neurofibrillary pathology or accumulation of AE (GARTNER ET AL., 1999) . Distribution and progression of neurodegeneration throughout different brain areas in the course of AD, moreover, matches the pattern of neuronal plasticity (i.e.
• AD Alzheimer's disease
• the technical problem underlying the present invention is to provide means suitable for treating or preventing neurodegenerative disorders like AD and, in addition, diseases associated with an unscheduled activation of the cell cycle.
• Neuronal cell death both during brain development and neurodegeneration is accompanied by re-activation of the cell cycle as evidenced by re-expression of cell -cycle regulators and partial or even complete replication of DNA.
• This process of cell cycle re-activation is related to cell death under such diverse conditions such as developmental cell death and neurodegeneration of various origins such as AD, Amylothrophic Lateral Sclerosis (ALS) , Parkinsons 's disease, Ischemia or others, indicates a critical link between cell cycle activation and neuronal cell death. Further evidence in support of this suggestion could be provided by the neuroprotective action of cell cycle blockade under various in vitro paradigms of acute cell death.
• AD Alzheimer's disease
• neurodegeneration is not homogenously distributed throughout the brain. It rather shows a distinct pattern with a systematic distribution in space and time.
• Neuronal reactivation of the cell cycle in AD occurs in those neurons which are potentially vulnerable against cell death, i.e. the pattern of neurons affected by cell cycle re-activation is basically identical to the pattern of neurodegeneration. This indicates that cell cycle re-activation is an early event in the pathogenetic chain eventually leading to cell death.
• Critical molecular switches of cell cycle activation in neurons therefore, represent molecular targets suitable for prevention and/or treatment of neurodegenerative disorders.
• Figure 1 Schematic illustration of the intracellular signalling events triggered by morpho-dysregulation in AD These events involve an aberrant activation of p21ras/MAP- kinase signalling, a loss of differentiation control, the subsequent re-entry and partial completion of the cell cycle and eventually result in cell death.
• FIG. 1 Neuronal DNA replication in AD assessed by 3 independent methods
• a prominent 4n-peak is obtained by laser scanning cytometry after PI staining of neurons in AD.
• A/B microexplants of mice brain (ED 17); B: reduced rate of apoptosis induced by okadaic acid (10 nM) after transfection with pl6 INK4a (TUNED .
• C/D hepatocytes transfected with either GFP or pEGFP-N- pl6 INK4a .
• D pl6 INK4a prevents staurosporine-induced cell death.
• E/F hippocampi of transgenic mice with inducible neuron- specific expression of pl6 INK4a (CamKII promotor, tet -system) .
• F Induction of pl6 INK4a expression prevents neuronal death induced by NMDA (Fluorojade staining of degenerating neurons: arrows) .
• Figure 4 Inducible neuron-specific expression of p!6 INK4a in the cortex of transgenic mice
• CamKII promoter controlled tTA expression allows regulation of tetO/CMVmin promoter linked pl6 INK4a expression in dependence of Dox administration (left, plus Dox, off-state; right, without Dox, on-state; immunocytochemical detection of pl6 INK4a )
• the present invention relates to a vector or a mixture of at least two vectors comprising
• a nucleic acid molecule encoding (i) a protein interfering with the biological activity of the cyclin dependent kinase CDK4 and/or CDK6 , or (ii) an RNA interfering with CDK4 and/or CDK6 expression and/or activity, under the control of an inducible promoter;
• nucleic acid molecules (a) and (b) can be present in one vector or, as separate entities, in two vectors.
• RNAs interfering with CDK4 and/or CDK6 expression and/or activity e.g., RNAi or RNAs exhibiting an inhibitory effect based on other mechanisms of RNA-RNA and/or RNA-protein interactions.
• the protein encoded by the nucleic acid molecule of (a) reduces or inhibits the biological activity of CDK4 and/or CDK6.
• the present invention provides a novel therapeutic concept of preventing progressive neurodegeneration through blockade of cell cycle re-entry of neurons.
• the invention relates to a gene-therapeutic concept to slow down or even prevent neurodegeneration with high therapeutic efficacy and minimal or no side-effects.
• the invention uses a gene therapeutic approach that will target the critical molecular regulatory switches CDK4 and CDK6 to slow down or completely shut off the cell cycle in differentiated neurons which will result in rescuing the cell.
• the concept is based on inhibition of cell-cycle re-entry, a critical trigger of cell death in neurons, and will be accomplished by down- regulation of CDK4 and/or CDK6, e.g., through (i) ectopic expression of its physiological inhibitor pl ⁇ INK4a or other inhibitors and (ii) use of an RNA interfering with CDK4 and/or CDK6 expression and/or activity.
• Preferred CDK inhibitors that can modulate activity of CDK4 and CDK6 which are critical molecular switches for cell cycle activation belong to the INK4 family (particularly preferred are pl6 INK4a , pl5 INK4B , pl8 INK4C and pl9 INK4D ) or the Cip/Kip family (particularly preferred are p21 cip , p27 Kipl and p57 Kip2 ) .
• Individual INK4 and Cip/Kip inhibitors have tissue and cell specific properties with respect to inhibition of CDK4/CDK6.
• RNA interference (RNAi) -based gene silencing in the form of small interfering RNAs (siRNA) , small hairpin RNAs (shRNA) , microRNA, non-coding RNA has emerged in recent years as a valuable tool for studying gene expression both in cell culture and in vivo (BANTOUNAS ET AL., 2004; ZHOU ET AL. , 2006) .
• RNA recognition and its down-regulation are based on the anti- sense action of so called "small inhibitory nucleic acids" to which antisense oligonucleotides, catalytic nucleic acids - ribozymes and deoxyribozyraes as well as small interfering RNAs (RNAis) are included. All of these nucleic acids recognize the target molecule, e.g., the gene encoding CDK4 or CDK6 , via sequence- specific Watson-Crick base pairing and lead to the formation of a complementary complex with messenger RNA. The mechanism of action of these inhibitory nucleic acids is different.
• Antisense oligonucleotides when bound to the target molecule form DNA-mRNA duplexes and block the translation by "hybridization arrest” or activate RNase H and lead to RNA degradation (STEIN AND CHENG, 1993) .
• Ribozymes and deoxyribozymes facilitate the cleavage of RNA phosphodiester bonds via a catalytic mechanism (EMILSSON ET AL. , 2003) .
• Anti-sense, ribozyme and deoxyribozyme strategies are widely used to design nucleic acids for therapeutic applications (CHRISTOFFERSEN AND MARR, 1995; LEWIN AND HAUSWIRTH, 2001; OPALINSKA AND GEWIRTZ, 2002) .
• regions of CDK4 and CDK6 which are preferred targets for the above discussed RNA based interference with CDK4 and/or CDK6 expression. Examples of preferred regions for the gene silencing approach are:
• RNAs for targeting any of the above regions (a) to (d) are: microRNAs (e.g., mirl24a, mir34, mirl ⁇ ) , nc (non- coding) RNAs, ribozymes, siRNAs or shRNAs .
• Direct transfection for example by simple lipid-based protocols
• the silencing agents has certain disadvantages, including low silencing activity of exogenously delivered RNAis, transient effect of gene silencing and induction of so called "off-target” effects (induction of silencing of non- target genes) .
• RNA interference One of the most crucial limitations of application of RNA interference in therapy is the low efficiency of delivery of RNAi molecules into the target cells. They are degraded quickly by intracellular nucleases making long term studies (and potential therapeutic applications) virtually impossible.
• certain cell types e.g. primary neurons
• RNAi sequences are adapted to include a spacer that mediates the formation of a hairpin structure (shRNA) , which allows the sense and antisense sequences to form base pairs.
• shRNA hairpin structure
• vector-based systems for the expression of shRNA were developed, whereby the silencing nucleic acid is expressed under the control of a polIII (e.g. U6, Hl) promoter.
• polIII e.g. U6, Hl
• More recently microRNA shuttles have been used to deliver shRNAs and an important feature of this method is that polll promoters (e.g. CMV or Synapsin) can be used in the viral vector.
• polll promoters e.g. CMV or Synapsin
• the present invention provides vector (s), wherein the RNA for RNAi based silencing of CDK4 and/or CDK6 expression is a siRNA, shRNA, microRNA, non-coding RNA, ribozyme or deoxyribozyme .
• the modular character of the gene therapeutic tools allows to adapt the above concept in alternative specifications for the treatment of a wide variety of other neurological disorders where unscheduled cell -cycle re-entry of cells is of critical importance such as Parkinsons 's disease, stroke, amyotrophic lateral sclerosis or proliferative vitreoretinopathy. Further, it will be applicable to a broad range of non-neurological disorders where unscheduled cell-cycle re-entry of non- neuronal cells is of critical importance such as cancer, immuno-proliferative disorders, cardiac hypertrophy, atherosclerosis, glomerulonephritis, psoriasis, AIDS and others (Table 1; ARENDT, 2008) . In addition to AD, malignomas and cardiovascular disorders, which together are the three major burden of health care systems, are in the direct focus of this novel strategy. Table 1
• HCMV cardiovascular disease # human pap iii omavirus (HP v )
• HSV herpes simplex virus
• a unit carrying the gene of interest controlled by an inducible promoter (feature (a)
• the Tet-on/off system is preferred since it is most suitable for applications in patients because:
• Dox is liposoluble and has considerable tissue penetration properties which inludes the brain (UEBERHAM ET AL., 2005) , which is a prerequiste for using the tet -system to develop CNS gene therapies;
• oral administration of Dox allows fast and dose-dependent gene induction/repression switches in vivo (AURISICCHIO ET AL. , 2001) ;
• the reverse repressor of tetracycline operon (rtetR) is fused to the herpes simplex virus VP16 transcriptional factor to establish the reverse tetracycline- controlled trans-activator (rtTA) .
• rtTA reverse tetracycline- controlled trans-activator
• This binds to an inducible promoter and activates transcription of genes of interest in the presence of tetracycline or its analogous doxycycline.
• the inducible promoter consists of the Tet operator tetO fused to a cytomegalovirus minimal promoter (CMVmin) .
• CMVmin cytomegalovirus minimal promoter
• KRAB KRAB of the human Kox-1 protein and [b] the tetR protein fused to the human Mad-1 domain, which is involved in the recruitment of mSin3-histone deacetylase complex.
• the KRAB repressor proteins and a strategy using tetR-Mad-1 are preferred.
• non-integrating vectors do not form complex episomal concatamers (seen with AAV vectors that must be used at high titres) that also alter expression profiles.
• lentiviral vectors are the tools of choice for gene delivery into the central nervous system. They have a relatively large transgene capacity (8-10 kb) , can be generated to high titre, have low immunogenicity and unlike retroviral vectors, can efficiently transduce postmitotic neurons to generate stable and long term expression of the transgene (for review see WONG ET AL. , 2006) . Following entry into target cells, lentiviral vectors stably integrate into the host genome. Safety issues relating to insertional mutagenesis can be avoided by the use of a non- integrating viral vector, for example the adeno-associated vector (AAV) .
• AAV adeno-associated vector
• AAV vectors can efficiently transduce neuronal cell types and have low immunogenicity (for review see TENENBAUM ET AL., 2004), however they are limited by transgene capacity (4-5 kb) and have also been shown to integrate into active genes in mice (NAKAI ET AL. , 2003) . More promisingly, integration-deficient lentiviral vectors, originally described to be inefficient at transducing dividing cells (CASE ET AL. , 1999; NALDINI ET AL . , 1996), have recently been shown to maintain transgene expression in vitro (Lu ET AL. 2004; SAENZ ET AL. , 2004; VARGAS JR. ET AL., 2004) and in vivo (YANEZ-MUNOZ ET AL.
• non-viral vectors that can be used for the present invention.
• non-viral vector-mediated gene transfer has already successfully been applied to various organs including CNS.
• Different clinically effective approaches resulting in tumor regression have recently been reviewed (OHLFEST ET AL. , 2005B) .
• OHLFEST ET AL. , 2005B Different clinically effective approaches resulting in tumor regression have recently been reviewed.
• PEIs branched and linear polyethylenimines
• PEIs show efficient and versatile gene delivery.
• PEIs are positively charged and condense negativeIy-charged DNA to sizes below 200 nm, facilitating cell entry and causing endosomal rupture.
• the degree of branching affects transfection efficiency (KICHLER 2004) .
• PEIs might be particularly promissing for CNS targeting, possesing several advantages, (i) DNA/PEIs are well tolerated when administered to the CNS (LEMKINE ET AL. 2002; OHLFEST ET AL. 2005A; OH ET AL. 2007) , (ii)
• the brain is an attractive target for PEI where PEIs were found highly- enriched even after systemic administration (JOHANSSON ET AL. , 2004) .
• PEIs can be coupled to different ligands possessing high affinity to surface receptors of the target cell .
• the vector or mixture of vectors of the present invention further contains a nucleic acid sequence encoding a peptide or polypeptide for cell- specific targeting.
• Cell -type specific targeting can be achieved, e.g., by coupling non-viral vectors to peptides and polypeptides, preferably antibodies, against cell -specific surface receptors .
• Antibodies should have (i) a strong specificity for neurons, they should be (ii) non-toxic and (iii) cause no or only diminished activation of immune cells in vivo. Further, (iv) they should not interfere with critical physiological function.
• antibody as used herein describes an immunoglobulin whether natural or partly or wholly synthetically produced. This term also covers any protein having a binding domain which is homologous to an immunoglobulin binding domain. These proteins can be derived from natural sources, or partly or wholly synthetically produced. Examples of antibodies are the immunoglobulin isotypes and the Fab, F(ab 1 ) 2 , scFv, Fv, dAb and Fd fragments.
• Trk tyrosine kinase
• ARENDT ET AL. 1983
• TrkA receptors tyrosine kinase A receptors, specifically located on cholinergic neurons which are affected in AD most early and most severly
• ARENDT ET AL. 1983
• TrkA receptors After binding to TrkA receptors, the complete Ab-TrkA- receptor-complex is internalised (LESAUTEUR ET AL., 1996) . This allows a proper internalisation of conjugated PEIs as it occurs with the physiological ligand NGF.
• anti- NGF-antibody can be used. After binding to NGF, the antibody- NGF-complex is also bound to the TrkA receptor followed by accelerated internalisation as compared to NGF alone (SARAGOVI ET AL. 1998) .
• alternative cell surface molecules of cholinergic neurons such as p75 neurotrophin receptor (p75NTR) , neuronal cell adhesion molecule (NCAM) and nicotinic acetylcholine receptors (nAChR) will specifically be targeted.
• p75NTR neurotrophin receptor
• NCAM neuronal cell adhesion molecule
• nAChR nicotinic acetylcholine receptors
• a modified rabies virus glycoprotein (rvg) recently used to shuttle naked RNAi into neurons (KUMAR ET AL., 2007) will be coupled to PEIs which facilitates stabilisation of transported RNAi.
• PEIs a modified rabies virus glycoprotein
• p75NTR, NCAM and nAChR bind the rabies protein on the cell surface and facilitate internalisation.
• endogenic neurotropism of the peptide is used to specifically target cholinergic neurons selectively affected in AD. Further, it allows easy crossing of the blood brain barrier, which in turn allows peripheral administration of this tool.
• the nucleic acid molecules of the vector (s) of the present invention can be linked to a tissue specific promoter and used for gene therapy.
• cell-type specific expression can be achieved by cell-specific control of expression, e.g., by neuron-specific promoters.
• Many promoters with preference to neurons have been characterized and were tested in vivo (HiOKI ET AL., 2007) by various shuttle/expression systems.
• the CamKII and synapsin (SYN) promoters have many advantages, because they are exclusively expressed in neurons (KUGLER ET AL. , 2003) .
• the NSE promoter has only a relative specificity for neurons and is also expressed in glial cells.
• the SYN promoter shows the highest specifity for neuronal expression (>96%) (HIOKI ET AL., 2007), and has already ⁇ uccesfully been applied for generation of transgenic mice with neuron-specific expression of p21ras (HEUMANN ET AL. , 2000; ARENDT ET AL., 2004; GARTNER ET AL. , 2005; SEEGER ET AL., 2005; ALPAR ET AL. , 2006) .
• Recently, the high neuronal specificity of the CamKII promoter could be demonstrated (UEBERHAM ET AL. , 2005; 2006) .
• Expression level of genes of interest can further be improved by (a) enhancement promoter activity via generating hybrid promoters by fusing with CMV enhancer according to HIOKI ET AL. (2007) or (b) incorporating the wood-chuck hepatitis virus post -transcriptional re-gulatory element (WPRE) at the 3 'untranslated region (PATERNA ET AL., 2000) .
• WPRE wood-chuck hepatitis virus post -transcriptional re-gulatory element
• the present invention also provides vector (s) as described above for use in a method for the prevention or treatment of (a) a neurogenerative disorder or (b) a disease associated with an unscheduled activation of the cell cycle.
• the present invention also relates to the use of (a) vector (s) as defined above for the preparation of a pharmaceutical composition for the prevention or treatment of (a) a neurogenerative disorder or (b) a disease associated with an unscheduled activation of the cell cycle.
• said neurogenerative disorder is Alzheimer's disease (AD) .
• the pharmaceutical composition also contains a pharmaceutically acceptable carrier.
• suitable pharmaceutical carriers etc. are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc.
• Such carriers can be formulated by conventional methods and can be administered to the subject at a suitable dose.
• Administration of the suitable compositions may be effected by different ways, e.g. by intravenous, intraperetoneal , subcutaneous, intramuscular, topical or intradermal administration. The route of administration, of course, depends on the nature of the disease, e.g., AD, its localisation and the kind of compound contained in the pharmaceutical composition.
• dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, dosages for any one patient depends on many factors, including the patient's size, body surface area, age, sex, the particular compound to be administered, time and route of administration, the kind and stage of the disease (e.g. AD), general health and other drugs being administered concurrently.
• the delivery of the vectors (s) of the present invention can be achieved, e.g., by direct application to the target site, e.g., the brain or, e.g., by intrathecal, intracerebrospinal , intranasal, intraperintoneal or oral administration.
• the blood-brain barrier represents a considerable hurdle to the delivery of therapeutic agents, such as viral vector- mediated gene therapy or PEIs to the brain.
• therapeutic agents such as viral vector- mediated gene therapy or PEIs
• the development of techniques to efficiently bypass this barrier would revolutionise the management of neurological diseases .
• Osmotic disruption of the blood-brain barrier may be achieved by intra-arterial injection of a concentrated mannitol solution prior to drug administration. Although this approach may transiently open-up the endothelial cell tight junctions, drug appears to accumulate in the underlying basement membrane, limiting tissue penetration (MULDOON ET AL. , 1999) .
• CED convection-enhanced delivery
• CED does not depend on diffusion to achieve adequate drug distribution.
• CED distributes therapeutic agents along a pressure gradient generated between the catheter tip and the brain extracellular space. Consequently, in contrast to techniques that are dependent on diffusion, which leads to drug distribution heterogeneously, short distances, down a concentration gradient, CED enables the controlled, homogeneous distribution of drugs over large distances (up to 5 cm from the catheter tip) regardless of their molecular size (GILL ET AL., 2003; GILLIES ET AL. , 2005) .
• the relative DNA content of the cells was determined by the integral PI fluorescence values and these data were further analyzed using the cell cycle software ModfitLT, version 2.0 (Verity Software House Inc., Topsham, ME, USA) .
• Cell cycle software ModfitLT version 2.0 (Verity Software House Inc., Topsham, ME, USA) .
• Figure 2A cell populations, containing an amount of DNA of 2n, 2n to 4n or 4n could clearly be discriminated. While most cells were represented by the 2n-peak, an additional 4n-peak (arrow) was clearly obtained for AD brain, which was not present in age-matched healthy control brains.
• Hybridization was performed with a ZytoDotCEN 17 probe (ZytoVision, Bremerhaven, Germany) which target alpha- satellite-sequences of the centromere of chromosome 17.
• the digoxigenin labeled probe was immunohistochemically visualized using peroxidase-conjugated Fab fragments of an anti- digoxigenin antibody from sheep (Boehringer-Mannheim, Mannheim, Germany) and nickelammoniumsulfate / DAB / 0.015 % H 2 O 2 as chromogen.
• Fixed human lymphocytes, dropped on object slides and HeLa cells, cultured under standard conditions and grown on cover slips were used as controls.
• CISH Chromogenic in situ hybridization
• Single neurons, indentified by immunoreacitivity for neurofilamants (SMI 311) were cut from brain slices with a laser microdissector (PALM ® MicroBeam, P.A. L. M. Microlaser Technologies AG, Bernried, Germany) and subsequently subjected to DNA quantification.
• DNA content of individual neurons was quantified through real-time PCR amplification of alu repeats (Walker et al . , 2003), a class of short interspersed elements in the eukaryotic genome which reach a copy number of about 1 million in primates (Houck et al . , 1979; Batzer and Deininger, 2002) .
• Alu repeats were chosen due to their high copy number and low level of polymorphism compared to other short interspersed elements in the eukaryotic genom (Roy-Engel et al . , 2001). The residual risk of an artificial influence by different copy numbers or single nucleotide polymorphisms in several individuals was avoided by the intraindividual comparison of two different brain areas of each patient.
• the single cell DNA content was further analyzed in the same cases by laser capture microdissection of neurons in the entorhinal cortex individually identified under the microscope and subsequent PCR amplification of alu repeats.
• the frequency distribution of single cell DNA content obtained by this method is displayed in Figure 2C (upper panel) . Comparing AD to controls, a shift towards higher size classes and differences in the shape of the distribution becomes apparent.
• the distributions of control groups have a single maximum at 2.5-3.5 pg per cell which corresponds to the size for a 2n DNA content as determined in initial validation experiments.
• AD groups displayed a second maximum in the size group of 6.5-7.5 pg per cell most likely representing tetraploid neurons (4n) ( Figure 2C, lower panel) .
• pl6 INK4a human fibroblast RNA was isolated, reversely transcribed using random pdN6 -primers and Superscript II RT (Gibco) and the obtained cDNA was amplified using the following specific primer pairs: pl6-forward: 5'-GAG AAC AGA CAA CGG GCG GCG and pl6-revers: 5'-CCT GTA GGA CCT TCG GTG ACT.
• the pl6 rNK4a sequence was cloned using sure clone ligation kit (Promega) in a cloning vector (i.e. from PUC18 series [Promega]) resulting in pUC18- pl6.
• This plasmid was transformed in CaCl 2 competent JM109 E.coli cells and cultured on agar plates in the presence of ampicillin. A colony was picked, cultured in LB medium, the plasmid was isolated using Qiagen Maxi-prep and the insert was sequenced.
• the pl6 INK4a insert was cut using restriction enzymes and further subcloned into the pSinRep5 vector which was prior linerarized in the multing cloning site with restriction enzymes.
• the pSinRep5 vector belongs to the Sindbis expression system which was purchased from Invitrogen ("Sindbis Expressions System"; Invitrogen; catalog-Nr. K750-01) .
• the newly generated pSinRep5-pl6 INK4a vector was linearized and RNA was transcribed using SP6 polymerase. RNA was also transcribed from the DH-BB helper plasmid by SP6 polymerase.
• DH-BB helper RNA and SinRep5-pl6 RNA were mixed with lipofectin (purchased from Gibco) and added to cultured BHK cells. 24 hours after this co-transfection the medium was removed, centrifuged by 2000 x g to remove cell debris and the remaining supernatant containing Sindbis-pl6 virus was used as virus stock solution for experiments shown in Example 3.
• the pl6 INK4a sequence was cut by restriction enzymes and further subcloned in the expression vector pEGFP-N (Clontech) which was used for experiments shown in Example 3.
• the pl6 INK4a cDNA was amplified using the following specific primer pairs containing MIuI and HindIII sites allowing subcloning into pBI vector (pl6-Mlu-F: ctcacgcgtagcgggagcagcatggagccggcg; pl6-Hind-R: atcaagcttgctctggttctttcaatcggggat) resulting in pBI-pl6 INK4a .
• the transgenic mice with inducible neurospecific- specific expression of pl6 INK4a were generated using the heterologous tTA system.
• transgenic line p tet pl6 INK4a (C57B1/6-DBA background and generated by microinjection of pBI-pl6 INK4a in mouse oocytes by conventional methods) carrying the bidirectional transcription unit for luciferase and pl6 INK4a were interbred with individuals of the transactivator line CamKII (C57B1/6-NMRI background) .
• Animals were housed under a constant day-night cycle of 12:12 hours and fed a standard chow diet (Altromin 1324, Altromin Deutschen f ⁇ r Tierernahrung, Germany) , with access to water/doxycycline hydrochloride solution ad libitum under all conditions. Animal experiments were carried out in accordance with the European Council Directive of 24 November 1986 (86/609/EEC) and were approved by the local authorities.
• Doxycycline hydrochlorid (Sigma, Deisenhofen, Germany, Dox) was dissolved to 50 ⁇ g/ml in water and given in brown bottles, which were exchanged twice a week, to prevent transcription. Expression of transgenic proteins was induced by substituting plain water for Dox. P16 INK4a expressing mice and controls were used in the experiments described in Example 3.
• Rat brain slices were transduced with stock dilutions of (A) Sindbis viruses, or (B) Sindbis-pl6 INK4a viruses. Following treatment of rat brain slices with okadaic acid (10 nM OA, 24 h) which induces neuronal cell death brain slices were incubated with 4% PFA and a TUNEL reaction with dUTP-Rhodamin was performed.
• Figure 3A Red colour marks many apoptotic neurons in Sindbis transduced microexplants .
• Figure 3B shows Sindbis -pl6 INK4a transduced cultured microexplants (TUNEL; dUTP-Rhodamin) demonstrating reduced neuronal cell death with lower number of apoptotic neurons.
• P16 INK4a expressing mice transgenic pl6 INK4a is expressed after doxycyclin removal from drinking water
• P16 INK4a non- expressing mice repression of transgenic pl6 INK4a expression is due to doxycyclin administered in drinking water
• NMDA By stereotactic apparatus NMDA was administered (2 ⁇ g NMDA/ ⁇ l PBS; injection speed 0.1 ⁇ l/ min; injection time 5 min,- region: into the hippocampus) . After surviving time of 14 days mice were killed, the brains perfused with 4% paraformaledyde and slices were Fluorojade stained for detection of dying neurons.
• P16 INK4a expressing mice (Figure 3F) show low number of apoptotic neurons in contrast to mice with repressed pl6 INK4a expression ( Figure 3E) .
• Fluoro-Jade B is an anionic fluorochrome which selectively stains both cell bodies and processes of degenerating neurons. The method was slightly adapted from that originally described (Schmued et al . , 1997) . Sections were mounted onto gelatin- coated (2%) slides, air dried at 50 0 C for 50 min and immersed in a solution containing 1% sodium hydroxide in 80% ethanol for 3 min. Following incubation for 1 min in 70% ethanol and 2 min washing in distilled water, slides were transferred to a solution of 0.06% potassium permanganate for 15 min on a shaker table. After rinsing in distilled water (1 min), slides were incubated in Fluoro-Jade B staining solution for 20 min.
• Fluoro-Jade B (Histo- Chem Inc., Jefferson, USA) was dissolved in 100 mL distilled water and 10 mL of this stock solution was diluted with 90 mL of 0.1% acetic acid to give the staining solution. Following staining, slides were rinsed with water, dried and coverslipped. Lesion volumes were determined using series of Fluoro-Jade B-stained slices applying the software NeurolucidaTM (version 5.05.4, MicroBrightField Inc., Williston, USA) . Briefly, the lesion was encircled on every tenth Fluoro-Jade B-stained slice and the cross-sectional area was determined by the software NeurolucidaTM.
• Transgenic mice with inducible neuron- specific expression of pl6 iNK4a [tTACamKIIa/tTA-responsive promoter (P tet ) pl6 INK4a ] were generated using the heterologous tTA system (Baron and Bujard, 2000; Gossen and Bujard, 1992; Gossen et al . , 1995) .
• the transactivator (tTA) a fusion protein of an E.
• coli-derived tet repressor (tetR) DNA binding domain and the transactivation domain of VP16 protein derived from herpes simplex virus (Gossen and Bujard, 1992) is placed under the control of a CamKIIa promoter, which allows a neuron-specific expression of the tTA protein.
• the tTA protein can specifically bind to the tet operator (tetO) sequence and subsequently induces the transcription from the adjacent cytomegalovirus (CMV) minimal promoter which is combined with a transgene (pl6 INK4a ) .
• CMV cytomegalovirus
• Tetracycline or its derivative Doxycycline can prevent binding of tTA to tetO and the transactivation of any transgene cloned behind the CMV promoter is stopped (here pl6 INK4a expression is prevented) . In contrast, removal of Dox allows the induction of transgene expression (here pl6 INK4a -expression is allowed) .
• mice line was used, carrying a chromosomal -integrated p te tPl6 INK4a vector (Ueberham et al . , 2008) , consisting of both the pl ⁇ INK4a and the luciferase cDNA under control of the bidirectional promoter P tet -bil (Baron et al., 1995) .
• the human pl6 INK4a cDNA was amplified using the following specific primer pairs containing MIuI and HindIII restriction endonucleases sites allowing subcloning into pBI-5 vector (CVU89934, GenBank at NCBI, Bethesda, MD, USA; (Baron et al .
• the plasmid pBI-pl6 INK4a was linerarized by restriction endonucleases and used for generation of transgenic mice by conventional oocyte-injection (C57B1/6-DBA background) .
• the obtained founder mice were tested for transgeneity using standard PCR methods.
• the pBI vector consists of the bidirectional transcription unit for luciferase and the pl6 INK4a cDNA which were inherited together, but remain silent in the P t e t Pl6 INK4a mouse line.
• the P teC pl6 INK4a line was interbred with a mouse line expressing a transactivator protein (tTA) controlled by the calcium-calmodulin kinase Ha promoter (tTACamKIIa- line B,- C57B1/6-NMRI background (Mayford et al . , 1996)) .
• tTA transactivator protein
• tTACamKIIa- line B calcium-calmodulin kinase Ha promoter
• Non-transgenic siblings obtaining the same dosage of Dox in drinking water showed no toxic effects of the drug.
• Induction of pl6 rNK4a expression was achieved by omitting Dox from the drinking water, supplying plain water instead.
• Animals were housed under a constant day-night cycle of 12:12 hours and fed a standard chow diet (Altromin 1324, Altromintechnik fur Tierernahrung, Germany) , with access to water or water/doxycycline hydrochloride solution ad libitum under all conditions. Animal experiments were carried out in accordance with the European Council Directive of 24 November 1986 (86/609/EEC) and were approved by the local authorities.
• Plasmid pBI-5 was used to generate pBI- pl6 iNK4a (plasmid) vector; vector pBI-pl6 INK4a was used to generate P te tpl6 INK4a mouse line.
• AAV serotype 2 vectors preferentially integrate into active genes in mice. Nat. Genet. 34:297-302.
• Van der Flier WM Scheltens P (2005) Epidemiology and risk factors of dementia. J.Neurol .Neurosurg. Psychiat . 76 supl 5:2- 7.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• General Health & Medical Sciences (AREA)
• Molecular Biology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Biotechnology (AREA)
• Medicinal Chemistry (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Biophysics (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Gastroenterology & Hepatology (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Epidemiology (AREA)
• General Chemical & Material Sciences (AREA)
• Neurology (AREA)
• Neurosurgery (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Cell Biology (AREA)
• Oncology (AREA)
• Toxicology (AREA)
• Marine Sciences & Fisheries (AREA)
• Immunology (AREA)
• Hospice & Palliative Care (AREA)
• Psychiatry (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (7)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (2)

Family

ID=40673417

Family Applications (1)

Country Status (8)

Cited By (6)

Families Citing this family (4)

Family Cites Families (6)

• 2009
  • 2009-02-04 EP EP13159236.2A patent/EP2620447B1/en not_active Not-in-force
  • 2009-02-04 EP EP09001521A patent/EP2218784A1/en not_active Withdrawn
• 2010
  • 2010-02-04 US US13/146,592 patent/US20120004277A1/en not_active Abandoned
  • 2010-02-04 CA CA2751531A patent/CA2751531A1/en not_active Abandoned
  • 2010-02-04 CN CN2010800127623A patent/CN102356156A/zh active Pending
  • 2010-02-04 JP JP2011548607A patent/JP5869884B2/ja not_active Expired - Fee Related
  • 2010-02-04 AU AU2010211289A patent/AU2010211289B2/en not_active Ceased
  • 2010-02-04 WO PCT/EP2010/000702 patent/WO2010089122A2/en not_active Ceased
  • 2010-02-04 KR KR1020117020766A patent/KR101378353B1/ko not_active Expired - Fee Related
• 2016
  • 2016-01-29 US US15/011,092 patent/US20160144054A1/en not_active Abandoned

Non-Patent Citations (84)

Also Published As

Similar Documents

Legal Events